Date post: | 25-Dec-2015 |
Category: |
Documents |
Upload: | candace-poole |
View: | 218 times |
Download: | 3 times |
What is Cloning? What is Cloning? Making an exact genetic copy of a Making an exact genetic copy of a
cell, organ or an organismcell, organ or an organism This process uses This process uses SOMATIC SOMATIC
CELLSCELLS (non-sex cells) instead of (non-sex cells) instead of sex cells because somatic cells sex cells because somatic cells contain a complete set of contain a complete set of chromosomes (46).chromosomes (46).
Basics of the Cloning ProcedureBasics of the Cloning ProcedureSomatic Cell Nuclear TransferSomatic Cell Nuclear Transfer
This happens This happens in vitroin vitro (outside the (outside the body).body).
The nucleus of a somatic cell is placed The nucleus of a somatic cell is placed inside an egg cell that has had its inside an egg cell that has had its nucleus removed.nucleus removed.
Electricity sparks cell division of the Electricity sparks cell division of the egg cell and an embryo is formed.egg cell and an embryo is formed.
Basics of the Cloning ProcedureBasics of the Cloning Procedure
An embryo is the form of the organism An embryo is the form of the organism in its early stages. It is a group of in its early stages. It is a group of undifferentiatedundifferentiated cells. cells.
The embryo is placed in the uterus of The embryo is placed in the uterus of the egg donor or surrogate mother.the egg donor or surrogate mother.
A surrogate mother is a female who A surrogate mother is a female who carries the baby for another female. carries the baby for another female.
HISTORY OF CLONINGHISTORY OF CLONING 19531953 frogfrog 19961996 sheepsheep 19981998 cowcow 2001 rabbit2001 rabbit 2002 rat2002 rat 20022002 catcat 20032003 horsehorse 20052005 dogdog
Cloning does not always Cloning does not always produce expected results. It produce expected results. It
is also expensive and is also expensive and inefficient!inefficient!
CC the cat cost $50,000 to create. Her CC the cat cost $50,000 to create. Her genetics were the same as her clone, genetics were the same as her clone, however she did not appear identical! Why?however she did not appear identical! Why?
Horse- 841 attempts = .12% efficiencyHorse- 841 attempts = .12% efficiency Sheep- 277 attempts = .36% efficiencySheep- 277 attempts = .36% efficiency
Cloning Pros/ConsCloning Pros/ConsProsPros Can clone organs for Can clone organs for
transplant patients.transplant patients. Can help infertile couples have Can help infertile couples have
offspring genetically linked to offspring genetically linked to one of the parents.one of the parents.
Can increase populations of Can increase populations of endangered species.endangered species.
Can bring back a deceased Can bring back a deceased pet.pet.
Can replicate living things with Can replicate living things with desirable traits- like trees that desirable traits- like trees that grow quickly.grow quickly.
ConsCons Does not help to improve Does not help to improve
the genetic diversity of a the genetic diversity of a species.species.
Could create a black Could create a black market for transplant market for transplant organs-Create clones to organs-Create clones to harvest organs!harvest organs!
Expensive and inefficient!Expensive and inefficient!
STEM CELL RESEARCHSTEM CELL RESEARCH What is a What is a stem cellstem cell??
A cell that is not yet A cell that is not yet differentiated into a differentiated into a specific type.specific type.
What’s so special What’s so special about about embryonic embryonic stem cells?stem cells?
They are They are PluripotentPluripotent can become any of the can become any of the
220 different cell types220 different cell types
Why is the use of Why is the use of embryonic stem cells so embryonic stem cells so controversial?controversial?
Removing a stem cell from an Removing a stem cell from an embryo for experimentation destroys embryo for experimentation destroys the embryo. the embryo.
Is this murder?Is this murder? When does life begin?When does life begin?
Read and discuss “Embryos R Us Read and discuss “Embryos R Us Case Study”Case Study”
Therapeutic Therapeutic potentialpotentialTurn the stem cells into:Turn the stem cells into:
Pancreas cells to produce insulin to Pancreas cells to produce insulin to relieve diabetesrelieve diabetesDopamine producing cells in the brain Dopamine producing cells in the brain to relieve Parkinson’s diseaseto relieve Parkinson’s diseaseNew limbs and failing organsNew limbs and failing organs
Is it controversial to Is it controversial to experiment on all stem cells?experiment on all stem cells?
In addition to embryonic stem cells, there are adult In addition to embryonic stem cells, there are adult stem cells.stem cells.
