Virus-like particles (VLPs) represented the first example of arecombinantly expressed vaccine, with the licensure in the mid1980s of two hepatitis B vaccines based on yeast-derivedhepatitis B surface antigen particles (HBsAg) (Hilleman, 1992).Presently, subunit vaccines based on VLPs derived from the L1capsid proteins of human papillomavirus (HPV) are in late-stage clinical trials and have demonstrated remarkable efficacyagainst their targeted HPV subtypes (Harper et al., 2004; Villa et
al., 2005). The success of these antigens in inducing protectiveimmunity is due in large part to their highly ordered andrepetitive structure. The quasicrystalline nature of VLPsfacilitates pattern recognition by the specific and innate immunesystems and sustained antibody production as a consequence ofefficient activation of B cells through surface Ig cross-linking(Bachmann et al., 1993, 1998). The immunostimulatoryproperties of VLPs prompted their application as a platformfor the display of defined linear epitopes from diversepathogens, as well as self-antigens. However, for the mostpart, published reports do not address the duration of theprotective immunity induced by these chimeric VLPs againstthe target pathogen. A notable exception is a recombinantchimeric HBsAg VLP, which displays a large fragment of thecircumsporozoite protein from the malaria parasite Plasmodiumfalciparum. Several trials in humans have demonstrated that thisvaccine induced both strong antibody and T cell responses, with
476 M.L. Smith et al. / Virology 348 (2006) 475–488
protection against multiple parasite genotypes. In spite of this,the protective immunity was relatively short lived, indicatingthat further optimization in vaccine composition is required, toelicit sufficient memory T helper (Th) cells to ensure ananamnestic response (Bojang et al., 2001; Stoute et al., 1998).Vaccines based on the display of only one or a few HLA-restricted T cell epitopes on VLPs will limit the vaccineapplicability to only a subset of the patient population (Birkett etal., 2002; Nardin et al., 2000). The field therefore needs newmethods to increase the number of pathogen specific CD4+-Tcell epitopes that may be displayed on VLPs, in order to removelimitation to certain HLA genotypes and to bolster induction ofspecific memory T cells. Also, as most pathogen-neutralizingepitopes are conformational, restriction to the display of short,linear peptide epitopes is a significant drawback of most VLPepitope display platforms. Solution of these problems necessi-tates an increase in the size of the protein fragment that is to bedisplayed, which increases the potential for introducing proteinconformations that disrupt the capsid protein's primarysequence, preventing particle formation (Karpenko et al.,2000). Improved structural understanding of capsid formation(Kratz et al., 1999) and genetic engineering approaches (SantaCruz et al., 1996) have permitted the display of GFP as a geneticfusion to core antigen particles of hepatitis B (HBcAg) and topotato virus X (PVX). A single chain functional antibody (scFv)has also been displayed in the case of PVX (Smolenska et al.,1998). However, GFP and scFvs are structurally compact, andthe ability to extend this approach to proteins with moreextended tertiary structures is unclear. Recently, the ectodomainof the outer surface protein A from Borrelia burgdorferi wasfused to the HBcAg capsid (Nassal et al., 2005). This fusion wasparticularly difficult to generate, and the final VLP preparationwas heterogeneous in nature, also containing incomplete parti-cles and polymorphic multimeric structures. In addition, theseapproaches may compromise the ability to recover purifiedVLP, particularly in the case of filamentous capsids such asPVX.
An alternative approach is to uncouple expression andpurification of the capsid scaffold and the heterologous proteinto be displayed, with subsequent conjugation of the desiredantigen to the VLP surface. Using this strategy, biotinylatedpapillomavirus L1 VLPs were decorated with a streptavidinfusion of the self-polypeptide TNF-α. This composition elicitedhigh-titer protective autoantibodies in a mouse model for type IIcollagen-induced arthritis (Chackerian et al., 2001). Strategiesbased on bifunctional cross-linkers with cowpea mosaic virus(CPMV) (Chatterji et al., 2004) and HBcAg (Jegerlehner et al.,2002) as scaffolds have also been described. Here, we report theimplementation of a platform for the display of whole foreignproteins on the surface of TMV, in which the protein forconjugation was also transiently expressed in planta viarecombinant TMV vectors, and subsequently purified. To obtaina soluble scaffold for biotinylation that accumulated to highlevels required the evolution of a recombinant TMV with asurface-exposed lysine. Streptavidin fusions of either GFP or anN-terminal fragment (aa 61–171) of the Canine oral papilloma-virus L2 protein (COPV L261–171) were conjugated to this
biotinylated, lysine modified TMV capsid, and these complexeswere characterized. The papillomavirus minor capsid protein(L2) is a promising vaccine candidate, as it induces antibodiesthat can cross-neutralize different papillomavirus species, unlikethe major capsid protein (L1), which induces strictly type-specific immunity. However, L2 is a poor immunogen andrequires potent adjuvants for induction of protective antibodies(Pastrana et al., 2005; Roden et al., 2000). Since our primaryapplication of the TMV scaffold was to improve vaccineimmunogenicity, we compared the immune response obtainedwith these VLP complexes to those generated by the freestreptavidin fusion proteins.
Results
Generation of a soluble and high yielding lysine modified coatprotein
Initially, to obtain a surface-exposed lysine, we engineered arTMV that expressed a coat protein (CP) with the amino acidsGKGAG fused to the N-terminus (LSB 2800). However, thisrecombinant virus was suboptimal for our studies; the yield ofpurified virion (Fig. 1A) was low (0.1–0.2 mg/g infected tissue).This construct also aggregated upon storage at 4 °C (Fig. 1B). Tocircumvent these problems, we used a library-based passage andselection scheme to select for viruses displaying a surface-exposed lysine that retained solubility at high protein concentra-tions. A lysine was introduced at the N-terminus of the type U1strain of TMV, with three randomized codons placed immedi-ately upstream. Transcripts from approximately 3600 cloneswere pooled and inoculated onto Nicotiana benthamiana plantsto generate a library of TMV CP mutants (library LSB 1295).Isolation of virion from systemically infected tissue selected forfunctional library members that possessed the desired purifica-tion characteristics. The purified virus was stored for 2–5 days at4 °C, at a concentration of 10 mg/ml or greater, to permit virionwith a propensity for aggregation to settle. We then used thesupernatant in three subsequent virus passages. A total of 74isolates from this selected library were sequenced, and 11 uniqueCP fusions were identified (Table 1). All isolates had at least oneacidic residue (glutamic acid or aspartic acid) one or tworesidues N-terminal of the fixed lysine residue. Together, thissmall collection of selected viruses suggests that one or moresurface-exposed acidic residues are needed to mitigate thepresence of the surface-exposed lysine. Eight of these individualisolates were transcribed and inoculated onto plants to compareyields with those obtained from virus LSB 2800 (Table 1).Selected members of the LSB 1295 library represented a 10- to70-fold yield improvement over virus LSB 2800, withrecoveries that exceeded 7 mg/g infected tissue noted for isolateLSB 1295.10. On the basis of expression level and isolatefrequency, LSB 1295.4, with the amino acid sequence ADFK atthe CP N-terminus, was carried forward. We observed noprecipitation of this evolved and selected recombinant virus(Fig. 1A), which represents a significant improvement in virusphysical properties relative to the original lysine-displayingrecombinant (LSB 2800) (Fig. 1B).
Table 1Deduced amino acid sequence, frequency, and virion yield for a selection ofpLSB1295 library isolates
pLSB Sequence Frequency Yield mg/gfresh weight
477M.L. Smith et al. / Virology 348 (2006) 475–488
GFP–streptavidin and COPV L261–171–streptavidin expressionin planta
Expression of the GFP-SA fusion in N. benthamiana plantsusing a modified TMVexpression vector (Shivprasad et al., 1999)
2800 M GKG SYS – 0.1–0.21295.1 M AEFK SYS 4 4.31295.2 M EVLK SYS 2 ND1295.3 M AEVK SYS 13 1.31295.4 M ADFK SYS 27 5.21295.6 M DVEK SYS 2 2.01295.9 M EGAK SYS 7 0.91295.10 M EPMK SYS 1 7.31295.11 M EMGK SYS 4 4.31295.12 M DGAK SYS 1 2.71295.13 M EGLK SYS 13 ND1295.14 M VEFK SYS 2 ND
ND, not determined.
