Molecular Cell, Vol. 2, 639–651, November, 1998, Copyright 1998 by Cell Press

Two Actin-Related Proteins Are Shared FunctionalComponents of the Chromatin-RemodelingComplexes RSC and SWI/SNF

similarity to counterparts in related complexes. The SWI/SNF group now includes two yeast complexes (SWI/SNF itself and the related RSC complex [Cairns et al.,1996c]), two human complexes (hSWI/SNFa and hSWI/SNFb [Kwon et al., 1994; Wang et al., 1996a, 1996b]),

Bradley R. Cairns,*‡§‖ Hediye Erdjument-Bromage,†Paul Tempst,† Fred Winston,‡and Roger D. Kornberg**Department of Structural BiologyStanford University School of MedicineStanford, California 94305 and the BRM complex from Drosophila (Tamkun et al.,

1992; Papoulas et al., 1998). A wealth of genetic evi-†Molecular Biology ProgramMemorial Sloan-Kettering Cancer Center dence supports roles for SWI/SNF-related complexes

in the control of transcription through nucleosome re-New York, New York 10021‡Department of Genetics modeling (reviewed in Winston and Carlson, 1992), but

many questions remain regarding their composition,Harvard Medical SchoolBoston, Massachusetts 02115 roles in vivo, and mechanism of action. A separate set

of complexes, all containing the ATPase ISWI (Elfring et§Huntsman Cancer Institute andDepartment of Oncological Sciences al., 1994) and 2–3 additional polypeptides, have been

purified from Drosophila extracts and have been termedUniversity of Utah School of MedicineSalt Lake City, Utah 84108 NURF (Tsukiyama and Wu, 1995), CHRAC (Varga-Weisz

et al., 1997), and ACF (Ito et al., 1997). These complexesall display nucleosome remodeling activities in vitro,and their precise roles in transciption and/or chromatinSummaryassembly are the subject of current studies.

Computer searches for actin-related proteins revealThe yeast Saccharomyces cerevisiae contains two re-a family of ten proteins in yeast (Arp1–Arp10), as welllated chromatin-remodeling complexes, RSC and SWI/as several related proteins in Drosophila and mammalianSNF, which are shown to share the actin-related pro-cells (Poch and Winsor, 1997). Although some of theseteins Arp7 and Arp9. Depending on the genetic back-actin-related proteins have demonstrated roles in cyto-ground tested, arp7D and arp9D mutants are eitherkinesis or chromosome dynamics, several remain un-inviable or show greatly impaired growth and Swi2/characterized. Here, we show that RSC and SWI/SNFSnf2 mutant phenotypes. Unlike swi/snf mutants, via-share the two actin-related proteins Arp7 and Arp9. Ge-ble arp7D or arp9D mutants have an Spt2 phenotype,netic studies in yeast have recently linked the essentialsuggesting that RSC affects transcription. Tempera-actin-related protein Act3 (Arp4) to transcriptional regu-ture-sensitive mutations in ARP7 and ARP9 were iso-lation and chromatin structure (Harata et al., 1994; Jianglated, and the amino acid changes support the struc-and Stillman, 1996). Together, these results suggest thattural relationship of Arp7 and Arp9 to actin. However,actin-related proteins may regulate transcription andsite-directed mutations predicted to impair ATP bind-perturb chromatin as functional members of chromatin-ing or hydrolysis did not detectably affect Arp7 or Arp9remodeling complexes.function. Our results suggest that actin-related pro-

teins perform important roles in chromatin-remodel-ing complexes by virtue of structural rather than enzy- Resultsmatic similarities to actin.

RSC and SWI/SNF Both Contain the Actin-RelatedIntroduction Proteins Arp7 and Arp9

We previously purified RSC and SWI/SNF to homogene-One important class of chromatin-remodeling factors ity from yeast extracts (Figure 1A; Cairns et al., 1994,utilizes ATP hydrolysis to perturb chromatin structure. 1996c). Of the twelve members of SWI/SNF complex,This class can be divided into two groups based on nine have been identified (Estruch and Carlson, 1990;common properties such as polypeptide composition Laurent et al., 1990, 1992; Peterson and Herskowitz,and activities in vitro (reviewed in Kingston et al., 1996; 1992; Treich et al., 1995; Cairns et al., 1996a, 1996b).Cairns, 1998). One such group is termed “SWI/SNF- To determine the identity of two additional SWI/SNFrelated” as the prototype complex (yeast SWI/SNF) was members, the 59 kDa and 61 kDa subunits (previouslycharacterized as a complex of Swi, Snf, and Swp pro- designated Swp59 and Swp61) were isolated and treatedteins (Neigeborn and Carlson, 1984; Stern et al., 1984; with trypsin. Sequencing of two peptides derived fromLaurent et al., 1990, 1991; Peterson and Herskowitz, Swp59 yielded TTLVQFGLNEETFTVPEL and PAALWDV1992; Cairns et al., 1994, 1996b; Peterson et al., 1994). QF, which matched amino acids 18–35 and 459–467,SWI/SNF-related complexes are large (10–15 proteins), respectively, of the open reading frame YMR033w. Se-capable of ATP-dependent remodeling of nucleosomes quencing of two peptides from Swp61 yielded FGGDFLDin vitro (Cote et al., 1994; Imbalzano et al., 1994), and FQVHER and STDVWYEASTWIQQFK, which matchedcontain several subunits with a high degree of sequence amino acids 184–196 and 217–232, respectively, of

YPR034w.Of the sixteen components of RSC, only four have‖ To whom correspondence should be addressed (e-mail: bcairns@

hci.utah.edu). been identified (Laurent et al., 1992; Tsuchiya et al.,

Molecular Cell640

Figure 1. SWI/SNF and RSC Complexes Contain Two Proteins Similar to Actin

(A) Purified SWI/SNF and RSC. For SWI/SNF, the immune eluate from an anti-Snf6 immuno-affinity column (described in Cairns et al., 1994)is shown stained with silver. For RSC, Fraction #36 from from Mono S (described in Cairns et al., 1996c) is shown stained with Coomassie.(B) Actin is divided into four structural domains. The locations of ATP and the divalent ion (large bullet) are indicated. Adapted from Kabschet al. (1990) with permission.(C) Alignments of actin (S. cerevisiae Act1) with Arp7, Arp9, and human Baf53 reveal similarity of the yeast Arp proteins to actin in domains1 and 3, but not 2 or 4. At left is a diagram showing the order of the domains shown in (B) as the actin main chain is traced through thealignments. The locations of the mutations conferring temperature sensitivity (isolated by random mutagenesis) are shown as bullets (·), andthe locations chosen for site-directed replacements with asterisks (*). Positions showing amino acid similarity are shaded

1992; Cairns et al., 1996c; Cao et al., 1997; Treich and peptides from Rsc12 uniquely identified YMR033w; afinding confirmed by Edman sequencing of the peptideCarlson, 1997). To identify two additional components

of RSC, peptides from Rsc11 and Rsc12 were isolated SQTTLVQFGLNEETFTVPELEI, which corresponds to resi-dues 16–37. Mass fingerprinting with ten peptides fromand analyzed by MALDI-TOF mass spectrometry and

limited Edman sequencing. Mass fingerprinting with ten Rsc11 uniquely identified YPR034w; a finding confirmed

Actin-Related Proteins and Chromatin Remodeling641

by Edman sequencing of the peptide NFLFKPLNK,which corresponds to residues 289–297. Thus, RSC andSWI/SNF both contain Rsc11/Swp61 and Rsc12/Swp59.Sequencing of other RSC and SWI/SNF members hasnot revealed additional shared components (data notshown). In addition, neither of these proteins are mem-bers of yeast RNA polymerase II holoenzyme (Kim etal., 1994; Koleske and Young, 1994), mediator (Kim et al.,1994), or any of the basal transcription factor complexes(unpublished observations), suggesting that their pres-ence in RSC and SWI/SNF is specific.

