Eur. J. Biochem. 221, 917-925 (1994) 0 FEBS 1994 Molecular characterization of human TRPM-2/clusterin, a gene associated with sperm maturation, apoptosis and neurodegeneration Paul WONG’.’, Daniel TAILLEFER’, Johnathon LAKINS’, Jean PINEAULT’, Gerald CHADER’ and Martin TENNISWOOD’ ’ Department of Biochemistry, University of Ottawa, Ottawa, Canada ’ Laboratory of Retinal Cell and Molecular Biology, National Institutes of Health (NEI), Bethesda, USA (Received February 11, 1994) - EJB 94 0194/2 The TRPM-2klusterin gene and its cognate protein has been characterized in a number of species, Although the functional role, or roles, of the TRPM-2klusterin protein remains to be firmly established, the gene has been implicated in a variety of physiological processes, including sperm maturation, lipid transport, membrane remodelling and inhibition of the complement cascade. TRPM-2klusterin is induced de now during the regression of the prostate and other hormone- dependent tissues after hormone ablation, and is over-expressed in several human neurodegenerative diseases including Alzheimer’s disease, epilepsy and retinitis pigmentosa. We describe the genomic structure of the human TRPM-2klusterin gene which is organized into nine exons, ranging in size from 47 bp (exon I) to 412 bp (exon V), spanning a region of 16580 bp. Comparison with sequences registered in the databases shows that it has extensive similarity to the human protein designated as SP-40,40 or complement-lysis inhibitor (CLI), a protein that appears to block the membrane-attack complex of complement. However, the cDNA sequences reported for SP-40,40 and CLI diverge significantly in the 5’ untranslated region of the mRNA (coded for by exon I), raising the possibility that the TRPM-2klusterin gene is present in the human genome as a small multi-gene family or that there are several alternate exon I sequences in the TRPM-2 gene. Southern analysis and fluores- cent in situ hybridization suggest that the clusterin gene is a single-copy gene, and that, if alternative exon I sequences are present in the genome, they lie outside of the A clones that have been charac- terized. Analysis of the promoter region of the human TRPM-2hlusterin gene shows many simi- larities to the rat TRPM-2klusterin promoter including a putative control region containing several potential regulatory elements that may regulate the complex tissue-specific control of the gene which must be constitutively expressed in some tissues but is inducible in others. Clusterin was first identified in ram rete testis fluid, where it was shown to be an 80-kDa, heterodinieric glyco- protein that facilitated the aggregation of a variety of cells in culture (Fritz et al., 1983; Blaschuk et al., 1983). Recently it has been established that sulfated glycoprotein 2 (SGP-2) cDNA, encodes the rat homolog of clusterin which is secreted by the Sertoli cells of the testis (O’Bryan et al., 1990; Collard and Griswold, 1987; Smith et al., 1992) and by the epithelial cells in the caput of the epididymis (Sylves- ter et al., 1991; Grima et al., 1990; Cheng et al., 1990; Zakeri et al., 1992). The clusterin transcript has also been detected at low levels in normal rat brain and over-expression of the gene has been associated with a number of human neurodegenerative disorders, including Alzheimer’s disease, epilepsy and retinitis pigmentosa (May et al., 1990; Danik et al., 1991; Michel et al., 1992; Duguid et al., 1989; Jones et Correspondence to M. Tenniswood, W. Alton Jones Cell Science Fax: +1 518 523 1849. Abbreviations. SGP-2, sulfated glycoprotein 2 ; SP-40,40, serum protein 40,40 ; CLI, complement-lysis inhibitor; FISSH, fluores- cence in situ suppression hybridization. Note. The novel nucleotide sequence data published here have been submitted to the GenBank sequence data bank and are available under accession numbers M63378 and M63376. Center, 10 Old Barn Road, Lake Placid, NY 12946, USA al., 1992). Another homolog of clusterin, TRPM-2, has been independently identified and characterized as a testosterone- repressed prostatic message that is induced in the rat ventral prostate by chemical or surgical castration to levels approxi- mately 100-fold higher than those seen in the testis (LCger et al., 1987, 1988; Wong et al., 1993b). Subsequently clusterin has been shown to be induced in a wide variety of solid tissues and tumors that undergo apoptosis in response to hor- monal ablation or other extrinsic signals (Rennie et al., 1988; Kyprianou and Isaacs, 1989; Sawczuk et al., 1989; Kypria- nou et al., 1991a and b; Bettuzzi et al., 1991; Rosenberg and Paller, 1991). The human homolog of clusterin has been given a number of acronyms including serum protein 40,40 (SP- 40,40; Kirszbaum et al., 1989; O’Bryan et al., 1990) and complement-lysis inhibitor (CLI ; Jenne and Tschopp, 1989). Other homologs to clusterin have been independently cloned and characterized in a number of other species, and in other diverse tissues in both rat and human (Fritz and Murphy, 1993). For the sake of simplicity, we will refer to the gene as clusterin. The physiological role, or roles, of clusterin have not been clearly elucidated. The protein has been impli- cated in a variety of biological processes including lipid transport (de Silva et al., 1990), inhibition of complement attack (Kirszbaum et al., 1989; Jenne and Tschopp, 1989),
Transcript
Eur. J. Biochem. 221, 917-925 (1994) 0 FEBS 1994
Molecular characterization of human TRPM-2/clusterin, a gene associated with sperm maturation, apoptosis and neurodegeneration Paul WONG’.’, Daniel TAILLEFER’, Johnathon LAKINS’, Jean PINEAULT’, Gerald CHADER’ and Martin TENNISWOOD’ ’ Department of Biochemistry, University of Ottawa, Ottawa, Canada ’ Laboratory of Retinal Cell and Molecular Biology, National Institutes of Health (NEI), Bethesda, USA
(Received February 11, 1994) - EJB 94 0194/2
The TRPM-2klusterin gene and its cognate protein has been characterized in a number of species, Although the functional role, or roles, of the TRPM-2klusterin protein remains to be firmly established, the gene has been implicated in a variety of physiological processes, including sperm maturation, lipid transport, membrane remodelling and inhibition of the complement cascade. TRPM-2klusterin is induced de now during the regression of the prostate and other hormone- dependent tissues after hormone ablation, and is over-expressed in several human neurodegenerative diseases including Alzheimer’s disease, epilepsy and retinitis pigmentosa. We describe the genomic structure of the human TRPM-2klusterin gene which is organized into nine exons, ranging in size from 47 bp (exon I) to 412 bp (exon V), spanning a region of 16580 bp. Comparison with sequences registered in the databases shows that it has extensive similarity to the human protein designated as SP-40,40 or complement-lysis inhibitor (CLI), a protein that appears to block the membrane-attack complex of complement. However, the cDNA sequences reported for SP-40,40 and CLI diverge significantly in the 5’ untranslated region of the mRNA (coded for by exon I), raising the possibility that the TRPM-2klusterin gene is present in the human genome as a small multi-gene family or that there are several alternate exon I sequences in the TRPM-2 gene. Southern analysis and fluores- cent in situ hybridization suggest that the clusterin gene is a single-copy gene, and that, if alternative exon I sequences are present in the genome, they lie outside of the A clones that have been charac- terized. Analysis of the promoter region of the human TRPM-2hlusterin gene shows many simi- larities to the rat TRPM-2klusterin promoter including a putative control region containing several potential regulatory elements that may regulate the complex tissue-specific control of the gene which must be constitutively expressed in some tissues but is inducible in others.