Adult stem cells are found in many organs and Adult stem cells are found in many organs and tissues, including brain, bone marrow, blood and tissues, including brain, bone marrow, blood and skin. skin.
These stem cells are These stem cells are multipotentmultipotent which means they which means they can only become a certain type of cell(s) .can only become a certain type of cell(s) .
Their purpose is to maintain and repair the tissue in Their purpose is to maintain and repair the tissue in which they are found.which they are found.
Is it controversial to Is it controversial to experiment on all stem cells?experiment on all stem cells?
Experimenting with adult stem cells is not Experimenting with adult stem cells is not controversial because it does not harm the controversial because it does not harm the adult if the cells are removed from the body.adult if the cells are removed from the body.
There has been some exciting recent research There has been some exciting recent research that has demonstrated the ability to turn adult that has demonstrated the ability to turn adult stem cells into embryo-like stem cells. These stem cells into embryo-like stem cells. These are called are called “induced pluripotent stem cells” (IPSCs). .
Genetic EngineeringGenetic Engineering genegene- DNA sequence that codes for a protein. - DNA sequence that codes for a protein.
AATAATCGTAACCGGCGTAACCGGTTATTA genomegenome -all the possible bases in a species or -all the possible bases in a species or
individualindividual Human Genome Project (1990-2003)Human Genome Project (1990-2003) - - All of the All of the
base pairs in the human genome have been base pairs in the human genome have been sequenced (locations of genes on the 23 sequenced (locations of genes on the 23 chromosomes have been determined). The human chromosomes have been determined). The human genome has approximately 20, 500 genes.genome has approximately 20, 500 genes.
What is Genetic What is Genetic Engineering?Engineering? The modification of the DNA in an organism or The modification of the DNA in an organism or
the exchange of DNA between organisms.the exchange of DNA between organisms. Why would we want to do this?Why would we want to do this?
Genetic engineering can happen between Genetic engineering can happen between different species because the DNA code is different species because the DNA code is universal. All living things have ACGT universal. All living things have ACGT nucleotides and the same amino acid coding nucleotides and the same amino acid coding scheme.scheme. AUG codes for methionine in all living things!AUG codes for methionine in all living things!
Steps to Genetic Steps to Genetic EngineeringEngineering 1. A gene of interest is removed from a 1. A gene of interest is removed from a
genome.genome. 2. The gene is attached to a vector 2. The gene is attached to a vector
(transporter) and delivered into a host (transporter) and delivered into a host cellcell
3. The host cell is put into a nutrient 3. The host cell is put into a nutrient medium and allowed to divide many medium and allowed to divide many times to create many copies of the times to create many copies of the gene.gene.
4. The host cell is inserted into the 4. The host cell is inserted into the organism.organism.
How is a gene removed How is a gene removed from a genome?from a genome?
Restriction enzymesRestriction enzymes- recognize a - recognize a specificspecific DNA sequence and cut the DNA DNA sequence and cut the DNA wherever that sequence exists.wherever that sequence exists.
ATCGGATGAATTCTACCGATTAAGTAGCCATCTTAAGATGGCTAATTC
How is the gene of How is the gene of interest separated from interest separated from other genes?other genes?
Gel electrophoresis
Gel ElecrophoresisGel Elecrophoresis DNA samples are placed in a porous gel which is DNA samples are placed in a porous gel which is
connected to an electric current.connected to an electric current. The current moves the DNA pieces and separates The current moves the DNA pieces and separates
them based on their size. The smallest pieces them based on their size. The smallest pieces move the fastest and end up at the bottom.move the fastest and end up at the bottom.
We can use this technique to isolate genes, We can use this technique to isolate genes, determine genetic relationships (paternity), determine genetic relationships (paternity), determine evolutionary relationships, and solve determine evolutionary relationships, and solve crimes.crimes.
What is a common vector What is a common vector used in genetic used in genetic engineering?engineering? Plasmids are circular DNA molecules Plasmids are circular DNA molecules
found in bacteria that are often used for found in bacteria that are often used for genetic engineering.genetic engineering.
The plasmid is cut with the same The plasmid is cut with the same restriction enzyme used to cut out the restriction enzyme used to cut out the gene of interest. gene of interest.
Once the plasmid has the new gene, it Once the plasmid has the new gene, it is calledis called recombinant DNA. recombinant DNA.
Gene Therapy Humans can be genetically engineered. Normal genes can be inserted into cells
containing defective genes in order to correct genetic disorders.