Searches of the NCBI translated database using thealgorithm BLAST (Altschul et al., 1990) with YMR033wand YPR034w identified similar sets of proteins com-posed entirely of actins and actin-related proteins. Re-cently, an extended family of ten actin-related proteins inS. cerevisiae was defined, and YPR034w and YMR033wwere designated Arp7 and Arp9, respectively (Poch andWinsor, 1997). In keeping with this nomenclature, wewill hereafter refer to Swp61/Rsc11/YPR034w as Arp7and Swp59/Rsc12/YMR033w as Arp9. Arp7 is moreclosely related to yeast actin (BLAST P-Value 2 3 10214)than is Arp9 (BLAST P-Value 2 3 1023). Their similarity toactins is only modest (Arp7: 22% identical, 44% similar;Arp9: 17% identical, 40% similar). However, the ATPasefragement of the heat shock protein Hsc70 is only 12%identical to actin, yet a comparison of their crystal struc-tures shows that the structure of the central cores ofboth actin and Hsc70 are almost identical (Flaherty etal., 1991; see Discussion). Actin has been divided intofour structural domains (Kabsch et al., 1990), and ouralignments suggest that their similiarity is limited to the Figure 2. Arp7 and Arp9 Cofractionate with RSC or SWI/SNFcentral core of actin (central regions of domains 1 and For both SWI/SNF and RSC purification, yeast extracts were initially3) and does not include the regions known to be impor- fractionated on Bio-Rex 70, DEAE Sephacel, hydroxylapatite, andtant for the interaction of actin with myosin (primarily Mono Q (Cairns et al., 1994, 1996c) prior to resolution on the columns

indicated.the outer surface of domain 1), tropomyosin (domain(A) Arp7 and Arp9 cofractionate on Mono S and TSK-heparin, and4), or actin homotypic interactions (primarily domain 2)coelute with the RSC. For TSK-heparin (upper panel), adsorbed(Figures 1B and 1C). The lack of homology in theseproteins were eluted in a buffer with a linear gradient of 200–800

regions strongly suggests that these Arp proteins do mM potassium acetate. For Mono S (lower panel), adsorbed proteinsnot interact with these proteins in vivo, a suggestion were eluted in a buffer with a linear gradient of 100–800 mM potas-

sium acetate. For each, fractions (approximately 2.5 mg per lane)supported by their absence in purified RSC and SWI/were separated in an SDS-10% acrylamide gel and immunoblottedSNF (data not shown). Arp7 and Arp9 are much morewith anti-Rsc6p, anti-Arp7, and anti-Arp9 antiserum.related to actin than they are to each other, as BLAST(B) Arp7 and Arp9 cofractionate on TSK-heparin with SWI/SNF com-

does not yield a statistically significant score when the plex. Adsorbed proteins were eluted in a buffer with a linear gradienttwo proteins are compared. In addition, both proteins of 200–800 mM potassium acetate. For each, fractions (approxi-

mately 2.0 mg per lane) were separated in an SDS-10% acrylamideare more related to certain actin-related proteins (suchgels and immunoblotted separately with anti-Snf6, anti-Arp7, or anti-as Arp4) than they are to actin itself. Taken together,Arp9 antiserum.these results show that both RSC and SWI/SNF share

two proteins significantly similar to both actin and otheractin-related proteins.

protein (Figure 2A). The antibodies raised were antigen-specific (Figure 3A) and recognized no other proteins inRSC or SWI/SNF (Figure 2, Figure 3, and data notArp7 and Arp9 Are Present Simultaneously in RSCshown). On all columns tested and for both RSC andOur results raise the question of whether RSC (or SWI/SWI/SNF, Arp7 and Arp9 elution was coincident (FigureSNF) is a single complex containing both Arp7 and Arp9,2), arguing against the presence of distinct complexesor a mixture of two separate complexes, one containingcontaining only one of these Arp proteins. Further immu-Arp7 and the other Arp9. Precise coelution of Arp7 andnoblot analyses of column eluates showed that the vastArp9 from various adsorbents would argue against themajority of Arp7 and Arp9 immunoreactivity can be ac-presence of separate complexes. Therefore, we as-counted for by these two complexes, suggesting thatsessed Arp7 and Arp9 cochromatography by immu-their action may be limited to these two complexes (datanoblot analysis of column eluates with polyclonal anti-

bodies raised against purified full-length Arp7 or Arp9 not shown).

Molecular Cell642

Figure 4. ARP7 and ARP9 Are Essential for Mitotic Growth in S288CGenetic Background and Important for Growth in W303 GeneticBackground

Diploids heterozygous for either an arp7D mutation or an arp9D

mutation were sporulated and dissected. Four representative tet-rads are shown, with the four spores (A–D) from each tetrad in ahorizontal row. (A) ARP7 and ARP9 are essential in S288C back-ground. Dissections of the S288C heterozygous diploids YBC16(arp7D::LEU2/ARP7, top panel) and YBC20 (arp9D::LEU2/ARP9,lower panel). More extensive growth of S288C tetrads (ten days)did not reveal microcolonies with an arpD genotype. (B) ARP7 andARP9 are not essential for growth in W303 background. Dissectionsof W303 heterozygous diploids BCY340 (arp7D::LEU2/ARP7, toppanel) and BCY330 (arp9D::LEU2/ARP9, lower panel). Tetrads weregrown for eight days at 308C.

Figure 3. Arp7 Antibodies Immunodeplete Arp9 Protein and OtherMembers of RSC

(A) Arp7 and Arp9 antibodies are specific for their antigen. Purecontaining both proteins. Anti-Arp7 antibodies immuno-RSC (Mono S fraction #36, 250 ng) was separated on two neigh-

boring lanes of a SDS-10% acrylamide gel and immunoblotted with depleted RSC from a partially purified fraction whereasanti-Rsc6 antiserum and either anti-Arp7 antiserum (lane 1) or anti- anti-Snf6 antibodies had no effect (Figure 3B), and Arp9Arp9 antiserum (lane 2). was almost quantitatively coimmunoprecipitated, sug-(B) Immunoprecipitation of RSC with anti-Arp7 antibodies. A fraction

gesting that both proteins are present in the same RSCcontaining highly purified RSC (heparin fraction #38, 1 mg) wascomplex. Although anti-Arp9 antibodies were effectivetreated with either Anti-Arp7 antibodies or anti-Snf6 antibodies con-in immunoblots, they were less effective in immunopre-jugated to protein A–Sepharose. The following were separated in a

SDS-10% acrylamide gel and immunoblotted: pure RSC (Mono S cipitation experiments, providing only 50% immunode-fraction #36, 250 ng, lane 1), heparin RSC (Fraction #38, 500 ng, pletion. However, Arp7 was present at equivalent levelslane 2), half of the anti-Arp7 supernatant (lane 3), half of the anti- in the immune eluates and supernatants, again sug-Arp7 immune eluate (lane 4), half of the anti-Snf6 supernatant (lane

gesting their coprecipitation and their presence together5), or half of the anti-Snf6 immune eluate (lane 6).in RSC (Figure 3C).(C) Immunoprecipitation of RSC with anti-Arp9 antibodies. RSC

(heparin fraction #38, 1 mg) was treated with either Anti-Arp9 anti-bodies or anti-Snf6 antibodies conjugated to protein A–Sepharose. Phenotypes of arp7 and arp9 Mutants SuggestThe following were separated in a SDS-10% acrylamide gel and Roles in Transcription and Chromatin Controlimmunoblotted: pure RSC (Mono S fraction #36, 250 ng, lane 1), For the purpose of functional analysis, we constructedheparin RSC (500 ng, lane 2), half of the anti-Arp9 supernatant (lane

deletion mutations of ARP7 or ARP9 in diploids (in case3), half of the anti-Arp9 immune eluate (lane 4), half of the anti-Snf6the mutations caused inviability), and the phenoytypessupernatant (lane 5), or half of the anti-Snf6 immune eluate (lane 6).caused were determined in haploids following sporula-tion and tetrad analysis. To test for possible dependenceon the genetic background, we constructed the muta-Immunodepletion of Arp9 protein from a chromato-

graphic fraction with anti-Arp7 antibodies (and vice-versa) tions in both S288C and W303 strains. In the S288Cgenetic background, both arp7D and arp9D mutationswould strongly suggest the existance of one complex

Actin-Related Proteins and Chromatin Remodeling643

prevented cell growth, as viability segregated 2:2 (Figure phenotype is not observed with other swi/snf null mu-tants (Happel et al., 1991), suggesting that RSC function4). The arp7D and arp9D spores germinated and arrested

as microcolonies of approximately 50 large cells, show- may be required for an Spt1 phenotype, thus pointingto a role for RSC in transcription and chromatin control.ing that ARP7 and ARP9 are essential for mitotic growth

in this background (Figure 4). Surprisingly, the W303genetic background gave a different result: arp7D or Mutations that Suppress the Defects of swi/snfarp9D haploids were viable, although extremely slow Mutants Are Not Able to Suppressgrowing. In addition, a high-copy plasmid bearing ARP7 arp7 or arp9 Null Mutationswill not confer viability to an S288C-derived arp9D strain Previous work has demonstrated that swi/snf mutationsor improve the growth of a W303-derived arp9D strain. can be partially suppressed by mutations in genes thatSimilarily, high-copy plasmids bearing ARP9 have no encode histone proteins or certain chromatin regulatorseffect on the growth of arp7D cells, providing evidence (Winston and Carlson, 1992). Guided by these previous(beyond their null phenotypes) that Arp7 and Arp9 are studies, we tested whether such mutations could sup-not redundant for an important cellular function. These press the growth defects conferred by an arp7D or arp9Dresults show that ARP7 and ARP9 are required for mutation. In contrast to the behavior of swi/snf muta-growth in S288C derivatives and extremely important tions, we detected no suppression of arp7D or arp9Dfor growth in W303 derivatives. by the histone mutation hta1-htb1D (a deletion of one

In addition to extremely slow growth, the W303 arp7D of two loci encoding histones H2A and H2B), spt5–194,and arp9D null mutants exhibited several other mutant spt6–14, sin3D, or spt2D (sin1D). This analysis tested forphenotypes. First, they had phenotypes in common with suppression of the arp7D and arp9D lethality in S288Cswi/snf mutants, including the inability to grow on media background and slow growth in W303 background (forcontaining raffinose, galactose, or sucrose as the sole W303, only sin1D/spt2D was tested). The presence ofcarbon source, or to sporulate (as homozygous mutant Arp7 and Arp9 in RSC suggests a simple explainationdiploids). These phenotypes provide genetic evidence for these results: in contrast to SWI/SNF, RSC is bothfor the involvement of Arp7 and Arp9 in SWI/SNF func- essential and abundant and may have multiple essentialtion. Significantly, arp7D and arp9D mutants also dis- targets or functions that cannot all be suppressed byplayed phenotypes not found in swi/snf mutants; they mutation of a single chromatin component or regulator.failed to grow in the presence of 2% formamide (whichcan interfere with hydrogen bonding in proteins) at tem-

