MOLECULAR AND PHYSIOLOGICAL EVIDENCE FOR FUNCTIONAL GABA-C
RECEPTORS IN GROWTH HORMONE SECRETING CELLS
Katia Gamel-Didelon1, Lars Kunz1, Karl Josef Föhr2, Manfred Gratzl1, and Artur Mayerhofer1
1Anatomisches Institut der Universität München (Germany)
2Klinik für Anästhesiologie, Universität Ulm (Germany)
Running Title: GABA-C receptors in growth hormone secreting cells
Corresponding author:
Artur Mayerhofer
Anatomisches Institut der Universität München
Biedersteiner Strasse 29
80802 München (Germany)
Tel: 089-4140-3150
Fax: 089-397035
Email: [email protected]
1
Copyright 2003 by The American Society for Biochemistry and Molecular Biology, Inc.
JBC Papers in Press. Published on March 26, 2003 as Manuscript M301729200 by guest on February 19, 2018
http://ww
w.jbc.org/
Dow
nloaded from
SUMMARY
The neurotransmitter γ-aminobutyric acid (GABA), released by hypothalamic neurons, as well
as by growth hormone- (GH) and adrenocorticotropin- (ACTH) producing cells, is a regulator
of pituitary endocrine functions. Different classes of GABA receptors may be involved. In this
communication, we report that GH cells, isolated by laser microdissection from rat pituitary
slices, possess the GABA-C receptor subunit ρ2. We also demonstrate that in the GH adenoma
cell line, GH3, GABA-C receptor subunits are not only expressed, but form functional channels.
GABA-induced chloride (Cl-) currents were recorded using the whole-cell patch-clamp
technique: these currents were insensitive to bicuculline (a GABA-A antagonist), but could be
induced by the GABA-C agonist cis-4-aminocrotonic acid (CACA). In contrast to typical
GABA-C mediated currents in neurons, they quickly desensitized. Intracellular Ca2+ (Ca2+i)
recordings were also performed on GH3 cells. The application of either GABA or CACA led to
Ca2+-transients of similar amplitude indicating that the activation of GABA-C receptors in
GH3 cells may cause membrane depolarization, opening of voltage-gated Ca2+-channels and a
subsequent Ca2+-influx. Our results point at a role for GABA in pituitary GH cells and disclose
an additional pathway to the one known via GABA-B receptors.
2
by guest on February 19, 2018http://w
ww
.jbc.org/D
ownloaded from
INTRODUCTION
γ-Aminobutyric acid (GABA) is widely distributed in the central nervous system (CNS; (1)) 1.
There, generally, it inhibits neuronal firing and contributes to stabilization of the membrane resting
potential by acting on GABA-A, -B and -C receptors. The term ‘GABA-C’ receptor, which
refers to bicuculline- and baclofen-insensitive ionotropic GABA receptors formed by ρ
subunits, is controversial and GABA-C receptors may simply be a subset of GABA-A channels
(2). GABA-C receptors are located in certain areas of the CNS and in the retinae of various
species. They form chloride (Cl-) channels, assumed to organize in either homo- or heteromers
of the different ρ subunits (3). Outside of the CNS and retina, the expression of GABA-C
receptor subunits was reported based on RT-PCR analysis performed in rat peripheral tissues,
namely in gonadal endocrine tissues, adrenal gland, placenta, small intestine (4) and was also
found by immunohistochemistry in human neuroendocrine midgut tumor cells (5). In these cells,
GABA-C receptors were shown to be functional by studying Ca2+i levels and hormone release.
In addition, functional GABA-C receptors were also observed in pituitary thyrotropin-secreting
(TSH) cells using electrophysiological techniques (6). GABA, produced by growth hormone
(GH) secreting cells (7), acts as an autocrine regulator of GH levels via GABA-B receptors (8).
In the present study, we report that GH cells also express GABA-C receptor subunits, which
form functional receptors in a rat GH producing cell line, GH3.