did not affect plant growth or biomass accumulation, with theexpected mosaic phenotype observed on systemically infectedtissue approximately 6 days post-inoculation. Near confluentfluorescence of the systemically infected tissue occurred 8–9 daysfollowing inoculation. The GFP-SA fusion was detectable in crudeplant extracts (Figs. 1C; GJ), migrating as a single band with anapparent molecular weight of 40 kDa and of comparable intensityto the TMV CP band, which migrated at 21 kDa. The yield ofpurified fusion ranged from 60 to 120 mg/kg plant tissueprocessed. By MALDI-TOF mass spectrometry, the observedmass of the purified species was within 0.05% of 39,717.1 Da,corresponding to full-length GFP-SA, with the methionine cleavedand the N-terminal amine acetylated (data not shown). Thetetrameric form of core streptavidin is stable at 60 °C and below(Bayer et al., 1990). To confirm tetramerization of GFP-SA,samples incubated at 60 °C or 95 °C in SDS-PAGE loading bufferwere analyzed by gel electrophoresis (Fig. 1D). At 60 °C, theprominent species migrated between 150 and 200 kDa, indicativeof tetramer formation, while at 95 °C, the 40-kDa fusion monomerpredominated, with a minor ∼12 kDa species also present.Similarly, we expressed COPV L261–171-SA in planta using aTMV vector and found the yield of purified fusion to be
Fig. 1. Purification and characterization of lysine modified rTMVs and thefusion proteins GFP-SA and COPV L261–171-SA. LSB 2800, initial lysinemodified rTMV CP; LSB 1295.4, lysine modified rTMV CP selected on thebasis of expression level and solubility from a mitigating sequence library. (A)SDS-PAGE analysis of crude homogenates from systemically infected N.benthamiana plants (GJ) and the purified virions (F). GJ samples were diluted 5-fold prior to loading. (B) Visual comparison of the rTMV solubility followingstorage for 10 days at 4 °C and subsequently mixed to resuspend precipitate(indicated by arrow). Protein concentrations were LSB 2800, 0.8 mg/ml; LSB1295.4, 13 mg/ml. (C) Purification of GFP-SA by iminobiotin affinitychromatography. S1, initial supernatant; S1 S, 25% ammonium sulfatesupernatant, S1 P, 25% ammonium sulfate pellet; L, affinity chromatographyload; FT, chromatography flow through; F1 and F2, elution fractions;•, GFP-SA fusion. (D) Influence of temperature on the SDS-PAGE migration of LSB1295.4 CP, GFP-SA and COPV L261–171-SA (L2-SA). Samples were incubatedin SDS-PAGE loading dye at 60 °C (60) and 95 °C (95) for 15 min prior toanalysis on a 10–20% Tris–glycine gel. MW, Mark 12 protein standard wasemployed as a molecular weight marker on all gels.
478 M.L. Smith et al. / Virology 348 (2006) 475–488
comparable to GFP-SA (data not shown). The purified COPVL261–171-SA fusion monomer migrated at 30 kDa by SDS-PAGE,and tetramer formation was confirmed by a band shift to 116 kDa(Fig. 1D). In addition, mass spectrometry confirmed N-terminalmethionine cleavage, and the principal species mass was within0.05% of the expected value (24,894.8 Da; data not shown).
TMV biotinylation and complex formation with streptavidinfusion proteins
In vitro biotinylation of the surface-exposed lysine of LSB1295.4 was accomplished using the commercially available N-hydroxysuccinimide (NHS) PEO4–biotin. LSB 1295.4 wascombined with the NHS-PEO4–biotin reagent at either a 24- or240-fold molar excess relative to the viral CP and incubated forup to 48 h at either room temperature or 4 °C. Although biotinlinker attachment to the 18 kDa CP represents only a 473-Daincrease in molecular weight, it resulted in a discernable shift bygel electrophoresis (Fig. 2A) permitting the extent of CPconjugation to be assessed. With a 24-fold excess of biotinlinker, approximately 20% of the virus surface was conjugated(Fig. 2A), and biotinylation was confirmed by mass spectrom-etry (Fig. 2B). To obtain fully biotinylated TMV, it wasnecessary to incubate the LSB 1295.4 virus preparation at room
Fig. 2. Biotinylation of the lysine modified LSB 1295.4 rTMV. (A) SDS-PAGE analysa 24-fold (24) or 240-fold (240) molar excess of NHS-PEO4–biotin. The conjugations24-h incubation; 48, 48-h incubation. MW 1, Magic Mark XP molecular weight markbiotinylated LSB 1295.4 CP. A 24-fold molar excess of NHS-PEO4–biotin was empmolar excess of NHS-PEO4–biotin and a 48-h incubation at 4 °C. (D) Protein blot witconjugate. (E) Protein blot with sample layout as in panel A, probed with GFP-SA
temperature in the presence of a 240-fold molar excess of thelinker (Figs. 2A and C). Under these conditions, we detectedtwo additional minor bands by gel electrophoresis. Thisindicates conjugation of two or three biotins to a subset of theTMV capsid proteins. We also observed these minor specieswhen we incubated type U1 CP with the biotin linker (Fig. 2A).The identity of the minor conjugation species was confirmed bymass spectrometry (data not shown). The biotinylated U1 CPand the multiply conjugated LSB 1295.4 capsid protein weredetected, with comparable efficiency, by either a streptavidinhorseradish peroxidase conjugate or the TMV vector expressedGFP-SA in Western blots (Figs. 2D and E).
To array the recombinant protein-SA tetramers on the surfaceof the TMV, we used fully biotinylated virion preparations. TheGFP-SA was present at a 1.3-fold molar excess relative tobiotinylated CP, corresponding to a theoretical maximumloading of 710 tetramers per virion rod. Following incubation,the complex was isolated from unbound tetramer by sequentialprecipitation using either ammonium sulfate or PEG. Controlreactions, employing non-biotinylated LSB 1295.4, demon-strated the specificity of the tetramer association (Fig. 3A). Thecomplex recovered following PEG precipitation was examinedby electron microscopy and compared to the starting virusscaffold, with and without biotinylation (Fig. 3B). The majority
is of conjugation reactions for wild-type TMV (U1) and LSB 1295.4 using eitherwere performed at either 4 °C or room temperature (RT). I, unconjugated CP; 24,er; MW 2 Mark 12 molecular weight marker. (B) MALDI-TOF MS for partiallyloyed with incubation at 4 °C for 24 h. (C) As for panel B, but with a 240-foldh sample layout as in panel A, probed with a streptavidin horseradish peroxidaseand imaged under a UV-B source.
Fig. 3. Characterization of the rTMV/SA fusion complexes. (A) Visual comparison of GFP-SA association with LSB 1295.4 virion in the presence and absence ofsurface displayed biotin. Following incubation, the TMV was precipitated by the addition of 25% w/v ammonium sulfate and centrifugation. 1295.4, non-biotinylatedrTMV; 1295.4 Bt, biotinylated rTMV. (B) Electron microscopy of rTMV/GFP-SA complex and the starting rTMV preparations. Top left, LSB 1295.4 virus; bottomleft, biotinylated LSB 1295.4 virus; right, biotinylated LSB 1295.4 virus complexed with GFP-SA. Scale bar represents 200 nm. (C) Comparison of virion surface foruncoated rTMVand the rTMVassociated with either GFP-SA or COPV L261–171-SA. Top left, LSB 1295.4 virus; top right, biotinylated LSB 1295.4 virus (single 20sdisk is also visible); middle row, two images of rTMV/GFP-SA complex, with different levels of negative staining. Bottom row, two images of rTMV/COPV L261–171-SA complex (a single 20 s disk encased by SA fusion is visible). Scale bar represents 100 nm. (D) SDS-PAGE analysis of the rTMV/GFP-SA complex and the separatecomplex components following heating at either 60 °C or 95 °C. Legend; I, LSB 1295.4; Bt, biotinylated LSB 1295.4; I GFP SA, PEG precipitation of non-biotinylated LSB 1295.4 combined with GFP-SA; Bt GFP SA, PEG precipitation of rTMV/GFP-SA complex; MW 1, Magic Mark XP molecular weight marker; MW2, Mark 12 molecular weight marker. (E) Western blot probed with an anti-TMV polyclonal antibody. Lane order is identical to panel D. (F) Western blot probed withan anti-GFP antibody. Lane order is identical to panel D.
479M.L. Smith et al. / Virology 348 (2006) 475–488
of the rods observed in the LSB 1295.4 virus preparation wereof the expected length (300 nm) with a diameter of 18 nm.Complete biotinylation of the capsid proteins did not alter thesize distribution of the virus. However, in the case ofbiotinylated TMV loaded with GFP-SA, we observed a notablereduction in rod length: approximately 90% of rods were below200 nm in length with 50–100 nm rods predominating. Asecond electron dense layer, corresponding to the associatedGFP-SA, was clearly visible, increasing the diameter of the rodsto 29 nm (Fig. 3C). After extensive examination, we could
detect no partially coated or uncoated rods, suggesting completecoverage of the TMV capsid surface. When COPV L261–171-SAwas used in place of GFP-SA, a polydispersity in rod length wasalso observed (data not shown), and all TMV capsids exhibiteda similar, additional electron dense layer (Fig. 3C).