Clusterin was first identified in ram rete testis fluid, where it was shown to be an 80-kDa, heterodinieric glyco- protein that facilitated the aggregation of a variety of cells in culture (Fritz et al., 1983; Blaschuk et al., 1983). Recently it has been established that sulfated glycoprotein 2 (SGP-2) cDNA, encodes the rat homolog of clusterin which is secreted by the Sertoli cells of the testis (O’Bryan et al., 1990; Collard and Griswold, 1987; Smith et al., 1992) and by the epithelial cells in the caput of the epididymis (Sylves- ter et al., 1991; Grima et al., 1990; Cheng et al., 1990; Zakeri et al., 1992). The clusterin transcript has also been detected at low levels in normal rat brain and over-expression of the gene has been associated with a number of human neurodegenerative disorders, including Alzheimer’s disease, epilepsy and retinitis pigmentosa (May et al., 1990; Danik et al., 1991; Michel et al., 1992; Duguid et al., 1989; Jones et
Correspondence to M. Tenniswood, W. Alton Jones Cell Science
protein 40,40 ; CLI, complement-lysis inhibitor; FISSH, fluores- cence in situ suppression hybridization.
Note. The novel nucleotide sequence data published here have been submitted to the GenBank sequence data bank and are available under accession numbers M63378 and M63376.
Center, 10 Old Barn Road, Lake Placid, NY 12946, USA
al., 1992). Another homolog of clusterin, TRPM-2, has been independently identified and characterized as a testosterone- repressed prostatic message that is induced in the rat ventral prostate by chemical or surgical castration to levels approxi- mately 100-fold higher than those seen in the testis (LCger et al., 1987, 1988; Wong et al., 1993b). Subsequently clusterin has been shown to be induced in a wide variety of solid tissues and tumors that undergo apoptosis in response to hor- monal ablation or other extrinsic signals (Rennie et al., 1988; Kyprianou and Isaacs, 1989; Sawczuk et al., 1989; Kypria- nou et al., 1991a and b; Bettuzzi et al., 1991; Rosenberg and Paller, 1991).
The human homolog of clusterin has been given a number of acronyms including serum protein 40,40 (SP- 40,40; Kirszbaum et al., 1989; O’Bryan et al., 1990) and complement-lysis inhibitor (CLI ; Jenne and Tschopp, 1989). Other homologs to clusterin have been independently cloned and characterized in a number of other species, and in other diverse tissues in both rat and human (Fritz and Murphy, 1993). For the sake of simplicity, we will refer to the gene as clusterin. The physiological role, or roles, of clusterin have not been clearly elucidated. The protein has been impli- cated in a variety of biological processes including lipid transport (de Silva et al., 1990), inhibition of complement attack (Kirszbaum et al., 1989; Jenne and Tschopp, 1989),
91 8
sperm maturation (Sylvester et al., 1991 ; Zakeri et al., 1992) and membrane re-modelling during apoptosis (Tenniswood et al., 1992; Wong et al., 1993b). Indeed, the evolutionary conservation of clusterin together with its expression in a multitude of biological processes suggest that the protein is involved in more than one essential biological function (Jenne and Tschopp, 1992). To obtain a better understanding of the control of clusterin expression and its role in these diverse physiological functions, we have defined the struc- tural organization and expression of the human clusterin gene.
MATERIALS AND METHODS Preparation and screening of cDNA and genomic libraries
Blood samples for DNA extraction were collected in EDTA-containing vacuum containers. High-molecular-mass DNA was extracted as previously described (Wong et al., 1989). Human genomic libraries were constructed in EMBL- 3, using a modified protocol designed to enhance the repre- sentation of hard-to-clone fragments, and were propagated by infection of Escherichia coli Mb406 (Wong et al., 1993a). A Agtll human testes cDNA library was obtained (Clontech) and propagated by infection of Y1090.
Labeling of DNA probes Double-stranded DNA probes were radio-labeled with
[a-”PIdCTP by oligolabeling (Feinberg and Vogelstein, 1983). The incorporated radioactivity was separated from un- incorporated nucleotides on G-50 Sephadex columns. The specific activity of the labeled probes was not less than lo8 cpm/pg. DNA probes used for fluorescence in situ sup- pression hybridization (FISSH) analysis were nick translated in the presence of digoxigenin- 11 -dUTP ; unincorporated nu- cleotides were removed as described above.
Library screening Plaque lifts were made using Hybond N membranes
(Amersham) and were processed as previously described (Allday and Jones, 1987). The membranes were prehybrid- ized, hybridized, and washed under stringent conditions as recommended by the manufacturer. Autoradiography was performed at -70°C for 16 h to 4 days with Cronex X-ray film between Kodak X-omatic intensifying screens.