3
by guest on February 19, 2018http://w
ww
.jbc.org/D
ownloaded from
MATERIAL AND METHODS
Animals
Pituitary glands and brains were obtained from Sprague-Dawley rats bred at the Technische
Universität München. They were painlessly killed under ether anesthesia, according to
institutional animal care guidelines. The tissues were removed and processed as previously
described (7;8).
Culture procedures of rat GH3 cells
The culture procedures applied for GH3 cells were described (8). Briefly, the cells were grown in
F12-DME (Sigma, Deisenhofen, Germany) medium supplemented with 10% fetal calf serum
(FCS; PAA Laboratories, Linz, Austria). Since GH3 cells produce GABA, the patch-clamp and
Ca2+ measurements required regular renewal of the medium. Positive recordings were obtained
only up to day 6 of culture, when the cells did not yet form a confluent monolayer.
Immunohistochemistry and laser microdissection of rat pituitary cells
Immunohistochemical methods were performed as previously described (8). For staining GH and
TSH cells the following antisera were used: monkey anti-GH (diluted 1:500; courtesy Dr.
Parlow, NHPP, Torrance, CA, USA) and rabbit anti-TSH (1:20,000; Chemicon International,
Temecula, CA, USA) respectively, and as secondary antibodies, biotin-labeled goat anti-human
and goat anti-rabbit (diluted 1:500; Dianova, Hamburg, Germany). The subsequent
microdissection of immunostained cells from rat pituitaries was performed using the PALM®
4
by guest on February 19, 2018http://w
ww
.jbc.org/D
ownloaded from
Robot-MicroBeam technology (P.A.L.M.GmbH, Bernried, Germany) and following methods
described (8-10).
RNA isolation and RT-PCR
RNA isolation and RT-PCRs from GH3 cells, laser dissected GH and TSH cells, or rat tissues,
were performed as reported (8). Oligonucleotide primers (Table 1) were chosen to encompass
exon-intron boundaries to detect possible genomic DNA contamination; for amplifying ρ2
cDNA from the laser dissected samples, nested primers were required. For all experiments, the
nature of the amplified cDNAs was confirmed by direct sequencing using one of the
oligonucleotide primers (AGOWA, Berlin, Germany).
Immunocytochemistry
GH3 cells were cultivated on glass coverslips (2x104 cells per coverslip) for 1 day. They were
then fixed and handled as previously described (11). For immunolocalization of GABA-C
receptors, a polyclonal antibody produced in rabbit was used (diluted 1:50; courtesy Dr. Enz,
Erlangen, Germany). This antiserum was raised against ρ1, but was shown to recognize ρ2, as
well (12). Immunoreactivity was visualized using a fluorescein isothiocyanate (FITC)-labeled
secondary goat antirabbit antiserum (diluted 1:200; Dianova, Hamburg, Germany). For control
purposes, either the specific antiserum was omitted or incubations with rabbit normal serum
(1:10,000; 1:20,000; 1:40,000) were carried out instead. Sections were examined with a Zeiss
Axiovert microscope (Zeiss, Jena, Germany), equipped with a FITC filter set.
5
by guest on February 19, 2018http://w
ww
.jbc.org/D
ownloaded from
Patch-clamp whole-cell recordings
Patch-clamp measurements were performed on GH3 cells grown on glass coverslips for 3-6
days. The cells were voltage-clamped at -80 mV and whole-cell currents were recorded
(sampling rate, 100 Hz; low-pass filter, 30 Hz) at room temperature (~22 °C) utilizing an EPC-9
amplifier (HEKA elektronik, Lambrecht, Germany). Borosilicate patch pipettes (DMZ-
Universal Puller; Zeitz, Augsburg, Germany) showed a tip resistance of 3-5 MΩ. The
‘extracellular’ bath solution contained 140 mM NaCl, 3 mM KCl, 1 mM CaCl2, 10 mM HEPES,
and 10 mM glucose (pH 7.4). The pipette solution contained 130 mM KCl, 5 mM NaCl, 1 mM
MgCl2, 1 mM CaCl2, 2 mM EGTA, and 10 mM HEPES (pH 7.4).