Paternity Testing
If there is uncertainty about a child’s biological If there is uncertainty about a child’s biological father, DNA samples from the possible fathers can father, DNA samples from the possible fathers can be compared with the DNA of the child and mother.be compared with the DNA of the child and mother.
All DNA samples are treated with the same All DNA samples are treated with the same restriction enzyme and are run on a gel by restriction enzyme and are run on a gel by electrophoresis.electrophoresis.
A child’s DNA pieces are a combination of pieces A child’s DNA pieces are a combination of pieces from the mother and father (each DNA band must from the mother and father (each DNA band must match a band from one parent). match a band from one parent).
Genetics Technology BingoGenetics Technology Bingo1. Cloning1. Cloning
2. Induced pluripotent stem cells2. Induced pluripotent stem cells
3. Embryo3. Embryo
4. Multipotent 4. Multipotent
5. Surrogate5. Surrogate
6. Technology6. Technology
7. Gel electrophoresis7. Gel electrophoresis
8. Plasmid8. Plasmid
9. Adult stem cell9. Adult stem cell
10. Genetic engineering 10. Genetic engineering
11. Electricity11. Electricity
12. Restriction enzyme12. Restriction enzyme
13. Gene therapy 13. Gene therapy
14. Genome14. Genome
15. Gene15. Gene
16. Recombinant DNA16. Recombinant DNA
17. In vitro 17. In vitro
18. Somatic cell18. Somatic cell
19. Somatic cell nuclear transfer19. Somatic cell nuclear transfer
20. Vector20. Vector
21. Uterus21. Uterus
22. X-inactivation22. X-inactivation
23. Embryonic stem cell23. Embryonic stem cell
24. Pluripotent24. Pluripotent
Biotechnology Test Review Questions:Biotechnology Test Review Questions: EasyEasy Small, circular piece of bacterial DNA is called a ____.Small, circular piece of bacterial DNA is called a ____. Give two examples of vectors:Give two examples of vectors: The entire collection of genes within human cells is called The entire collection of genes within human cells is called
the _______________.the _______________. Difference between technology and biotechnology?Difference between technology and biotechnology? Function of restriction enzymes?Function of restriction enzymes? HGP stands for? How many base pairs in HG? How HGP stands for? How many base pairs in HG? How
many proteins?many proteins? Difference between surrogate and biological mother?Difference between surrogate and biological mother? A _____________ is caused by a defective or mutant A _____________ is caused by a defective or mutant
gene.gene. Define gene.Define gene. The first cell created by sexual reproduction is called a The first cell created by sexual reproduction is called a
MediumMedium 1. Inserting unrelated pieces of DNA together will 1. Inserting unrelated pieces of DNA together will
result in ____________________.result in ____________________. 2. IVF stands for? What is a synonym used for 2. IVF stands for? What is a synonym used for
IVF?IVF? 3. What does transgenic mean?3. What does transgenic mean? 4. Idenical twins are considered to be genetic 4. Idenical twins are considered to be genetic
___________.___________. 5. How does IVF work? What does the female 5. How does IVF work? What does the female
have to do? What does the male have to do?have to do? What does the male have to do? 6. Why does IVF sometimes result in twins, triplets, 6. Why does IVF sometimes result in twins, triplets,
or quads?or quads? 7. Difference between fraternal vs. identical twins?7. Difference between fraternal vs. identical twins? 8. How does Gel Electrophoresis separate DNA 8. How does Gel Electrophoresis separate DNA
fragments?fragments? 9. What is an example of a genetic disease?9. What is an example of a genetic disease? 10. What kind of ethical questions arise from IVF?10. What kind of ethical questions arise from IVF?
DifficultDifficult What is the difference between gene therapy and What is the difference between gene therapy and
genetic engineering?genetic engineering? Difference between a hybrid and chimera?Difference between a hybrid and chimera? Steps of genetic engineering?Steps of genetic engineering? The Hind R1 restriction enzyme is used to slice The Hind R1 restriction enzyme is used to slice
DNA at the GAATTC between the G and A. DNA at the GAATTC between the G and A. Illustrate how this enzyme would precisely cut the Illustrate how this enzyme would precisely cut the fragment:fragment:
ATTAGATCGCCCTAGAATTCAAGCTGGTAGCTAGCTACATCTAATTAGATCGCCCTAGAATTCAAGCTGGTAGCTAGCTACATCTA TAATCTAGAGGGATCTTAAGTTCGACCATCGATCGATGTAGATTAATCTAGAGGGATCTTAAGTTCGACCATCGATCGATGTAGAT
What research can be done using gel What research can be done using gel electrophoresis?electrophoresis?