The rTMV/GFP-SA complex was further characterized bygel electrophoresis and Western blots (Figs. 3D–F). Incubationat 60 °C, in the presence of SDS-PAGE loading buffer, resultedin complete disassociation of the TMV virion; however, thebiotin/streptavidin linkage remained intact. The CP/tetramer
Fig. 4. Amino acid analysis of LSB 1295.4 rTMV (A) and the GFP-SA fusionprotein (B). Following acid hydrolysis of the purified proteins, the amino acidswere separated by ion exchange chromatography. Peaks corresponding to theindividual amino acids are identified using the one letter code. Nor, norleucineinternal standard; NH3, ammonia peak from amide deamination reactions whichoccur during acid hydrolysis. Differences in the buffer/column system employedfor panels A and B resulted in the observed shift in the elution position for theNH3 peak relative to the amino acid peaks. The TMVCP lacks histidine (H), andthis peak is therefore unique to the GFP-SA.
480 M.L. Smith et al. / Virology 348 (2006) 475–488
association resulted in a band shift relative to the GFP-SAalone. With incubation at 95 °C, the streptavidin/biotin linkagewas broken, and the GFP-SA and biotinylated CP migrated asmonomers (Fig. 3D). To confirm that the tetramer band shiftobserved at 60 °C was the result of biotinylated CP association,a Western blot was performed, with an anti-TMV polyclonalantiserum used as the probe (Fig. 3E). The bands at N220 kDa,which represent the complex (Bt GFP SA), were detected andwere also reactive when an anti-GFP (Fig. 3F) or anti-streptavidin (data not shown) polyclonal antibody was used asthe probe. The control loading reactions, in which GFP-SAwascombined with non-biotinylated LSB 1295.4 virus (I GFP SA),were analyzed in parallel. These samples were also subjected tosequential PEG precipitations. By gel electrophoresis, no GFP-SA was detected in the PEG precipitated control samples (Fig.3D). This was confirmed by Western blot (Fig. 3F), indicatingthat the isolation procedure we employed for the rTMV/GFP-SA complex effectively eliminated free SA fusion tetramers.The rTMV/COPV L2 L261–171-SA complexes were analyzed inparallel with similar results (data not shown).
Quantitative characterization of the rTMV/streptavidin fusioncomplexes by amino acid analysis
The analysis described in Fig. 3 provides a qualitativecharacterization of the complex generated but no information onthe level of virion decoration by the streptavidin fusion.Initially, we used gel electrophoresis together with densitomet-ric analysis of the Coomassie blue-stained bands to assess theextent of TMV loading. However, the intensity of staining byCoomassie brilliant blue is protein composition dependent(Compton and Jones, 1985; de Moreno et al., 1986), preventingquantitation of the CP and streptavidin fusion using a singlestandard. Amino acid analysis was therefore investigated as analternative to quantitatively determine streptavidin fusionloading. Since the full-length protein was determined to bethe predominant species for the LSB 1295.4 CP and bothstreptavidin fusions, the amino acid composition of the complexcomponents can be related to the total picomoles of each residuedetected, by a series of linear algebraic equations. Five of theseequations are listed below (Eq. (1)) for the rTMV/GFP-SAcomplex.
19 U1pmol þ 42 GFP-SApmol ¼ ASXpmol
12 U1pmol þ 26 GFP-SApmol ¼ LEUpmol
12 GFP-SApmol ¼ HISpmol
16 U1pmol þ 30 GFP-SApmol ¼ GLXpmol
11 U1pmol þ 11 GFP-SApmol ¼ ARGpmol
ð1Þ
In the present case, there are only two unknowns, thepicomoles of LSB 1295.4 CP and the picomoles of GFP-SA, soat the minimum, two of the equations listed above are requiredto define the complex. To determine the appropriate equationsto employ, three independent amino acid analyses wereperformed for both the LSB 1295.4 virus and the GFP-SA, tocompare the experimental compositions obtained to the knowncomposition of each protein. Representative chromatograms for
the LSB 1295.4 CP and GFP-SA are shown in Fig. 4. A subsetof the amino acids for which the known and experimentalcompositions agreed within ±3% were then used; the picomolesof GFP-SAwas estimated from the picomoles of histidine in thecomplex, since this amino acid was unique to the fusion (Fig.4B), and this value was then employed in the equations forarginine, leucine, and asparagine/aspartic acid, to obtain anaverage for the picomoles of LSB 1295.4 CP present. Thecomposition of the complex used as immunogen in the animalstudies was determined to be an essentially equimolar ratio ofGFP-SA to LSB 1295.4 CP (1.05:1.0). This translated into 559SA fusion tetramers, or 2200 GFP molecules, displayed perintact virion. If we assume a 1:1 ratio between tetramer fusionand biotinylated CP, a loading of 26% was achieved. When weused this procedure for the rTMV/COPV L261–171-SA complex,we found the level of streptavidin fusion association to becomparable (data not shown). As an internal control, the totalpicomoles of protein estimated by this composition-dependentprocedure was employed to back-calculate protein concentra-tion and this value compared to the concentration obtainedusing the data for all amino acids in a composition-independentcalculation, based solely on the molecular weight of theindividual amino acids. The two concentration values wereconsistently within 10% of one another.
481M.L. Smith et al. / Virology 348 (2006) 475–488
Preliminary evaluation of the immunological response toantigen decorated virions
We compared the humoral immune response generated byGFP or COPV L261–171 decorated virions with that obtained byimmunization with the respective streptavidin fusion alone, inboth mice and guinea pigs. For the mouse studies, antigen dosewas normalized to 1 μg and 10 μg of GFP or 2 μg and 20 μgCOPV L261–171, with the antigen administered in the absence ofadjuvant. A guinea pig study was also performed with GFP,using a 10 μg dose, and for a subset of animals, the antigen wasco-administered with the adjuvant RIBI (Corixa, Hamilton,MT). For the GFP-based studies, an additional control consistedof GFP-SA combined with non-biotinylated LSB 1295.4 virus,in proportions mirroring the complex composition (Table 2).This group was included to differentiate between the effect ofphysical association with the TMV capsid and the presence ofthe capsid alone on the immune response.
After a single immunization, we observed augmented GFPspecific antibody titers in a subset of mice from the groupsadministered rTMV/GFP-SA, relative to GFP-SA alone or thestreptavidin fusion mixed with the LSB 1295.4 virus. Anaugmented response was observed at both the 1 μg and 10 μgGFP doses (Fig. 5A). Following the second 1 μg GFP
Table 2Experimental set-up for the animal studies to evaluate the immunogenicity of therTMV/streptavidin antigen fusion complexes
Group Adjuvant Antigendose(μg)
Antigen-SAdose (μg)
rTMVdose (μg)
M PBS No – – –M GFP-SA alone
(GFP SA)No 1 1.3 –
M GFP-SA +unbiotinylatedrTMV (I GFP SA)
No 1 1.3 0.57
M GFP-SA/rTMVcomplex (Bt GFP SA)
No 1 1.3 0.57
M GFP-SA alone No 10 13 –M GFP-SA +
unbiotinylated rTMVNo 10 13 5.7
M GFP-SA/rTMVcomplex
No 10 13 5.7
GP GFP-SA +unbiotinylated rTMV
No 10 13 5.7
GP GFP-SA +unbiotinylated rTMV
Yes 10 13 5.7
GP GFP-SA/rTMVcomplex
No 10 13 5.7
GP GFP-SA/rTMVcomplex
Yes 10 13 5.7
M COPV L261–171-SAalone (L2 SA)
No 2 4.1 –
M COPV L261–171-SA/rTMV complex(Bt L2 SA)
No 2 4.1 2.6
M COPV L261–171-SAalone (L2 SA)
No 20 41 –
M COPV L261–171-SA/rTMVcomplex (Bt L2 SA)
No 20 41 26
Species; M, BALB/c mice; GP, guinea pigs.