Calcium measurements
Ca2+ measurements were performed on GH3 cells, up to day 6 of culture and before reaching
confluency, as described (13). Briefly, the cells were loaded with Fura-2/AM (2,5 µM, dissolved
in DMSO) for 30 min at 37 °C in a standard external solution, consisting of 140 mM NaCl, 2.7
mM KCl, 1.5 mM CaCl2, 1 mM MgCl2, 6 mM glucose, and 12 mM HEPES (pH 7.3).
Fluorescence measurements were performed with the Zeiss Fast Fluorescence Photometry
System (MPM-FFP, Zeiss Oberkochen, Germany). The excitation wavelength was switched, at
400 Hz, between 340 and 380 nm using appropriate interference filters (bandwith 10 nm). The
emitted light (505 – 530 nm) was monitored after averaging with a final time resolution of 80
ms. Ca2+ levels are given in the figures as fluorescence ratios obtained from alternating
excitation at 340 and 380 nm.
6
by guest on February 19, 2018http://w
ww
.jbc.org/D
ownloaded from
Drug application
For both patch-clamp and Ca2+ measurements, a combination of global and local bath perfusion
was installed that generated a continuous fluid stream containing the agent, but confining it to a
small volume. Fast pressurized perfusion systems equipped with magnetic valves were used for
drug application as previously described (13;14). At each experiment, bath solution was applied
first to test for mechanical interference by the mere approaching flow of solutions. GABA,
CACA, bicuculline and baclofen (Tocris, Ballwin, MO, USA) were utilized at a concentration
100 µM as previously reported (6).
RESULTS
Expression of GABA-C receptors in rat pituitary GH cells and in GH3 cells
GABA-C receptors are present outside the CNS and retina, for example in the pituitary gland.
There, TSH cells were shown to possess functional GABA-C channels (6). Therefore, we used
TSH cells as a reference for our experiments. Rat pituitary sections were immunostained either
for GH or for TSH, and subsequently submitted to laser microdissection followed by RT-PCR
experiments (Fig.1). GH and TSH immunoreactive cells were harvested (Fig.1A), RNA was
extracted and nested RT-PCRs for ρ2 were performed (Fig.1B). Since additional tissue surround
the cells of interest after microdissection, control samples in which GH/TSH immunoreactive
cells were destroyed by laser shots before excision, were also analyzed. The ρ2 subunit was
detected in GH cells and, as expected, in TSH cells, but not in the controls.
7
by guest on February 19, 2018http://w
ww
.jbc.org/D
ownloaded from
GH3 cells are derived from a rat GH pituitary adenoma (15) and are widely used as a model for
the study of pituitary somatotrophs. We examined whether GH3 cells also possess GABA-C
receptors. RT-PCR experiments identified ρ1 and ρ2 subunit mRNAs in GH3 cells (Fig.2A).
GABA-C receptor protein at GH3 cells membranes was shown by immunocytochemistry
(Fig.2B). The antiserum, which recognizes both ρ1 and ρ2, showed a staining, which was
confined to the plasma membrane of the cells (Fig.2B, left panel). Omitting the antiserum
resulted in a weak homogeneous staining pattern (Fig.2B, right panel). Further controls were
performed by incubating the cells with rabbit normal serum (dilutions ranging from 1:10,000 to
1:40,000). These experiments led to an homogeneous non-specific staining within the cells (data
not shown) and argue for the specificity of the membrane-associated immunoreactivity obtained
using the anti-GABA-C receptor antiserum.