Subcloning and sequencing Genomic subclones were generated by restriction endo-
nuclease digestion of the EMBL-3 clusterin genomic frag- ments and subcloning into the pTZ18R or pTZ19R vector. The insert from the full-length cDNA clone, HT7, was enzy- mically excised with EcoRI and subcloned into the EcoRI site of PTZ19R. Deletion clones of both genomic and cDNA clones were generated using the Erase-a-base system (Pro- mega Biotec) and sequenced using the chain-termination method (Sanger et al., 1977) in the presence of [ u - ~ ~ S I ~ A T P and T7 and SP6 primers, using SequenaseTM (USB). Compu- terized analysis of the sequences obtained, and comparison with the GenBank database, were performed using both MicrogenieTM (Beckman Canada) and PC gene (Intelligene- tics).
Southern and Northern analysis
Southern blots were made using Genescreen Plus nylon membrane (Dupont). 5 pg human genomic DNA was di- gested to completion with various restriction endonucleases and fractionated on a 1% agarose gel and transferred to Hy- bond N membranes. In addition, commercial zooblots were obtained from Clontech. The membranes were prehybridized for 4 h at 65°C in 10% dextran sulphate, 1 % SDS, 1 M NaCl and 10mg/ml sheared salmon sperm DNA, and hybridized overnight in the same solution at 65°C with the denatured labeled probe (2X106 cpdml) . The membranes were either washed stringently as instructed by the manufacturer, or twice for 15 min in 2 X NaCI/Cit (NaCVCit; 0.3 M NaC1, 0.03 M sodium citrate) at 65 “C, once for 30 min in 2 X NaCV Cit, 0.1% SDS at 65”C, and once in 0.1 X NaCl/Cit, 0.1% SDS for 15 min at 65°C. Autoradiography was performed as described above.
For Northern analysis a membrane containing poly(A)- rich RNA from different adult human tissues was obtained from Clontech. In addition, a membrane containing 20 pg total RNA, extracted from several tissues at different times during development, was obtained from BIOS laboratories. The prehybridization, hybridization and stringent wash con- ditions were essentially as described above.
FISSH analysis
FISSH analysis was performed at BIOS Laboratories using variations of standard methodologies (Lichter et al., 1990). Digoxigenin-dUTP-labeled DNA probe was com- bined with sheared human DNA in 50% formamide, 2X NaCVCit and 10% dextran sulfate and hybridized to dena- tured human metaphase chromosome spreads, prepared from cultured normal human lymphocytes, at 37°C overnight. To remove excess probe after hybridization, slides were washed once at 40°C for 10 min in 50% formamide, 2 X NaCVCit and once at 40°C for 2 min in 2 X NaCVCit. Probe-specific hybridization signal was detected by application of anti-di- goxigenin fluorescein isothiocyanate (1.3 pg/ml in 4 X NaCV Cit, 1% BSA, 0.1% Tween), chromosomes were then coun- terstained with propidium iodide and visualized under a Ni- kon Opthiphot microscope equipped with epifluorescence.
RESULTS
Analysis of clusterin cDNA clones
A 1.67-kb, human clusterin cDNA clone was isolated from the Agtll human testes cDNA library by screening with 17H, the full-length rat cDNA clone corresponding to clus- terin (Wong et al., 1993b). The human clusterin cDNA clone, designated HT7, was shown to be missing 27 nucleotides from the 5’end of the expressed sequence by alignment with the rat clusterin cDNA, the rat genomic and human genomic sequences (data not shown). The missing segment of the hu- man exon I sequence was deduced from the alignment of the existing 5’HT7 sequence with 5’ human clusterin genomic, rat genomic and rat cDNA sequences (data not shown). The human clusterin mRNA is of 1674 nucleotides (Fig. 1 a) and contains a large open reading frame spanning 1347 nucleo- tides (between +77 and +1424), leaving 76 nucleotides of 5’ untranslated sequence and 246 nucleotides of 3’ untranslated sequence. The putative (ATG) start codon at position (+77)
919
A vl v2 ACGCGGCGTCGCUGWGCAGCAGCATGGGCACAGGGTCCGTGACCGAGGCGTGCAAAGACTCCAGAATTGGAGG~TGATGAAGACTCTGCTGCTGTTTGTGGGGCTGCTGCTGACC
v3 TGGGAGAGTGGGCAGGTCCTGGGGGACCAGACGGTCTCAGACAATGAGCTCCAG~AATGTCCMTCAGGGAAGTAAGTACGTCMTMGGAAATTCMTGCTGTCMCGGGGTG~ TrpGLuSerG I yG InVal LeuGL yAspGLnThrVal SerAspAsnGLuLeuG L nG LuMet SerAsnGLnG LySerLysTyrVa LAsnLysG LuI LeG LnAsnALaVal AsnG I yVal Lys
.k C A G A T M A G A C T C T C A T A G A M A C A M C ~ G A G C G C A A G A ~ C T G C T C A G C A A C C T A G A A G M G C C A A G M G A A ~ G A G G A T G C C C T ~ T G A ~ C C A G G ~ T C A G A G A C ~ G GLnI LeLysThrLeuI LeGluLysThrAsnCLuGluArgLysThrLeuLeuSerAsnLeuG I uGl uA LaLysLysLysLysG IuAspA LaLeuAsnGluThrArgGLuSerGluThrLys
GAGAGGTTGACCAGGAMTACMCGAGCTGCT~GTCCTACCAGTGGAAGATGCTCAACACCTCCTCCTTGCTGGAGCAGCT~C~GCAGTTT~TGGGTGTCCCGGCTGG~C GLuArgLeuThrArgLysTyrAsnGLuLeuLeuLysSerTyrGlnTrpLysMetLeuAsnThrSerSerL~LeuGLuG InLeuAsnGluG L nPheAsnTrpVaLSerArgLeuAIaAsn
v9 ATCACTGTGACGGTCCCTGTAGAAGTCTCCAGGMGAACCCTAAATTTATGGAGACCGTGGCGGAGAAAGCGCTGCAGGAATACCGC~GCACCGGGAG~GT~GATGTGGATGTT I leThrValThrValProValGluValSerArgLysAsnProLysPh~etG~uThrVaLALaGluLysA~aLe~lnGLuTyrArgLysLysHisArgGLuGLu---------------
118
238
358
478
598
71 8
a38
958
1 078
1198
1318
1438
1558
1674
CCTGAATGCACAGGCAGCCCGGCCCAAGTCCCACTAGGCAGATGGATTCGGTGT 1 2 0 A 1 ...........................................................