Fig. 5. Comparative serological analysis of the immune response to the GFP-SAalone or displayed on the surface of biotinylated LSB 1295.4 virion. (A) Serumendpoint dilutions for the anti-GFP immune response observed in micefollowing the first immunization. (B) Anti-GFP immune response observed inmice following two immunizations. All immunizations were normalized to 1 μgGFP per injection. (C) Serum endpoint dilutions for the anti-GFP immuneresponse observed in guinea pigs following two immunizations, normalized to10 μg GFP per dose. RIBI was employed as an adjuvant. Legend for antigenadministered; PBS, PBS control; GFP SA, GFP-SA alone; I GFP SA, GFP-SAmixed with non-biotinylated LSB 1295.4 virion; Bt GFP SA, rTMV/GFP-SAcomplex.
immunization, the mice administered the rTMV/GFP-SA (BtGFP SA) showed a robust immune response with endpoint titersthat were significantly higher (P value = 0.0001) than thoseobserved within the groups administered the free GFP-SA in thepresence or absence of non-biotinylated virus (Fig. 5B). At the10 μg GFP dose, the differentiation between groups was not asmarked (data not shown). Conjugation of GFP to the TMVcapsid also elicited an improved immune response in guineapigs. After the second immunization, GFP-specific antibodieswere present in the sera of both animals administered the
482 M.L. Smith et al. / Virology 348 (2006) 475–488
complex, while none were detectable in animals administeredthe mixture of GFP-SA and non-biotinylated virus (Fig. 5C).When the antigens were administered with RIBI adjuvant, thedifferentiation between the groups was maintained with themean antibody titers elicited by the complex being 5- to 20-foldhigher than those observed with the free GFP-SA. With COPVL261–171 as the target antigen, we observed a similar immuneresponse profile to that obtained with GFP. A clear augmen-tation in antibody titer was evident following a single 20 μgadministration of the L2 protein fragment when the antigen wasbiotin-TMV capsid-associated (Fig. 6A; Bt L2 SA). This initialresponse was boosted significantly with re-administration of theTMV complexed antigen (Fig. 6B). In contrast, the 20 μg doseof the COPV L261–171 alone (L2 SA) produced only limitedboosting, and endpoint titers were on average 6-fold lower thanfor the complex immunized animals (Bt L2 SA) (Pvalue b 0.0001). For the 2 μg COPV L261–171 dose, no groupdifferentiation was observed following one dose of antigen,however, with TMV conjugation significant boosting occurredwith antigen re-administration.
Discussion
TMV has proven an effective carrier for the display offoreign peptides, successfully eliciting a neutralizing immuneresponse against numerous target pathogens and in one reportedcase, breaking B cell tolerance and inducing auto-reactiveantibodies (reviewed in Pogue et al. (2002)). However, thedisplay of peptide fragments exceeding 25–30 amino acids asgenetic fusions to the CP has been problematic and the aminoacid composition of the epitope, whatever its size, influences itscompatibility. To expand the utility of TMVas an antigen carrierand overcome the antigen size limitations associated withgenetic modification, we investigated the use of a biotin-decorated capsid for the presentation of antigen–streptavidinfusions. Biotin was introduced by using NHS-PEO4–biotin, anamine reactive conjugate of the vitamin. Although the TMV CPcontains two lysine residues (amino acids 54 and 69), predictedto delineate the surface-exposed 60s loop, their reactivity withthe biotin conjugate was low (Figs. 2D and E), suggesting
Fig. 6. Comparative serological analysis of the immune response to the COPV L261–Serum endpoint dilutions for the anti-COPV L2 immune response observed in mice fin mice following two immunizations. Legend for antigen administered; L2 SA, CO
limited solvent exposure. Since the terminal amino group wasalso unreactive, owing to its acetylation in planta (Filner andMarcus, 1974), the introduction of a surface-exposed amine wasrequired. Initially, a lysine flanked by two glycine residues wasfused to the N-terminus of CP, yielding the recombinant virusLSB 2800. When purified, this fusion had a propensity toaggregate, even at low protein concentrations (Fig. 1B). Themechanism by which the addition of a basic residue results insuch poor solubility characteristics is not clear. We employed alibrary-based approach to obtain a soluble TMV capsid with asolvent-exposed lysine, by introducing three random aminoacids upstream of an N-terminal lysine. From the small numberof isolates sequenced (Table 1), a clear bias was evident for theintroduction of acidic residues, suggesting the need to mitigatethe presence of the added positive charge. Charge separationwas also preferred, with one or two predominantly aromatic oraliphatic residues separating the acidic residue and the lysine forthe majority of the isolates, virus LSB 1295.6 being theexception. Purified virus was obtained for 8 of the 11 isolates,and no correlation was observed between the frequency of aparticular mitigating sequence and the rTMV yield. Virus titersobtained in every case represented a notable improvement overLSB 2800. Furthermore, the majority of the LSB 1295 virusseries remained soluble when stored at greater than 10 mg/ml,as illustrated for LSB 1295.4 (Fig. 1B), the rTMV carriedforward in this study. Recently, Demir and Stowell (2002)generated a lysine modified virion by introducing a singleamino acid mutation at the C-terminus of the native CP (denotedT158K). To permit comparison with the mitigating sequencecapsids of the LSB 1295 library, we cloned, expressed andpurified the T158K recombinant (data not shown). Purificationwas performed as outlined by Demir and Stowell, as well as bythe modified Gooding and Hebert (1967) procedure that weemployed for both LSB 2800 and the LSB 1295 virion series(see Materials and Methods), and identity was confirmed bymass spectrometry. The T158K mutant accumulation was 25- to30-fold higher than for LSB 2800, with levels in the infectedtissue reaching 3 mg/g fresh weight and depending on thepurification route, yields of purified virus ranged from 0.9 to 1.5mg/g fresh weight. To assess lysine accessibility, the T158K and
171-SA alone or displayed on the surface of biotinylated LSB 1295.4 virion. (A)ollowing the first immunization. (B) Anti-COPV L2 immune response observedPV L261–171-SA alone; Bt L2 SA, rTMV/COPV L261–171-SA complex.
483M.L. Smith et al. / Virology 348 (2006) 475–488
LSB 1295.4 virus preparations were combined with NHS-PEO4–biotin. By protein gel electrophoresis, we observed asimilar level of biotin conjugation to both the T158K and LSB1295.4 virions, suggesting the degree of solvent exposure forthe lysines in the two CP contexts was comparable. However, inour hands, the T158K virus showed a marked propensity toaggregate. When the T158K virus was centrifuged briefly, lessthan 10% remained in the supernatant, irrespective of thepurification route employed. In contrast, when LSB 1295.4virus was centrifuged in parallel, N98% remained soluble,highlighting the benefits of the mitigating sequence libraryapproach (data not shown). Excessive aggregation of the TMVscaffold will probably hinder processing of the assembledcomplexes whether they be employed in vaccinology, othermedicinal applications or for the formation of nanomolecularwires for electronic devices, as was proposed by others (Demirand Stowell, 2002).
There are conflicting reports regarding the tolerance of TMVfor the addition of positively charged amino acids. The displayof two peptides tested by Bendahmane et al. (1999), containingone or four basic residues, elicited necrotic lesions on theinoculated leaves, a phenomenon that could be counteracted bythe introduction of acidic residues. Similarly for CPMV (Portaet al., 2003) and zucchini yellow mosaic virus (Kimalov et al.,2004), systemic infectivity was reduced with an increase in pI ofthe displayed peptide. However, positively charged peptidesfused to TMV that show no deleterious host phenotypes andwhich were easily purified have also been documented (Wu etal., 2003). Our experience with positively charged epitopesspans this spectrum, with the purified virus fusions alsoshowing a range of solubilities that can, in addition, beinfluenced by whether the peptide is inserted at the N or Cterminus (LSBC, unpublished results). In sum, the data led us toconclude that generalizations are of limited benefit and thatlibrary based selection strategies similar to those we describe inthis paper may constitute a relatively rapid approach toovercome the negative effects of any given epitope fused toTMV CP or other viral capsid proteins. We have employed thislibrary-based approach for either lysine or cysteine display atthe C-terminus of the TMV U1 CP (inserted between aminoacids 155 and 156), as well as for the introduction of a surface-exposed cysteine residue at either CP terminus. In all cases, thesolubility and accumulation of these evolved recombinantvirions were superior to the addition of either GKG or GCG,and the virions were compatible with multiple homo- andheterodimer linker chemistries (LSBC, unpublished results).
Modification of the native TMV CP was necessary becausethe amino acid side chains commonly targeted for modificationwere not represented on the virion surface. Recently, new linkermodalities have been designed, which permit chemicalmodification of the native U1 CP and offer an alternativestrategy to the use of a recombinant TMV scaffold for antigendisplay (Schlick et al., 2005). Biotin peptide mimics offer yetanother means for antigen display. The C-terminus of TMV hasbeen successfully modified to display the streptavidin-specificheptapeptide sequence TLIAHPQ and tetramer association withthis recombinant virion was demonstrated (Negrouk et al.,
2004). However, similar to 2-iminobiotin (Hofmann et al.,1980), streptavidin affinity for this peptide mimic is orders ofmagnitude lower than for biotin, with disassociation occurringunder acidic conditions. These characteristics will likely alterthe immunological characteristics of the complex and may beattractive in certain cases. For example, rapid antigen unloadingfollowing uptake into the acidic lysosomal compartment mayfacilitate antigen cross-presentation, which is crucial in antiviralimmunity (Lizee et al., 2003). The breadth of choices in theavailable capsid scaffolds introduces the possibility of tailoringthe vaccines characteristics to the generation of the mostappropriate immune response for the target disease.