Isolation and Analysis of Temperature-Sensitiveperatures greater than 338C, or in the presence of 15Alleles of ARP7 and ARP9mM caffeine. In addition, arp7D arp9D double mutantsTo learn more about the functions of these Arp proteinsare almost identical in all phenotypes to either singleand their possible structural relatedness to actin, wemutant, strongly suggesting that these proteins functionisolated temperature-sensitive mutations in ARP7 andin the same processes, consistent with our coimmuno-ARP9. For ARP7, this screen yielded seven Ts2 mutants,precipitation results. The phenotypes and genetic prop-and all of the mutations were recessive to ARP71. Fiveerties associated with arp7D and arp9D mutants, then,of the Ts2 mutants (arp7–122, arp7–161, arp7–162,are likely caused by impairing the function of both SWI/arp7–311, and arp7–371) were unable to form colonies atSNF and RSC.378C, whereas the remaining two (arp7–301, arp7–491)In vivo support for a role for Arp7 and Arp9 in chroma-grew slowly, suggesting that these two have partial Arp7tin-mediated control of transcription was provided byfunction at 378C (Figure 5 and data not shown). All seventhe observation that both arp7D and arp9D mutationsof the Ts2 mutants grew slowly on media containing 2%cause an Spt2 (Suppressor of Ty) phenotype. This phe-formamide, 1.2 M sodium chloride, or 15 mM caffeinenotype is caused by mutations in genes involved in tran-and were able to grow slowly on media lacking histidinescription and chromatin regulation such as the TATA-(moderate Spt2 phenotype) (Figure 6A). None of thesebinding protein, histones, and certain members of themutants had Swi2/Snf2 mutant phenotypes (Raf2, Suc2,SAGA complex (Eisenmann et al., 1989; Roberts andGly2, Ino-), suggesting that the mutations are more spe-Winston, 1997). Mutants with an Spt2 phenotype arecific for RSC function or that only a low level of Arp7able to suppress the auxotrophies caused by either Tyfunction is required to provide Swi1/Snf1 phenotypes.or solo LTR (d) insertion mutatons adjacent to the HIS4The screen for Ts2 mutations in ARP9 yielded one mu-or LYS2 genes (Winston, 1992). One example is the his4–tant, arp9–661, which displayed phenotypes similar to912d promoter, where the presence of a solo d elementthose observed for arp7 Ts2 mutants but grew slowlyin the HIS4 promoter causes the production of a non-at the permissive temperature (Figures 5 and 6).functional HIS4 transcript that confers a His2 phenotype.

Otherwise wild-type cells containing his4–912d are His2.Mutations in ARP7 that Confer Ts2 PhenotypesSpt2 mutants suppress this defect by altering initiationAlter Conserved Residues Importantto produce a wild-type length HIS4 mRNA.for the Structure of ActinStrains bearing the two promoter insertion mutationsThe central core region (domains 1 and 3) contains thehis4–912d and lys2–128d are unable to grow on solidmajority of the residues conserved among actin-relatedmedia lacking either histidine or lysine and are desig-proteins. In actin and Hsc70, many of these residuesnated His2, Lys2, and Spt1. We find that strains of theare known to be important for either ATP hydrolysis orgenotype arp7D his4–912d lys2–128d or arp9D his4–912d

lys2–128d are His1, Lys1, and therefore Spt2. An Spt2 for the overall structural fold of the protein. To determine

Molecular Cell644

loop flexibility or interfere with ATP binding. However,other experiments (described below) suggest that thismutation does not impair ATP binding. The remainingtwo amino acid changes, E411K and G329R, appear toreveal features unique to Arp7. The E411K substitutionalters a highly conserved residue in a solvent-accessiblea helix in domain 3 that links two highly conserved bsheets crucial for core structure. In actin, this helix isnot involved in interactions with any known protein. Ourresults suggest that this helix is either important struc-turally (which may underlie its sequence conservation)or that it mediates an essential interaction of Arp7 withanother protein. The remaining tight Ts2 mutation (arp7–162, G329R) maps to domain 4, a region not conservedbetween Arp7 and actin, suggesting that a protein loopunique to Arp7 is important for function. Taken together,these results strongly suggest that Arp7 is related toactin structurally, and they have also revealed a loopunique to Arp7 that is important for function. Our arp9Ts2 allele contained a single base pair change, whichconverted the codon at amino acid position 438 (CAAencoding glutamine), to a TAA stop codon. This alter-ation is predicted to eliminate 30 amino acids from thecarboxyl terminus, which was confirmed by immunoblotanalysis (data not shown).

Extensive Site-Directed Mutagenesis of ResiduesPredicted to Mediate ATP Hydrolysis DoesNot Impair Function of Either Arp7 or Arp9

Figure 5. Temperature-Sensitive Mutations in ARP7 and ARP9 Actin and Hsc70 are ATP-binding and hydrolyzing pro-(A) Growth of arp7 Ts2 strains at permissive (308C) and nonpermis- teins that require a divalent cation as a cofactor. Thesive (378C) temperatures. Strains: WT, BY4727; or YBC726 trans- central core of these proteins includes the ATP-bindingformants harboring 2 mm ARP7 (pY24LIB.ARP7), ARP7 (pNCT.ARP7)

pocket as well as the residues important for the overall(wild type); those bearing arp7 Ts2 mutations contain pNCT.arp7–structrual fold (Kabsch et al., 1990; Flaherty et al., 1991).122 (YBC776), pNCT.arp7–161 (YBC777), and pNCT.-arp7–162

(YBC778). (B) Growth of the Ts2 arp9–661 strain at permissive (308C) Mutational analyses have been performed by severaland nonpermissive (378C) temperature. Strains: WT, BY4727; arp9– groups on actin and related proteins such as Hsc70661, YBC775 harboring pNCT.arp9–661; arp9D, YBC790 harboring (Wertman et al., 1992; Wilbanks et al., 1994; Chen andpNCT.ARP9. All strains are S288C derivatives. Rubenstein, 1995). Together, these studies have demon-

strated that altering residues that contact either the ionor ATP severely impairs function in vivo as well as ATPwhether the mutations present in our Ts2 alleles altered

conserved residues, and in particular those of known hydrolysis in vitro.To determine more directly the role of ATP hydrolysissignificance in actin, we sequenced the entire open

reading frame of the five tight arp7 Ts2 alleles. Only in Arp7 and Arp9 function, we performed site-directedmutagenesis using the previous studies on actin anda single base pair change was present in each allele,

conferring a single amino acid substitution. Four of five Hsc70 to guide our replacements. We tested for a varietyof mutant phenotypes, including growth on glucose,amino acid changes altered residues that are identical

between wild-type Arp7 and actin and that are highly raffinose, and galactose at 308C and 378C, as well asgrowth on plates lacking histidine or lysine (Spt2 pheno-conserved among all actin-related proteins (arp7–311,

A19P; arp7–371, S33F; arp7–161, G396V; arp7–122, type). Several different amino acid changes were tested(Table 1). In domain 1 of actin, the residues D11 and S14E411K) (Figure 1C). Three of these amino acid changes

(A19P, S33F, and G396V) are easily understood in light make important contacts with the ion and the g-phos-phate of ATP, respectively, and an aspartic acid in thisof the actin structure (Figure 1C and Figure 7). First,

A19P inserts a proline into a b sheet crucial for core position is conserved in all actin-related proteins exceptArp7 and Arp9. Domain 3 is similar to domain 1 in struc-structure. Second, the conserved S33 residue in Arp7 is

adjacent to an absolutely conserved proline in a flexible ture and function; a conserved aspartic acid residue atposition 199 in Hsc70 (position 154 in actin) is criticalloop that joins domains 1 and 2, and an S33F substitution

could alter loop flexibility or domain 2 orientation. Third, for ion coordination and is present in both Arp7 andArp9. The catalytic residues for Hsc70 and actin areG396 of Arp7 corresponds to one of only five residues

that are absolutely identical in all actin-related proteins. sugggested to be E175 and Q137, respectively (Hurley,1996). Our alignments suggest that the correspondingIn actin, this glycine accommodates a sharp turn and

does not interfere sterically with the binding of ATP. The residue in Arp7 is a glutamate (E141), whereas an alanineis present in Arp9.G396V substitution in Arp7 is predicted to either restrict

Actin-Related Proteins and Chromatin Remodeling645

Figure 6. Ts2 Mutations in ARP7 and ARP9Confer a Moderate Spt2 Phenotype

(A) Growth of strains bearing Ts2 arp7 muta-tions and the d element insertion alleles his4–912d and lys2–128d. Strains were grown aspatches on YPD, replica-plated to syntheticmedia lacking either histidine or lysine andgrown for five days at 308C. Strains: all areYBC726 harbouring plasmids with the indi-cated arp7 Ts2 mutations except wild type(WT, FY120) and spt6–14 (FY957).(B) Growth of the Ts2 arp9–661 strain. YBC780harboring the plasmid pNCT.arp6–661 orpNCT. ARP9. The wild-type (WT) strain is FY2.All strains are S288C derivatives.