CLI CLU s p 4 0 4 0 ............................................................
v2 CLI G A A G G G C T G G C T G C T G T T G C C T C C G G C T C T T G ~ G T C A A C 180 CLU CGCGGCGTCGCCAGGAGCAGCAGCATGGGCACAGGGTCCGTGACCGAGGCGTGC~GAC 61 s p 4 0 4 0 _.._.._.____-..--.-..~~~.~..~~.-.. CGCCGCTGACCGAGGCGTGCAAAGAC 27 * * * * * * * * * * * * * * * * *
. . . . . . . . . . . . . . . . . . . . . . . .
204 8 5 41
Fig. 1. Nucleotide Sequence of the human clusterin cDNA and comparison to SP-40,40 and CLI. (A) The nucleotide sequence of the cDNA (nucleotides 1-1674), with the predicted translation product. The largest open reading frame from +77 to +1424 spans 1347 nucleotides stopping at nucleotide (1424) leaving 76 nucleotides of 5' untranslated sequence and 246 nucleotides of 3' untranslated sequence. The putative (ATG) start codon is present at position (+77). There is a polyadenylation consensus sequence (AATAAA) at position (1653). (V) The exon positions are given above the coding sequence. The predicted protein, is 449 amino acids and is characterized by 10 cysteine residues (+) and 6 potential glycosylation sites (0). The N-terminal 21-22 amino acids are typical of a secretory signal sequence. (B) Alignment of S'untranslated sequences of clusterin, SP-40,40 and CLI. (O), The positions of the exons; (*), identical nucleotides in all three sequences.
is in agreement with published consensus translation-start se- quences (Kozak, 1987; Cavener and Ray, 1991). There is a polyadenylation consensus sequence (AATAAA) at position (+1653), approximately 24 nucleotides from the start of the
poly(A) tail. The predicted protein sequence is of 449 amino acids and is characterized by 10 cysteine residues and 6 po- tential glycosylation sites. The N-terminal 21 -22 amino acids are typical of a secretory signal sequence.
920
I I I m I V V V I w vm M
E H E H E H K E H I i f I I I I 5' 3'
m7 WS ws6 11155 His4
H5.1.1.1 genomk ins& A H9.1.1.1 genomic insert
H l K b
Fig. 2. Structure of the human clusterin gene. The human clus- terin gene is organized into nine exons and eight introns spanning a region of 16580 bp. The diagram shows the restriction sites (E, EcoRI; H, HindIII; K, KpnI) and subclones used for sequencing (depicted by the arrows) generated from two overlapping genomic clones; 1 H5.1.1.1 and /z H9.1.1.1.
Two human homologs to clusterin have been previously characterized, CLI (Jenne and Tschopp, 1989) and SP40-40 (Kirszbaum et al., 1989; O'Bryan et al., 1990). Computer alignment of the three sequences shows that they are essen- tially identical from the start of the translated sequence to the 3' end of the d N A , differing by three conservative sub- stitutions. However the cDNA sequences differ significantly in the 5' untranslated sequences (Fig. 1 B). This finding sug- gests that clusterin may either be a member of a small, highly similar multi-gene family, or a single gene in which the 5'
untranslated sequences are expressed and ligated to the cod- ing sequence in a tissue-specific or development-specific fashion.
Structure and chromosomal localization of the human clusterin gene
An unamplified MboI human genomic EMBL-3 library was screened to identify A clones harboring the clusterin ge- nomic sequence. Restriction mapping, verified by hybridiza- tion with HT7 and purified clusterin genomic fragments, established that the complete human gene was contained within two overlapping genomic clones, AH5.1.1.1 and AH9.1.1.1, spanning 18.5 kb (Fig. 2). All the coding regions, and approximately 90% of the intronic regions, including all exonlintron splice junctions, were subcloned and sequenced. Sequence comparison of the cDNA sequence with the geno- mic sequence revealed that the clusterin gene is organized into nine exons and eight introns spanning a region of 16580 bp (Fig. 2) The sizes of exons range from 47 bp (exon I) to 412 bp (exon V). The size of introns range from 207 bp (intron 8) to 4377 bp (intron 6). Appropriate consensus splice sites are present at each exodintron boundary.
The divergence in the 5' untranslated sequences iden- tified by comparison of clusterin, CLI and SP-40,40 occurs at, or very near to, the boundary of intron I and exon 11, suggesting that these sequences may be derived from dif- ferential splicing of unique exon I sequences to the remainder of the mRNA. The putative exon I lengths are 47, 12, and 166 nucleotides for clusterin, SP-40,40 and CLI, respectively. While the corresponding sequence for the clusterin cDNA
Fig. 3. Southern analysis of the human clusterin gene and comparison to other species. (A) Southern analysis of the human clusterin gene. Human genomic DNA was restriction digested with the indicated restriction enzymes, electrophoresed and transferred to Nylon membranes prior to hybridization with radiolabeled HT7 (2 X lo6 cpdml) . The hybridizing bands match the restriction fragments predicted from the sequence data of H5.1.1.1 and H9.1.1.1 genomic clones. (B) Zooblot of clusterin. DNA from a variety of species was restriction digested with EcoRI, electrophoresed and transferred to Nylon membrane prior to hybridization with radiolabeled HT7 (2 X106 cpdml) . The membrane was hybridized for 24 h and washed under stringent conditions as described in Materials and Methods. The autoradiogram was exposed for 2 days.
