Indian Journal of Experimental Biology

Vol. 56, June 2018, pp. 373-384

Molecular characterization of microsymbionts

associated with root nodules of Crotalaria burhia Buch.-Ham. ex Benth.,

a native keystone legume species from Thar Desert of India

Indu Singh Sankhla1,2

, Raju Ram Meghwal1, Sunil Choudhary

1,3, Sonam Rathi

1, Nisha Tak

1,

Alkesh Tak1 & Hukam Singh Gehlot

1*

1BNF and Microbial Genomics Laboratory, Department of Botany, Jai Narain Vyas University, Jodhpur-342 033, Rajasthan, India 2Department of Botany, University of Rajasthan, Jaipur-302 004, Rajasthan, India 3ICFRE-Arid Forest Research Institute (AFRI), Jodhpur-302 005, Rajasthan, India

Received 19 April 2016; revised 14 July 2017

Establishment of legume-rhizobia symbiosis has ample agronomic and ecological significance. Characterization of native

rhizobia could enhance our understanding of their natural distribution and co-evolution. The Great Indian Thar Desert is an

ecologically significant unique habitat with its flora and fauna. Crotalaria spp. is an economically important legume widely

distributed in the Thar Desert and can be considered its one of the bioresources, particularly for biological nitrogen fixation

with their symbiotic rhizobia. Here, we examined the legume Crotalaria burhia Buch.-Ham. ex Benth. in search of potential

novel rhizobial species. Out of 72 root nodule bacterial (RNB) strains isolated from C. burhia, 51 rhizobia-like strains were

examined for genetic diversity based on ARDRA and RAPD patterns. BLASTn sequence similarity results based on 16S

rRNA gene of selective thirteen strains representing four ARDRA types revealed that they were related to genera Ensifer,

Rhizobium and Bradyrhizobium. In 16S rRNA gene phylogeny, five (CB5, CB17, CB36, CB44, CB56) strains were closer

to Ensifer kostiensis, three (CB6, CB12, CB32) to E. terangae and CB11 showed similarity with E. kostiensis and E. saheli.

Strain CB4 was similar to Bradyrhizobium yuanmingense and three (CB29, CB31, CB46) strains were closer to species of

Rhizobium (R. etli, R. sullae and R. borbori respectively). Symbiotic (nodA and nifH) genes phylogeny of Ensifer sp. CB56

was incongruent and showed close similarity with E. fredii whereas sym gene phylogeny of Bradyrhizobium sp. CB4 was

congruent with 16S rRNA gene phylogeny. In Rhizobium strains sym genes could not be amplified and they failed to

nodulate host. Our study suggests that C. burhia is nodulated by diverse strains of Ensifer and Bradyrhizobium in alkaline

soil of Thar Desert and these strains effectively cross-nodulated crop Vigna radiata.

Keywords: ARDRA, Bradyrhizobium, Burhia Rattlepod, Ensifer, nifH, Nitrogen fixation, nodA, Nodulation, Root nodule

bacterial (RNB) strains

Legume-rhizobia symbiosis known for biological

nitrogen fixation have long term agronomical and

ecological significance and is one of the alternative to

nitrogen fertilizers. Rhizobia are Gram negative,

aerobic, soil bacteria with ability to mostly form N

fixing nodules on roots of legumes1. Most of the

legume-rhizobia symbiosis studies have been carried

out on either agricultural crops (soybean, mungbean,

pea and chickpea) or pasture legumes (clover and

alfalfa). From last two decades such studies have been

extended to wild/native legumes from tropical and

semi-tropical climatic zones that resulted in

discovering several novel species and genera belonging

to class alphaproteobacteria and betaproteobacteria2.

The genus Crotalaria L. is the third largest in

Papilionoideae subfamily of Leguminosae having

more than 700 species3. It is distributed in tropical and

sub-tropical regions of the world with the majority of

species (543) native to tropical Africa and

Madagascar. In India, it is the largest legume taxa

comprising 93 species of which 27 are endemic4.

Many species of Crotalaria have great economic

importance in terms of insecticides, fibres, silage and

green manure having agronomic values4,5

. Crotalaria

burhia Buch.-Ham. ex Benth., (Burhia Rattlepod)

locally called ‘Shinio’, is a perennial bushy legume

widely distributed on sandy areas throughout the Thar

Desert of India and adjoining Pakistan. The Indian

Thar Desert is characterized by erratic precipitation,

high irradiation, high temperature and saline tracts6.

Overall, the area is alkaline and the soil has been

________

*Correspondence:

Phone: +91 94141 24939 (Mob.)

E-mail: hsgehlot@gmail.com

INDIAN J EXP BIOL, JUNE 2018

374

classified as ‘desert soil’ poor in nitrogen and available

phosphorus. Therefore the plants, animals, and microbes

growing in Thar Desert are continuously under biotic

and abiotic stresses. Gehlot et al.7 suggested some

traditional and modern scientific approaches for

characterization, conservation and sustainable utilization

of bioresources of the Thar Desert. Nodulation in

number of wild/native legumes of Thar Desert have

been reported as well as root nodule microsymbionts of

several legumes have been characterized at molecular

and genomic level recently8-19

.

The C. burhia is one of the keystone species of

Thar Desert and has a great potential in terms of

restoration of soil fertility through nitrogen fixation

and also in prevention of desertification through its

soil binding and sand dune stabilizing properties,

hence it have great ecological importance.

Crotalaria has been reported to be nodulating by

Bradyrhizobium strains20

. However, Crotalaria

podocarpa is nodulated by a novel rhizobia

Methylobacterium nodulans21

. Furthermore, Liu et al.22

isolated Rhizobium and Bradyrhizobium strains from

nodules of C. pallida in China, while Rocha23

isolated

Mesorhizobium sp. from root nodules of

C. spectabilis. On the basis of Amplified r-DNA

Restriction Analysis (ARDRA) Singha et al.24

identified

three groups of rhizobial strains (Rhizobium,

Bradyrhizobium and Mesorhizobium) from C. pallida in

Assam, India. Sankhla et al.12

reported that

C. medicagenia is nodulated by Ensifer strains in sandy

areas of Indian Thar Desert. In this study, we

investigated genetic diversity of root nodule bacteria

(RNB) associated with C. burhia and characterized its

rhizobia at molecular level including symbiotic genes.

