CENOMICS8,217-224 (1990) Molecular Analysis of the Drosophila Nuclear Lamin Gene MIDHAT OSMAN,*-’ MICHAEL PAZ,*-’ YOSEF LANDESMAN,* ABRAHAM FAINsoD, t AND YOSEF GRUENBAUM*** *Department of Genetics, The Life Sciences Institute, The Hebrew University, Jerusalem 91904, and -IDepartment of Cellular Biochemistry, The Hebrew University-Hadassah Medical School, Jerusalem 9 10 IO, Israel Received December21, 1989;revised May 11, 1990 A complete nucleotide sequence of a 4.2-kb genomic fragment containing the Drosophila lamin gene and flanking sequences is presented. Primer extension ex- periments and sequence analysis revealed that tran- scription starts from a single promoter. The lamin maternal 2.8-kb transcript and the 3.0-kb zygotic transcript are generated from two alternative poly- adenylation sites. The gene contains four exons. The first intron is 7 bp upstream of the first AUG site. The two other introns are located within the a-helical rod domain of the protein: one in coil 1B in the 42-amino- acid domain that is absent in vertebrate cytoplasmic intermediate filament proteins and the other in coil 2 at a position different from intron positions within the vertebrate intermediate filament genes. Together with the sequence homology analysis, the data suggest ei- ther that the lamin gene was the ancestral gene of in- termediate filament genes or that the lamin gene di- verged from other intermediate filament genes early in evolution. 0 1990 Academic Press, he. INTRODUCTION Underlying the inner membrane of the nuclear en- velope is a proteinaceous network of intermediate fil- ament fibrils termed the nuclear lamina (Gerace and Burke, 1988; Krohne and Benevente, 1986; McKeon, 1987). The lamins are the major proteins of the nuclear lamina. The number of lamin genesin different organ- isms varies from a single lamin gene (Maul et al., 1984; Smith et al., 1987) to at least five different lamin genes (Wolin et al., 1987). Mammals probably have two lamin genes; one encodes lamins A and C and the other en- codes lamin B (Fisher et aZ.,1986; McKeon et rd., 1986). Sequence data from this article have been deposited with the EMBL/GenBank Data Libraries under Accession No. X16275. 1 The first two authors made equal contributions. 2 To whom correspondence should be addressed. 217 Lamin A and C expression is under developmental reg- ulation and occurs following differentiation, while lamin B is probably present in the nuclear envelope of every mammalian cell (Guilly et uZ.,1987; Stewart and Burke, 1987). The five known Xenopus lamin polypep- tides are probably encoded by five different genes and appear in the nuclear envelope in different amounts depending on the cell type and the developmental stage (Wolin et al., 1987). The single Drosophila lamin gene encodes two transcripts of 2.8 and 3.0 kb (Gruenbaum et uZ.,1988). The 2.8-kb mRNA is the major transcript in the developing oocyte and in the embryonic maternal pool, while the 3.0-kb mRNA is the major transcript following cellularization of the Drosophila embryo (Gruenbaum et al., 1988). Both transcripts encode a single primary translation product, Dm,,, that under- goes specific post-translational modifications to form three distinguishable isoforms, DmI, Dmz, and D,it (Gruenbaum et al., 1988; Smith and Fisher, 1984,1989). These lamin isoforms differ in their phosphorylation patterns and are under developmental regulation. DmI and Dmz interconvert in responseto heat shock (Smith and Fisher, 1984). Lamin cDNA clones have been isolated from human (Fisher et al., 1986; McKeon et al., 1986), Xenopus (Krohne et al., 1987; Stick, 1988; Wolin et al., 1987), and Drosophila (Gruenbaum et al., 1988). The putative translation product deduced from the cDNAs revealed that lamins share significant homology with all inter- mediate filament proteins in the a-helical rod domain. Like the other intermediate filament proteins, the rod domain of the lamins contains three a-helical coils that are separated by short linkers. Each coil is composed of several characteristic heptad repeats that are capable of forming coiled coils (Franke, 1987). Coil 1B of both the invertebrate and the vertebrate lamins has the same length as a recently identified invertebrate cytoplasmic intermediate filament protein (Weber et al., 1988) but is 42 amino acids (6 heptads) longer than coil 1B of vertebrate cytoplasmic intermediate filament proteins o&w-7543/90 $3.00 Copyright 0 1990 by Academic Press, Inc. All rights of reproduction in any form reserved.
Transcript
CENOMICS8,217-224 (1990)
Molecular Analysis of the Drosophila Nuclear Lamin Gene
MIDHAT OSMAN,*-’ MICHAEL PAZ,*-’ YOSEF LANDESMAN,* ABRAHAM FAINsoD, t AND YOSEF GRUENBAUM***
*Department of Genetics, The Life Sciences Institute, The Hebrew University, Jerusalem 91904, and -IDepartment of Cellular Biochemistry, The Hebrew University-Hadassah Medical School, Jerusalem 9 10 IO, Israel
Received December21, 1989;revised May 11, 1990
A complete nucleotide sequence of a 4.2-kb genomic fragment containing the Drosophila lamin gene and flanking sequences is presented. Primer extension ex- periments and sequence analysis revealed that tran- scription starts from a single promoter. The lamin maternal 2.8-kb transcript and the 3.0-kb zygotic transcript are generated from two alternative poly- adenylation sites. The gene contains four exons. The first intron is 7 bp upstream of the first AUG site. The two other introns are located within the a-helical rod domain of the protein: one in coil 1B in the 42-amino- acid domain that is absent in vertebrate cytoplasmic intermediate filament proteins and the other in coil 2 at a position different from intron positions within the vertebrate intermediate filament genes. Together with the sequence homology analysis, the data suggest ei- ther that the lamin gene was the ancestral gene of in- termediate filament genes or that the lamin gene di- verged from other intermediate filament genes early in evolution. 0 1990 Academic Press, he.