23.3 23.2 p 23.1
22 ]El -JpSgEl 21.3
21.2 21.1
12
11.2 11.1 11.1 11.21 11.22 11.23 12
13
21.1
21.2
q 21.3
22.1 22.2 22.3
23
p-KJ - 1
24.1 24.2 24.3
C
921
Fig. 4. FISSH chromosomal localization of human clusterin. (A) Profile of a single cell showing co-localization of the clusterin genomic probe (H9.1.1.1) to two pairs of chromosome eight chromatids and D8Z1 (indicated by arrow) to the centromeric region of the same chromosome 8 pair. (B) Enlarged view, showing localization of the clusterin genomic probe H9.1.1.1 (indicated by arrow) to the mid region of the short arm of chromosome 8, 8p. (C) Ideogram of human chromosome 8 showing the relative distance of the clusterin locus between the centromere and telomere of the short arm of chromosome 8 and the position of other genes known to be localized near this region.
sequence is present in the genomic clones, no similar regions for the SP-40,40 and CLI sequences are present in the 4.5 kb of sequence upstream of the start of exon 11, suggesting that, if they exist, they lie outside of the region spanned by the existing genomic clones.
To further examine the possibility that there are several closely related clusterin genes in the genome, human geno- mic DNA was digested with several restriction enzymes, Southern blotted and hybridized to the full-length HT7 cDNA (Fig. 3A). Since all of the observed bands are pre- dicted on the basis of the genomic sequence and there are no unpredicted cross-hybridizing bands, it is most likely that clusterin is present in the genome as a single-copy gene, as previously suggested (Purello et al., 1991). This is further corroborated by zooblot analysis (Fig. 3B), in which the hu- man cDNA cross-hybridizes with DNA from all of the verte- brate species screened. The intensity of hybridization of the human probe to other mammalian species varies consider- ably, being strongest to the monkey and rabbit, and least in- tense to the rat and mouse. This suggests that the gene has been well conserved during evolution, and makes it unlikely that a second, less well conserved gene is present, but unde- tected, at the same stringency in the human genome.
Chromosomal localization of the human clusterin gene Recently, a number of groups have used the rat SGP-2
cDNA probe to localize the human homolog to human chro- mosome 8 by the analysis of somatic-cell hybrid panels (Slawin et al., 1990; Purrello et al., 1991). In addition, the gene for human SP-40,40 has been localized to chromosome 8 by chromosome-specific dot analysis (Minoshima et al., 1991). We have used FISSH to determine whether other clus- terin homologs can be detected on human chromosomes and to further refine the regional localization of the clusterin lo- cus on human chromosome 8. In co-hybridization in situ ex- periments, both H.9.1.1.1, one of the human clusterin geno- mic clones, and D8Z1 probes were used together for hybrid- ization to metaphase chromosomes (Fig. 4). D8Z1 is a chro- mosome-8-specific centromeric probe and provides unequiv- ocal identification of human chromosome 8. In all instances, chromosomes which hybridized with H9.1.1.1 also showed hybridization with D8Z1 thus localizing the human clusterin gene to chromosome 8. In all cells examined, H9.1.1.1 hy- bridized near the mid-region of the short arm of chromosome 8, 8p. In total, 121 metaphase cells showing clean hybridiza- tion of the H9.1.1.1 probe were examined and the location of the H9.1.1.1 hybridization signal relative to the centro-
922
ddt
Heart Brain Uver Kidney
Fig. 5. Northern analysis of human clusterin expression. (A) Poly(A)-rich RNA (20 pg) from the indicated tissues was electrophoresed on formaldehyde gels, transferred to nylon membranes and hybridized to radiolabeled HT7 insert. The membranes were washed at high stringency and autoradiographed on Cronex X-ray film between X-Omat intensifying filters. (B) Total RNA (20 pg) from the indicated tissues obtained at the indicated times of gestation was electrophoresed on formaldehyde gels and transferred to nylon membranes as described above. The membranes were washed at high stringency and autoradiographed on Cronex X-ray film between X-Omat intensifying filters. The autoradiograms were scanned on an LKB Ultroscan XL enhanced laser densitometer. The results were standardized by compar- son to the hybridization of a 28s rRNA probe to the same blots after stripping the initial hybridization.
mere and telomere of the short arm of chromosome 8 was measured. From this analysis, the clusterin locus was deter- mined to be located 43 % of the distance from the centromere to the telomere (Fig. 4). Correlation of this distance relative to conventional chromosome maps places the gene locus in band 8p21 at a position just distal to the transition between bands 8p12 and 8p21, confirming the recent report that local- ized the band to 8p21 (Fink et al., 1993). There was no evi- dence in any of the spreads examined, of hybridization to other chromosomes.
Tissue-specific expression of clusterin mRNA A profile of clusterin expression in normal human tissues
is presented in Fig. 5A. The steady-state levels of clusterin mRNA are relatively high in normal brain, liver and pan- creas, while the steady-state level of the mRNA is consider- ably lower in heart, lung and kidney. Over-exposure of the autoradiogram also reveals very low levels of expression in the skeletal muscle but there does not appear to be any ex- pression in the placenta. The expression of clusterin in the brain is induced in the fetus at about 20 weeks of age, since there is no apparent clusterin mRNA expression in the central nervous system of the 10-week-old fetus (Fig. 5B). Similarly, the steady-state level of clusterin mRNA is not high enough to be detected in fetal heart and the transcript is only detecta- ble in the adult tissue. In contrast, the steady-state levels of clusterin mRNA are high enough to be detected by Northern analysis in fetal kidney and liver, at both 10 and 20 weeks of gestation, and the level of the transcript continues to increase in the adult.
Analysis of the clusterin promoter region
By computer analysis, it is possible to identify several motifs that may be responsible for the regulation of the clus-
terin gene. The human clusterin gene has a classical promoter region with a TATAA box at (-26) and a GCATT box at (-93). In addition to the human sequence, information is available for the rat (Wong et al., 1993b) and quail (Herault et al., 1992) promoter regions. Direct sequence comparison indicates that the degree of similarity is extremely high (83%) in a region spanning (-139) to ( f l ) for the rat and human sequences (Fig. 6). The similarity drops to (34%) for the remainder of the upstream sequence. A number of clus- tered motifs are conserved in the rat and human genes, in particular the region from -73 to -87 which contains the Spl/NF-2/APl motifs in an extended palindrome. We have suggested that this region is an essential region for clusterin regulation in other mammalian systems (Wong et al., 1993b). In addition there is a HTF-like mini-island just prior to the 5' end boundary of the conserved promoter region as well as a G+C-rich region between the TATAA box and the +1 site which contains several CpG dinucleotides which may be sub- ject to methylation. Although the exact sequence of these regions has not been strictly conserved between rat and hu- man, the precise locations of the G+C-rich regions in the clusterin promoter have been retained through evolution. The avian promoter appears to be quite different since it appears to operate as a TATA-less promoter. In quail neuroretinal cells, transformed with Rous avian sarcoma virus, the gene is regulated through an AP-1 consensus sequence, located 19 nucleotides upstream of the single intiation site (Herault et al., 1992). Furthermore transcriptional control of the avian gene appears to involve a purine-rich element which is not present in either the rat or human promoter regions (Wong et al., 1993b). Since the quail gene, is considerably smaller than the rat and human clusterin genes and appears to lack the exon I of the vertebrate genes, these differences in regulation may reflect evolutionary differences, but could also be due to re-arrangements arising from the transformation process itself (Herault et al., 1992).