Materials and Methods

Nodule sampling and isolation of rhizobia

Root nodules of C. burhia were collected from 25

sites in five districts of Western Rajasthan (Table 1).

The nodules were collected during the monsoon and

Table 1 — Nodulation status of Crotalaria burhia growing at different sampling sites throughout Thar Desert and

origin of root nodule bacterial (RNB) strains

District Soil sampling site Geographical coordinates pH OC

(%)

Total N

(%)

P

(kg/ha)

Avg. no. of

nodules per plant

Purified root nodule

bacterial strains

Jodhpur Amritlal stadium 26°20'25.40"N/73° 3'3.09"E 8.2 0.16 0.0078 9.2 08 CB1, CB2, CB45, CB46r,

CB47, CB48

JNVU New

Campus

26°14'49.85"N/73°

1'18.65"E

8.2 0.18 0.0091 12.4 09 CB5e, CB7, CB27, CB28,

CB29r, CB30

Kailana 26°18'5.83"N/72°58'29.38"E 8.2 0.10 0.0052 8.2 09 CB8, CB55

Osian 26°44'26.57"N/72°53'49.26"E 8.9 0.14 0.0071 18.4 14 CB38, CB39, CB40, CB42, CB44e

Pratapnagar 26°17'29.28"N/73° 0'6.36"E 8.8 0.23 0.0048 16.3 09 CB49, CB50, CB51

Shergarh 26°19'10.58"N/72°18'1.42"E 8.7 0.19 0.0112 9.2 09 CB67, CB68

Nagaur Alai 27°19'24.91"N/73°35'6.99"E 8.2 0.24 0.0092 6.4 08 CB10, CB61

Baghnada 27° 8'42.94"N/73°48'32.42"E 8.2 0.26 0.0111 11.2 11 CB6e, CB15, CB16

Deh 27°18'30.40"N/73°54'53.51"E 8.4 0.28 0.0069 8.2 10 CB3, CB4b

Harima 27°15'26.84"N/73°51'39.74"E 8.5 0.29 0.0071 7.8 14 CB21, CB22, CB23

Inana 27° 8'2.63"N/73°49'39.20"E 8.1 0.22 0.0114 10.8 12 CB18, CB19, CB20

Tausar 27° 6'36.85"N/73°46'30.60"E 8.4 0.23 0.0121 9.8 10 CB24, CB25, CB26

Barmer Barmer 25°45'10.09"N/71°26'5.31"E 8.2 0.14 0.0079 10.2 08 CB33, CB43

Bhuka 25°39'54.66"N/72° 0'54.03"E 8.8 0.13 0.0095 9.2 09 CB31r, CB32e, CB34

Chohtan 25°29'44.82"N/71° 5'6.90"E 8.1 0.16 0.0048 11.2 05 CB35, CB36e, CB37

Nimdee 26° 4'2.97"N/71°19'48.46"E 8.6 0.18 0.0081 11.9 07 CB9, CB11e, CB12e

Jaisalmer Chandhan 26°59'18.13"N/71°18'13.62"E 8.8 0.17 0.0117 6.4 07 CB52, CB41

Jaisalmer 26°53'49.55"N/70°56'31.18"E 8.3 0.19 0.0050 6.9 07 CB63, CB64

Kuldhera 26°52'28.36"N/70°46'34.28"E 8.6 0.19 0.0094 5.5 09 CB56e, CB57

Longewala 27°30'8.57"N/70° 7'28.76"E 8.5 0.29 0.0098 7.1 07 CB65, CB66

Pokaran 26°58'25.49"N/71°54'6.92"E 8.7 0.22 0.0069 5.1 05 CB71, CB72

Sum 26°50'31.14"N/70°32'53.19"E 8.1 0.11 0.0069 8.7 09 CB58, CB62, CB69, CB70

Bikaner Bikaner 28° 1'49.04"N/73°15'30.63"E 7.9 0.21 0.0047 10.2 09 CB53, CB54

Deshnok 27°47'20.09"N/73°20'22.46"E 8.7 0.21 0.0117 11.9 10 CB13, CB14, CB17e

Nokha 27°34'11.22"N/73°27'36.13"E 9.0 0.29 0.0092 11.2 08 CB59, CB60

[CB, Crotalaria burhia; Strains identified as eEnsifer sp., bBradyrhizobium sp. and rRhizobium sp. on the basis of 16S rRNA gene sequences]

Sankhla et al.: CHARACTERIZATION OF MICROSYMBIONTS ASSOCIATED WITH CROTALARIA ROOT NODULES

375

post-monsoon season (July-October) in the years

2011, 2012 and 2013. The Flora of the Indian Desert6

and regional Botanical Survey of India were referred

for identification of C. burhia plants in the field.

Whole plant were excavated with intact root system

and then thoroughly washed with tap water. The

nodulation status of excavated plants was recorded

and 4-5 root nodules with roots were kept in moist

soil and brought to the laboratory for preservation of

nodules and isolation of rhizobia. The viable seeds of

C. burhia were also collected to perform host

authentication experiments. Root nodules of C. burhia

were surface sterilized and bacterial strains were

isolated and purified according to standard procedure

as described by Vincent25

and Somasegaran and

Hoben26

. All bacterial strains were cultured on Congo

Red-Yeast Extract Mannitol Agar (CR-YEMA) plates

and incubated at 28ºC. The CR-YEM agar plates were

checked regularly to record colony characteristics of

isolates and to confirm their purity.

Soil sampling and analysis

Rhizosphere soil of C. burhia was collected from

each sampling sites at the time of nodule sampling for

chemical analysis. Chemical properties of the

collected soil such as pH (aqueous extract), total

nitrogen (N), organic carbon (OC) and available

phosphorus (P) were determined by using various

standard methods described in Gehlot et al.8.

Molecular characterization

Isolation of genomic DNA

Purified bacterial strains were grown in YEM broth

and were used for isolation of genomic DNA using

method described by Cheng and Jiang27

. Bacterial

cells were washed with TE (Tris-EDTA) and STE

(Sodium chloride-Tris-EDTA) buffer, and lysed

directly by adding phenol. The supernatant was

treated with chloroform to remove traces of phenol.

The supernatant (containing DNA) was used as

template for amplification of 16S rRNA and

symbiotic (nodA and nifH) genes through thermo

cycler (BioRad T100).