INTRODUCTION
Underlying the inner membrane of the nuclear en- velope is a proteinaceous network of intermediate fil- ament fibrils termed the nuclear lamina (Gerace and Burke, 1988; Krohne and Benevente, 1986; McKeon, 1987). The lamins are the major proteins of the nuclear lamina. The number of lamin genes in different organ- isms varies from a single lamin gene (Maul et al., 1984; Smith et al., 1987) to at least five different lamin genes (Wolin et al., 1987). Mammals probably have two lamin genes; one encodes lamins A and C and the other en- codes lamin B (Fisher et aZ., 1986; McKeon et rd., 1986).
Sequence data from this article have been deposited with the EMBL/GenBank Data Libraries under Accession No. X16275.
1 The first two authors made equal contributions. 2 To whom correspondence should be addressed.
217
Lamin A and C expression is under developmental reg- ulation and occurs following differentiation, while lamin B is probably present in the nuclear envelope of every mammalian cell (Guilly et uZ., 1987; Stewart and Burke, 1987). The five known Xenopus lamin polypep- tides are probably encoded by five different genes and appear in the nuclear envelope in different amounts depending on the cell type and the developmental stage (Wolin et al., 1987). The single Drosophila lamin gene encodes two transcripts of 2.8 and 3.0 kb (Gruenbaum et uZ., 1988). The 2.8-kb mRNA is the major transcript in the developing oocyte and in the embryonic maternal pool, while the 3.0-kb mRNA is the major transcript following cellularization of the Drosophila embryo (Gruenbaum et al., 1988). Both transcripts encode a single primary translation product, Dm,,, that under- goes specific post-translational modifications to form three distinguishable isoforms, DmI, Dmz, and D,it (Gruenbaum et al., 1988; Smith and Fisher, 1984,1989). These lamin isoforms differ in their phosphorylation patterns and are under developmental regulation. DmI and Dmz interconvert in response to heat shock (Smith and Fisher, 1984).
Lamin cDNA clones have been isolated from human (Fisher et al., 1986; McKeon et al., 1986), Xenopus (Krohne et al., 1987; Stick, 1988; Wolin et al., 1987), and Drosophila (Gruenbaum et al., 1988). The putative translation product deduced from the cDNAs revealed that lamins share significant homology with all inter- mediate filament proteins in the a-helical rod domain. Like the other intermediate filament proteins, the rod domain of the lamins contains three a-helical coils that are separated by short linkers. Each coil is composed of several characteristic heptad repeats that are capable of forming coiled coils (Franke, 1987). Coil 1B of both the invertebrate and the vertebrate lamins has the same length as a recently identified invertebrate cytoplasmic intermediate filament protein (Weber et al., 1988) but is 42 amino acids (6 heptads) longer than coil 1B of vertebrate cytoplasmic intermediate filament proteins
o&w-7543/90 $3.00 Copyright 0 1990 by Academic Press, Inc.
All rights of reproduction in any form reserved.
218 OSMAN ET AL.
(Franke, 1987). In addition, electron microscopy studies revealed that the lamina structure is probably similar to that of the intermediate filaments (Aebi et al., 1986).
Most vertebrate intermediate filament genes ana- lyzed to date, including the a-keratin, cytokeratin, desmin, vimentin, and glial fibrillar acidic protein genes, show striking conservation in the position of their introns within the regions of the gene that encodes the a-helical coils (for review see Steinert and Roop, 1988). It was noted that one of the most conserved introns is in coil 1B at the position where the six ad- ditional heptad repeats of the lamin are inserted (We- ber, 1988).
On the basis of (a) the conservation in the position of the introns, (b) the sequence homology in the rod domain between all intermediate filaments, and (c) the similar predicted structural conformations of these proteins, a few related models of the evolution of the intermediate filament genes have been proposed (Julien et al., 1987; Levy et al., 1987; Lewis and Cowan, 1986; Myers et al., 1987; Steinert et al., 1985). According to some of these models, the intermediate filament genes evolved from an ancestral gene containing introns. Since the expression of the different intermediate fil- ament genes is cell specific and the expression of the lamin is ubiquitous, it was speculated that the lamin gene could have been the ancestral intermediate fila- ment gene (Franke, 1987). The difference in the po- sitions of introns within the neurofilament genes from those of other cytoplasmic intermediate filament genes was explained either by an event of reverse transcrip- tion or by a selective loss of introns. In contrast, Julien et al. (1987) have proposed that the ancestral gene might have been intronless.