Surprisingly, we found that substitutions at these con- the actin and Hsc70 crystal structures strongly suggeststhat replacing the glycine at this position with a tyrosineserved positions confer no observable phenotype (Table

1). It is possible that our substitutions truly impaired ATP will block ATP binding (data not shown). We find, how-ever, that neither a S338Y replacement in Arp7 nor ahydrolysis, but we were not able to observe phenotypes

because RSC (or SWI/SNF) function requires only that G397Y replacement in Arp9 confers any phenotypes.Taken together, these results suggest that Arp7 andeither Arp7 or Arp9 hydrolyze ATP. To explore this pos-

siblity, we combined mutations in Arp7 with mutations Arp9 lack ATP binding and hydrolysis.in Arp9 in the same cell. All double mutant combinationstested also caused no significant phenotypes (Table 1). Gal4-Arp7 and Gal4-Arp9 Fusion Proteins

Confer Both Spt2 and ConditionalThus, these results stongly suggest that two proteins arenot redundant for an essential ATPase-related function. Swi2/Snf2 Phenotypes

Our results suggest that Arp7 and Arp9 functions areTo test whether Arp7 or Arp9 possesses an essentialATP-binding activity, we performed a replacement that required for SWI/SNF functions, mitotic growth, and for

some aspect of normal transcription. Therefore, we mayshould block the binding of ATP in these proteins.Among actin and all actin-related proteins, a pair of be able to isolate arp7 or arp9 alleles that impair only

a subset of these functions. One example would be anglycine residues in domain 2 (positions 301 and 302 inactin) are highly conserved. Only glycine can be acco- allele that supported mitotic growth but caused Swi2/

Snf2 and/or Spt2 phenotypes. Fortuitously, alleles ofmodated at position 301 or 302 to avoid steric hindrancewith ATP (Kabsch et al., 1990; Flaherty et al., 1991). A this sort were generated through the construction and

analysis of GAL4-ARP7 and GAL4-ARP9 fusions. Weglycine is also required at position 301 to accommodatea sharp turn in the main chain. Molecular modeling with find that expression of a fusion protein consisting of the

Molecular Cell646

components that are shared between RSC and SWI/SNF (B. R. C., unpublished data). A recent indepen-dent study has shown that human SWI/SNF containsthe actin-related protein Baf53 (Zhao et al., 1998), andsequencing of the related Drosophila BRM complexrecently yielded a peptide with homology to an actin-related protein of unknown function (Papoulas et al.,1998). While this paper was being reviewed, Petersonand colleagues reported the presence of Arp7 and Arp9in a fraction containing partially purified SWI/SNF (Pe-terson et al., 1998). Their identification of Arp7 and Arp9was based solely on mass spectrometric analysis ofpartially purified SWI/SNF and so demonstrated thelikely presence of these proteins in the fraction, not theirassociation in SWI/SNF complex. We have provided de-finitive identification of Arp7 and Arp9 by peptide se-quencing, biochemical evidence of cofractionation, andcoimmunoprecipitation. Together, these results suggestthat actin-related proteins are conserved componentsof SWI/SNF-related complexes in eukaryotes.

Our work has focused on establishing whether actin-related proteins have functional roles in SWI/SNF-relatedcomplexes and to what extent their sequence similarityto actin extends to functional similarities. We have

Figure 7. ARP7 Mutations and Their Phenotypes Superimposed on shown that both arp7D and arp9D mutants, in the W303the Crystal Structure of Actin background, possess swi/snf phenotypes and that GAL4-The locations of the alterations in Arp7 and Arp9 are based on the ARP7 and GAL4-ARP9 fusions, in both backgroundssequence alignments presented in Figure 1C. Red dots identify the tested, are alleles that cause conditional swi/snf pheno-locations of the arp7 Ts2 substitutions. Green dots identify the loca- types. These phenotypes demonstrate a role for thesetions of site-directed replacements performed with both ARP7 and

proteins in SWI/SNF function. We attribute the extremelyARP9 that were designed to impair ATP hydrolysis (all of whichpoor growth/inviability of arp7D and arp9D mutants toconferred no phenotype). The large blue dot identifies the locationimpaired RSC function, as most other RSC genes testedof the divalent cation. Adapted from Kabsch et al. (1990) with per-

mission. are essential for growth (Laurent et al., 1992; Cairns etal., 1996c; Cao et al., 1997; Treich and Carlson, 1997)and the vast majority of Arp7 and Arp9 immunoreactivity

DNA-binding domain of Gal4 (amino acids 1–147) fused is associated with RSC. In addition, other swi/snf nullto either full-length Arp7 or Arp9 in their corrosponding mutants, while somewhat sick, still grow very well com-null strain (of either S288C or W303 background) sup- pared to arp7D and arp9D mutants. Our null phenotypesports mitotic growth, but confers an Spt2 phenotype are in contrast to those of Peterson et al. (1998) who(His1 growth, Table 2). This phenotype is fully recessive report that S288C-derived arp7D and arp9D mutants areto ARP1. The strength of the Spt2 phenotype caused viable and grow better than snf2D strains, whereas weby GAL4-ARP7 or GAL4-ARP9 is modest however, as observe inviability. This difference could be the result ofeither can suppress his4–912d but not lys2–128d. uncharacterized differences in the particular laboratory

Interestingly, arpD cells expressing GAL4-ARP fu- strains used for the experiments. However, the differ-sions do not display strong Swi2/Snf2 phenotypes at ence may also be explained by the presence of a sup-308C, but show Swi2/Snf2 phenotypes at 378C, including pressor mutation that confers growth ability to arp7Dgrowth defects on media containing galactose, raffi- or arp9D strains. Since Peterson et al. constructed arp7Dnose, or glycerol (Table 2). These phenotypes are not and arp9D mutations in haploid strains instead of diploiddue to toxicity as expression of Gal4-Arp derivatives in strains, suppressors could have arisen. In support ofwild-type cells has no effect at either temperature (Table this possibility, we have recently isolated spontaneous2). Thus, the genes encoding these fusion proteins may suppressor mutations that confer growth ability to arp7Dbe considered special arp7 and arp9 alleles that are or arp9D mutants but that do not suppress their Swi2/defective for certain RSC functions (Spt2) and SWI/SNF Snf2 mutant phenotypes (B. R. C. and F. W., unpublishedfunctions (at 378C) but retain the ability to support mitotic data). Our mutant analysis also suggest that RSC affectsgrowth. Taken together, these alleles provide further transcription, as our W303-derived arp7D and arp9Devidence for a role for these Arp proteins in SWI/SNF strains and our S288C-derived arp Ts2 strains displayfunctions and transcriptional control. an Spt2 phenotype not observed with any other swi/snf

mutation. These arp Ts2 alleles may be utilized to iden-Discussion tify RSC (and SWI/SNF) target genes through the use

of whole-genome transcriptional expression systems.Here, we show through a combination of peptide se- Arp7 and Arp9 show only modest sequence identity toquencing, mass fingerprinting, and immunoprecipitation actin (22% and 17%, respectively). However, the ATPaseexperiments that both SWI/SNF and RSC contain the fragment of Hsc70, with only 12% sequence identity to

actin, is virtually identical to actin structurally in theactin-related proteins Arp7 and Arp9. These are the only

Actin-Related Proteins and Chromatin Remodeling647

Table 1. Effect of Amino Acid Replacements on the Function of Arp7 and Arp9 Compared to Similar Substitutions in Actin or Hsc70

Equivalent Equivalent Effect onSubstitution(s) in Phenotype Substitution(s) Phenotype Substitution(s) ATP HydrolysisArp7 or Arp9 Conferred in Actin Conferred in Hsc70 (Fold-Lowered) References

In isolationS14A, Arp7 None S14A Ts2 ND ND Chen and Rubenstein, 1995S16A, Arp9 NoneH11A S14A, Arp7 None D11A Lethal D10N; D10S ≈100; ≈20 Wertman et al., 1992Y13A S16A, Arp9 None Wilbanks et al., 1994D158N, Arp7 None ND ND D199N ≈100 Wilbanks et al., 1994D163N, Arp9 NoneS14A D158N, Arp7 Nonea ND ND D199N ≈100 Chen and Rubenstein, 1995S16A D163N, Arp9 Nonea Wilbanks et al., 1994D158A, Arp7 None D154A D167A Lethal D199S ≈100 Wertman et al., 1992D163A, Arp9 None Wilbanks et al., 1994D163A T166A, Arp9 NoneE141A, Arp7 Noneb ND ND E175S ≈100 Wilbanks et al., 1994S397Y, Arp7 Noneb ND ND ND NDG338Y, Arp9 Noneb

In combinationS397Y, Arp7 Noneb ND ND ND NDG338Y, Arp9H11A S14A, Arp7 None D11A Lethal D10N; D10S ≈100; ≈20 Wertman et al., 1992Y13A S16A, Arp9 Wilbanks et al., 1994E141A, Arp7 Noneb D154A D157A Lethal D199S; E175S ≈100; ≈100 Wilbanks et al., 1994D163A T166A, Arp9 Wertman et al., 1992S14A D158N, Arp7 Slight Ts-a ND ND D199N ≈100 Chen and Rubenstein, 1995S16A D163N, Arp9 Wilbanks et al., 1994

