+ All Categories
Home > Documents > Molecular Biology Techniques - WordPress.com · o C numberof A T in primer m 4 u & 2 u & ... Colin...

Molecular Biology Techniques - WordPress.com · o C numberof A T in primer m 4 u & 2 u & ... Colin...

Date post: 17-Aug-2020
Category:
Upload: others
View: 1 times
Download: 0 times
Share this document with a friend
39
Molecular Biology Techniques
Transcript
Page 1: Molecular Biology Techniques - WordPress.com · o C numberof A T in primer m 4 u & 2 u & ... Colin Pitchfork was the first criminal caught based on DNA fingerprinting evidence. He

Molecular Biology Techniques

Page 2: Molecular Biology Techniques - WordPress.com · o C numberof A T in primer m 4 u & 2 u & ... Colin Pitchfork was the first criminal caught based on DNA fingerprinting evidence. He

Outline

Restriction-enzyme analysis

The polymerase chain reaction (PCR)

DNA Fingerprinting

DNA sequencing

Blotting techniques

Recombinant DNA

Page 3: Molecular Biology Techniques - WordPress.com · o C numberof A T in primer m 4 u & 2 u & ... Colin Pitchfork was the first criminal caught based on DNA fingerprinting evidence. He

Restriction Enzyme Analysis

aka restriction endonucleases

Recognizes specific base sequences and

cleaves

PALINDROMES

Two-fold rotational symmetry

Page 4: Molecular Biology Techniques - WordPress.com · o C numberof A T in primer m 4 u & 2 u & ... Colin Pitchfork was the first criminal caught based on DNA fingerprinting evidence. He

Restriction Enzyme

Separation by gel

electrophoresis

Agarose (>20 kb)

PAGE (1 kb)

Visualization

Autoradiography

Ethidium bromide use to map the structure of a

DNA fragment

Page 5: Molecular Biology Techniques - WordPress.com · o C numberof A T in primer m 4 u & 2 u & ... Colin Pitchfork was the first criminal caught based on DNA fingerprinting evidence. He

Electrophoresis

Page 6: Molecular Biology Techniques - WordPress.com · o C numberof A T in primer m 4 u & 2 u & ... Colin Pitchfork was the first criminal caught based on DNA fingerprinting evidence. He

Electrophoresis

Page 7: Molecular Biology Techniques - WordPress.com · o C numberof A T in primer m 4 u & 2 u & ... Colin Pitchfork was the first criminal caught based on DNA fingerprinting evidence. He

Electrophoresis

Stained gel result

Visualization may be achieved through UV dyes or radioactive agents

Page 8: Molecular Biology Techniques - WordPress.com · o C numberof A T in primer m 4 u & 2 u & ... Colin Pitchfork was the first criminal caught based on DNA fingerprinting evidence. He

Polymerase Chain Reaction

A rapid and versatile in vitro method to amplify

defined target DNA within a heterogeneous

collection of DNA sequences (genomic DNA or

cDNA)

Page 9: Molecular Biology Techniques - WordPress.com · o C numberof A T in primer m 4 u & 2 u & ... Colin Pitchfork was the first criminal caught based on DNA fingerprinting evidence. He

PCR Requirements

Template (genomic DNA or cDNA population)

Oligonucleotide primers

DNA polymerase (Taq polymerase)

dNTP

Thermal cycler

Page 10: Molecular Biology Techniques - WordPress.com · o C numberof A T in primer m 4 u & 2 u & ... Colin Pitchfork was the first criminal caught based on DNA fingerprinting evidence. He

Cycles (25 – 30)

Denaturation

95o C

Separate strands

Annealing

50 – 70 oC (~5o C lower than Tm)

DNA Synthesis

70 – 75 oC (ideal temp for Taq polymerase)

thermus aquaticus (Taq)

Page 11: Molecular Biology Techniques - WordPress.com · o C numberof A T in primer m 4 u & 2 u & ... Colin Pitchfork was the first criminal caught based on DNA fingerprinting evidence. He

Calculating the Tm

primerinTAofnumberCprimerinCGofnumberCT oo

m &2&4

5’ – ATTGCAAGTTCGGTAACCGG – 3’

Page 12: Molecular Biology Techniques - WordPress.com · o C numberof A T in primer m 4 u & 2 u & ... Colin Pitchfork was the first criminal caught based on DNA fingerprinting evidence. He
Page 13: Molecular Biology Techniques - WordPress.com · o C numberof A T in primer m 4 u & 2 u & ... Colin Pitchfork was the first criminal caught based on DNA fingerprinting evidence. He