Typically streptavidin fusions are expressed in bacterialsystems, and functional protein is recovered from the isolatedinclusion bodies following solubilization and refolding(Kipriyanov et al., 1995; Sano and Cantor, 1991) with typicalyields of a few milligrams per 100 ml of culture (Sano andCantor, 2000). In the case of antigens whose neutralizingepitopes are conformational in nature, there is always theconcern that the native tertiary structure may not be recovered.The successful production of soluble and functional recombi-nant streptavidin in Escherichia coli has been reported (Galliziaet al., 1998); however, this approach does not yet appear to havebeen extended to streptavidin fusions. For mammalian pathogenantigens and self-antigens, eukaryotic expression systems mayoffer improved epitope authenticity and circumvent the need forprotein refolding. There have only been a limited number ofreports describing the expression of streptavidin and avidin inplants, and the production of fusions thereof has not beendescribed. By employing a transient TMV vector expressionsystem, plant development and foreign protein expression aretemporally segregated, facilitating the expression of streptavi-din fusion proteins in the absence of toxic side effects whichhave been observed when streptavidin is expressed in transgenicplants (Murray et al., 2002). For the two TMV vector producedstreptavidin fusions described here (GFP-SA and COPVL261–171-SA), this permitted the recovery of 60–120 mg offunctional tetramer/kg tissue, which compares favorably withbacterial expression and obviates the need for a refolding step.
Rigorous qualification of recombinant vaccine compositionis critical if the products are to be developed commercially. Weshowed that amino acid analysis of the two componentcomplexes permitted the quantitative determination of theircomposition. This approach can be extended to any proteincomplex, provided the individual components to be combinedare sufficiently characterized, for example by mass spectrom-etry. Up to 18 linear algebraic equations can be derived relatingthe picomoles of each protein to the picomoles of a given aminoacid, as outlined in Eq. (1). When only two components arepresent, this introduces a high degree of redundancy, permittingthe independent determination of the moles of each proteinusing pairs of equations and averaging of the results. Thisprocedure could in theory be extended to complexes consistingof up to 18 unique components, although consideration ofamino acids sensitive to the protein hydrolysis procedure willreduce the number of valid equations. For example, cysteine,methionine, and tryptophan are destroyed during the 6 N HCl
484 M.L. Smith et al. / Virology 348 (2006) 475–488
hydrolysis. Also for the stable amino acids, caution must beexercised in the equations chosen. As indicated in the Results,we selected only amino acids that were accurately andreproducibly quantified. For example, with the chromatographyand peak integration parameters employed, the isoleucinecomposition was consistently underestimated by 16–18%.The equation based on this amino acid was not employed asthe error would be propagated, yielding incorrect and/orpotentially meaningless solutions, e.g., negative picomoles ofa given protein component. In certain cases, it may be helpful totag the peptide or protein that is conjugated to TMV, to facilitatequantitation of the conjugation efficiency; the TMV CP lackshistidine (Fig. 4A), therefore, for this capsid a polyhistidine tagwould be appropriate, as this would provide a unique signaturein the chromatogram trace.
The size distribution of the biotinylated TMV capsids wasaltered following decoration with the streptavidin fusions, withthe predominant rod length decreasing from 300 nm to 50–100nm (Fig. 3B). The assembly of neutravidin onto the surface ofbiotinylated TMV, already coated onto copper grids, haspreviously been reported (Demir and Stowell, 2002). Althoughthese authors showed a similar level of decoration to that wereported here, they made no comment regarding alterations tothe particle size distribution. In our case, we subjected thedecorated virions to a series of PEG precipitations to eliminateunbound streptavidin fusion prior to analysis. It is possible thatfragmentation of the TMV conjugate rods occurred during thisadditional processing, although no change in the particle sizedistribution was observed for control samples (non-biotinylatedTMV mixed with streptavidin fusion) processed in parallel. Analternative explanation is that the packing of the streptavidintetramers onto the capsid surface exceeded a critical limit,resulting in rupture of the TMV rod. The SDS detergent, addedat 2% w/v with no heating, disrupts TMV virion yielding freeCP (data not shown), whereas biotinylated CP–streptavidinassociation can occur in the presence of SDS and is stable up to60 °C (Fig. 3D). This disparity in stability suggests that theaffinity of streptavidin for the biotinylated CP may be sufficientfor rod breakage when the streptavidin fusion is present inexcess of the packing limit, as was the case here. Since theextent of capsid surface biotinylation can be easily controlled(Fig. 2), this possibility can be addressed experimentally and ifnecessary a level of biotinylation chosen that will give completesurface coverage, while maintaining intact 300 nm rods. Theinfluence of the complex dimensions on the immune responsemay also merit investigation. Early studies in rabbits adminis-tered either 14C-labeled TMV virions or disassociated CPdemonstrated that the particulate nature of TMV resulted inimproved uptake by and activation of antigen presenting cells,as the intact capsids were more effectively and rapidlytransported from the site of injection to proximal lymphnodes, and then to the spleen (Loor, 1967). Further studies withstreptavidin fusion loaded rods, of different size distributions,would permit the influence of rod length on the potency of theimmune response to be evaluated.
In the current study, we used GFP as a model antigen.Clearly, physical association of the streptavidin fusion tetramers
to TMV capsids augmented the immune response induced bythe TMV complexes, relative to free tetramer alone or tetramermixed with non-biotinylated rods (Fig. 5). After the secondimmunization, total IgG titers were improved 4- to 20-fold inboth mice and guinea pigs, and with mice antibodies weredetectable after the first immunization for animals administeredthe rTMV/GPF-SA complex. The robust immune responses torelatively small amounts of antigen in the absence of adjuvantled us to investigate whether the TMV–antigen couplingapproach could be used to improve the immune response to anantigen that is notoriously poorly immunogenic—the minorcapsid protein of papillomaviruses. We found that the boostingresponse obtained with COPV L261–171-SA was significantlyimproved by TMV conjugation, which confirms the data weobtained with GFP coupling to TMV, and reinforces ourconclusion that whole protein display on the TMV capsid is agenerally applicable approach for the augmentation of thehumoral immune response. Furthermore, we have observed thatcomplex formation with TMV is a requirement for the robustinduction of activated antigen-specific CD8+ T cells, which isnecessary for vaccines that require a cellular immune responsefor efficacy (manuscript in preparation). These encouragingresults have provided a rationale for ongoing studies in ourlaboratory, focusing on a series of antigen targets from humanimmunodeficiency virus, human papillomavirus, and theirrespective preclinical models. Facile systems for the displayof heterologous proteins on the surface of icosahedral capsidsand their therapeutic potential have been reported (Chackerianet al., 2001; Jegerlehner et al., 2002). The current work extendscapsid display for therapeutic applications to another geometry,that of rod-shaped capsids, thereby increasing the density withwhich whole antigens may be displayed compared to competingVLP systems. On a T = 3 particle such as hepatitis B coreantigen VLP, 180 tetramers can be theoretically accommodated,while the capacity of a T = 7 particle such as papillomavirus is420. The 26% loading obtained in the present study correspondsto 550 tetramers per intact 300 nm long virion, and for caseswhere the antigen fusion partner to streptavidin is smaller, afurther increase in the TMV packing density is theoreticallypossible, while for the icosahedral platforms, it will remainconstant.
Materials and methods
Generation of soluble tobacco mosaic virus displaying asurface-exposed lysine
The amino terminus of the TMV CP resides on the exteriorof TMV particles, allowing amino acids fused to the N-terminusof the TMV CP to be displayed on the virion surface. Usingstandard molecular techniques, codons for the amino acidsequence glycine–lysine–glycine–alanine–glycine (GKGAG),were fused to the 5′ end of the TMV CP ORF in a plasmidcontaining the full-length cDNA clone of TMV RNA, under thecontrol of the T7 RNA polymerase promoter. The resultingplasmid was named pLSB 2800. T7 transcripts of pLSB 2800were inoculated onto N. benthamiana plants to generate LSB
485M.L. Smith et al. / Virology 348 (2006) 475–488
2800 virion. (Recombinant virus names are based on the namesof the plasmid-based cDNA clones. This nomenclature isfollowed throughout this manuscript). LSB 2800 was purifiedfrom systemically infected N. benthamiana plants, by amodification of the procedure of Gooding and Hebert (1967).Briefly, the tissue was homogenized in 0.86 MNaCl, 0.04% w/vsodium metabisulfite (0.5 g of tissue/ml of buffer), adjusted topH 5.0, heated to 47 °C for 5 min, chilled and centrifuged at6000 × g for 5 min. The clarified supernatant was subjected totwo sequential PEG precipitations to recover the virus. Thisconcentrated virus was extracted with 25% chloroform v/v, toremove host protein impurities and pigments that remainedassociated with the virus.