TGCACCGGCCCCCACCTCCCGGCTTCCAGAAAGCTCCCCTTGCTTTCCGCGGCATTCTTT 1 I I I I I I I 1 1 I I I I I I I I I / I / l l l / l / l I l l I l l 1 I I I I I I I I I I
-cGCAGGTTTGCAGCCAGCC--AAAGGGGGTGTACTTGAGCAGAGcGCT
GPGcGTGAoTCATGCAGGTTTGCAGCCAGCCCCAAA-GGTGTGTGcGcG~cGGAGcGCT I l I l I I 1 I l 1 I 1 1 l 1 / I / I I I I I / / I / I I I l l I / / I l l I I I I I I I I I I I
I I I I I I I I I I I I I l l 1 I l l 1 I l l I I I I I I I I l l l l l l l I l l I I l l
GHF-1 [ GC-Rich Region I
RAT
HUMAN
RAT
HUMAN
RAT
HUMAN
RAT
HUMAN
RAT
HUMAN
RAT
HUMAN
Fig. 6. Comparison of rat and human clusterin promoters. The degree of similarity in the first 1.50 nucleotides upstream of the promoter is over 80%. The sequence similarity for the next 1.50 nucleotides upstream is less than 35%. cG, CpG dinucleotide repeats; single underline, SP 1 -recognition motif; double underline, AP1 -recognition motif; TATAAA, presumptive TATA box.
DISCUSSION
The clusterin gene is expressed in many solid tissues and tumors undergoing apoptosis (Tenniswood et al., 1992), and it is also expressed in Alzheimer’s disease and several other neurodegenerative disorders (Michel et al., 1992). However, clusterin is not expressed in most hematopoietic cells under- going apoptosis. Furthermore, the presence of the clusterin protein in these tissues is not necessarily indicative of apoptosis since there is considerable evidence that clusterin is expressed during membrane remodelling, scar formation and wound healing, and sperm maturation (Jenne and Tschopp, 1992; May and Finch, 1992), biological processes that do not involve apoptosis. It has been suggested that ex- pression of clusterin in some adult tissues such as the kidney, liver and lung, and during fetal development in the kidney may relate to membrane remodelling or to the development of either fluid/membrane or aidmembrane interfaces (de Silva et al., 1990). The expression of clusterin in the normal adult brain and during development may be related to the requirement for membrane remodelling and cellular plasticity and it is unlikely that the expression of clusterin in normal brain is associated with cell death.
We have established that the human clusterin gene is or- ganized into nine exons and eight introns spanning a region of approximately 16580 bp. Since CLI, SP40-40 and human clusterin appear to represent a single gene locus (as sug- gested by both Southern and FISSH analysis), the presence of three different 5‘ sequences suggests the possibility of al- ternative exon usage during the transcription and processing of the gene. However, we have only identified the exon I sequence reported for the clusterin gene in the available ge- nomic databases. While the data presented here cannot elimi- nate the possibility of alternative exon I usage, this has been eliminated in the rat clusterin gene, where the divergence is thought to be due to a cloning artifact (Wong et al., 1993b).
The variation in the steady-state levels of clusterin ex- pression in different tissues suggests that the regulation of clusterin expression is tightly regulated and tissue specific. The clusterin promoter region contains a classical TATAA box and GCATT box at -26 and -93, respectively. In addi- tion there is an extended palindrome (from -73 to -87) that is conserved in both the rat and human promoter, which contains several well characterized DNA-binding motifs in- cluding AP-1, NF-E2 and SP-1. This suggests that the pro- teins that bind this sequence may be important in the control of clusterin expression. Preliminary gel-shift assays suggest that members of the fos and jun families, as well as other proteins, associate with this region, and probably serve to repress the expression of the gene in the rat ventral prostate, where it is induced de novo during apoptosis (Taillefer, D., unpublished results). This is germane to neurodegenerative processes since it has recently been demonstrated that con- tinuous c-fos expression precedes apoptosis in excitotoxic cell death in the hippocampus and dentate gyrus of transgenic animals (Smeyne et al., 1993). Over-expression of clusterin has been noted in two human neurodegenerative disorders ; Alzheimer’s disease and retinitis pigmentosa (Duguid et al., 1989; May and Finch, 1992; Jones et al., 1992). It is not clear whether the expression of clusterin in these disorders is related to apoptosis, however the increased expression of clusterin continues well after degeneration of the relevant tissue has occurred, suggesting that the gene is probably not induced as part of the apoptosis that may lead to the degener- ation disorder. The localization of clusterin to chromosome 8 excludes this locus as being a candidate for the known familial forms of Alzheimer’s disease (May and Finch, 1992). In addition, the specific localization of clusterin to 8p21 excludes it as being a likely candidate for retinitis pigmentosa 1 (RPl), which has been mapped to 8qll-q22 (Lehmer et al., 1992). Since clusterin expression is elevated in both of these neurodegenerative phenotypes, clusterin in-
924
duction may be a secondary consequence of the disease phe- notype.
The presence of a G+C-rich/HTF-like mini-island, that is susceptible to methylation raises the possibility that the developmental regulation of the expression of the clusterin gene may also be dependent on the methylation status of the gene, and the inability to induce the gene in some tissues may relate either to the methylation status of the gene, or its chromatin conformation rather than to the particular combi- nation of binding proteins associated with the promoter.