Electrophysiology of GABA-C receptors in GH3 cells
The whole-cell patch-clamp technique was applied to single GH3 cells in order to test the
functionality of the putative GABA-C receptors. Application of 100 µM GABA induced an
inward whole-cell current at a holding potential of -80 mV in about 70 % of the cells (n = 13;
Fig. 3A). The GABA-induced current was rapidly and almost completely desensitizing during
GABA application. GABA was also capable of eliciting the current in the presence of the
GABA-A antagonist bicuculline (n = 4; 100 µM; Fig. 3C), even when bicuculline was applied
about 1 min prior to GABA. There was no significant difference between the maximum
amplitudes (paired t-test) for 100 µM GABA (0.8±0.3 pA/pF; mean±SD) and for 100 µM
GABA + 100 µM bicuculline (0.9±0.8 pA/pF). The channel giving rise to the GABA-induced
8
by guest on February 19, 2018http://w
ww
.jbc.org/D
ownloaded from
Cl- current was identified as GABA-C receptor because of its activation by the specific GABA-C
receptor agonist cis-4-aminocrotonic acid (CACA, 100 µM) in all GABA-sensitive cells tested
(n = 6; Fig. 3B). The specific peak current activated by GABA or CACA was in the range of
0.5-5.0 pA/pF and thereby comparable to the GABA-C current observed in TSH cells (6).
Activation of the current by GABA or CACA was repeatable several times in the same cell after
washing with agonist-free bath solution for about 2 min (Fig. 3A, B). The peak amplitude did
not decrease in the course of the experiment in contrast to the rundown of the GABA-C receptor
currents reported in TSH cells (6).
The activation of GABA-C receptors provokes intracellular Ca2+ transients
We performed fluorimetric measurements of cytosolic Ca2+ concentrations in GH3 cells (Fig.4).
Both GABA and the GABA-C specific agonist CACA (100 µM, each) induced Ca2+-transients
of similar amplitude (n=9 cells). However, the use of baclofen (GABA-B receptors agonist) did
not lead to Ca2+-transients (data not shown). The Ca2+-transients recorded in GH3 cells using
either GABA or CACA are most probably due to Ca2+-influx through voltage-gated Ca2+
channels (16). Indeed, both KCl- and GABA-induced Ca2+-transients are almost completely
blocked by gadolinium (Gd3+, 500µM), a blocker of voltage-dependent Ca2+ channels
(preliminary studies, data not shown).
9
by guest on February 19, 2018http://w
ww
.jbc.org/D
ownloaded from
DISCUSSION
In this study, the expression of GABA-C receptors is reported in endocrine cells, namely in the
pituitary GH cells and in their corresponding cell line, GH3. These receptors are functional in
GH3 cells: the current induced by GABA or by the typical GABA-C agonist, CACA, is
characterized by its insensitivity to the GABA-A antagonist bicuculline and by its quick
desensitization. The opening of GABA-C channels may induce a membrane depolarization as
suggested by an increase in Ca2+i levels measured by fluorometry on GH3 cells.
In the pituitary gland, all types of GABA receptors are expressed (7;8;17) and GABA, produced
either by the hypothalamus or by the pituitary itself (7;18;19), is known to be involved in the
regulation of hormone levels (8;20;21). Interestingly GABA-C receptors were previously
demonstrated in pituitary TSH cells (6). Therefore, these cells served as positive controls in our
study. We detected the ρ2 subunit in GH and, as expected, in TSH cells. Boue-Grabot and
coworkers showed that TSH cells possess functional GABA-C channels, reported the absence of
ρ1 in follicle-stimulating hormone (FSH), adrenocorticotropin (ACTH) and prolactin (PRL)
cells, but did not investigate GH cells (6). By identifying ρ2 in TSH and GH cells, we confirm
and extend their results.