We report the complete genomic sequence of the Drosophila lamin gene. Lamin transcription starts from a single promoter and the two lamin transcripts are formed by utilizing different polyadenylation signals. The positions of the introns within the Drosophila lamin gene differ from those of all the analyzed mem- bers of the intermediate filament genes. The evolu- tionary implications of this observation are discussed.
MATERIALS AND METHODS
Libraries and Clones
The genomic library of Drosophila en1 in the vector X Charon 34 phage was kindly provided by Z. Ali and Dr. T. Kornberg (University of California, San Fran- cisco). The isolation and characterization of the two Drosophila lamin cDNAs, cDNL2800 and cDNL3000 representing the two putative lamin transcripts, have been described (Gruenbaum et al., 1988). Drosophila melanogaster stocks Canton S, Berlin, and Qiryat An-
avim were a gift of Dr. R. Falk (The Hebrew Univer- sity) .
RNA Isolation and Primer Extension
Total RNA was isolated from Drosophila Schneider tissue culture cells by the guanidinium thiocyanatel CsCl method (Chirgwin et al., 1979). The oligonucle- otide used in these experiments was synthesized ac- cording to the published sequence of the Drosophila lamin cDNA clones and corresponds to positions 42 to 60 bp downstream to the start of cDNL3000 clone (Gruenbaum et al., 1988). Primer extension was per- formed as described (Hudson and Davidson, 1984). The synthetic oligonucleotide was 32P-end-labeled (1 X lo7 cpm/pmol). Total RNA (15 pg) was annealed with 3 X lo5 cpm of the labeled nucleotide for 5 min at 65°C in a solution containing 50 mM KCl, 60 m&f Tris-HCl, pH 8.3,1.2 mM EDTA, 10 mM MgCls, and 25 mM p- mercaptoethanol. Following slow cooling of the solution to 42”C, 1.3 mM each of all four dNTPs and 10 units of reverse transcriptase (Promega) were added. Incu- bation was for 1 h at 42’C. The solution was extracted once in phenol, ethanol precipitated, and resuspended in 2 ~1 H20, and 4 ~1 of sequencing dye (USB) was added. Half of the reaction mixture was loaded on a sequencing gel and electrophoresed in parallel to a se- quencing reaction of the corresponding genomic region performed with the same oligonucleotide that was used in the primer extension reaction. The second half was loaded on a sequencing gel and electrophoresed in par- allel to DNA size markers.
Hybridization Conditions
Screening of the Drosophila genomic library and Southern analysis were performed under high-strin- gency hybridization conditions as described by South- ern (1975). Hybridization mixtures contained 50% formamide, 5X SSC, 50 n&f sodium phosphate, pH 6.5, 5X Denhardt’s solution, 2 mg/ml herring testis DNA, and 32P-labeled hybridization probe (3 X 10’ cpm/pg DNA). Hybridizations were performed at 42°C. Washes were twice for 15 min each with 2X SSC, 0.1% SDS at room temperature and four times for 30 min each with 0.1X SSC, 0.1% SDS at 52°C.
Sequencing of DNA
Subclones for sequencing were prepared by subclon- ing specific fragments into a pUC118 vector. To com- plete the sequence on both strands of the DNA, some sequencing reactions were performed by using synthetic 17-mers as primers. The nucleotide sequence of the cloned DNA was determined by using the dideoxy chain termination technique of Sanger et al. (1977). Se-
Drosophila NUCLEAR LAMIN GENE 219
quencing was performed on denatured supercoiled plasmids by using the modified T7 DNA polymer- ase (USB).
RESULTS
Cloning of the Drosophila Genomic Lamin Gene
To clone the genomic region of the Drosophila lamin, a library screen of Drosophila genomic DNA derived from Drosophila flies that carry the spontaneous en- grailed mutation en1 (Eker, 1929) in the vector X Charon 34 was performed using the cDNL3000 lamin cDNA (Gruenbaum et aZ., 1988) as a probe. Nine phages that preferentially hybridized to the probe were iso- lated. One was taken for further analysis and was des- ignated XgdL9. A 9.8kb EcoRI fragment that specifi- cally hybridized to the cDNL3000 probe was subcloned into pUC9 vector (pGDL9.8). A partial restriction map of pGDL9.8 is shown in Fig. 1A. Southern analysis of pGDL9.8 clone, digested with several restriction en- zymes using cDNL3000 as a probe, and sequence anal- ysis (see below) revealed that the cDNA sequence is contained within a 4.2-kb fragment of pGDL9.8. A de- tailed restriction map of this 4.2-kb fragment is shown in Fig. 1B.