Utility of PCR in Medical Diagnostics

Detection of bacteria and viruses by specific

primers

HIV virus in people who have not mounted an immune response

Mycobacterium tuberculosis bacilli

Detection of certain cancer cells

ras genes and leukemias caused by chromosomal rearrangement

Monitoring cancer chemotherapy

Page 14: Molecular Biology Techniques - WordPress.com · o C numberof A T in primer m 4 u & 2 u & ... Colin Pitchfork was the first criminal caught based on DNA fingerprinting evidence. He

Utility of PCR in Forensics

DNA fingerprinting

Restriction fragment length polymorphisms

PCR-Based analysis

Can be used to determine biological parentage

Can be used to settle assault and rape cases

Page 15: Molecular Biology Techniques - WordPress.com · o C numberof A T in primer m 4 u & 2 u & ... Colin Pitchfork was the first criminal caught based on DNA fingerprinting evidence. He

Steps:

1. Get DNA sample

2. Amplify with PCR

3. Cut with restriction enzyme

4. Run resulting fragments on gel electrophoresis

5. Analyze result

A sample with the

shorter DNA

fragments travels

through the gel faster

than a sample with

the larger fragments

Page 16: Molecular Biology Techniques - WordPress.com · o C numberof A T in primer m 4 u & 2 u & ... Colin Pitchfork was the first criminal caught based on DNA fingerprinting evidence. He

DNA fingerprinting

DNA analysis can be used for catching criminals, establishing parentage, finding how closely organisms are related and many other applications.

The pattern of bands in a gel electrophoresis is known as a genetic fingerprint or a ‘genetic profile’

If a genetic fingerprint found in a sample of blood or other tissue at the scene of a crime matches the genetic fingerprint of a suspect, this can be used as evidence

A DNA sample can be obtained from the suspect using blood, cheek epithelial cells taken from the mouth lining or even the cells clinging to the root of a hair

Page 17: Molecular Biology Techniques - WordPress.com · o C numberof A T in primer m 4 u & 2 u & ... Colin Pitchfork was the first criminal caught based on DNA fingerprinting evidence. He

V S S1 S2 S3

V Victim

S Sample from crime scene

S1 Suspect 1

S2 Suspect 2

S3 Suspect 3

More than 20 fragments from Suspect 1 match those taken from the crime scene

DNA profiles

Page 18: Molecular Biology Techniques - WordPress.com · o C numberof A T in primer m 4 u & 2 u & ... Colin Pitchfork was the first criminal caught based on DNA fingerprinting evidence. He

Starting position of sample

1 2 3 4

Genetic fingerprint of …

1 mother

2 child

3 possible father A

4 possible father B

There is a match between one of the child’s restriction fragments and one of the mother’s. There is also a match between the child’s other fragment and one from possible father A.

Neither of the child’s restriction fragments match those of possible father B

Page 19: Molecular Biology Techniques - WordPress.com · o C numberof A T in primer m 4 u & 2 u & ... Colin Pitchfork was the first criminal caught based on DNA fingerprinting evidence. He

Famous cases

In 2002 Elizabeth

Hurley used DNA

profiling to prove

that Steve Bing was

the father

of her child Damien

Page 20: Molecular Biology Techniques - WordPress.com · o C numberof A T in primer m 4 u & 2 u & ... Colin Pitchfork was the first criminal caught based on DNA fingerprinting evidence. He

Famous Cases

Colin Pitchfork was

the first criminal

caught based on

DNA fingerprinting

evidence.

He was arrested in

1986 for the rape

and murder of two

girls and was

sentenced in 1988.

Page 21: Molecular Biology Techniques - WordPress.com · o C numberof A T in primer m 4 u & 2 u & ... Colin Pitchfork was the first criminal caught based on DNA fingerprinting evidence. He

Famous Cases

O.J. Simpson was cleared of a double murder charge in 1994 which relied heavily on DNA evidence.

This case highlighted lab difficulties.

Page 22: Molecular Biology Techniques - WordPress.com · o C numberof A T in primer m 4 u & 2 u & ... Colin Pitchfork was the first criminal caught based on DNA fingerprinting evidence. He

Sequencing by Sanger Dideoxy Method

Controlled

termination of

replication

Uses 2’,3’ dideoxy analog of nucleotide

Page 23: Molecular Biology Techniques - WordPress.com · o C numberof A T in primer m 4 u & 2 u & ... Colin Pitchfork was the first criminal caught based on DNA fingerprinting evidence. He

Sequencing by Sanger Dideoxy Method

Page 24: Molecular Biology Techniques - WordPress.com · o C numberof A T in primer m 4 u & 2 u & ... Colin Pitchfork was the first criminal caught based on DNA fingerprinting evidence. He