We verified by RT-PCR and immunocytochemistry that GH3 cells also express GABA-C
receptors. Then, performing patch-clamp recordings on single GH3 cells, we could prove
functional GABA-C receptors. The application of either GABA or CACA (100 µM, each)
10
by guest on February 19, 2018http://w
ww
.jbc.org/D
ownloaded from
induced a Cl- current insensitive to bicuculline, exhibiting an untypical fast desensitization, but
lacking rundown. Similar inactivating GABA-C currents were observed in rat TSH cells (6) but
also in bipolar cells of the carp retina (22). Usually, GABA-C receptor activation is regarded to
entail sustained Cl- currents (23-25) in contrast to the typically desensitizing GABA-A receptor
(26-28). Most likely, either variations in the subunit composition (29), species-dependent
protein sequence differences, or/and tissue specific splicing variants (6) account for these
different properties. In addition, we previously reported the presence of the GABA-A receptor
subunit γ2 in rat GH cells (7). The possibility that hetero-oligomerization might occur among ρ
and GABA-A subunits is under debate (30;31) and may also explain various electrogenic
profiles.
In this report, we show that pituitary GH cells express GABA-C receptors, and that they are
functional in a corresponding tumor cell line, GH3. What could be the physiological role of
GABA-C receptors in GH secreting cells? A gut neuroendocrine tumor cell line STC-1 was also
shown to possess functional GABA-C receptors (5;6). In STC-1 cells, GABA increases Ca2+i
levels by acting on GABA-C receptors. It is also known that the activation of GABA-B receptors
influences Ca2+i concentrations in neurons (32). Since GH3 cells bear functional GABA-B
receptors as well (8), one can suppose that GABA may control Ca2+i levels via both
metabotropic and ionotropic mechanisms. To test this hypothesis, we performed fluorimetric
measurements of cytosolic Ca2+ concentrations in GH3 cells. We showed that both GABA and
11
by guest on February 19, 2018http://w
ww
.jbc.org/D
ownloaded from
CACA (100 µM, each) induced Ca2+-transients of similar amplitude. However, preliminary
experiments using baclofen (a GABA-B receptor agonist) did not result in Ca2+-transients.
These observations argue for a control of Ca2+i levels by GABA via ionotropic routes.
A possible mechanistic explanation for the Ca2+-transients can be deduced from results
obtained in developing neurons. There, GABA acts as a trophic substance. Via GABA-A
channels, GABA can depolarize the cell membrane, when the Cl- reversal potential is positive to
the resting membrane potential (33-35). Thus, it can provoke Ca2+-transients via the activation
of voltage-operated Ca2+ channels (5;36). The Ca2+-transients recorded in GH3 cells, using
either GABA or CACA, are most probably due to Ca2+-influx through voltage-gated Ca2+
channels (16). Indeed, preliminary results showed that both KCl- and GABA-induced Ca2+-
transients are almost completely blocked by Gd3+ (500µM), a blocker of voltage-dependent
Ca2+ channels. We propose that GABA action on GABA-C receptors leads to membrane
depolarization and Ca2+-influx in GH3 cells, suggesting an excitatory function of GABA in
endocrine cells.
In summary, the presence of multiple GABA receptor subtypes in GH cells, with different
properties and GABA sensitivities, suggests that GABA may have several functions in these
cells (e.g., regulation of chloride conductance, membrane potential, control of Ca2+i
12
by guest on February 19, 2018http://w
ww
.jbc.org/D
ownloaded from
concentrations, modulation of hormone secretion). Our present results are in accordance with
recent reports indicating new roles of neurotransmitters, including GABA, in various
nonneuronal tissues. This is best illustrated in the pancreas, where the neurotransmitter glutamate
is secreted by α-cells and triggers the Ca2+-dependent exocytosis of GABA from β-cells. Once
secreted, GABA in turn binds to GABA-A receptors on α-cells, where it acts as a paracrine
inhibitor for glucagon secretion (37). Thus, signalling molecules originally thought to be
restricted to the central nervous system appear to be produced and active in important endocrine
systems, namely the anterior pituitary and the pancreas.