Sequencing and Sequence Comparison
To further characterize the Drosophila lamin gene and to learn about its structure, we sequenced the ge- nomic region that is homologous to the cDNA se- quences and flanking regions. Figure 1C shows the structure of Drosophila lamin gene as determined from the comparison between the genomic and the cDNA sequences. Figure 2 shows the complete nucleotide se- quence of the Drosophila lamin gene including the in- trons and flanking sequences. The termination sites of clones cDNL3000 and cDNL2800 that represent the two Drosophila lamin transcripts are marked in Fig. 2. Overall, the sequence of the genomic clone was similar to our previously published cDNA sequence (Gruen- baum et aZ., 1988). Eight differences between the cDNA and the genomic sequences were detected (Fig. 2, bold letters). Seven of them are base substitutions; three are in the 5’ and the 3’ noncoding regions and the other four are silent mutations in the coding region. At po- sition 1860 (Fig. 2) the CG dinucleotide is substituted by a GC. This change in the DNA sequence changes the amino acid sequence at position 270 from Asp-Val to Glu-Leu. The CG sequence in the cDNA clone was probably due to mutation during the subcloning of the cDNA since (i) the amino acid sequence is now more homologous to the mammalian lamin A/C sequence, and (ii) in another cDNA subclone of cDNL3000, GC and not CG is present in the sequence. The silent sub-
FIG. 1. Genomic organization of the Drosophila lamin gene. (A) Partial restriction map of pGDL9.8 clone. (B) A more detailed restriction map of the 4.2-kb fragment containing lamin coding se- quences and flanking regions. The restriction enzymes are C, Club H, HindIII; M, MluI; P, P&I; RI, EcoRI; RV, EcoRV, S, San; X, XbuI; Xh, XhoI; Xm, XmuIII. (Cl Genomic organization of the lamin gene. Open boxes represent the exons and solid lines represent introns and 5’ and 3’ noncoding sequences. The position of the first methi- onine and the polyadenylation sites of the two lamin transcripts are marked.
stitution of G with C at position 2076 (Fig. 2) abolishes the BamHI site in the lamin gene. To corroborate the G to C substitution, we performed Southern analysis of BamHI-digested DNA derived from the Drosophila strains Oregon R, Berlin, Canton S, and Qiryat Ana- vim, using the cDNL3000 as a probe. We observed that this BamHI site was present only in the Drosophila Oregon R strain DNA (data not shown). This BamHI site was previously shown to be present in our cDNA clones prepared from the Oregon R strain (Gruenbaum et al., 1988).
The sequence analysis revealed that the two lamin transcripts are contained within the same four exons. The sequences of the exon-intron junctions fit well with the consensus donor and acceptor splicing se- quences (Padget et al., 1986). Thus, the two lamin transcripts must be generated by alternative polyade- nylation. Neither transcript contains the consensus AAUAAA polyadenylation signal (Brienstiel et al., 1985). The putative signal sequences for the polyade- nylation of the two lamin transcripts are underlined in Fig. 2. There is an AUAUAU sequence 26 bp up- stream from the polyadenylation site of the 2.8-kb transcript, and 68 bp upstream from the polyadenyl- ation site is the sequence AAUACA that was proposed as the polyadenylation signal for a human keratin gene (Marchuk et al., 1984). In addition, 13 bp upstream from the polyadenylation site of the 3.0-kb transcript is the AACAAA sequence that was reported as the pu- tative polyadenylation signal for the Drosophila tropo- myosin transcript (Boardman et al., 1985).
M S SKSRRAGTATPQPGNTST CCCCCGGCCCGCCATCGGGTCCGCAGCCGCCGCCGCCGCCGTCCACTCACTCGCAGACGCCTCCAGCCCCCTCAGCCCCACCC
P R P A IGSAAAAAVHSLADASSPLSPT GGCACTCGCGCGTGGCCGAGAAGGTGGAGCTGGAGCTGCAG~CCTG~CGATCGCCTGGCCACCTACATTGACCGGGTGCGC~C RHSRVAEKVELQNLNDRLATYI D R V RN CTGGAGACGGAGAACTCCCGCCTCACCATCGAGGTGCAGACCACCAGGGACACGGTCACACGCGAGACCACC~CATC~
LETENSRLT I E V Q T TRDTVTRETTNIK GAACATCTTCGAGGCCGAGCTGCTGGAGACGCGCGCCGTCTGCTCGATGACACAGCTAGGGATCGC~TCGTGCCGAGATCG
NIFEAELLETRRLLDDTARDRARAEI ATATCAAGCGTCTCTGGGAGGAGAATGAGGAGCTCAAGAAGAGTGCACCACTGCTGAG D IKRLWEENEELKNKLDK'KTKECTTAE Ggtaagtgcgtggaaactgaatcgataagaaaaccttataa~~g~agggCaaagaaag~agag~aa~ga~aaaa~~aaaa gtaagaagagacaaaaggcgtggtttcaagcaagaacgaaaca~~ca~~~ag~~gc~gaactg~a~a~aa~ga~~a~ccc atgatattcctcactttctgtgacaaaatcatccctattc~ggac~~~aacgaaca~~aa~~ga~~ga~~a~cccaaccc gcagGCAATGTCCGCATGTACGAGTCGCGCGCCAACGAGC