Amplification of 16S rRNA gene

Table 2 enlists various primers used in this study

for molecular characterization. Nearly full length 16S

rRNA gene of selected bacterial strains was amplified

using universal primers (18F and 1492R)28

. Each

reaction was carried out in a final volume of 20 μL

containing: 1 μL of template DNA (90 ng/μL), 0.6 U

of Taq DNA polymerase, 1.2 μM of each of the

primers, 2 mM MgCl2, 150 μM of each dNTP and 1X

PCR buffer. The PCR temperature profiles were as

follows: initial denaturation at 94ºC for 5 min

followed by 35 cycles of 94ºC for 30 s, 53ºC for 30 s,

72ºC for 60 s and a final extension at 72ºC for 5 min.

Amplified PCR products along with 500 bp marker

were run on 0.89% (w/v) agarose gel, prepared in 1X

TAE buffer and pre-stained with ethidium bromide.

The bands were visualized under BIO-RAD Gel Doc

System (Bio Rad SR+, USA Inc.). The amplified PCR

products were quantified using Denovix (USA) DS11

spectrophotometer (nanodrop).

Molecular fingerprinting

Genetic variability among bacterial strains was

studied using following DNA fingerprinting patterns:

ARDRA (Amplified r-DNA Restriction Analysis) pattern

The restriction endonucleases MspI (Genei

Bangalore) was used to digest the amplified PCR

products (16S rRNA gene). The reactions were carried

out in a final volume of 20 μL containing 2 μL of 10X

buffer, 0.25 μL of MspI enzyme (10U/μL), 10 μL

aliquots of PCR products and 7.75 μL of nuclease free

water. The reaction mixture was incubated at 37ºC for

overnight. Digested PCR products along with 100 bp

DNA ladder (Genei Bangalore) were run on 2.0%

agarose gel at 80 V for 1-2 h for separation of restricted

fragments and were visualized by staining with ethidium

bromide using BIO-RAD Gel Doc System.

RAPD (Random Amplification of Polymorphic DNA) pattern

RPOI primer (nif gene directed primer widely used

for study of genetic diversity) was used to randomly

amplify genomic DNA as described by Richardson et al.29

.

The reactions were carried out in a final volume of

Table 2 — List of primers used in this study for

molecular characterization

Primer Oligonucleotide sequence (5'→ 3')a Reference

RPOI AATTTTCAAGCGTCGTGCCA 30

18F AGAGTTTGATCCTGGCTCAG 29

1492R CTACGGCTACCTTGTTACG 29

800F GTAGTCCACGCCGTAAACGA 31

820R CATCGTTTACGGCGTGGACT 31

nodA1 TGCRGTGGAARNTRNNCTGGGAAA 32

nodA2 GGNCCGTCRTCRAAWGTCARGTA 32

nifHF TACGGNAARGGSGGNATCGGCAA 33

nifHI AGCATGTCYTCSAGYTCNTCCA 33

[aA, C, G, T =standard nucleotides; N=A, C, G or T; R=A or G;

Y= C or T; S=G or C and W=A, T]

INDIAN J EXP BIOL, JUNE 2018

376

20 μL containing: 1.5 μL of template DNA (90 ng/μL),

1U of Taq DNA polymerase, 3 μM of RPOI primer,

3.75 mM MgCl2, 150 μM of each dNTP and 1X PCR

buffer. The thermal cycling condition were as

follows: initial denaturation at 94ºC for 5 min

followed by 5 cycles at 94ºC for 30 s, 50ºC for 60 s,

72ºC for 90 s and then 30 cycles at 94ºC for 30 s,

55ºC for 25 s and 72ºC for 90 s and a final extension

at 72ºC for 5 min. The amplified DNA fragments

were resolved on 2.0% agarose gel at 80 V for 1-2 h

along with DNA ladder of 100 bp and generated

fingerprints were visualized under BIO-RAD Gel Doc

System. Sequencing of 16S rRNA gene

On the basis of ARDRA and RAPD patterns, 13

isolates were selected for sequencing of their 16S

rRNA gene. Amplified sample in adequate quantity

(50 μL having 20-30 ng/μL DNA) were sent to

Xcleris Genomics Labs Ltd., Ahmedabad for

sequencing. Universal external (18F and 1492R)28

and

internal (800F and 820R)30

primers were used to

obtain nearly full length (1.5 kb) nucleotides sequence

of 16S rRNA gene. The sequencing was done on

Applied Biosystems platform using Big Dye version

3.1 terminator and 5X buffer. Gene Tool Lite 1.0

(2000) software (Doubletwist, Inc., Oakland, CA,

USA) was used for analysis of all raw sequences.

Sequence similarity searches for nucleotide

sequences were performed at the National Centre for

Biotechnology Information (NCBI) server using basic

local alignment search tool (BLAST). After

completion of analysis, sequences were submitted to

NCBI database using Sequin.

Nodulation test

Selective strains were evaluated for their ability to

form nodules on their original host (C. burhia) as well

as crop legume Vigna radiata. Seeds of C. burhia

were scarified and surface sterilized by treatment with

95% (v/v) ethanol for 2 min and 0.1% HgCl2 for 3 min

followed by several washes with sterile distilled water

and then allowed to germinate in petri plates,

containing sterilized moist filter paper. Three to four

germinated seedlings were planted aseptically into

each plastic pot containing washed and sterilized

sand. Each seedling was inoculated with 1 mL

(109cells/mL) of bacterial strains at exponential

growth phase. Un-inoculated seedlings either supplied

with mineral nitrogen (as 0.1% KNO3 in nutrient

solution) or grown without nitrogen served as N+ and

N- controls, respectively. The entire experimental set

up of inoculated and controls plants were designed in

triplicates. Seedlings were grown under natural

sunlight and temperature (28±2ºC day and night) in

glass house. Similar procedure was applied for

V. radiata except scarification of seeds. Plants were

harvested and checked for nodulation after 6-8 weeks

of inoculation as described by Somasegaran and

Hoben26

. Rhizobia were re-isolated and purified from

root nodules of inoculated plants and compared with

the parental strains on the basis of colony morphology

and genetic fingerprints (RAPD pattern) using RPOI

primer29

.