ACKNOWLEDGEMENTS
We thank all our colleagues, in particular Barbara Zschiesche, Andreas Mauermayer and Marlies
Rauchfuss. We are grateful to Dr. Ralf Enz for his generous gift of anti-GABA-C antiserum and
to Prof. Enrico Cherubini and Dr. Frédéric Didelon for their expert advice. Access to the
PALM® Robot-MicroBeam device for the experiments of lasermicrodissection was made
possible by Dr. Viktor Meineke, Munich. This work was supported by a grant from Eli Lilly
International Foundation.
13
by guest on February 19, 2018http://w
ww
.jbc.org/D
ownloaded from
Reference List
1. Sivilotti, L. and Nistri, A. (1991) Prog. Neurobiol. 36, 35-92
2. Barnard, E. A., Skolnick, P., Olsen, R. W., Mohler, H., Sieghart, W., Biggio, G., Braestrup,
C., Bateson, A. N., and Langer, S. Z. (1998) Pharmacol. Rev. 50, 291-313
3. Enz, R. (2001) Biol. Chem. 382, 1111-1122
4. Akinci, M. K. and Schofield, P. R. (1999) Neurosci. Res. 35, 145-153
5. Jansen, A., Hoepfner, M., Herzig, K. H., Riecken, E. O., and Scherubl, H. (2000) Pflügers
Arch. 441, 294-300
6. Boue-Grabot, E., Taupignon, A., Tramu, G., and Garret, M. (2000) Endocrinology 141,
1627-1632
7. Mayerhofer, A., Hohne-Zell, B., Gamel-Didelon, K., Jung, H., Redecker, P., Grube, D.,
Urbanski, H. F., Gasnier, B., Fritschy, J. M., and Gratzl, M. (2001) FASEB J. 15, 1089-