Due to LSB 2800 aggregation with storage, a library-basedstrategy was undertaken, to construct a recombinant TMV CPhaving both a surface-exposed lysine residue and high solubility.Using a PCR-based approach, three randomized codons and alysine codon were fused to the 5′ end of the U1 CP ORF. TheTMV CP gene and 3′ UTR were amplified from a full-lengthcDNA clone of the U1 strain of TMV (p801) using oligonucleo-tides JAL 613 (CGAACCATGGNNNNKNNKAAATCTTA-CAGTATCACTACTCCATCTCA) as a forward primer and JAL590 (GCCAACACATCCGGGTACCTGGGCCCCTA) as a re-verse primer. The resulting PCR product of about 800 bp wasdigested with NcoI (underlined in JAL 613 sequence) and KpnI(underlined in JAL 590 sequence) and ligated into NcoI, KpnIdigested pJL 150/254 to produce the CP library, pLSB 1295. ThepLSB 1295 library was transformed into DH5α E. coli and plated.DNA was prepared from a pool of about 3600 colonies of thislibrary, linearized with KpnI and transcribed with T7 RNApolymerase using the T7 mMessage mMachine kit (Ambion,Austin, TX), according to manufacturers' instructions. Transcriptwas inoculated onto 12 N. benthamiana plants at a concentrationof approximately 100 infectious units per plant.
Approximately 8–10 days post-inoculation, one systemicallyinfected leaf from each N. benthamiana plant was harvested andpooled. TMV particles were purified from the pooled infectedleaves as described above, by extracting in a buffer lacking NaCland omitting the final chloroform treatment. The purified viruswas passaged for three additional cycles, with the virus purifiedbetween each cycle. After the final virus purification, RNAwasisolated using the Qiagen RNAeasy kit (Valencia, CA),according to the manufacturers' instructions. The CP gene wasamplified from the purified viral RNA using the PromegaImPromII RT-PCR kit (Madison, WI) and the oligonucleotideJAL 619 (GCCTTGGTACCTGGGCCCCTACCGGGGG-TAACGG). The CP gene region and 3′ UTR were subsequentlyamplified from the RT reaction product using oligonucleotidesJAL 618 (CGATGATGATTCGGAGGCTACTG) and JAL 619as forward and reverse primers, respectively. The resulting PCRproduct was digested with NcoI and KpnI and ligated into NcoI-KpnI digested pJL 150/254. This ligation reaction was trans-formed into DH5α E. coli, and DNA samples from individualcolonies were sequenced to determine the coding sequence at the5′ end of the CP gene for isolates from the selected library.
To obtain virus samples of recombinant clones from theselected library, transcript was generated, inoculated onto N.
benthamiana plants and TMV particles purified from system-ically infected tissue as described earlier. Individual virussamples were analyzed by protein gel electrophoresis, and massspectrometry was performed to confirm the identity of theadditional amino acids on the CP N-terminus.
Cloning, expression, and purification of the streptavidinfusions
Purified Streptomyces avidinii genomic DNA was obtainedfrom ATCC (Manassas, VA), and the streptavidin core (SA)coding sequence (372 bp covering amino acids 40–163 of theSwissprot accession number P22629) was amplified by PCR.The SA coding sequence was ligated to the SacI site in the GFPinsert in the TMV expression vector, p30B GFPc3 (Shivprasadet al., 1999), using standard cloning techniques, resulting in afusion of GFP to the N-terminus of the streptavidin core. Thisplasmid, pLSB 1290, was modified further to remove the GFPand to introduce the NgoMIVand AvrII restriction sites at the N-terminus of the SA core to facilitate additional cloning (plasmidpLSB1821). A DNA fragment, corresponding to amino acids61–171 of the L2 protein of COPV (Genbank accession numberNP056818), COPV L261–171, was synthesized by Geneart(Regensburg, Germany) using the preferred codon usage oftobacco. Following NgoMIV and AvrII digestion, the fragmentwas cloned into pLSB1821 to generate plasmid pLSB1825.Infectious transcripts, prepared from pLSB1290 or pLSB1825,were inoculated onto N. benthamiana plants.
To isolate the GFP-SA fusion, infected plant tissue washomogenized in three volumes of extraction buffer (100 mMphosphate pH 7.2, 0.01% Na-metabisulfite, 1 μl BME per ml)and filtered through cheesecloth. Following heat treatment at52–55 °C for 7 min, the homogenate was centrifuged at12,000 × g for 10 min and an initial 25% ammonium sulfate cutperformed on the clarified supernatant. The GFP-SA containingprotein fraction was precipitated with 50% ammonium sulfate,resuspended to 1/5th the original volume, and dialyzed against1× phosphate-buffered saline (PBS), adjusted to pH 9.3. ForCOPV L261–171-SA, 25 mM Tris-maleic acid, pH 7.5, 2 mMEDTAwas employed as the extraction buffer, the heat treatmentomitted and 0.4% w/v polyethyleneimine added to facilitateclarification. A single 30% ammonium sulfate cut wasperformed to concentrate COPV L261–171-SA.
Affinity chromatography was performed using an AKTApurifier 10 system (Amersham Biosciences, Piscataway, NJ).The clarified plant extract was adjusted to pH 11 and loadedonto an immobilized iminobiotin resin (Pierce, Rockford, IL)using 1 ml resin per 20 g tissue extracted. The capturedstreptavidin fusion was eluted using 0.1 M acetic acid, pH 4.0and the peak fractions dialyzed against phosphate buffer prior tostorage.
Biotinylation of the LSB 1295.4 rTMV surface-exposed lysine
From the library passage experiment, multiple uniquerecombinant viruses were obtained (Table 1) which remainedsoluble post-purification at concentrations of 10 mg/ml or
486 M.L. Smith et al. / Virology 348 (2006) 475–488
higher. TMV recombinant LSB 1295.4 containing the N-terminal amino acids ADFK was selected for in vitrobiotinylation reactions. Biotin was covalently conjugated tothe surface-exposed lysine using EZ-Link NHS-PEO4–biotin(Pierce, Rockford, IL). Lyophilized NHS-PEO4–biotin wasdissolved in phosphate buffer containing the rTMV at aconcentration of 0.8 mg/ml, with the biotin analog typicallypresent at a 24-fold or 240-fold molar excess. The conjugationreactions were incubated with mixing at either 4 °C or roomtemperature, for up to 60 h, as described in the Results.Unreacted NHS-PEO4–biotin was removed by PEG precipita-tion of the biotinylated rTMV (4% w/v PEG, 4% w/v NaCl),and the biotinylated virus was resuspended in 1× PBS.
Analytical procedures, immunoassays, and electronmicroscopy
Polyacrylamide gel electrophoresis (PAGE) of proteins in thepresence of sodium dodecyl sulfate (SDS) (Laemmli, 1970) wasperformed on 10–20% Tris glycine gels (BioRad, Hercules CA,or Invitrogen, Carlsbad, CA), following the manufacturers'instructions. The Mark 12 or Magic Mark XP proteins standards(both Invitrogen) were employed as molecular weight refer-ences. Western blots (Towbin et al., 1979), employing 0.2 μmpolyvinylidene fluoride membrane (BioRad) were probed witheither rabbit anti-TMV polyclonal, PVAS-135D (ATCC) or arabbit anti-GFP polyclonal (Polysciences, Warrington, PA). Inboth cases, the secondary antibody was a goat anti-rabbithorseradish peroxidase (HRP) conjugate (BioRad). To evaluaterTMV biotinylation, blots were probed with either streptavidinHRP (Pharmingen, San Diego, CA) or the GFP-SA fusion. HRPdetection was with the ECL+ chemiluminescent kit (Amer-sham) with Hyperfilm ECL (Amersham) employed for imagecapture, as per the manufacturers' instructions.