Amplification and sequencing of symbiotic genes (nodA and nifH)

In selected isolates nodA and nifH genes were

amplified. Primers nodA1 and nodA231

were used for

PCR amplification of an internal fragment of size

650 bp of nodA gene (codes for N-acyl transferase

nodulation protein). The reactions were carried out in

a final volume of 20 μL containing: 1 μL of template

DNA, 0.6U of Taq DNA polymerase, 1 μM of each of

the primers, 3.12 mM MgCl2, 150 μM of each dNTP,

and 1X PCR buffer. PCR cycling conditions were as

follows: initial denaturation at 94ºC for 5 min, 5

cycles at 94ºC for 30 s, 55ºC for 30 s and 72ºC for

60 s followed by 30 cycles at 94ºC for 30 s, 62ºC for

45 s, 72ºC for 90 s and a final extension at 72ºC for

7 min. Amplification of nifH region (750 bp codes for

Fe protein of nitrogenase enzyme) was carried out

using primers nifHF and nifHI32

and the reaction

mixture was prepared same as for nodA. PCR cycling

conditions were as follows: initial denaturation at

94ºC for 5 min followed by 25 cycles at 94ºC for 30 s,

57ºC for 30 s, 72ºC for 30 s and a final extension at

72ºC for 7 min. PCR products along with DNA ladder

of 100 bp (Genei Bangalore) were run on 1.0%

agarose gel at 80 V for 1 h to confirm the

amplification of targeted gene. The amplified

products were sequenced with the corresponding

primers using an Applied Biosystems sequencer.

Phylogenetic analysis

Nucleotide sequences of RNB isolated from C. burhia

in this study were submitted in the GenBank database.

The accession numbers have been specified in the

corresponding phylograms. The multiple sequence

alignment program CLUSTALW33

was used to align

the nucleotide sequences obtained in present study

(16S rRNA and symbiotic genes sequences), together

with related sequences of type strains retrieved from

Sankhla et al.: CHARACTERIZATION OF MICROSYMBIONTS ASSOCIATED WITH CROTALARIA ROOT NODULES

377

the NCBI database. The phylogenetic trees were

generated using MEGA 6 software34

with maximum

likelihood method based on a GTR+G+I model.

A bootstrap for 1000 replicates was performed to

obtain the confidence values for the tree topologies.

Results

Nodulation status and soil analysis

Soil samples and nodules of C. burhia were

collected from all the sampling sites in five districts of

Western Rajasthan (Table 1). The C. burhia plants

growing in natural habitat is shown in Fig. 1A-C; with

flower (Fig. 1D); collected seeds (Fig. 1E) and root

nodules (Fig. 1F). The nodulation in C. burhia was

observed at all sampling sites, although the average

number of nodules per plant varied from site to site.

The highest average number of nodules per plant was

recorded fourteen in Osian (Jodhpur) and Harima

(Nagaur) sampling sites (semi-arid) and lowest was

five in Chohtan (Barmer) and Pokaran (Jaisalmer),

both arid to hyper arid sites (Table 1). Initially,

nodules were globular but became elongated,

indeterminate and branched on maturity (Fig. 1F).

The morphology and internal structure of C. burhia

root nodules have been described in our previous

study8. Soil characteristics such as total N, P, organic

carbon and pH of various sampling sites were not

significantly different as descried earlier8. The pH of

soils in all sampling sites in Thar Desert was alkaline

and ranged from pH 7.9 to 9 (Table 1); however, soil

texture, annual rainfall (100-500 mm), mean daily

temperature in summer (25-35ºC) and winter (7-15ºC)

were found varied.

DNA fingerprinting (ARDRA and RAPD) and sequencing of

16S rRNA gene

A single band of approx. 1.5 kb of 16S rRNA gene

was amplified in all strains. The 51 rhizobial strains

formed four groups on the basis of the ARDRA

(Table 3). The largest ARDRA group-I had 42 strains

and group II had five strains which were identified as

species of Ensifer and Bradyrhizobium respectively,

on the basis of 16S rRNA gene sequencing and

BLASTn results. The group III and IV each

containing 2 strains were identified as species of

Rhizobium.

All the isolates showed considerable variation in

RAPD pattern and were distributed in 14 groups. The

largest ARDRA group-I that comprised of 42 strains

Fig. 1 — (A) The Crotalaria burhia plants growing in natural

habitat during rainy season; (B) in dry season; (C) closer view; (D)

a flower; (E) collected seeds; and (F) indeterminate root nodules.

Table 3 — Grouping of selective Crotalaria burhia-RNB strains

based on genetic fingerprinting

RPOI genetic

groups

Strains ARDRA genetic

groups

I CB7, CB8, CB11e, CB14, CB15,

CB17e, CB27, CB28, CB30,

CB40, CB42, CB72

I (42 strains)

II CB1, CB2, CB3, CB5e, CB44e

III CB6e, CB36e, CB59

IV CB10, CB60, CB61, CB62,

CB63, CB66

V CB54, CB55, CB56e, CB68

VI CB57, CB58, CB64, CB67,

CB69

VII CB32e,CB70, CB71

VIII CB52, CB53

IX CB12e

X CB20

XI CB4b, CB9, CB43, CB49, CB65 II (5 strains)

XII CB29r III (2 strains)

XIII CB46r

XIV CB31r, CB51 IV (2 strains)

[Strains identified as eEnsifer sp., bBradyrhizobium sp. and rRhizobium sp. on the basis of 16S rRNA gene sequences]

INDIAN J EXP BIOL, JUNE 2018

378

(including nine sequenced Ensifer strains) was further

resolved into 10 RAPD groups (Table 3). This

suggests that RPOI based fingerprinting gives better

resolution of genetic diversity when compared with

ARDRA. Strains CB4, CB9, CB43, CB49 and CB65

showed similar banding patterns in both ARDRA and

RAPD. Based on ARDRA and RAPD profiles, 13

representative strains (CB4, CB5, CB6, CB11, CB12,

CB17, CB29, CB31, CB32, CB36, CB44, CB46 and

CB56) were selected and sequenced for their 16S

rRNA gene. On the basis of BLASTn sequence

similarity search results for 16S rRNA gene out of 13

strains, nine were identified as species of Ensifer

(CB5, CB6, CB11, CB12, CB17, CB32, CB36, CB44

and CB56), three as species of Rhizobium (CB29,

CB31 and CB46) and one strain (CB4) as species of

Bradyrhizobium (Table 4).