Plasmids bearing arp mutant alleles were transformed into diploids heterozygous for arpD mutations (YBC88, S288C background; BCY390,W303 background), and phenotypes were tested in haploid segregants as described in Experimental Procedures.a Tested only in W303 background.b Tested only in S288C background.

central core; the a carbon positions can be superim- present to connect these complexes to actin-bindingproteins and cytoskeletal processes involving actin. Ge-posed with a RMS deviation of only 2.3 A (Flaherty et

al., 1991). Our Ts2 arp7 mutations encode substitutions netic support is provided by the observation that a muta-tion in the SWI/SNF component Anc1/Tfg3/Taf30 willthat align to residues important for actin structure,

strongly suggesting that Arp7 is related to actin structur- not complement a temperature-sensitive allele of actin;however, this protein is a member of several other com-ally in the central core (Figure 1C and Figure 7). However,

extensive site-directed mutagenesis on both ARP7 and plexes with diverse roles in transcriptional regulation,raising the possiblilty that this genetic interaction is indi-ARP9 does not support a role for ATP hydrolysis in their

function (Table 1, Figure 1C, and Figure 7). In addition, rect (Cairns et al., 1996a). Biochemical support is pro-vided by the recent observations that both human SWI/we observed no ATP hydrolysis with purified recombi-

nant versions of Arp7 or Arp9 (data not shown). Taken SNF complex and the Drosophila BRM complex not onlycontain a protein related to actin (Baf53 in human cells,together, these results strongly suggest that Arp7 and

Arp9 resemble actin structurally, but not functionally. Bap55 in Drosophila) but also contain actin itself (Papou-las et al., 1998; Zhao et al., 1998). Baf53 retains similarityWhy are actin-related proteins in chromatin-remodel-

ing complexes? One possible answer is that they are to actin in many of the regions that contact myosin,

Table 2. GAL4-ARP7 and GAL4-ARP9 Alleles Confer Spt2 and Conditional Swi2/Snf2 Phenotypes

Growth ConditionHost Plasmid-encodedGenotype Expressed Protein Glucose Galactose Raffinose Glycerol 2His 2Lys

308C 378C 308C 378C 308C 378C 308C 378C 308C 308Carp7D Arp7 1 1 1 1 1 1 1 1 2 2

arp9D Arp9 1 1 1 1 1 1 1 1 2 2

WT Gal4-Arp7 1 1 1 1 1 1 1 1 2 2

WT Gal4-Arp9 1 1 1 1 1 1 1 1 2 2

arp7D Gal4-Arp7 1 1 1 1/2 1/2 2/1 1 1/2 1 2

arp9D Gal4-Arp9 1 1/2 1/2 2 2/1 2 1/2 2 1/2 2

Plasmids bearing GAL4-ARP alleles (pGBT9.ARP7 and pGBT9.ARP9) were transformed into YBC726 (arp7D), YBC780 (arp9D), and FY118(WT, wild type). YBC726 and YBC780 transformants were streaked for single colonies on media that contains 5-FOA to select for loss ofURA3 ARP7 or URA3 ARP9 plasmids, respectively.Growth conditions: solid minimal media plates lacking tryptophan.Scoring: 1, wild type; 1/2 slow growth; 2/1, very slow growth; 2, no growth.

Molecular Cell648

Table 3. Yeast Strains

Strain Mating type Genotype Source

W303a MATa/a trp1-1/trp1-1 ura3-1/ura3-1 can1-100/can1-100 ade2-1/ade2-1 A. Tzagoloffleu2-3, 112/leu2-3,112 his3-11,15/his3-11,15

BCY330a MATa/a ade2-1/ade2-1 trp1-1/trp1-1 leu2-3,112/leu2-3,112 his3-11,15/his3-11,15 This workura3-1/ura3-1 can1-100/can1-100 arp9D::LEU2ARP9

BCY340a MATa/a ade2-1/ade2-1 trp1-1/trp1-1 leu2-3,112/leu2-3,112 his3-11,15/his3-11,15 This workura3-1/ura3-1 can1-100/can1-100 arp7D::LEU2ARP7

BCY365a MATa/a ade2-1/ade2-1 trp1-1/trp1-1 leu2-3,112/leu2-3,112 his3-11,15/his3-11,15 This workura3-1/ura3-1 can1-100/can1-100 arp7D::TRP1ARP7

BCY350a MATa ade2-1 trp1-1 can1-100 leu2-3,112 his3-11,15 ura3-1 arp9D::LEU2 This workBCY351a MATa ade2-1 trp1-1 can1-100 leu2-3,112 his3-11,15 ura3-1 arp9D::LEU2 This workBCY360a MATa ade2-1 trp1-1 can1-100 leu2-3,112 his3-11,15 ura3-1 arp7D::LEU2 This workBCY363a MATa ade2-1 trp1-1 can1-100 leu2-3,112 his3-11,15 ura3-1 arp7D::LEU2 This workBCY390a MATa/a ade2-1/ade2-1 trp1-1/trp1-1 leu2-3,112/leu2-3,112 his3-11,15/his3-11,15 This work

ura3-1/ura3-1 can1-100/can1-100 arp9D:;LEU2/ARP9 arp7D::TRP1/ARP7BCY392a MATa ade2-1 trp1-1 can1-100 leu2-3,112 his3-11,15 ura3-1 This work

arp7D::TRP1 arp9D::LEU2BCY403a MATa ade2-1 trp1-1 can1-100 leu2-3,112 his3-11,15 ura3-1 snf2D::LEU2 This workBCY417a MATa ade2-1 trp1-1 can1-100 leu2-3,112 his3-11,15 ura3-1 snf2D::TRP1 This workBCY466a MATa/a ade2-1/ade2-1 trp1-1/trp1-1 leu2-3,112/leu2-3,112 his3-11,15/his3-11,15 This work

ura3-1/ura3-1 can1-100/can1-100 arp7D::LEU2/arp7D::TRP1BCY355a MATa/a ade2-1/ade2-1 trp1-1/trp1-1 leu2-3,112/leu2-3,112 his3-11,15/his3-11,15 This work

ura3-1/ura3-1 can1-100/can1-100 arp9D::LEU2/arp9D::LEU2FY2b MATa ura3-52 Winston LabFY118b MATa his4-912d lys2-128d leu2D1 trp1D63 ura3-52 Winston LabFY120b MATa his4-912d lys2-128d leu2D1 trp1D63 ura3-52 Winston LabFY957b MATa his4-912d lys2-128d leu2D1 ura3-52 spt6-14 Winston LabYBC15b MATa/a his4-912d/his4-912d lys2-128d/lys2128d leu2Dl/leu2D1 trp1D63/trp1D63 This work

ura3-52/ura3-52 arp7D::TRP1/ARP7YBC16b MATa/a his4-912d/his4-912d lys2-128d/lys2128d leu2Dl/leu2D1 trp1D63/trp1D63 This work

ura3-52/ura3-52 arp7D::LEU2/ARP7YBC20b MATa/a his4-912d/his4-912d lys2-128d/lys2128d leu2D1 trp1D63/trp1D63 This work

ura3-52/ura3-52 arp9D::LEU2/ARP9YBC47b MATa his4-912d lys2-128d leu2D1 ura3-52 spt5-194 [pY24.LIB.ARP9] This workYBC48b MATa his4-912d lys2-128d leu2D1 ura3-52 spt5-194 [pY24.LIB.ARP7] This workYBC51b MATa his4-912d lys2-128d leu2D1 ura3-52 spt6-14 [pY24.LIB.ARP7] This workYBC53b MATa his4-912d lys2-128d leu2D1 ura3-52 spt5-194 [pY24.LIB.ARP9] This workYBC86b MATa lys2-128d leu2D1 trp1D63 ura3-52 arp9D::LEU2 [pY24.LIB.ARP9] This workYBC87b MATa his4-912d lys2-128d leu2D1 ura3-52 [pY24.LIB.ARP7] This workYBC88b MATa/a his4-912d/HIS4 lys2-128d/lys2128d leu2Dl/leu2D1 trp1D63/trp1D63 This work

ura3-52/ura3-52 arp7D::LEU2/ARP7 arp9D::LEU2/ARP9YBC619b MATa his4-912d lys2-128d leu2D1 trp1D63 ura3-52 arp7D::LEU2 [pNCU.ARP7] This workYBC708b MATa lys2-128d his3D200 leu2D1 trp1D63 ura3-52 sin3D::HIS3 This work

arp9D::LEU2 [pY24.LIB.ARP9]YBC709b MATa lys2-128d his3D200 leu2D1 trp1D63 ura3-52 sin3D::HIS3 This work

arp7D::TRP1 [pNCU.ARP9]YBC726b MATa his4-912d lys2-128d leu2D1 trp1D63 ura3-52 This work