LNEDLNEALKE LERLRKQFEET R K N L AACAGGAGACACTGTCGCGCGTTGACCTGGAGAACACCACCATTCAGAGTCTGCGCGAGGAGCTCTCGTTC~GGATCAGATC E Q ETLSRVDLENTIQSLREE LSFKDQI CATTCGCAGGAGATCAATGAGTCGCGCCGCATCAAACAGATCGACGGGTCGCCTCAGCTCCGAGT
H S Q E INEGRRIKQTEYSEIDGSPQLRV ACGATGCCAGTTGAAGCAGTCGCTGCAGGAOCTGCGCGCGCCCAGTACGAGGAGCAGATGCAGATT~TCGCGATG~TCC
E L R S TRVRIDALNANINELEQANADLN TGCGCGCATCCGTGATCTGGAGCGCCAGCTGGACAACGATGG
AR I RDLERQ LDNDRERHGQE IDLLEK AGCTCATTCGGCTGCGCGAATGACGCAACAGCTCAGCTC~GGAGTACCAGGACCTTAT~ACATC~Ggttagctttaat E L I R L R E EMTQQLKE Y Q D L M D I K acttgtctaaaatcgtgcacgtattaatacataaatctaaa~c~aat~atCC~gc~~agGTCTCCCTGGATTTGG~TCGCCGCA
v s L D L E I A A TACGACAAGCTGCTGGTGGGCGAGGAGGCTCGTTTGAACATCCTTTAG
QSLRNS TRATPSRRTPSAAVKRKRAV TCGACGAGTCGGAGGATCACAGCGTCGCCGATTACTATGTGGAGATC VDESEDHSVADYYVSASAKGNVE I K E I GATCCCGAGGGCAAGTTCGTAAGGCTGTTCAACAAGGGCAGCGAGGAGGTGGCCATCGGTGGCTGGCAGCTGCAGCGGCT
INEKGP STTYKFHRSVRIEPNGVITV GGTCGGCGGACACCAAGGCCTCGCACGAGCCGCCATCGCCATCGAGCCTTGTGATG~GTCACAG~GTGGGTCTCCGCCGAC~C WSADTKASHE PPSSLWMKSQKWVS AD N ACTAGGACGATTTTGCTGAACTCCGAGGGCGAGGCCGTGGCACAC
SSSRLSRRRSVTAVDGNEQLYHQQGD CTCAGCAGTCAAACGAGAAGTGCGCAATTATGTAAAATCATCTTTGCTGAACAAG PQQSNE K C A I M ter ACAAACAAAATAAGCACACACGAAGATCATCAT~TTTAG~CCC~CACACACACCGA~TACAGAGATTTATTATTCA GCTAAGTTATTTTTTGTGGCCGCAGCGCCAATTATTATTT~TC~CATTTGTGTAG~GACATCCTG~TCTTCGTTTC GTTTGTACACTTTCGTTTTCCCTTTCTTAACAAATTCTATAGTTTATTGTTTCGATGTTTTGTATTCCGCGTT~CTGAT CTATGTAAACTTTATTTGGTATAAACTGGAGAGAGCATGGAGAGAGCATGTT~CTCTTTTTTATGCCACATAG~TTTACGT~GACGTT CACTTCTTGTATTCGCGGCGGCAAGAACTTTGAAAATATTTTACGCTCCACCT ACATATTTAGTAAATTAGTTTTTAAGCTATATATCCCAGAT~CCAGTCGACGTCA~~C~C~C~CA ACGAGCACGTAGTGAGTGATTTATAAGATACAGGTCAGGTC~GAGGATT~CT~G~C~CGCTCCTGAC~CAGACAT ATTTATTTAAGTATTTTTTGTACAATCAACATAAAATACAT~TACATTATACATTATACATACATATACATACATACATTATATAT
FIG. 2. Sequence of the genomic lamin gene. Coding sequences are in capital letters. The putative protein translation product is shown under the DNA sequence. The putative TATA box is in bold letters and is underlined. Also underlined is the synthetic oligonucleotide that was used for the primer extension. Nucleotides that are substituted in the cDNA sequence are shown in bold letters. The two arrows at positions 3691 and 3893 mark the polyadenylation sites of the 2.8- and 3.0-kb lamin mRNAs.
Drosophila NUCLEAR LAMIN GENE 221
AB
-
-
bp 234
194
118
72
FIG. 3. Primer extension analysis performed on total Drosophila Schneider tissue culture cells RNA. The position of the primer is shown in Fig. 2. An arrow indicates the primer extension product (A). The lengths of the size markers in lane B are marked on the right. The primer extension product and the size markers were sep- arated on a sequencing gel. In another experiment, the primer ex- tension product was separated next to a sequencing reaction of the genomic region, using the synthetic oligonucleotide as a primer. This analysis gave similar results (data not shown).
Possible Regulatory Sequences
The putative CAP site was analyzed by the primer extension technique (Hudson and Davidson, 1984). The sequence of the synthetic oligonucleotide corresponds to positions 42 to 60 downstream from the start of the clone (Gruenbaum et al., 1988) and is underlined in Fig. 2. Total RNA was extracted from Schneider tissue culture cells and used as a template. Only a single ini- tiation site for lamin transcription was detected (Fig. 3). Transcription starts with the sequence AGGCATGCC located 24 bp upstream from the be- ginning of both lamin cDNA clones, and 29 bp up- stream from the transcription start site is a TATCTA sequence that can probably serve as the RNA poly- merase II binding site (Hurbury and Struhl, 1989).
Comparisons between the Drosophila Lamin Gene and Genes Encoding Cytoplasmic Intermediate Filaments
The Drosophila lamin gene contains three introns (Figs. 1C and 2). The first intron is 662 bp long and is
located 7 bp upstream to the AUG translation start codon. The second and the third introns are located in the a-helical region of the gene. The second intron is 243 bp long. The intron is positioned in coil 1B in the first heptad of the six additional heptads missing in the vertebrate cytoplasmic intermediate filament pro- teins. The third intron is 65 bp in length and is located at amino acid 103 of coil 2.