Authentication and host range

Five Ensifer strains (CB5, CB17, CB36, CB44 and

CB56) and a single Bradyrhizobium strain (CB4)

were found nodulating their original host C. burhia

and crop V. radiata, while remaining four Ensifer

strains (CB6, CB11, CB12 and CB32) and three

Rhizobium strains (CB29, CB31 and CB46) failed to

nodulate their original host as well as V. radiata.

Phenotypically, nodulated plants appeared dark-green

Table 4 — Percentage sequence similarities of Crotalaria burhia-RNB strains based on 16S rRNA and symbiotic

(nodA and nifH) genes with closest type/reference strain.

Strains NCBI GenBank

accession

number

Closest type/reference strain

(GenBank accession number)

Sequence

similarity

(%)

Biological and geographical origin of

closest type/reference strain

16S rRNA gene

CB4 KJ871655 Bradyrhizobium yuanmingense CCBAU 10071T

(AF193818)

99.8 Lespedeza cuneata, China

CB5 KF938904 Ensifer kostiensis HAMBI 1489T (Z78203) 99.9 Senegalia senegal, Sudan

CB6 JN832576 Ensifer terangae LMG 7834T (X68388) 99.7 Senegalia laeta, Senegal

CB11 KF938905 Ensifer kostiensis HAMBI 1489T (Z78203)

Ensifer saheli ORS 609T (X68390)

99.7 Senegalia senegal, Sudan

Sesbania cannabina, Senegal

CB12 KJ871656 Ensifer terangae LMG 7834T (X68388) 99.7 Senegalia laeta, Senegal

CB17 KF938906 Ensifer kostiensis HAMBI 1489T (Z78203) 99.9 Senegalia senegal, Sudan

CB29 KF938907 Rhizobium aegyptiacum 1010T (NR_137399)

Rhizobium bangladeshense BLR175T (NR_137241)

Rhizobium binae BLR195T (NR_137242)

Rhizobium etli CFN 42T (NR_029184)

Rhizobium lentis BLR27T (NR_137243)

100 Trifolium alexandrinum, Egypt Lens

culinaris, Bangladesh

Lens culinaris, Bangladesh

Phaseolus vulgaris, Mexico

Lens culinaris, Bangladesh

CB31 KF938908 Rhizobium sullae IS 123T (NR_029330) 97.3 Hedysarum coronarium, Spain

CB32 KF938909 Ensifer terangae LMG 7834T (X68388) 99.7 Senegalia laeta, Senegal

CB36 KF938910 Ensifer kostiensis HAMBI 1489T (Z78203) 99.9 Senegalia senegal, Sudan

CB44 KF938911 Ensifer kostiensis HAMBI 1489T (Z78203) 99.9 Senegalia senegal, Sudan

CB46 KM044262 Rhizobium borbori DN316T (EF125187) 97 Activated sludge, China

CB56 KF938912 Ensifer kostiensis HAMBI 1489T (Z78203) 99.9 Senegalia senegal, Sudan

nodA gene

CB4 KF437384 Bradyrhizobium yuanmingense CCBAU 10071T

(AM117557)

97.1 Lespedeza cuneata, China

CB56 KJ018181 Ensifer fredii USDA 205T (EU292000)

Ensifer xinjiangensis CCBAU 110T (EF457965)

91.2 Glycine max, China

Glycine max, China

nifH gene

CB4 KJ018170 Bradyrhizobium yuanmingense CCBAU 10071T

(EU818927)

98.4 Lespedeza cuneata, China

CB56 KJ018169 Ensifer fredii USDA257 (CP003565)

Ensifer xinjiangensis CCBAU 110T (DQ411933)

Ensifer sojae CCBAU 05684T (GU994077)

95.1 Glycine max, China

Glycine max, China

Glycine max, China

Sankhla et al.: CHARACTERIZATION OF MICROSYMBIONTS ASSOCIATED WITH CROTALARIA ROOT NODULES

379

in comparison to control and non-nodulated plants.

After recording the nodulation status 2-3 re-isolates

were successfully isolated and purified from

excavated root nodules of each host (C. burhia and

V. radiata) plant. The colony characteristics and

RAPD patterns (using RPOI primer) of re-isolates

were exactly similar to corresponding inoculated

parental strains (Fig. 2). The results of host

authentication, suggest that C. burhia is nodulated by

both, species of Ensifer and Bradyrhizobium. Sequencing of symbiotic genes

Symbiotic (nodA and nifH) genes of selective

nodulating isolates CB56 (Ensifer strain) and CB4

(Bradyrhizobium strain) were successfully amplified

and sequenced. The symbiotic genes could not be

amplified in the case of non-nodulating Rhizobium

(CB29, CB31 and CB46) and Ensifer (CB6, CB11,

CB12 and CB32) strains, although various primer sets

were used (Table 2).

Phylogenetic studies

16S rRNA gene phylogeny

In phylogenetic analyses, the Ensifer strains

formed three 16S rRNA types clustering into separate

clades and a single lineage (Fig. 3). The first clade

(16S rRNA type I) comprised by five nodulating

strains (CB5, CB17, CB36, CB44 and CB56) showing

100% sequence similarities with Ensifer sp. TF7,

TW10, RA9 and PC2 isolated from native legumes of

the Thar Desert as well as with Ensifer sp. K15

(LK936546) and Vr38 (LN851899) isolated from

chickpea and mung bean nodules, respectively, from

Pakistan. These five strains were very close to

E. kostiensis HAMBI 1489T (99.9% sequence

similarities) as well as to E. saheli LMG 7837T

(=ORS 609T) with 99.7% sequence similarities. The

strain CB11 alone formed a separate lineage (16S

rRNA type II) and showed 99.7% sequence similarity

with type strains E. kostiensis HAMBI 1489T and

E. saheli LMG 7837T. The second clade (16S rRNA

type III) comprised of 3 strains (CB6, CB12 and

CB32) showing 99.7% sequence similarities to

Ensifer sp. E60 (isolated from acacias in Algeria), and

type strain E. terangae LMG 7834T (Fig. 3 and Table 4).