arp7D::LEU2 [pY24.LIB.ARP7]YBC775b MATa lys2-128d leu2D1 trp1D63 his3D200 ura3-52 arp9D::LEU2 [pNCT.arp9-661] This workYBC776b MATa his4-912d lys2-128d leu2D1 trp1D63 ura3-52 arp7D::LEU2 [pNCT.arp7-122] This workYBC777b MATa his4-912d lys2-128d leu2D1 trp1D63 ura3-52 This work

arp7D::LEU2 [pNCT.arp7-161]YBC778b MATa his4-912d lys2-128d leu2D1 trp1D63 ura3-52 This work

arp7D::LEU2 [pNCT.arp7-162]YBC780b MATa his4-912d lys2-128d leu2D1 trp1D63 ura3-52 This work

arp9D::LEU2 [pY24.LIB.ARP9]YBC786b MATa his4-912d lys2-128D leu2D1 trp1D63 ura3-52 This work

arp7D::LEU2 [pNCT.arp7-301]YBC787b MATa his4-912d lys2-128d leu2D1 trp1D63 ura3-52 This work

arp7D::LEU2 [pNCT.arp7-311]YBC788b MATa his4-912d lys2-128d leu2D1 trp1D63 ura3-52 This workYBC789b MATa his4-912d lys2-128Gd leu2D1 trp1D63 ura3-52 This work

arp7D::LEU2 [pNCT.arp7-311]YBC790b MATa his4-912d lys2-128d leu2D1 trp1D63 ura3-52 This work

arp9D::LEU2 [pNCT.ARP9]BY4727b MATa his3D200 leu2D0 lys2D0 met 15D0 trp1D63 ura3D0 Brachmann et al., 1997

a W303 background.b S288C background.

Actin-Related Proteins and Chromatin Remodeling649

ATAGCCTACTACTC-39). The 482 bp product was cloned as aprofilin, and other actin molecules (actin polymerizes toBamHI/XbaI fragment into the BamHI/XbaI sites of p305.arp7D.39form actin filaments), and human SWI/SNF can interactor the BamHI/SpeI sites of p304.arp7D.39 to afford pBCarp7D::LEU2with proteins such as profilin in vitro (Zhao et al., 1998)or pBCarp7D::TRP1, respectively.

raising the possiblity that such interactions are impor- To acquire ARP9, BCY350 was transformed with a yeast genomictant for SWI/SNF function. DNA library (URA3, 2 mm origin), and fast-growing Ura1, 5-FOA-

sensitive clones were chosen. Plasmid DNA was isolated and re-Our work, however, calls into question the generalitytransformed into BCY350, and wild-type growth was conferred. Thisof these interactions, as purified RSC and SWI/SNF con-plasmid (pY24LIB.ARP9) contains about 10 kb of genomic DNA in-tain two actin-related proteins and lack actin entirely.cluding ARP9. To prepare a plasmid bearing only ARP9, pNCT.ARP9Additionally, neither Arp7 nor Arp9 retain similarity to(CEN6 TRP1 ARP9), a 2.2 kb PstI/SpeI fragment from pY24LIB.ARP9

actin in the regions that mediate interactions with known containing ARP9 was cloned into the Pst/SpeI sites of pRS314.actin-binding proteins, or actin itself, strongly suggesting ARP9 is a split gene; an RNA encoding the first 10 amino acids is

spliced to the RNA encoding the remaining 457 amino acids, remov-that neither Arp7 nor Arp9 bind such proteins. Severaling an intron of 87 nucleotides. This intron was removed by cloningpossibilities may be considered to account for thesea DNA product encoding the C-terminal 457 amino acids into theobservations. First, the role of actin and actin-relatedvector pGEX-3X, followed by an oligonucleotide encoding theproteins could be very different in higher eukaryotesamino-terminal ten amino acids. ARP9 DNA encoding amino acids

than in yeast; actin and Baf53/Bap55 may interact with 11–467 was isolated by PCR with genomic DNA and the primers:known actin-binding proteins whereas yeast Arp7 and BCE595 (59-CCCCGGATCCATATGATAATATACCCCAGATCTCAA

ACT-39) and BCE593 (59-CCCGGATCCTTAATGGTGATGGTGATArp9 do not. Alternatively, actin and/or actin-related pro-GGTGAAATTGCACGTCCCAAAGAGCA-39). The resulting 1.4 kbteins in both yeast and metazoan SWI/SNF-related com-product begins (relative to the ARP9 start codon) at 1117 (aminoplexes may interact with a similar set of nuclear proteinsacid 11) and extends to 11491 (stop codon) and adds six histidinethat have not been identified previously as actin part-residues to the carboxyl terminus. It was digested with BamHI and

ners. Among the candidates for these proteins are com- cloned into the BamHI site of PGEX-3X, and an oligonucleotide wasponents of the nuclear matrix, as human SWI/SNF com- inserted into the NdeI site encoding the amino terminal 11 amino

acids to yield pGEX-3X. ARP9.plex is known to interact with the nuclear matrix (ReyesDeletions of ARP9 were isolated by g integration with the plasmidet al., 1997; Zhao et al., 1998), but other proteins such

pBCarp9D::LEU2. First, the 450 bp HindIII/BamHI fragment fromas histones and other chromatin components remainpGEX-3X.ARP9 (encoding the 39-end of Arp9) was cloned into thestrong candidates. It is possible that Arp7 and Arp9 mayHindIII/BamHI site of the vector pRS305 (LEU2) to create p305.

have diverged more substantially from actin than their arp9D.39. The 59 noncoding region of ARP9 (from 2248 to 224) wasmetazoan counterparts to help specify interactions with isolated by PCR using Taq polymerase and the primers BC59KO5

(59-CCCGGATCCATCACGATAATTGTTAGGTCAGGCATT-39) andthese proteins. Their partners may be revealed by ge-BCKO593 (59-CCCTCTAGACAAGACACTTAACTTCGCGTGGTAnetic experiments in yeast through the isolation of sup-CAT-39). The 224 bp product was cloned as a BamHI/XbaI fragmentpressors of our arp7 and arp9 mutations and may revealinto the BamHI/XbaI sites of p305.arp79.39 to afford pBCarp9D::LEU2.new connections to processes common to both RSC

GAL4-ARP plasmids are derivatives of pGBT9 (2 mm origin TRP1,and SWI/SNF functions. ADH1 promoter) prepared by cloning the BamHI fragment of pGEX-

3X.ARP7 or pGEX-3X.ARP9 into the BamHI site of pGBT9, and clonesof proper orientation were named pGBT9.ARP7 and pGBT9.ARP9,Experimental Proceduresrespectively.

PlasmidsTo acquire ARP7, BCY360 (arp7D::LEU2) was transformed with two Strains

Strains are derivatives of either W303 or S288C. All S288C deriva-different yeast genomic DNA libraries, a low-copy (URA3, CEN6)and a high-copy (URA3 2 mm), and fast-growing Ura1, 5-FOA-sensi- tives (designated either FY or YBC) are isogenic and GAL21 (Winston

et al., 1995), as are all W303 derivatives (designated BCY) (Table 3).tive cells were chosen. Plasmid DNA was isolated, retransformedinto BCY360, and wild-type growth was conferred in both cases. To construct arp7D in W303 background, plasmids pBCar-

p7D::LEU2 or pBCarp7D::TRP1 were digested with BamHI, trans-These plasmids (pCENLIB.ARP7 and pY24LIB.ARP7) contain about12 kb of DNA including ARP7. To prepare a plasmid bearing only formed into the MATa/a diploid W303 (BCY300) and either Leu1 or

Trp1 colonies were selected, respectively. Correct integrants wereARP7 (pNCU.ARP7, CEN6 URA3 ARP7), a 2.4 kb BamHI/HindIIIfragment from pCENLIB.ARP7 that contains ARP7 was cloned into identified by PCR analysis and were designated BCY340 and BCY3-

41(arp7D::LEU2/ARP7) and BCY365 and BCY366 (arp7D::TRP1/the BamHI/HindIII sites of pRS316 (Sikorski and Hieter, 1989). Plas-mids for mutagenesis of ARP7, pNCT.ARP7 (CEN6 TRP1 ARP7) and ARP7). In twenty tetrads derived from BCY340 and BCY341, ex-

tremely slow growth segregated 2:2, all spores of normal growthpNCH.ARP7 (CEN6 HIS3 ARP7), were prepared by cloning the 2.4kb BamHI/XhoI fragment of pNCU.ARP7 into the BamHI/XhoI site were Leu2 and all slow-growing spores were Leu1. One MATa

arp7D::LEU2 segregant was designated BCY360 and one MATaof pRS314 or pRS313, respectively. The ARP7 ORF was also isolatedby PCR with the following primers: BCE615 (59-CCCCGGATCCA arp7D::LEU2 segregant BCY363. From twenty tetrads from both