To gain an insight into the evolution of the inter- mediate filament genes and because this is the first analysis of a genomic clone of a lamin gene, we were interested in determining whether the positions of the introns within the Drosophila lamin gene match the intron positions within other intermediate filament genes. The relationship between intron positions of cytoplasmic intermediate filament genes and the Dro- sophila lamin gene is shown in Fig. 4. All three lamin introns are at locations different from the known po- sitions of analyzed intermediate filament genes, in- cluding the neurofilament genes.
DISCUSSION
The Drosophila lamin gene is developmentally reg- ulated, giving rise to a 2.8-kb maternal transcript and a 3.0-kb zygotic transcript (Gruenbaum et al., 1988; Smith et al., 1987). The data presented here show that the different transcripts are generated by utilizing dif- ferent polyadenylation sites. Alternative polyadenyl- ation occurs in many eukaryotic genes (Brienstiel et al., 1985) and can produce differences in transcript size between maternal and zygotic transcripts as in the case of the abl oncogene (Meijer et al., 1987). None of the putative lamin polyadenylation signals contains the consensus AAUAAA sequence. Polyadenylation signals
FIG. 4. Comparison of intron locations in selected vertebrate cytoplasmic intermediate filament genes of known structure and the Drosophila lamin gene. All known intermediate filament proteins have the same general structure. o-Helical coils in the rod domain are boxed. The intron positions are marked with arrows and the numbers below the arrows refer to the position of the amino acid residue in the subdomains of the protein according to Steinert and Roop (34). The box above coil 1B represents the additional six heptads that are unique to the lamins and to at least one of the invertebrate cytoplasmic intermediate filament proteins. One of the Drosophila lamin introns is positioned in coil 1B in this region and is in paren- theses.
222 OSMAN ET AL.
different from the AAUAAA were shown to be present in other eukaryotic genes (Brienstiel et al., 1985), in- cluding the lamin genes (Fisher et al., 1986; Stick, 1988; Wolin et al., 1987). The choice between the different Drosophila lamin polyadenylation signals might depend on maternal factors that more efficiently recognize the polyadenylation signal(s) of the 2.8-kb transcript.
The genomic lamin clone was derived from a strain containing a spontaneous mutation in the engrailed gene (Eker, 1929). Comparison of the genomic sequence to the cDNA clones revealed six silent substitutions. At least one of these substitutions is not the result of a cloning artifact since the BamHI site is present in the Oregon R strain but not in the Berlin, Canton S, or Qiryat Anavim strain, Accumulation of seven sub- stitutions in a 3-kb region presents another indication that the Drosophila genome is relatively dynamic (Fu- tuyma, 1986).
The Drosophila lamin gene is the first invertebrate intermediate filament gene and the first lamin gene in which the intron positions are known. Because it was speculated in several reports that the lamin gene might have been the ancestral gene, we attempted to place the lamin gene in the context of evolution. In the pro- posed model of intermediate filament gene evolution, either the lamin gene is the ancestral intermediate fil- ament gene or it branched from an ancestral gene early in evolution (Fig. 5). The first part of the model is based on several arguments. (i) While cytoplasmic in- termediate filaments are cell specific, lamin expression is ubiquitous; the nuclear lamina is found in every eu- karyotic organism analyzed to date. (ii) The Drosophila and the vertebrate lamins contain six heptad repeats in coil 1B that are absent in all vertebrate cytoplasmic intermediate filaments analyzed to date. (iii) The po- sitions of the introns in all the cytoplasmic interme- diate filament genes, except the neurofilaments genes, are highly conserved (Fig. 4). In contrast, the positions of the introns within the Drosophila lamin gene are clearly different from those of all other intermediate filament genes, including the neurofilaments. (iv) The homology between the Drosophila lamin protein in the a-helical coil regions and the vertebrate lamins is about 38% and the homology to all known cytoplasmic in- termediate filament proteins is 28-32% (data not shown). As in the case of all intermediate filament genes, the homology is especially high at the beginning of coil 1A and at the end of coil 2. These data probably indicate that the structural considerations dictated these peptide homologies.
A difference in the positions of the introns between Drosophila and other organisms was reported for the actin genes (Zakut et al., 1982). In the proposed model of actin gene evolution, the ancient actin gene con- tained introns in all the locations that still exist in one
FIG. 6. Model for the evolution of the intermediate filament gene family. The ancestral gene is assumed to be intronless and could have been the lamin gene. A branch point marks a duplication event. The numbers mark; (1) branching of the lamin gene-gene duplications of this gene gave rise to type A and type B lamins; (2) the loss of six heptads in coil lB-the loss of these heptads must have occurred before the branching of the neurofilament genes (3) (4) acquisition of seven introns-most of these introns were found to be conserved in almost all the cytoplasmic intermediate filament genes. Another possible model is discussed in the text.
species or another today and those introns were lost due to reverse transcription activity in the various or- ganisms. The fact that none of the intron positions in the Drosophila genes is conserved was attributed to the hypothesis that rapidly growing species have a stronger tendency to lose their introns (Zakut et al., 1982).