The phylogenetic analyses of Bradyrhizobium strain

CB4 revealed that it had 100% sequence similarity to

strains PRNB-26, M11 and GX5 isolated from

Pongamia pinnata (India), V. radiata (Nepal) and

V. radiata (China), respectively and was adjacent to

type strain B. yuanmingense CCBAU 10071T

(99.8%). In addition, the strain CB4 also showed

99.9% sequence similarity with B. yuanmingense

TF17 isolated from root nodules of Tephrosia

falciformis from Thar Desert (Fig. 3). The three non-

nodulating Rhizobium strains (CB29, CB31 and

Fig. 2 — The RPOI-DNA fingerprinting gel images of nodulating

parental (P) Crotalaria burhia (CB)-Ensifer strains compared

with re-isolates from host Crotalaria burhia (R1) and Vigna

radiata (R2 and R3).

Fig. 3 — Phylogenetic tree constructed using 16S rRNA gene

sequences of Ensifer and Bradyrhizobium strains isolated from the

Indian native legume Crotalaria burhia together with those of

type strains and close relatives. [The tree was built using a

Maximum Likelihood (ML) method and bootstrap values

calculated for 1000 replications are indicated at internodes. The

scale bar indicates 2% substitutions per site. Accession numbers

from GenBank are in parenthesis. (Abbreviations: B, Bradyrhizobium;

CB, Crotalaria burhia; E, Ensifer; JNVU, Jai Narain Vyas

University and T indicates type strain)]

INDIAN J EXP BIOL, JUNE 2018

380

CB46) formed three distinct types (Fig. 4). The strain

CB29 showed 100% similarity with following ty

pe strains: R. aegyptiacum 1010T, R. bangladeshense

BLR175T, R. binae BLR195

T, R. etli CFN 42

T and

R. lentis BLR27T. Strain CB31 showed 97.3%

similarity with R. sullae IS 123T and strain CB46 was

close to R. borbori DN316

T with 97% similarity.

Symbiotic gene phylogeny

The symbiotic genes of two strains CB56 and

CB4 each representing group of other similar

nodulating strains of Ensifer and Bradyrhizobium,

respectively, were successfully amplified and

sequenced to study their phylogeny. Our results

showed that the phylogeny of nodA gene of CB4

was congruent with its species phylogeny (close to

B. yuanmingense based on 16S rRNA gene). While

such congruence was not seen in the case of strain

CB56 (close to E. kostiensis based on 16S rRNA

gene). The nodA gene of CB56 showed 91.2%

sequence similarity with E. xinjiangensis CCBAU

110T and E. fredii USDA 205

T forming a distinct

lineage (Fig. 5 and Table 4). The nodA gene of

Bradyrhizobium strain CB4 clustered together with

NGB-SR15 isolated from soybean root nodules

from Egypt and showed 97.1% sequence similarity

to B. yuanmingense CCBAU 10071T.

The phylogeny of nifH gene was consistent with

that of nodA gene. Like nodA gene phylogeny, the

nifH gene of Ensifer sp. CB56 showed highest

sequence similarity (95.1%) with E. fredii USDA

257, E. sojae CCBAU 05684T and E. xinjiangensis

CCBAU 110T

(Fig. 6A and Table 4). Like 16S

rRNA and nodA phylogeny, the nifH gene of

Bradyrhizobium sp. CB4 was adjacent to B.

yuanmingense CCBAU 10071T and showed 98.4%

sequence similarity. The strain CB4 also showed

99.4% sequence similarity with strains such as

TF17, D1 and SR42 isolated form T. falciformis,

Glycine max and V. radiata, respectively

(Fig. 6B).

Fig. 4 — Phylogenetic tree constructed using 16S rRNA gene

sequences of non-nodulating Rhizobium strains isolated from

the Indian native legume Crotalaria burhia together with

those of type strains. [The tree was built using a Maximum

Likelihood (ML) method and bootstrap values calculated for

1000 replications are indicated at internodes. The scale bar

indicates 1% substitutions per site. Accession numbers from

GenBank are in parenthesis. (Abbreviations: CB, Crotalaria

burhia; JNVU, Jai Narain Vyas University; NR, NCBI

Reference sequence; R, Rhizobium and T indicates type

strain)]

Fig. 5 — Phylogenetic tree constructed using nodA gene

sequences of Ensifer and Bradyrhizobium strains isolated

from the Indian native legume Crotalaria burhia together

with those of type strains. [The tree was built using a

Maximum Likelihood (ML) method and bootstrap values

calculated for 1000 replications are indicated at internodes.

The scale bar indicates 10% substitutions per site. Accession

numbers from GenBank are in parenthesis. (Abbreviations:

B, Bradyrhizobium; CB, Crotalaria burhia; E, Ensifer;

JNVU, Jai Narain Vyas University and T indicates type

strain)]

Sankhla et al.: CHARACTERIZATION OF MICROSYMBIONTS ASSOCIATED WITH CROTALARIA ROOT NODULES

381

Discussion

Like other native legumes, such as Acacia and

Prosopis, the C. burhia is also well adapted and

nodulates in the nutritionally poor alkaline soil of

Thar Desert of India. Analysis of soil from the various

sampling sites in present investigation supports our

previous report8 and further confirms that soil in Thar

Desert is alkaline throughout and poor in total N and

available P. Although the soil is not significantly

differing in nutritional characters at various sites but

the sampling sites in the different districts belongs to

semi-arid and hyper arid regions and varied in

average annual rainfall and mean temperature in

summer and winter. The texture is also different and

purely sandy in Barmer, Bikaner and Jaisalmer

districts as compared to other sites. The field survey

showed that C. burhia is widely distributed

throughout Thar Desert in rain-fed open area and on

marginal lands that indicates its well adaptation to

harsh climatic conditions of Thar Desert. The plants

of C. burhia were found nodulating at all sampling

sites although the number of nodules per plant varied

from site to site. The average number of nodules per

plant was poor at the sampling sites of arid and hyper-

arid regions (Barmer and Jaisalmer), where soil was

more sandy, poor in texture as compared to other

sampling sites (semi-arid areas). Our results are in

accordance with the previous studies35

that edapho-

climatic conditions such as rainfall, salinity, pH and

temperature may affect the number of effective root

nodule bacteria (RNB) in the soil that establish

functional nitrogen-fixing symbiosis and therefore

number of nodules per plant varied.