BCY365 and BCY370, extremely slow growth also segregated 2:2,TATGACATTGAATAGGAAGTGCGTA-39) and BCE613 (59-CCCGGATCCCTAATGGTGATGGTGATGGTGGTTTGTTGCGTTCGTAGCCTG all spores of normal growth were Trp2 and all slow-growing spores

were Trp1. One MATa arp7D::TRP1 segregant was designatedCGA-39). The amplified product was digested and cloned into theBamHI site of PGEX-3X. A clone of proper orientation (pGEX- BCY367 and one MATa arp7D::TRP1 segregant BCY369. An identi-

cal procedure was followed to isolate arp7D strains in S288C genetic3X.ARP7) was used for large-scale protein production.Deletions of ARP7 were isolated by g integration using the plas- background. However, in twenty tetrads derived from the indepen-

dent heterozygous diploids YBC15 and YBC16 (arp7D::LEU2/ARP7)mids pBCarp7D::LEU2 or pBCarp7D::TRP1. The 880 bp BglII/BamHIfragment from pGEX-3X.ARP7 (containing the 39-end of ARP7) was or YBC17 and YBC18 (arp7D::TRP1/ARP7), viability segregated 2:2

and all viable spores were Trp2.cloned into the BamHI site of the vector pRS305 (LEU2) or pRS304(TRP1), and clones of correct orientation were named p305.arp7D.39 To isolate arp9D in W303 genetic background, plasmid pBCar-

p9D::LEU2 was digested with BamHI, transformed into the MATa/aand p304.arp7D.39, respectively. The 59 noncoding region of ARP7(from 248 to 2530) was isolated by PCR using Taq polymerase and diploid W303 (BCY300), and Leu1 colonies were selected. Correct

integrants were identified by PCR analysis, generating the indepen-the primers BC61KO5 (59-CCCGGATCCTACTTTATTTAGTGATCTACTAAGCAT-39) and BCKO613 (59-CCCTCTAGACGCGCTTTTGCTA dent heterozygous diploids BCY330 and BCY331 (arp9D::LEU2/

Molecular Cell650

ARP9). In twenty tetrads derived from BCY330 and BCY331, ex- Acknowledgmentstremely slow growth segregated 2:2, and all spores of normal growthwere Leu2, and all slow-growing spores were Leu1. One MATa The authors thank the members of the Winston and Kornberg labs

and also D. Stillman for helpful discussions, D. McKay for advicearp9D::LEU2 segregant was designated BCY350 and one MATa

arp9D::LEU2 segregant BCY352. An identical procedure was fol- on site-directed mutations, and the members of the Tempst lab forexpert advice on mass spectrometric analysis and peptide sequenc-lowed to isolate arp9D strains in S288C genetic background. How-

ever, in ten tetrads derived from the independent heterozygous ing. We also thank J. Tamkun, W. Wang, and G. Crabtree for commu-nicating results prior to publication and B. Laurent for antibodies.diploids YBC20 and YBC21 (arp9D::LEU2/ARP9), viability segre-

gated 2:2 and all viable spores were Leu2. B. R. C. was a fellow of the Leukemia Society of America. This workwas supported by supported by an NCI Core Grant P30 CA08748(P. T.) and NIH grants GM32967 (F. W.) and GM36659 (R. D. K.).

Isolation of arp7 and arp9 Temperature-Sensitive MutantsFor each, a “plasmid shuffle” procedure was utilized in each arpD

Received September 4, 1998; revised October 28, 1998.strain, an ARP-containing plasmid was replaced with an ARP-con-taining plasmid that has been subjected to chemical mutagenesis.

ReferencesFor ARP7, plasmid pNCT.ARP7 (10 mg) was mutagenized by incuba-tion in 1.0 M hydroxylamine for 8 hr (low mutagenesis) or 24 hr (high

Altschul, S.F., Gish, W., Miller, W., Myers, E.W., and Lipman, D.J.mutagenesis) at 378C. Plasmid DNA was recovered and transformed(1990). Basic local alignment search tool. J. Mol. Biol. 215, 403–410.into YBC726, an arp7D::LEU2 strain bearing pY24.LIB.ARP7. Trans-

formants were selected on SC-Trp, and 100 plates were acquired at Cairns, B.R. (1998). Chromatin remodelling machines: similar mo-180 colonies/plate. Colonies lacking pY24.LIB.ARP7 were selected tors, ulterior motives. Trends Biochem. Sci. 23, 20–25.with 5-FOA. Null frequencies of 0.5% (low mutagenesis) and 1.5% Cairns, B.R., Kim, Y.J., Sayre, M.H., Laurent, B.C., and Kornberg,(high mutagenesis) were obtained (percentage of 5-FOA sensitive R.D. (1994). A multisubunit complex containing the SWI/ADR6,colonies). Colonies were then tested for formamide sensitivity SWI2/SNF2, SWI3, SNF5, and SNF6 gene products isolated from(YPD 1 2% formamide, 308C), raffinose defective growth (with YP 1 yeast. Proc. Natl. Acad. Sci. USA 91, 1950–1954.2% raffinose containing 1 mg/ml antimycin A, 308C and 378C), sup-

Cairns, B.R., Henry, N.L., and Kornberg, R.D. (1996a). TFG3/TAF30/pression of his4–912d (with SC-His, 308C), or temperature-sensitiveANC1, an integral component of the yeast SWI/SNF complex andgrowth (158C or 378C). Plasmids conferring conditional growth werea homolog of the leukemogenic proteins ENL and AF-9. Mol. Cell.isolated and retested in YBC726 to verify plasmid linkage, and theBiol. 16, 3308–3316.entire ARP7 ORF was then sequenced to identify mutations. AnCairns, B.R., Levinson, R., Yamomoto, K.R., and Kornberg, R.D.almost identical procedure was followed for the isolation of condi-(1996b). Essential role of Swp73 in the function of Swi/Snf complex.tional arp9 mutations and utilized the ARP9 TRP1 CEN plasmidGenes Dev. 10, 2131–2144.pNCT.ARP9 and the S288C-derived haploid strain YBC86, which

bears an arp9D::LEU2 mutation covered by the plasmid pNCU. Cairns, B.R., Lorch, Y., Li, Y., Zhang, M., Lacomis, L., Erdjument-ARP9. For ARP7, about 7500 Trp1 colonies were obtained from each Bromage, H., Tempst, P., Du, J., Laurent, B., and Kornberg, R.D.of the low and high mutagenesis procedures, and null frequencies of (1996c). RSC, an essential, abundant chromatin remodeling com-1.0% (low mutagenesis) and 1.5% (high mutagenesis) were ob- plex. Cell 87, 1249–1260.tained. For ARP9, about 7100 Trp1 colonies were obtained from each Cao, Y., Cairns, B.R., Kornberg, R.D., and Laurent, B.L. (1997). Sfh1p,of the low and high mutagenesis procedures, and null frequencies of a component of a novel chromatin-remodeling complex, is required1.0% (low mutagenesis) and 1.5% (high mutagenesis) were ob- for cell cycle progression. Mol. Cell. Biol. 17, 3323–3334.tained.

Chen, X., and Rubenstein, P.A. (1995). A mutation in an ATP-bindingloop of Saccharomyces cerevisiae actin (S14A) causes a tempera-ture-sensitive phenotype in vivo and in vitro. J. Biol. Chem. 19,Preparation of arp7 and arp9 Site-Directed Mutants11406–11414.Plasmids bearing site-directed mutations in ARP7 and ARP9 wereCote, J., Quinn, J., Workman, J.L., and Peterson, C.L. (1994). Stimu-prepared with the Quick-Change system (Stratagene Inc.). For each,lation of GAL4 derivative binding to nucleosomal DNA by the yeasttwo complementary oligos (250 ng) bearing the desired mutationSWI/SNF complex. Science 265, 53–60.were annealed at 558C to 500 ng of a centromeric plasmid bearing

the wild-type ARP gene (either pNCU.ARP7, pNCH.ARP7, or pNCU.- Eisenmann, D.M., Dollard, C., and Winston, F. (1989). SPT15, theARP9). Templates bearing the mutation were generated by PCR gene encoding the yeast TATA-binding factor TFIID, is required forwith Pfu polymerase, digested to completion with DpnI, and trans- normal transcription initiation in vivo. Cell 58, 1183–1191.formed into competent MH1 cells. All mutations were verified by Elfring, L.K., Deuring, R., McCallum, C.M., Peterson, C.L., and Tam-DNA sequencing. Plasmids bearing these mutations were trans- kun, J.W. (1994). Identification and characterization of Drosophilaformed into diploids heterozygous for arpD mutations (YBC88, relatives of the yeast transcriptional activator SNF2/SWI2. Mol. Cell.S288C background; BCY390, W303 background), and phenotypes Biol. 14, 2225–2234.were analyzed in segregants from at least eight tetrads. These muta-

Estruch, F., and Carlson, M. (1990). SNF6 encodes a nuclear proteintions did not encode dominant lethal proteins, as control transforma-that is required for expression of many genes in Saccharomycestions with stoichiometric empty vector yielded equal numbers ofcerevisiae. Mol. Cell. Biol. 10, 2544–2533.transformants.Flaherty, K.M., McKay, D.M., Kabsch, W., and Holmes, K.C. (1991).Similarity of the three-dimensional structures of actin and theATPase fragment of the 70-kDa heat shock cognate protein. Proc.AntibodiesNatl. Acad. Sci. USA 88, 5041–5045.Recombinant Arp7 or Arp9 proteins fused to glutathione-S-trans-

ferase were isolated from E. coli XL1 cells (Stratagene, Inc) and Happel, A.M., Swanson, M.S., and Winston, F. (1991). The SNF2,purified from inclusion bodies as described previously for recombi- SNF5, and SNF6 genes are required for Ty transcription in Saccharo-nant Snf6p (Cairns et al., 1994). For each, approximately 2 mg of myces cerevisiae. Genetics 128, 69–77.full-length GST-Arp protein was isolated from an SDS-PAGE gel and Harata, M., Karwan, A., and Wintersberger, U. (1994). An essentialused for injection into rabbits. gene of Saccharomyces cerevisiae coding for an actin-related pro-

tein. Proc. Natl. Acad. Sci. USA 91, 8258–8262.