As in the case of the actin genes, an evolutionary model in which the ancient intermediate filament gene contained all the introns present to date within the intermediate filaments genes cannot be ruled out. However, in contrast to the case of the actin genes, it is more difficult to explain how an ancient intermediate filament gene lost all the “conserved” intron positions in both the Drosophila lamin gene and the vertebrate neurofilament genes. In addition, there is growing ev- idence that other ancestral genes were probably in- tronless (Rogers, 1989). Thus, it is more likely that the first intermediate filament gene was intronless (Fig. 5). This gene also contained the six additional heptads in coil 1B since they are present both in the lamin proteins and in an invertebrate cytoplasmic interme- diate filament protein. The lamin gene was the first gene that branched from the intronless ancestral gene. Duplications of this gene gave rise to the multigene family of the vertebrate type A and type B lamin genes. Since the vertebrate cytoplasmic intermediate fila- ments do not contain the six additional heptads in coil 1B (Weber, 1988), it was only at a later stage of evo-
Drosophila NUCLEAR LAMIN GENE 223
lution that the intermediate filament gene lost this portion of the protein. The next event probably in- volved the branching of a neurofilament gene and the insertions of the neurofilament-specific introns. Du- plications of the neurofilament gene gave rise to the three different vertebrate neurofilament genes (Stei- nert and Roop, 1988). A later evolutionary event was the insertidn of seven conserved introns. The rest of the model is essentially similar to the model of Julien et al. (1987).
ACKNOWLEDGMENT
This work was supported by the fund for basic science, adminis- trated by the Israel Academy of Sciences and Humanities.
1.
2.
3.
4.
5.
6.
7.
8.
9.
10.
11.
12.
13.
REFERENCES
AEBI, U., COHN, J. B., BUHLE, L., AND GERACE, L. (1986). The nuclear lamina is a meshwork of intermediate-type filaments. Nature (London) 323: 560-564.
BOARDMAN, M., BASI, G. S., AND STARTI, R. U. (1985). Multiple polyadenylation sites in the Drosophila tropomyosin gene are used to generate functional mRNAs. Nucleic Acids Res. 1: 1763- 1766. BRIENSTIEL, M. L., BUSSLINGER, M., AND STRUB, K. (1985). Transcription termination and B’processing: The end is in site. Cell41:349-359. CHIRGWIN, J. M., PRZYBYLA, A. E., MCDONALD, R. J., AND RUTER, W. J. (1979). Isolation of biological active ribonucleic acid from sources enriched in ribonuclease. Biochenistry 18: 294-299. EKER, R. (1929). The recessive mutant engrailed in Drosophila melanogaster. Hereditas 12: 217-222. FISHER, D. Z., CHAUDHARY, N., AND BLOBEL, G. (1986). cDNA sequencing of nuclear lamins A and C reveals primary and sec- ondary structural homology to intermediate filament proteins. Proc. Natl. Acad. Sci. USA 83: 6450-6454.
FRANKE, W. W. (1987). Nuclear lamins and the cytoplasmic intermediate filament proteins: A growing multigene family. Cell 48: 3-4.
FRIEDMAN, I. D., IMPERIALE, M. J., AND SANKAR, A. (1987). RNA 3’ end formation in the control of gene expression. Annu. Reu.Genet. 21:453-488. FUTUYMA, D. J. (1986). “Evolutionary Biology,” Sinauer As- sociates, Sunderland, MA. GERACE, L., AND BURKE, B. (1988). Functional organization of the nuclear envelope. Annu. Reu. Cell Biol. 4: 335-374.
GRUENBAUM, Y., LANDESMAN, Y., DREES, B., BARE, J. W., SAUMWEBER, H., PADDY, M., SEDAT, J. W., SMITH, D. E., BEN- TON, B., AND FISHER, P. A. (1988). Drosophila nuclear lamin precursor Dm, is translated from either of two developmentally regulated mRNA species apparently encoded by a single gene. J CellBiol. 100:585-596. GUILLY, M., BENSUSSAN, A., BOURGE, J., BORNES, M., AND COURVALIN, J. (1987). A human T lymphoblast cell line lacks lamin A and C. EMBO J. 6: 3795-3799.
HUDSON, G. S., AND DAVIDSON, B. E. (1984). Nucleotide se- quence and transcription of phenylalanine and tyrosine operons in Escherichia coli K12. J. Mol. Biol. 180: 1023-1051.
14.
15.
16.
17.
18.
19.
20.
21.
22.
23.
24.
25.
26.
27.
28.
29.
30.
HURBURY, P. A. B., AND STRUHL, K. (1989). Functional dis- tinctions between yeast TATA elements. Mol. Cell. Biol. 9: 5298-5304.