Molecular techniques such as ARDRA and RAPD

have been extensively used in rhizobial ecology for

genetic grouping and identification of strains. In the

present investigation, our results on the basis of DNA

fingerprinting indicates that fast growing Ensifer

strains are genetically more diverse than the slow

growing Bradyrhizobium strains. The more

occupancy of Ensifer strains compared to other

rhizobial (Bradyrhizobium and Rhizobium) strains in root

nodules of C. burhia indicates that Ensifer species are

well adapted to alkaline soils of Thar Desert and is

dominant microsymbiont of C. burhia and other native

legumes in the Thar Desert8,9,12,13,15,16,17,19

. There are

several reports8,9,12,13,15-19,

from different legumes

suggesting that alkaline soil and arid conditions

favours more incidences of Ensifer species in root

nodules rather than slow-growing species of

Bradyrhizobium. Genomic studies done by Tian

et al.36

also strengthen such assumptions and reported

that several gene clusters involved in osmoregulation

and adaptation to alkaline pH are present in the

species of Ensifer as compared to Bradyrhizobium.

The nine Ensifer strains sequenced in the present

study were classified into three types on the basis of

phylogenetic analysis of 16S rRNA gene, which were

mainly close to one of the three type strains

E. kostiensis HAMBI 1489T (isolated from root

nodules of Senegalia senegal, Sudan)37

, E. saheli

ORS609T (isolated from Sesbania cannabina,

Senegal)38

and E. terangae LMG 7834T (isolated from

Senegalia laeta, Senegal)38

; and also have close

similarity with Ensifer strains isolated from other

native legumes (Tephrosia spp., Rhynchosia aurea

Fig. 6 — Phylogenetic tree constructed using nifH gene sequences

of Ensifer (A); and Bradyrhizobium (B) strains isolated from the

Indian native legume Crotalaria burhia together with those of

type/reference strains. [The trees were built using a Maximum

Likelihood (ML) method and bootstrap values calculated for 1000

replications are indicated at internodes. The scale bar indicates

2% substitutions per site. Accession numbers from GenBank are

in parenthesis. (Abbreviations: B, Bradyrhizobium; CB,

Crotalaria burhia; E, Ensifer; JNVU, Jai Narain Vyas University

and T indicates type strain)]

INDIAN J EXP BIOL, JUNE 2018

382

and Prosopis cineraria) of the Thar Desert8,13

as well

as with Ensifer strains from Pakistan, which indicate

their Asiatic origin. On the other hand, strain CB4

showed similarity with Bradyrhizobium sp. isolated

from Tephrosia species from the semi-arid regions of

western Rajasthan8. Strain CB4 also showed close

similarity with B. yuanmingense CCBAU 10071T

(isolated from the root nodules of Lespedeza cuneata

from China)39

but formed a separate lineage. In

addition, B. yuanmingense type of strains has also

been isolated in India from the root nodules of

soybean from different agricultural-ecological-

climatic regions of India40

. The first report of isolation

of B. yuanmingense is from wild legume L. cuneata

from China39

and the same is the case in our present

study, and the previous reports from our group where

such strains have been isolated from wild native

legumes (C. burhia, Tephrosia spp. and Vachellia

leucophloea)8,16

of Thar Desert where no soybean

cultivation history is found. This suggests that

B. yuanmingense is important unexplored microbial

resource of India that has to be further studied for its

wide host range. The occurrence of non-nodulating

Rhizobium strains in the present investigation is

interesting as these non-nodulating strains showed

close similarity with few nodulating Rhizobium

strains, such as Phaseolus vulgaris microsymbiont

(R. etli) from Mexico; R. aegyptiacum (isolated from

root nodules of Trifolium alexandrinum, Egypt) and

three type strains (R. bangladeshense, R. binae and

R. lentis) isolated from the root nodules of Lens

culinaris, Bangladesh. A single strain CB46 was close

to non-nodulating R. borbori isolated from activated

sludge, China.

The result of nodulation test suggests that C.

burhia is nodulated by both Ensifer and

Bradyrhizobium strains but not by species of

Rhizobium. Interestingly CB-Ensifer and CB-

Bradyrhizobium strains are nodulating crop legume V.

radiata. This is the first report on molecular

characterization of N fixing microsymbiont of C.

burhia, an important native legume and a good soil

binder of arid regions of the Thar Desert. The

isolation of non-nodulating Rhizobium from root

nodules of native legumes in our case is similar to

other researchers who isolated non-nodulating

Rhizobium strains from a wide range of plant taxa.

The symbiotic genes could not be amplified in non-

nodulating Rhizobium strains. There could be a

possibility that these Rhizobium strains were

originally nodulating, but may have lost the ability to

nodulate or the related nod genes during the

subculturing. Surprisingly, some strains of Ensifer

(CB6, CB11, CB12 and CB32) belonging to 16S

rRNA type II and III failed to nodulate their host

C. burhia. This lack of nodulation efficiency can be

explained by assumptions, such as (i) these strains of

Ensifer may have opportunistically entered along with

other nodulating rhizobia; and (ii) these strains might

have lost their symbiotic traits during symbiosis or

once purified onto artificial YEMA media41

.

Similar to other studies32,42

, the phylogeny based on

symbiotic genes (nodA and nifH) of Ensifer sp. CB56

was incongruent with its 16S rRNA gene phylogeny.

Strain CB56 (close to E. kostiensis HAMBI 1489T in

16S rRNA gene phylogeny) was closer to E. fredii

USDA 205T43

and E. xinjiangensis CCBAU 110T44

in

its symbiotic gene phylogeny. Such incongruence

suggests that the sym genes in it have been acquired

from other symbiotic Ensifer species/strains present in

the soil through horizontal gene transfer (HGT). In

contrary, Bradyrhizobium sp. CB4 was close to

B. yuanmingense CCBAU 10071T in both 16S rRNA

and symbiotic gene phylogenies.

Conclusion

Crotalaria burhia is nodulated by both, the fast

growing species of Ensifer that has close similarity

with the Old World Ensifer strains (E. kostiensis,

E. saheli and E. terangae) and the slow growing

species of Bradyrhizobium close to B. yuanmingense.

The Ensifer strains in the present study are genetically

diverse as compared to Bradyrhizobium strains and

both type of strains cross-nodulated crop V. radiata.

The genetic diversity and incongruence between

species (16S rRNA) and symbiotic gene phylogeny is

the result of HGT due to stressful conditions

prevailing in Thar Desert of India. Few strains in the

present study are phylogenetically divergent from the

existing type strains which indicate the presence of

potential novel species of rhizobia in the desert

region. Occurrence of non-nodulating Ensifer and

Rhizobium strains suggests that root nodules harbours

both symbiotic as well as opportunistic bacteria.