In summary, molecular characterization of the human clusterin gene allows for a better understanding of the pos- sible mechanisms underlying the temporal and tissue-specific expression of the protein. Moreover an understanding of the gene will be valuable in elucidating the role that clusterin plays in the pathology of several important neurological dis- orders.
The research described in this study was supported by operating grants from the Medical Research Council of Canada and the National Cancer Institute of Canada. PW and JL were supported by graduate studentships from the Medical Research Council of Canada. JP was supported by a graduate studentship from Fonds pour la Formation de Chercheurs et 1’Aide a la Recherche. DT was supported by an Ontario Graduate Scholarship. The authors would like to thank Robert Gricken and Art Lysionok for their continued technical support.
REFERENCES Allday, M. J. & Jones, M. D. (1987) Rapid processing of nitrocellu-
Bettuzzi, S., Troiano, L., Davalli, P., Tropea, F., Ingletti, M. C., Grassilli, E., Monti, D., Corti, A. & Franceschi, C. (1991) In vivo accumulation of sulfated glycoprotein 2 mRNA in rat thymocytes upon dexamethasone-induced cell death, Biochem. Biophys. Res. Commun. 175, 810-815.
Blaschuk, O., Burdzy, K. & Fritz, I. B. (1983) Purification and char- acterization of a cell-aggregating factor (clusterin), the major glycoprotein in ram rete testis fluid, J. Biol. Chem. 258, 7714- 7720.
Cavener, D. R. & Ray, S. C. (1991) Eukaryotic start and stop transla- tion sites, Nucleic Acids Res. 19, 3185-3192.
Cheng, C. Y., Marshal, A., Grima, J. & Mathur, P. P. (1990) Tissue distribution and heterogeneity of rat clusterin in the reproductive tract, Mol. Androl. 2, 73-84.
Collard, M. W. & Griswold, M. D. (1987) Biosynthesis and molecu- lar cloning of sulfated glycoprotein 2 secreted by rat sertoli cells, Biochemistry 26, 3297-3303.
Danik, M., Chabot, J. G., Mercier, C., Benabid, A. L., Chauvin, C., Quirion, R. & Suh, M. (1991) Human gliomas and epileptic foci express high levels of a mRNA related to rat testicular sulfated glycoprotein 2, a purported marker of cell death, Proc. Nut1 Acad. Sci. USA 88, 8577-8581.
de Silva, H. V., Harmony, J. A. K., Stuart, W. D., Gil, C. M. & Robbins, J. (1990) Apolipoprotein J : Structure and tissue distri- bution, Biochemistry 29, 5380-5389.
Duguid, J. R., Bohmont, C. W,, Liu, N. & Tourtelotte, W. W. (1989) Changes in brain gene expression shared by scrapie and Alz- heimer disease, Proc. Nut1 Acad. Sci. USA 86, 7260-7264.
Feinherg, A. P. & Vogelstein, B. (1983) A technique for radio- labeling DNA restriction endonuclease fragments to high specific activity, Anal. Biochem. 132, 6-13.
Fink, T. M., Zimmer, M., Tschopp, J., Etienne, J., Jenne, D. E. & Lichter, P. (1993) Human clusterin (CLI) maps to 8p21 in prox- imity to lipoprotein lipase (LPL) gene, Genomics 16, 526-528.
Fritz, I. B., Burdzy, K., Setchell, B. & Blaschuk, 0. (1983) Ram rete testis fluid contains a protein (clusterin) which influences cell-cell interactions in vitro, Biol. Reprod. 28, 1173-1188.
Fritz, I. B. & Murphy, B. (1993) Clusterin: insights into a multifunc- tional protein, Trends Endocrinol. Metab. Y, 41 -45.
Grima, J., Zwain, I., Lockshin, R. A., Bardin, C. W. & Cheng, C. Y. (1990) Diverse secretory patterns of clusterin by epididymis and prostatekeminal vesicles undergoing cell regression following orchiectomy, Endocrinology 126, 2989 - 2997.
Herault, Y., Chatelain, G., Brun, G. & Michel, D. (1992) V-src- induced-transcription of the avian clusterin gene, Nucleic Acids Res. 20, 6377-6383.
Jenne, D. E. & Tschopp, J. (1989) Molecular structure and functional characterization of a human complement cytolysis inhibitor found in blood and seminal plasma: identity to sulfated glyco-
, protein 2, a constituent of rat testis fluid, Proc. Nut1 Acad. Sci. USA 86, 7123-7127.
Jenne, D. E. & Tschopp, J. (1992) Clusterin: the intriguing guises of a widely expressed glycoprotein, Trends Biochem. Sci. 17,
Jones, S. E., Meerbux, J. M. A,, Yeats, D. A. & Neal, M. J. (1992) Analysis of differentially expressed genes in retinitis pigmentosa retinas: altered expression of clusterin mRNA, FEBS Lett. 300,
Kirszbaum, L., Sharpe, J. A., Murphy, B., d’Apice, A. J., Classon, B., Hudson, P. & Walker, I. D. (1989) Molecular cloning and characterization of the novel, human complement-associated pro- tein, SP-40,40 : a link between the complement and reproductive systems, EMBO J. 8, 711 -718.
Kozak, M. (1987) An analysis of 5’-noncoding sequences from 699 vertebrate messenger RNAs, Nucleic Acids Res. 15, 8125-8132.
Kyprianou, N., Alexander, R. B. & Isaacs, J. T. (1991a) Activation of programmed cell death by recombinant human tumor necrosis factor plus topoisomerase 11-targeted drugs in L929 tumor cells, J. Nut1 Cancer Inst. 83, 346-350.
Kyprianou, N., English, H. F., Davidson, N. E. & Isaacs, J. T. (1991 b) Programmed cell death during regression of the MCF- 7 human breast cancer following estrogen ablation, Cancer Res.
Kyprianou, N. & Isaacs, J. T. (1989) “Thymineless” death in andro- gen-independent prostatic cancer cells, Biochem. Biophys. Res. Commun. 165, 73-81.