JULIEN, J. P., GROSVEXD, F., YAZDANBAKSH, K., FLAVELL, D., MEIJER, D., AND MUSHINSKI, W. (1987). The structure of human neurofilament gene (NF-L): A unique exon-intron organization in the intermediate filament gene family. Biochim. Biophys. Acta 909: 10-20. KROHNE, G., AND BENEVENTE, R. (1986). The nuclear lamins: A multigene family of proteins in evolution and differentiation. Ezp. Cell Res. 162: l-10. KROHNE, G., WOLIN, S. L., MCKEON, F. D., FFZANKE, W. W., AND KIRSCHNER, M. W. (1987). cDNA cloning, amino acid se- quence and binding specificity of member of the lamin B subfamily. EMBO J. 6: 3801-3808. LEVY, E., LIEM, R. H. K., D’EUSTACHIO, P., AND COWAN, N. J. (1987). Structure and evolutionary origin of the gene en- coding mouse NF-M, the middle-molecular-mass neurofilament protein. Eur. J. Biochem. 166: 71-77. LEWIS, S. A., AND COWAN, N. J. (1986). Anomalous placement of introns in a member of the intermediate filament multigene family: An evolutionary conundrum. Mol. Cell. Biol. 6: 1529- 1534. MARCHUK, D., MCCROHON, S., AND FUCHS, E. (1984). Re- markable conservation of structure among intermediate fila- ment genes. Cell 39: 491-498. MAUL, G. G., BAGLIA, F. A., NEWMEYER, D. D., AND OLSON- WILHELM, B. M. (1984). The major 67,000 molecular weight protein of the clam oocyte nuclear envelope is lamin-like. J. Cell Sci. 67: 69-85.
MCKEON, F. D., KIRSCHNER, M. W., AND KAPUT, D. (1986). Homologies in both primary and secondary structure between nuclear envelope and intermediate filament proteins. Nature (London) 3 19:463-468. M&EON, F. D. (1987). Nuclear lamin proteins and the structure of the nuclear envelope: Where is the function. BioEssays 4: 169-173. MEI~R, D., HERMANS, A., LINDREN, M., AGTHOVEN, T., KLEIN, A., MACKENBACH, P., GROOTEGOED, A., TALARICO, D., VALLE, G. D., AND GROSVELD, G. (1987). Molecular characterization of the testis specific c-abl mRNA in mouse. EMBO J. 6: 4041- 4048. MYERS, M. W., LAZZARINI, R. A., LEE, V. M-Y., SCHLAPFER, W. W., AND NELSON, D. L. (198’7). The human mid-size neu- rofilament subunit: A repeated protein sequence and the rela- tionship of its gene to the intermediate filament gene family. EMBG J. 6: 1617-1626. PADGET, R. A., GRABOWSKI, P. J., KONARSKA, M. M., SEILER, S., AND SHARP, P. A. (1986). Splicing of messenger RNA pre- cursors. Annu. Reo. Biochem. 56: 1119-1150. ROGERS, J. H. (1989). How were introns inserted into nuclear genes. Trends Genet. 6: 213-216. SANGER, F., NICKLEN, S., AND COULSON, A. R. (1977). DNA sequencing with chain termination inhibitors. Proc. Natl. Acad. Sci. USA 74: 5463-5467.
SMITH, D. E., AND FISHER, P. A. (1984). Identification, devel- opmental regulation and response to heat shock of two anti- genitally related forms of a major nuclear envelope proteins in Drosophila embryos: Application of an improved method for affinity purification of antibodies using polypeptides immobi- lized on nitrocellulose blots. J. Cell Biol. 99: 20-28.
SMITH, D. E., GRUENBAUM, Y., BERRIOS, M., AND FISHER, P. A. (1987). Biosynthesis and interconversion of Drosophila
224 OSMAN ET AL
nuclear lamin isoforms during normal growth and in response to heat shock. J. Cell Biol. 105: 771-790.
31. SMITH, D. E., AND FISHER, P. A. (1989). Interconversion of Drosophila nuclear lamin isoforms during oogenesis, early em- bryogenesis and upon entery of cultured cells into mitosis. J. CellBiol. 108: 255-265.
32. SOUTHERN, E. M. (1975). Detection of specific sequences among DNA fragments separated by gel electrophoresis. J. Mol. Biol. 98: 503-517.
33. STEINERT, P. M., STEVEN, A. C., AND ROOP, D. R. (1985). The molecular biology of intermediate filaments. Cell 42: 411-419.
34. STEINERT, P. M., AND ROOP, D. R. (1988). Molecular and cel- lular biology of intermediate filaments. Annu. Rev. Biochem. 57: 593-625.
35. STEWART, C., AND BURKE, B. (1987). Teratocarcinoma stem cells and early mouse embryos contain only a single major
lamin polypeptide closely resembling lamin B. Cell 51: 383- 392.
36. STICK, R. (1988). cDNA cloning of the developmentally regulated lamin LIlr of Xenopus kxwis. EMBO J. 7: 3189- 3197.
37. WEBER, K. (1988). Link between lamins and intermediate fil- aments. Nature (London) 320: 402.
38. WEBER, K., PLESSMANN, U., DODEMONT, H., AND KOSSMAGK- STEPHAN, K. (1988). Amino acid sequence and homopolymer- forming ability of the intermediate filament proteins from an invertebrate epithelium. EMBO J. 7: 2995-3001.
39. WOLIN, G. G., KROHNE, G., AND KIRSCHNER, M. W. (1987). A new lamin in Xenopus somatic tissues displays strong homology to human lamin A. EMBO J. 6: 3809-3818.
40. ZAKUT, R., SHANI, M., GIVOL, D., NEUMAN, S., YAFFE, D., AND NUDEL, U. (1982). Nucleotide sequence of the rat skeletal muscle actin gene. Nature (Landon) 298: 857-860.