Amino acid analysis (AAA) was performed by the MolecularStructure Facility at the University of California, Davis. Proteinquantitation was also performed using the bicinchoninic acid(BCA) assay (Pierce) in a microtiter plate format following themanufacturers' instructions. Wild-type TMV, type U1, quanti-fied by AAA was employed as a standard. Protein massdetermination was performed by matrix-assisted laser desorp-tion ionization time-of-flight mass spectrometry (MALDI-TOFMS) using a Voyager-DE STR Biospectrometry Workstation(Applied Biosystems, Foster City, CA). The mass spectrometerwas operated in linear and positive mode using delayedextraction at an accelerating voltage of 25 kV and 128 lasershots per spectrum. A single point mass calibration wasperformed using horse heart apomyoglobin (Sigma, St. Louis,MO). All MALDI-TOF sample spotting in sinipinic acid wasperformed using a dried-droplet method (Karas and Hillen-kamp, 1988). All raw spectral data were processed usingApplied Biosystems Data Explorer 4.0.0.0. Protein identifica-tion was determined using General Protein/Mass Analysis forWindows (GPMAW), version 5.0 (Lighthouse Data, Denmark)software.
For electron microscopy, grids (400 Mesh copper, carboncoated; Ted Pella, Redding, CA) were floated on drops of 1×
PBS, containing rTMV or the rTMV/streptavidin fusioncomplex, diluted to a concentration of 100–200 μg/ml (relativeto the rTMV alone). Following a 15-min contact time, excessliquid was removed, the grids negatively stained with 1%phosphotungstic acid (PTA) and permitted to air dry. Bacitracinat 25 μg/ml was employed during both the sample coating of thegrid and negative staining (Gregory and Pirie, 1973). Allsamples were examined on a Philips CM120 microscope,coupled to a Gatan MegaScan 795 digital camera.
Manufacture of the rTMV/streptavidin fusion complexes
Affinity purified GFP-SA was combined with biotinylatedrTMV, to obtain a final GFP-SA to rTMV CP mass ratio of 3:1.For COPV L261–171-SA, the mass ratio of streptavidin fusion torTMV CP was 1.4:1. The mixture was incubated for 4 h orovernight at room temperature, with gentle agitation, to allowthe streptavidin fusion to bind to the biotinylated virion. For therTMV/GFP-SA mixtures, unbound GFP-SA was removed byprecipitation of TMV particles with 4% PEG (MW 6000), 4%NaCl and centrifugation for 15 min at 10,000×g. The PEGprecipitation steps were repeated twice, and a control incubationemploying non-biotinylated rTMV was processed in parallel.Siliconized centrifuge tubes and pipettes were employed duringthe manufacturing.
Immunogenicity testing in mice and guinea pigs andserological analysis
The immunogenicity of the rTMV/GFP-SA complexes wasevaluated in both mice and guinea pigs. The murine studieswere performed using 6- to 8-week-old female BALB/c mice(Harlan Sprague–Dawley, Indianapolis, IN). Mice received twoimmunizations, administered subcutaneously at 2-week inter-vals in the absence of adjuvant. Tail bleeds were taken 9 daysafter each injection. All dosing was normalized to the mass ofGFP administered, with animals receiving either 1 μg or 10 μgGFP. Groups of five mice were employed, and the high and lowresponders from each group were omitted in the analysis. Forthe guinea pig study, 20-week-old animals (Harlan Sprague–Dawley) (2 per group) received a total of two 10 μg GFPimmunizations delivered at four sites along the back. For halfthe groups, the antigens were combined with the adjuvant RIBI(Corixa, Hamilton, MT), as per the manufacturers' instructions.Antigen was administered at 4-week intervals, with bleeds taken2 weeks after each injection by intravenous puncture of thecranial vena cava. The murine study to test the COPV L261–171-SA was similar in design to that described above, except thatgroups consisted of six animals, and the normalized COPVL261–171 doses were 2 μg or 20 μg. Table 2 summarizes theantigen groups evaluated for both the murine (M) and guineapig (GP) studies.
Antibody response to antigen was determined by enzyme-linked immunosorbent assay (ELISA). 96-well microtiter plates(MaxiSorp; Nalge Nunc, Rochester, NY) were coated witheither GFP (TMV vector expressed and purified to N90%) or abacterially expressed COPV L2 fragment (amino acids 38–160)
487M.L. Smith et al. / Virology 348 (2006) 475–488
in carbonate/bicarbonate buffer (pH 9.6). After blocking withbovine serum albumin, serial dilutions of the sera were added.Following a 1-h incubation, the plates were washed andincubated for an additional hour with the appropriate HRP-conjugated secondary antibodies; goat anti-mouse IgG (South-ern Biotechnology Associates, Birmingham, AL) or goat anti-guinea pig IgG (Bethyl Laboratories, Montgomery, Texas).Plates were developed using a tetramethyl benzidine substratesolution (Turbo TMB ELISA; Pierce), and the reactions stoppedby the addition of 1 N sulfuric acid. Plate absorbance was readat 450 nm in a 96-well plate spectrophotometer (MolecularDevices, Sunnyvale, CA). The serum endpoint dilutioncorresponded to an absorbance reading of twice background.Data and statistical analysis (unpaired t tests) was performedusing GraphPad (version 4.0) (San Diego, CA).
Acknowledgments
The authors are grateful to Jacqueline Bernales, Tina Corbo,Sherri Wykoff-Clary, and Patricia Edwards for the technicalassistance. MALDI-TOF MS analyses were performed byJoseph Whitson. TMV visualization was conducted at theelectron microscopy laboratory of the University of Californiaat Davis (UCD) School of Medicine, and we thank GreteAdmanson for the helpful technical advice. Amino acid analysiswas performed by Cuong Bui and Jack Presley at the UCDMolecular Structure Facility. The bacterially expressed COPVL2 fragment was provided by Drs Bennett Jenson and Shin-jeGhim (University of Louisville). This work was supported inpart by NIH grant AI055346 to KEP.
References
Bachmann, M.F., Rohrer, U.H., Kundig, T.M., Burki, K., Hengartner, H.,Zinkernagel, R.M., 1993. The influence of antigen organization on B-cellresponsiveness. Science 262 (5138), 1448–1451.
Bachmann, M.F., Zinkernagel, R.M., Oxenius, A., 1998. Cutting edgecommentary: immune responses in the absence of costimulation: virusesknow the trick. J. Immunol. 161 (11), 5791–5794.
Bayer, E.A., Benhur, H., Wilchek, M., 1990. Isolation and properties ofstreptavidin. Methods Enzymol. 184, 80–89.
Bendahmane, M., Koo, M., Karrer, E., Beachy, R.N., 1999. Display of epitopeson the surface of tobacco mosaic virus: impact of charge and isoelectric pointof the epitope on virus-host interactions. J. Mol. Biol. 290 (1), 9–20.
Birkett, A., Lyons, K., Schmidt, A., Boyd, D., Oliveira, G.A., Siddique, A.,Nussenzweig, R., Calvo-Calle, J.M., Nardin, E., 2002. A modified hepatitisB virus core particle containing multiple epitopes of the Plasmodiumfalciparum circumsporozoite protein provides a highly immunogenicmalaria vaccine in preclinical analyses in rodent and primate hosts. Infect.Immun. 70 (12), 6860–6870.
Bojang, K.A., Milligan, P.J.M., Pinder, M., Vigneron, L., Alloueche, A., Kester,K.E., Ballou, W.R., Conway, D.J., Reece, W.H.H., Gothard, P., Yamuah, L.,Delchambre, M., Voss, G., Greenwood, B.M., Hill, A., McAdam, K.,Tornieporth, N., Cohen, J.D., Doherty, T., 2001. Efficacy of RTS,S/ASO2malaria vaccine against Plasmodium falciparum infection in semi-immuneadult men in The Gambia: a randomised trial. Lancet 358 (9297),1927–1934.
Chackerian, B., Lowy, D.R., Schiller, J.T., 2001. Conjugation of a self-antigen topapillomavirus-like particles allows for efficient induction of protectiveautoantibodies. J. Clin. Invest. 108 (3), 415–423.
Chatterji, A., Ochoa, W., Shamieh, L., Salakian, S.P., Wong, S.M., Clinton, G.,
Ghosh, P., Lin, T.W., Johnson, J.E., 2004. Chemical conjugation ofheterologous proteins on the surface of cowpea mosaic virus. BioconjugateChem. 15 (4), 807–813.
Compton, S.J., Jones, C.G., 1985. Mechanism of dye response and interferencein the Bradford protein assay. Anal. Biochem. 151 (2), 369–374.
de Moreno, M.R., Smith, J.F., Smith, R.V., 1986. Mechanism studies of Coo-massie Blue and silver staining of proteins. J. Pharm. Sci. 75 (9), 907–911.
Demir, M., Stowell, M.H.B., 2002. A chemoselective biomolecular template forassembling diverse nanotubular materials. Nanotechnology 13 (4),541–544.
Filner, B., Marcus, A., 1974. TMV coat protein synthesis in vivo: analysis of theN-terminal acetylation. Virology 61 (2), 537–546.