1091
8. Gamel-Didelon, K., Corsi, C., Pepeu, G., Jung, H., Gratzl, M., and Mayerhofer, A. (2002)
Neuroendocrinology 76, 170-177
9. Frungieri, M. B., Calandra, R. S., Lustig, L., Meineke, V., Kohn, F. M., Vogt, H. J., and
Mayerhofer, A. (2002) Fertil. Steril. 78, 298-306
14
by guest on February 19, 2018http://w
ww
.jbc.org/D
ownloaded from
10. Schutze, K., Posl, H., and Lahr, G. (1998) Cell Mol. Biol. (Noisy-le-grand) 44, 735-746
11. Mayerhofer, A., Danilchik, M., Pau, K. Y., Lara, H. E., Russell, L. D., and Ojeda, S. R.
(1996) Biol. Reprod. 55, 509-518
12. Enz, R., Brandstatter, J. H., Wassle, H., and Bormann, J. (1996) J. Neurosci. 16, 4479-
4490
13. Fohr, K. J., Mayerhofer, A., Sterzik, K., Rudolf, M., Rosenbusch, B., and Gratzl, M.
(1993) J. Clin. Endocrinol. Metab 76, 367-373
14. Fritz, S., Kunz, L., Dimitrijevic, N., Grunert, R., Heiss, C., and Mayerhofer, A. (2002) J.
Clin. Endocrinol. Metab 87, 1362-1367
15. Tashjian, A. H., Jr., Bancroft, F. C., and Levine, L. (1970) J. Cell Biol. 47, 61-70
16. Safa, P., Boulter, J., and Hales, T. G. (2001) J. Biol Chem. 276, 38727-38737
17. Boue-Grabot, E., Dufy, B., and Garret, M. (1995) Brain Res. 704, 125-129
18. Schimchowitsch, S., Vuillez, P., Tappaz, M. L., Klein, M. J., and Stoeckel, M. E. (1991)
Exp. Brain Res. 83, 575-586
19. Vincent, S. R., Hokfelt, T., and Wu, J. Y. (1982) Neuroendocrinology 34, 117-125
20. Anderson, R. A. and Mitchell, R. (1986) J. Endocrinol. 108, 1-8
21. Lux-Lantos, V., Becu-Villalobos, D., Bianchi, M., Rey-Roldan, E., Chamson-Reig, A.,
15
by guest on February 19, 2018http://w
ww
.jbc.org/D
ownloaded from
Pignataro, O., and Libertun, C. (2001) Neuroendocrinology 73, 334-343
22. Han, M. H., Li, Y., and Yang, X. L. (1997) Neuroreport 8, 1331-1335
23. Enz, R. and Cutting, G. R. (1999) Eur. J. Neurosci. 11, 41-50
24. Polenzani, L., Woodward, R. M., and Miledi, R. (1991) Proc. Natl. Acad. Sci. U.S.A. 88,
4318-4322
25. Qian, H., Dowling, J. E., and Ripps, H. (1998) J. Neurobiol. 37, 305-320
26. Levitan, E. S., Blair, L. A., Dionne, V. E., and Barnard, E. A. (1988) Neuron 1, 773-781
27. Shields, C. R., Tran, M. N., Wong, R. O., and Lukasiewicz, P. D. (2000) J. Neurosci. 20,
2673-2682
28. Macdonald, R. L. and Olsen, R. W. (1994) Annu. Rev. Neurosci. 17, 569-602
29. Qian, H., Dowling, J. E., and Ripps, H. (1999) J. Neurobiol. 40, 67-76
30. Hackam, A. S., Wang, T. L., Guggino, W. B., and Cutting, G. R. (1998) J. Neurochem.
70, 40-46
31. Pan, Z. H., Zhang, D., Zhang, X., and Lipton, S. A. (2000) Eur. J. Neurosci. 12, 3137-
3145
32. Couve, A., Moss, S. J., and Pangalos, M. N. (2000) Mol. Cell Neurosci. 16, 296-312
33. Ben Ari, Y. (2002) Nat. Rev. Neurosci. 3, 728-739
16
by guest on February 19, 2018http://w
ww
.jbc.org/D
ownloaded from
34. Cherubini, E., Martina, M., Sciancalepore, M., and Strata, F. (1998) Perspect. Dev.
Neurobiol. 5, 289-304
35. Jentsch, T. J., Stein, V., Weinreich, F., and Zdebik, A. A. (2002) Physiol. Rev. 82, 503-
568
36. Kullmann, P. H., Ene, F. A., and Kandler, K. (2002) Eur. J. Neurosci. 15, 1093-1104
37. Hayashi, M., Yamada, H., Uehara, S., Morimoto, R., Muroyama, A., Yatsushiro, S.,
Takeda, J., Yamamoto, A., and Moriyama, Y. (2003) J. Biol. Chem. 278, 1966-1974
1 The abbreviations used in the text are: ACTH, adrenocorticotropin; Bic, bicuculline; Ca2+,
calcium; Ca2+i, intracellular calcium; CACA, cis-4-aminocrotonic acid; Cl-, chloride; CNS,
central nervous system; FSH, follicle-stimulating hormone; GABA, γ-aminobutyric acid; Gd3+,
gadolinium; GH, growth hormone; PRL, prolactin; TSH, thyrotropin-secreting.
17
by guest on February 19, 2018http://w
ww
.jbc.org/D
ownloaded from
Figure legends
Fig. 1: Pituitary GH cells express the GABA-C subunit ρ2.
(A) Section of a rat pituitary used for laser microdissection of either GH or TSH-secreting cells
identified beforehand by immunohistochemistry. Groups of positive cells (here immunostained
TSH cells; corresponding to TSH+ in panel B) were isolated from the surrounding tissue by a
laser beam (1a) and subsequently catapulted (1b) into the cap of a microfuge tube. Each sample
contained the equivalent of 30 to 50 immunoreactive cells. As a control, immunostained cells
were destroyed (corresponding to TSH- in panel B; 2, arrows) by the laser before catapulting.