Hurley, J.H. (1996). The sugar kinase/heat shock/actin superfamily:Isolation and Identification of Arp7 and Arp9implications of conserved structure for mechanism. Annu. Rev. Bio-RSC purification, peptide sequencing, mass spectrometric analy-phys. Biomol. Struct. 25, 137–162.ses, and sequence comparisons were performed exactly as de-

scribed previously (Tempst et al., 1994; Cairns et al., 1996c). Imbalzano, A.N., Kwon, H., Green, M.R., and Kingston, R.E. (1994).

Actin-Related Proteins and Chromatin Remodeling651

Facilitated binding of TATA-binding protein to nucleosomal DNA. Tempst, P., Geromanos, S., Elicone, C., and Erdjument-Bromage,Nature 370, 481–485. H. (1994). Improvements in microsequencer performance for low

picomole sequence analysis. METHODS Companion Meth. Enzy-Ito, T., Bulger, M., Pazin, M.J., Kobayashi, R., and Kadanoga, J.mol. 6, 248–261.(1997). ACF, an ISWI-containing and ATP-utilizing chromatin assem-

bly and remodeling factor. Cell 90, 145–155. Treich, I., and Carlson, M. (1997). Interaction of a Swi3 homologwith Sth1 provides evidence for a Swi/Snf2related complex with anJiang, Y.W., and Stillman, D.J. (1996). Epigenetic effects on yeastessential function in Saccharomyces cerevisiae. Mol. Cell. Biol. 17,transcription caused by mutations in an actin-related protein present1768–1775.in the yeast nucleus. Genes Dev. 10, 604–619.Treich, I., Cairns, B.R., Santos, T., Brewster, E., and Carlson, M.Kabsch, W., Mannherz, H.G., Suck D., Pai, E.F., and Holmes, K.C.(1995). SNF11, a new component of of the yeast SNF-SWI complex(1990). Atomic structure of the actin:DNase I complex. Nature 347,that interacts with a conserved region of SNF2. Mol. Cell Biol. 15,37–44.4240–4248.Kim, Y.-J., Bjorklund, S., Li, Y., Sayre, M.H., and Kornberg, R.D.Tsuchiya, E., Uno, A., Masuoka, K., Kanemori, Y., Okabe, S., and(1994). A multiprotein mediator of transcriptional activation and itsMikayawa, T. (1992). The Saccharomyces cerevisiae NPS1 gene, ainteraction with the C-terminal repeat domain of RNA polymerasenovel CDC gene which encodes a 160 kDa nuclear protein involvedII. Cell 77, 599–608.in G2 phase control. EMBO J. 11, 4017–4026.Kingston, R.E., Bunker, C.A., and Imbalzano, A.N. (1996). RepressionTsukiyama, T., and Wu, C. (1995). Purification and properties of anand activation by multiprotein complexes that alter transcription.ATP-dependent nucleosome remodeling factor. Cell 83, 1011–1020.Genes Dev. 10, 905–920.

Varga-Weisz, P.D., Wilm, M., Bonte, E., Dumas, K., Mann, M., andKoleske, A.J., and Young, R. (1994). An RNA polymerase II holoen-zyme responsive to activators. Nature 368, 466–469. Becker, P.B. (1997). Chromatin remodeling factor CHRAC contains

the ATPases ISWI and topoisomerase II. Nature 388, 598–599.Kwon, H., Imbalzano, A.N., Khavari, P.A., Kingston, R.E., and Green,M.R. (1994). Nucleosome disruption and enhancement of activator Wang, W., Cote, J., Xue, Y., Zhou, S., Khavari, P.A., Biggar, S.R.,binding by a human SWI/SNF complex. Nature 370, 477–481. Muchardt, C., Kalpana, G., Goff, S.P., Yaniv, M., Workman, J.L., and

Crabtree, G.R. (1996a). Purification and biochemical heterogeneityLaurent, B.C., Treitel, M.A., and Carlson, M. (1990). The SNF5 proteinof the mammalian SWI-SNF complex. EMBO J. 15, 5370–5382.of Saccharomyces cerevisiae is a glutamine- and proline-rich tran-

scriptional activator that affects expression of a broad spectrum of Wang, W., Xue, Y., Zhou, S., Kuo, A., Cairns, B.R., Tijan, R., andgenes. Mol. Cell. Biol. 10, 5616–5625. Crabtree, G.R. (1996b). Diversity and specialization of mammalian

SWI/SNF complexes. Genes Dev. 10, 2177–2130.Laurent, B.C., Treitel, M.A., and Carlson, M. (1991). Functional inter-dependence of the yeast SNF2, SNF5, and SNF6 proteins in tran- Wertman, K.F., Drubin, D.G., and Botstein, D. (1992). Systematicscriptional activation. Proc. Natl. Acad. Sci. USA 88, 2687–2691. mutational analysis of the yeast ACT1 gene. Genetics 132, 337–350.Laurent, B.C., Yang, X., and Carlson, M. (1992). An essential Sac- Wilbanks, S.M., Deluca-Flaherty, C., and McKay, D.B. (1994). Struc-charomyces cerevisiae gene homologous to SNF2 encodes a heli- tural basis of the 70-kilodalton heat shock cognate protein ATPcase-related protein in a new family. Mol. Cell. Biol. 12, 1893–1902. hydrolytic activity. J. Biol. Chem. 17, 12893–12898.Neigeborn, L., and Carlson, M. (1984). Genes affecting the regulation Winston, F. (1992). Analysis of SPT genes: a genetic approach to-of SUC2 gene expression by glucose repression in Saccharomyces ward analysis of TFIID, histones, and other transcription factors ofcerevisiae. Genetics 108, 845–858. yeast. In Transcriptional Regulation, S.L. McKnight and K. Yamo-Papoulas, O., Beek, S.J., Moseley, S.L., McCallum, C.M., Sarte, M., moto, eds. (Cold Spring Harbor, NY: Cold Spring Harbor LaboratoryShearn, A., and Tamkun, J.W. (1998). The Drosophila trithorax group Press), pp. 1271–1293.proteins BRM, ASH1 and ASH2 are subunits of the distict protein Winston, F., and Carlson, M. (1992). Yeast SNF/SWI transcriptionalcomplexes. Development, 125, 3955–3966. activators and the SPT/SIN chromatin connection. Trends Genet.Peterson, C.L., and Herskowitz, I. (1992). Characterization of the 8, 387–391.yeast SWI1, SWI2, and SWI3 genes, which encode a global activator

Winston, F., Dollard, C., and Ricupero-Hovasse, S.L. (1995). Con-of transcription. Cell 68, 573–583.

struction of a set of convenient S. cerevisiae strains that are isogenicPeterson, C.L., Dingwall, A., and Scott, M.P. (1994). Five SWI/SNF to S288C. Yeast 11, 53–55.gene products are components of a large multi-subunit complex

Zhao, K., Wang, W., Rando, O.J., Xue, Y., Swiderek, K., Kuo, A., andrequired for transcriptional enhancement. Proc. Natl. Acad. Sci. USACrabtree, G.R. (1998). Phosphoinostitol-dependent targetingof the91, 2905–2908.SWI/SNF-like BAF complex to nuclear chromatin/matrix during lym-

Peterson, C.L., Zhao, Y., and Chait, B.T. (1998). Subunits of the phocyte activation. Cell, in press.yeast SWI/SNF complex are members of the Actin-related protein(ARP) family. J. Biol. Chem. 273, 23641–23644.

Poch, O., and Winsor, B. (1997). Who’s who among Saccharomycescerevisiae actin-related proteins? A classification and nomenclatureproposal for a large family. Yeast 13, 1053–1058.

Reyes, J.C., Muchardt, C., and Yaniv, M. (1997). Components of thehuman SWI/SNF complex are enriched in active chromatin and areassociated with the nuclear matrix. J. Cell Biol. 137, 263–274.

Roberts, S., and Winston, F. (1997). Essential functional interactionsof SAGA, a Saccharomyces cerevisiae complex of Spt, Ada, andGcn5 proteins, with the Snf/Swi and Srb/Mediator complexes. Ge-netics 147, 451–465.

Sikorski, R.S., and Hieter, P. (1989). A system of vectors and yeasthost strains designed for efficient manipulation of DNA in Saccharo-myces cerevisiae. Genetics 122, 19–27.

Stern, M.J., Jensen, R.E., and Herskowitz, I. (1984). Five SWI genesare required for expression of the HO gene in yeast. J. Mol. Biol.178, 853–868.

Tamkun, J.W., Deuring, R., Scott, M.P., Kissinger, M., Pattatucci,A.M., Kaufman, T.C., and Kennison, J.A. (1992). brahma: a regulatorof Drosophila homeotic genes structurally related to the yeast tran-scriptional activator SNF2/SWI2. Cell 68, 561–572.