Fluorescence Detection

Page 25: Molecular Biology Techniques - WordPress.com · o C numberof A T in primer m 4 u & 2 u & ... Colin Pitchfork was the first criminal caught based on DNA fingerprinting evidence. He

Automated DNA Sequencing

Page 26: Molecular Biology Techniques - WordPress.com · o C numberof A T in primer m 4 u & 2 u & ... Colin Pitchfork was the first criminal caught based on DNA fingerprinting evidence. He

Southern blotting

Identification of restriction fragment

Page 27: Molecular Biology Techniques - WordPress.com · o C numberof A T in primer m 4 u & 2 u & ... Colin Pitchfork was the first criminal caught based on DNA fingerprinting evidence. He

Southern blotting

Identification of restriction fragment

Page 28: Molecular Biology Techniques - WordPress.com · o C numberof A T in primer m 4 u & 2 u & ... Colin Pitchfork was the first criminal caught based on DNA fingerprinting evidence. He

Recombinant DNA Technology

Constructing new combinations of unrelated

genes (ex. protein expression)

New combinations can be cloned by suitable

hosts

Covalent insertion of a DNA fragment from one

type of cell or organism into the replicating DNA

of another type of cell

Takes advantage of restriction enzymes and

DNA ligases

DNA ligase – catalyzes the formation of phosphodiester bond at a break in a DNA chain.

Page 29: Molecular Biology Techniques - WordPress.com · o C numberof A T in primer m 4 u & 2 u & ... Colin Pitchfork was the first criminal caught based on DNA fingerprinting evidence. He

BASIC STEPS:

1. Selection of carrier

(ex. plasmid)

2. Cleaving the DNA

strand of the carrier

3. Insert DNA of

interest into the

carrier (creating

recombinant or

hybrid DNA)

4. Introduce hybrid

DNA to host cell

(transformation)

5. Screening of host

cells

Page 30: Molecular Biology Techniques - WordPress.com · o C numberof A T in primer m 4 u & 2 u & ... Colin Pitchfork was the first criminal caught based on DNA fingerprinting evidence. He

Vectors = carriers of DNA fragments

Plasmids

Naturally occurring circular, double-stranded DNA that act as accessory chromosomes in bacteria; DNA fragments (15, 000 bp)

λ phage

Bacteriophage (virus) DNA; for larger

DNA fragments (23, 000 bp)

Yeast and bacterial artificial chromosome

Laboratory-designed carriers for larger

DNA fragments

Page 31: Molecular Biology Techniques - WordPress.com · o C numberof A T in primer m 4 u & 2 u & ... Colin Pitchfork was the first criminal caught based on DNA fingerprinting evidence. He

Parts of bacterial plasmid

Page 32: Molecular Biology Techniques - WordPress.com · o C numberof A T in primer m 4 u & 2 u & ... Colin Pitchfork was the first criminal caught based on DNA fingerprinting evidence. He

pBR322 Plasmid

Insertion can occur

in 3 restriction sites

Antibiotic resistance

Necessary for selection

Page 33: Molecular Biology Techniques - WordPress.com · o C numberof A T in primer m 4 u & 2 u & ... Colin Pitchfork was the first criminal caught based on DNA fingerprinting evidence. He

DNA fragment Vector

Page 35: Molecular Biology Techniques - WordPress.com · o C numberof A T in primer m 4 u & 2 u & ... Colin Pitchfork was the first criminal caught based on DNA fingerprinting evidence. He

How to construct

a recombinant

DNA:

Page 36: Molecular Biology Techniques - WordPress.com · o C numberof A T in primer m 4 u & 2 u & ... Colin Pitchfork was the first criminal caught based on DNA fingerprinting evidence. He

Screening for

successful

transformation

Page 37: Molecular Biology Techniques - WordPress.com · o C numberof A T in primer m 4 u & 2 u & ... Colin Pitchfork was the first criminal caught based on DNA fingerprinting evidence. He
Page 38: Molecular Biology Techniques - WordPress.com · o C numberof A T in primer m 4 u & 2 u & ... Colin Pitchfork was the first criminal caught based on DNA fingerprinting evidence. He

Screening for successful transformation

Page 39: Molecular Biology Techniques - WordPress.com · o C numberof A T in primer m 4 u & 2 u & ... Colin Pitchfork was the first criminal caught based on DNA fingerprinting evidence. He

Reference:

Garrett, R. and C. Grisham. Biochemistry. 3rd edition.

2005.

Berg, JM, Tymoczko, JL and L. Stryer. Biochemistry. 5th

edition. 2002.


Recommended