Scale bar equivalent to 40 µm. (B) RNA extracted from the laser-dissected cells was
subsequently submitted to nested RT-PCR amplifications. GABA-C receptor ρ2 was detected in
GH (lane GH+) and in TSH (lane TSH+) cells but not in their respective negative controls (lanes
GH-, TSH-). Sequencing confirmed ρ2 identity.
Fig. 2: GABA-C receptors in GH3 cells.
(A) RNA samples extracted from GH3 cells, rat whole pituitary (Pit.) and brain were reverse
transcribed and used for PCR using specific primers for GABA-C ρ1- and ρ2- subunits. Brain
samples served as positive controls; PCRs performed without template were negative (Co.).
Sequencing of the PCR products confirmed their identity. (B) The use of an antiserum
recognising both ρ1- and ρ2- subunits, localized GABA-C receptors at GH3 cell membranes as
seen by immunofluorescence microscopy. Immunoreactivity was detected in most cells; the
arrow points to membrane-associated staining (left panel). In the control shown, the primary
18
by guest on February 19, 2018http://w
ww
.jbc.org/D
ownloaded from
antiserum was omitted (right panel). Scale bar equivalent to 10 µm.
Fig. 3: Induction of GABA-C whole-cell Cl- currents in GH3 cells.
(A) Application of 100 µM GABA induced a quickly desensitizing inward current. (B) In the
same cell, 100 µM CACA elicited a current of similar amplitude and kinetics. (C) GABA
induced the current also in presence of the specific GABA-A antagonist bicuculline (Bic; 100
µM). The cells were clamped at -80 mV under symmetrical Cl- concentrations (ECl ≈ 0). The
horizontal bar and thereby the duration of drug application represents a time period of 10 s.
Fig. 4: Intracellular Ca2+-transients of GH3 cells in response to CACA and GABA.
Single GH3 cells (n=9) were subjected to the consecutive application of CACA and GABA (100
µM each) for 5 seconds. Both drugs induced a rapid increase of intracellular free Ca2+. Upon
drug removal Ca2+ levels returned to basal values. Note, the GABA-application is preceeded by
a spontaneous Ca2+ signal, commonly observed in GH3 cells. Changes in intracellular free Ca2+
concentrations are given as the recorded 340/380 nm ratios.
Table 1: Primer sequences used for PCR amplification of ρ1 and ρ2 GABA-C receptor subunits.
19
by guest on February 19, 2018http://w
ww
.jbc.org/D
ownloaded from
Table 1
NAMES SEQUENCES POSITION
ACCESSION
NUMBERS
ρ1 forward 5 GAAGATCTCCTGCACCTGTGG 3 1257-1277 NM_017291
ρ1 backward 5 GGTGTTGATCCTCATGCTCAC 3 1470-1450
ρ2 forward 5 GGATGGAAGCTACAGTGAATC 3 1299-1319 NM_017292
ρ2 backward 5 ATCCCTAGGAAAACACTGACC 3 1570-1550
Nested-ρ2 forward 5 TGGCTGGCTACCCAAGAAGC 3 1334-1353
Nested-ρ2
backward
5 GGCAGGAAATATCAACCTGG 3 1521-1502
20
by guest on February 19, 2018http://w
ww
.jbc.org/D
ownloaded from
Katia Gamel-Didelon, Lars Kunz, Karl J Föhr, Manfred Gratzl and Artur Mayerhoferhormone secreting cells
Molecular and physiological evidence for functional GABA-C receptors in growth
published online March 26, 2003J. Biol. Chem.
10.1074/jbc.M301729200Access the most updated version of this article at doi:
Alerts:
When a correction for this article is posted•
When this article is cited•
to choose from all of JBC's e-mail alertsClick here
by guest on February 19, 2018http://w
ww
.jbc.org/D
ownloaded from