Gallizia, A., de Lalla, C., Nardone, E., Santambrogio, P., Brandazza, A., Sidoli,A., Arosio, P., 1998. Production of a soluble and functional recombinantstreptavidin in Escherichia coli. Protein Expression Purif. 14 (2), 192–196.
Gooding, G.V., Hebert, T.T., 1967. A simple technique for purification oftobacco mosaic virus in large quantities. Phytopathology 57, 1285.
Gregory, D.W., Pirie, B.J.S., 1973. Wetting agents for biological electronmicroscopy: I. General considerations and negative staining. J. Microscopy99 (3), 261–265.
Harper, D.M., Franco, E.L., Wheeler, C., Ferris, D.G., Jenkins, D., Schuind, A.,Zahaf, T., Innis, B., Naud, P., De Carvalho, N.S., Roteli-Martins, C.M.,Teixeira, J., Blatter, M.M., Korn, A.P., Quint, W., Dubin, G., 2004. Efficacyof a bivalent L1 virus-like particle vaccine in prevention of infection withhuman papillomavirus types 16 and 18 in young women: a randomisedcontrolled trial. Lancet 364 (9447), 1757–1765.
Hilleman, M.R., 1992. Plasma-derived hepatitis B vaccine: a breakthrough inpreventive medicine. In: Ellis, R.W. (Ed.), Hepatitis B Vaccines in ClinicalPractice. Marcel Dekker, New York, pp. 17–39.
Hofmann, K., Wood, S.W., Brinton, C.C., Montibeller, J.A., Finn, F.M., 1980.Iminobiotin affinity columns and their application to retrieval ofstreptavidin. Proc. Natl. Acad. Sci. U.S.A. 77 (8), 4666–4668.
Jegerlehner, A., Tissot, A., Lechner, F., Sebbel, P., Erdmann, I., Kundig, T.,Bachi, T., Storni, T., Jennings, G., Pumpens, P., Renner, W.A., Bachmann,M.F., 2002. A molecular assembly system that renders antigens of choicehighly repetitive for induction of protective B cell responses. Vaccine 20(25–26), 3104–3112.
Karas, M., Hillenkamp, F., 1988. Laser desorption ionization of proteins withmolecular masses exceeding 10,000 daltons. Anal. Chem. 60 (20),2299–2301.
Karpenko, L.I., Ivanisenko, V.A., Pikal, I.A., Chikaev, N.A., Eroshkin, A.M.,Veremeiko, T.A., Ilyichev, A.A., 2000. Insertion of foreign epitopes inHBcAg: how to make the chimeric particle assemble. Amino Acids 18 (4),329–337.
Kimalov, B., Gal-On, A., Stav, R., Belausov, E., Arazi, T., 2004. Maintenance ofcoat protein N-terminal net charge and not primary sequence is essential forzucchini yellow mosaic virus systemic infectivity. J. Gen. Virol. 85 (11),3421–3430.
Kipriyanov, S.M., Dubel, S., Breitling, F., Kontermann, R.E., Heymann, S.,Little, M., 1995. Bacterial expression and refolding of single-chain Fvfragments with C-terminal cysteines. Cell. Biophys. 26 (3), 187–204.
Kratz, P.A., Bottcher, B., Nassal, M., 1999. Native display of complete foreignprotein domains on the surface of hepatitis B virus capsids. Proc. Natl. Acad.Sci. U.S.A. 96 (5), 1915–1920.
Laemmli, U.K., 1970. Cleavage of structural proteins during the assembly of thehead of bacteriophage T4. Nature 227, 680–685.
Lizee, G., Basha, G., Tiong, J., Julien, J.P., Tian, M.M., Biron, K.E., Jefferies,W.A., 2003. Control of dendritic cell cross-presentation by the majorhistocompatibility complex class I cytoplasmic domain. Nat. Immunol. 4(11), 1065–1073.
Loor, F., 1967. Comparative immunogenicities of tobacco mosaic virus, proteinsubunits, and reaggregated protein subunits. Virology 33, 215–220.
Murray, C., Sutherland, P.W., Phung, M.M., Lester, M.T., Marshall, R.K.,Christeller, J.T., 2002. Expression of biotin-binding proteins, avidin andstreptavidin, in plant tissues using plant vacuolar targeting sequences.Transgenic Res. 11 (2), 199–214.
488 M.L. Smith et al. / Virology 348 (2006) 475–488
2000. Synthetic malaria peptide vaccine elicits high levels of antibodies invaccinees of defined HLA genotypes. J. Infect. Dis. 182 (5), 1486–1496.
Nassal, M., Skamel, C., Kratz, P.A., Wallich, R., Stehle, T., Simon, M.M., 2005.A fusion product of the complete Borrelia burgdorferi outer surface proteinA (OspA) and the hepatitis B virus capsid protein is highly immunogenicand induces protective immunity similar to that seen with an effectivelipidated OspA vaccine formula. Eur. J. Immunol. 35 (2), 655–665.
Pastrana, D., Gambhira, R., Buck, C., Pang, Y., Thompson, C., Culp, T.,Christensen, N., Lowy, D., Schiller, J., Roden, R., 2005. Cross-neutralization of cutaneous and mucosal Papillomavirus types with anti-sera to the amino terminus of L2. Virology 337 (2), 365–372.
Pogue, G.P., Lindbo, J.A., Garger, S.J., Fitzmaurice, W.P., 2002. Making an allyfrom an enemy: plant virology and the new agriculture. Annu. Rev.Phytopathol. 40, 45–74.
Porta, C., Spall, V.E., Findlay, K.C., Gergerich, R.C., Farrance, C.E.,Lomonossoff, G.P., 2003. Cowpea mosaic virus-based chimaeras—Effectsof inserted peptides on the phenotype, host range, and transmissibility of themodified viruses. Virology 310 (1), 50–63.
Roden, R., Yutzy, W., Fallon, R., Inglis, S., DR, L., Schiller, J., 2000. Minorcapsid protein of human genital papillomaviruses contains subdominant,cross-neutralizing epitopes. Virology 270 (2), 254–257.
Sano, T., Cantor, C.R., 1991. A streptavidin–protein-A chimera that allows one-step production of a variety of specific antibody conjugates. Bio/Technology9 (12), 1378–1381.
Santa Cruz, S., Chapman, S., Roberts, A.G., Roberts, I.M., Prior, D.A.M.,Oparka, K.J., 1996. Assembly and movement of a plant virus carrying agreen fluorescent protein overcoat. Proc. Natl. Acad. Sci. U.S.A. 93 (13),6286–6290.
Schlick, T.L., Ding, Z.B., Kovacs, E.W., Francis, M.B., 2005. Dual-surfacemodification of the tobacco mosaic virus. J. Am. Chem. Soc. 127 (11),3718–3723.
Smolenska, L., Roberts, I.M., Learmonth, D., Porter, A.J., Harris, W.J., Wilson,T.M.A., Santa Cruz, S., 1998. Production of a functional single chainantibody attached to the surface of a plant virus. FEBS Lett. 441 (3),379–382.
Stoute, J.A., Kester, K.E., Krzych, U., Wellde, B.T., Hall, T., White, K., Glenn,G., Ockenhouse, C.F., Garcon, N., Schwenk, R., Lanar, D.E., Sun, P.,Momin, P., Wirtz, R.A., Golenda, C., Saloui, M., Wortmann, G., Holland,C., Dowler, M., Cohen, J., Ballou, W.R., 1998. Long-term efficacy andimmune responses following immunization with the RTS,S malaria vaccine.J. Infect. Dis. 178 (4), 1139–1144.
Towbin, H., Staehelin, T., Gordon, J., 1979. Electrophoretic transfer of proteinsfrom polyacrylamide gels to nitrocellulose sheets: procedure and someapplications. Proc. Natl. Acad. Sci. U.S.A. 76 (9), 4350–4354.
Villa, L.L., Costa, R.L.R., Petta, C.A., Andrade, R.P., Ault, K.A., Giuliano,A.R., Wheeler, C.M., Koutsky, L.A., Malm, C., Lehtinen, M.,Skjeldestad, F.E., Olsson, S.E., Steinwall, M., Brown, D.R., Kurman,R., Ronnett, B.M., Stoler, M.H., Ferenczy, A., Harper, D.M., Tamms,G.M., Yu, J., Lupinacci, L., Railkar, R., Taddeo, F.J., Jansen, K.U.,Esser, M.T., Sings, H.L., Saah, A.J., 2005. Prophylactic quadrivalenthuman papillomavirus (types 6, 11, 16, and 18) L1 virus-like particlevaccine in young women: a randomised double-blind placebo-controlledmulticentre phase II efficacy trial. Lancet Oncol. 6 (5), 271–278.