LCger, J. G., Le Guellec, R. & Tenniswood, M. P. (1988) Treatment with antiandrogens induces an androgen-repressed gene in the rat ventral prostate, Prostate 13, 131-142.
LCger, J. G., Montpetit, M. L. & Tenniswood, M. P. (1987) Charac- terization and cloning of androgen-repressed mRNAs from rat ventral prostate, Biochem. Biophys. Res. Commun. 147, 196- 203.
Lehmer, J. M., Heckenlively, J. R., Stone, E. M., Kimura, A. E., Blanton, S. H. & Daiger, S. P. (1992) Clinical characterization of chromosome 8 autosomal dominant retinitis pigmentosa (UCLA RPOI), Invest. Ophthalmol. & Visual Sci. 33, 1396.
Lichter, P., Chang, T., Call, K., Hermanson, G., Evans, G. A., Hous- man, D. & Ward, D. C. (1990) High resolution mapping of hu- man chromosome ll by in situ hybridization with cosmid clones, Science 247, 64-69.
May, P. C. & Finch, C. E. (1992) Sulfated glycoprotein 2 : new relationships of this multifunctional protein to neurodegenera- tion, Trends Neurosci. IS, 391.
May, P. C., Lmpert-Etchells, M., Johnson, S. A., Pokier, J., Mas- ters, J. N. & Finch, C. E. (1990) Dynamics of gene expression for a hippocampal gl ycoprotein elevated in Alzheimer’s disease and in response to experimental lesions in rat, Neuron 5, 831 - 839.
Michel, D., Chabot, J. G., Moyse, E., Danik, M. & Quirion, R. (1992) Possible functions of a new genetic marker in central nervous system: the sulfated glycoprotein-2 (SGP-2), Synapse (NY) 11, 105-111.
Minoshima, S., Tobe, T., Yamase, S., Choi, N. H., Tomita, M. & Shimizu, N. (1991) Assignment of human SP-40,40 gene to chromosome 8, Cytogenet. Cell Genet 58, 1929.
O’Bryan, M. K., Baker, H. W., Saunders, J. R., Kirszbaum, L., Walker, I. D., Hudson, P., Liu, D. Y., Glew, M. D., d’Apice, A. J. & Murphy, B. F. (1990) Human seminal clusterin (SP-40,40). Isolation and characterization, J. Clin. Invest. 85, 1477 - 1486.
154- 159.
279-282.
51,162-166.
925
Purrello, M., Bettuzzi, S., Di Pietro, C., Mirabile, E., Di Blasi, M., Rimini, R., Grzeschik, K. H., Ingletti, C., Corti, A. & Sichel, G. (1991) The gene for SP-40,40, human homolog of rat sulfated glycoprotein 2, rat clusterin, and rat testosterone-repressed pros- tate message 2, maps to chromosome 8, Genomics 10, 151-156.
Rennie, P. S., Bruchovsky, N., Buttyan, R., Benson, M. & Cheng, H. (1988) Gene expression during the early phases of regression of the androgen-dependent Shionogi mouse mammary carci- noma, Cancer Res. 48, 6309-6312.
Rosenberg, M. E. & Paller, M. S. (1991) Differential gene expres- sion in the recovery from ischemic renal injury, Kidney Int. 39, 1156- 1161.
Sanger, F., Milken, S. & Coulson, A. R. (1977) DNA sequencing with chain-terminating inhibitors, Proc. Natl Acad. Sci. USA 74, 5463 -5467.
Sawczuk, I., Hoke, G., Olsson, C. A,, Connor, J. & Buttyan, R. (1989) Gene expression in response to acute unilateral ureteral obstruction, Kidney lnt. 35, 1315-1319.
Slawin, K., Sawczuk, I. S., Olsson, C. A. & Buttyan, R. (1990) Chromosomal assignment of the human homologue encoding SGP-2, Biochem. Biophys. Res. Commun. 172, 160-164.
Smeyne, R. J., Vendrell, M., Hayward, M., Baker, S. J., Miao, G. G., Schilling, K., Robertson, L. M., Curran, T. & Morgan, J. I. (1993) Continuous c-fos expression precedes programmed cell death in vivo, Nature 363, 166-169.
Smith, F. F., Mertz, J. R., Krebs, I., Tres, L. L., Chae, C. B., Zakeri, Z., Engelhardt, J. A,, Hoover, D. M., Tenniswood, M. & Kiers-
zenbaum, A. L. (1992) Rat sertoli and spermatogenic cells ex- press S35-S45/SGP-2/TRPM-2 mRNA but the processing of the protein product is different, Mol. Reprod. Dev. 33, 363-372.
Sylvester, S. R., Morales, C., Oko, R. & Griswold, M. D. (1991) Localization of sulfated glycoprotein-2 (clusterin) on spermato- zoa and in the reproductive tract of the male rat, Biol. Reprod. 45, 195-207.
Tenniswood, M., Guenette, R. S., Lakins, J. L., Mooibroek, M., Wong, P. & Welsh, J. (1992) Active cell death in hormone depen- dent tissues, Cancer Metastasis Rev. 11, 197-220.
Wong, P., MacDonald, I. M. & Tenniswood, M. (1989) Use of the polymerase chain reaction for the differential cross screening of libraries cloned into phage-lambda-based vectors, Gene (Amst.) 85, 59-65.
Wong, P., Myal, Y., Shui, R. & Tenniswood, M. (1993a) Identificat- ion and cloning of a new category of DNA fragments which are poorly represented in human genomic libraries, Biochem. Bio- phys. Res. Commun. 190,453-461.
Wong, P., Pineault, J. M., Lakins, J., Taillefer, D., Leger, J. G., Wang, C. & Tenniswood, M. P. (1993b) Genomic organization and expression of the rat TRPM-2 (clusterin) gene, a gene impli- cated in apoptosis, J. Biol. Chem. 268, 5021-5031.
Zakeri, Z., Curto, M., Hoover, D. M., Wightman, K., Engelhardt, J., Smith, F. F., Kierszenbaum, A. L., Gleeson, T. G. & Tenniswood, M. (1992) Developmental expression of the S35-S45/SGP-2/ TRPM-2 gene in rat testis and epididymis, Mol. Reprod. Dev. 33, 373-384.