Furthermore polyphasic approach including multi

locus sequence analysis (MLSA) of conserved

protein-coding housekeeping genes, DNA-DNA

hybridization, BIOLOG, FAME analysis and whole

genome sequencing will be required for the

description of a formal new species of rhizobia

Sankhla et al.: CHARACTERIZATION OF MICROSYMBIONTS ASSOCIATED WITH CROTALARIA ROOT NODULES

383

nodulating C. burhia in the Thar Desert of India.

Host-range of these effective N fixing strains needs to

be studied for using them as inoculums in future.

Such basic studies on identification,

characterization, screening of broad host range and

efficient native desert rhizobia will be useful in

preparing consortium of agriculturally important

rhizobial strains and will also form a platform for

more detailed genomic studies to understand the

mechanism of adaptability to changing environment

and spread of aridity.

Acknowledgement

Author Indu S. Sankhla acknowledges the

University Grants Commission (UGC), New Delhi,

for junior and senior research fellowships. The work

was also supported by grants from UGC-SAPII-CAS-

I, UGC-BSR Start-Up-Grant (F.30-16/2014) and the

Department of Biotechnology, Govt. of India

(BT/PR11461/AGR/21/270/2008).

References

1 Sprent J, Legume nodulation: A Global Perspective, (John

Wiley & Sons, Inc), 2009, 65.

2 Peix A, Ramírez-Bahena MH, Velázquez E & Bedmar EJ,

Bacterial associations with legumes. Crit Rev Plant Sci, 34

(2015) 17.

3 Lewis GP, Schrire B, Mackinder B & Lock M, Legumes of

the world, (Kew Royal Botanic Gardens, Kew) 2005.

4 Ansari AA, Crotalaria L. in India, (Bishen Singh Mahendra

Pal Singh, Dehra Dun), 2008, 52.

5 Ranjith M, Bajya DR & Manoharan T, Field study on

repellent efficacy of Crotalaria burhia Buch.-Ham. ex

Benth. and Anacardium occidentale L. against Odontotermes

obesus (Rambur). Indian J Nat Prod Resour, 6 (2015) 288.

6 Bhandari MM, Flora of the Indian Desert, (MPS Report,

Jodhpur), 1990, 103.

7 Gehlot HS, Tak N, Dagla HR & Davis TD, Indigenous and

modern scientific strategies for characterization, conservation

and sustainable utilization of bio-resources of the Indian Thar

Desert. J Arid Land Stud, 24 (2014) 5.

8 Gehlot HS, Panwar D, Tak N, Tak A, Sankhla IS, Poonar N,

Parihar R, Shekhawat NS, Kumar M, Tiwari R, Ardley J,

James EK & Sprent JI, Nodulation of legumes from the Thar

desert of India and molecular characterization of their

rhizobia. Plant Soil, 357 (2012) 227.

9 Gehlot HS, Tak N, Kaushik M, Mitra S, Chen WM, Poweleit N,

Panwar D, Poonar N, Parihar R, Tak A, Sankhla IS, Ojha A,

Rao SR, Simon MF, dos Reis Junior FB, Perigolo N,

Tripathi AK, Sprent JI, Young JPW, James EK &

Gyaneshwar P, An invasive Mimosa in India does not adopt

the symbionts of its native relatives. Ann Bot, 112 (2013) 179.

10 Tak N, Gehlot HS, Kaushik M, Choudhary S, Tiwari R,

Tian R, Hill Y, Bräu L, Goodwin L, Han J, Liolios K,

Huntemann M, Palaniappan K, Pati A, Mavromatis K,

Ivanova N, Markowitz V, Woyke T, Kyrpides N & Reeve W,

Genome sequence of Ensifer sp. TW10; a Tephrosia

wallichii (Biyani) microsymbiont native to the Indian Thar

Desert. Stand Genomic Sci, 9 (2013) 304.

11 Panwar D, Tak N & Gehlot HS, Nodulated Native Legumes

in an Arid Environment of Indian Thar Desert. In: MH

Fulekar & RK Kale (eds.) Recent Trends in Plant Sciences

(IK International Publishing House Pvt. Ltd. New Delhi, India), 2014, 284.

12 Sankhla IS, Meghwal RR, Tak N, Tak A & Gehlot HS,

Phenotypic and molecular characterization of

microsymbionts associated with Crotalaria medicagenia: a

native legume of the Indian Thar Desert. Plant Archives, 15 (2015) 1003.

13 Tak N, Awasthi E, Bissa G, Meghwal RR, James EK,

Sprent JS & Gehlot HS, Multi locus sequence analysis and

symbiotic characterization of novel Ensifer strains nodulating

Tephrosia spp. in the Indian Thar Desert. Syst Appl Microbio, 39 (2016) 534.

14 Gehlot HS, Ardley J, Tak N, Tian R, Poonar N,

Meghwal RR, Rathi S, Tiwari R, Adnawani W, Seshadri R &

Reddy TB, High-quality permanent draft genome sequence

of Ensifer sp. PC2, isolated from a nitrogen-fixing root

nodule of the legume tree (Khejri) native to the Thar Desert of India. Stand Genomic Sci, 11 (2016) 43.

15 Sankhla IS, Tak N, Meghwal RR, Choudhary S, Tak A,

Rathi S, Sprent JI, James EK & Gehlot HS, Molecular

characterization of nitrogen fixing microsymbionts from root

nodules of Vachellia (Acacia) jacquemontii, a native legume from the Thar Desert of India. Plant Soil, 410 (2017) 21.

16 Choudhary S, Meghwal RR, Sankhla IS, Tak N & Gehlot HS,

Molecular characterization and phylogeny of novel diverse

nitrogen fixing microsymbionts associated with Vachellia

(Acacia) leucophloea in arid and semiarid regions of Rajasthan. Indian Forester, 143 (2017) 266.

17 Rathi S, Gaur S, Tak N, Tak A & Gehlot HS, Genetically

diverse root nodule bacteria associated with Alysicarpus

vaginalis from alkaline soil of Rajasthan, India. Plant

Archives, 17 (2017) 495.

18 Le Quéré A, Tak N, Gehlot HS, Lavire C, Meyer T, Chapulliot D,

Rathi S, Sakrouhi I, Rocha G, Rohmer M & Severac D,

Genomic characterization of Ensifer aridi, a proposed new

species of nitrogen-fixing rhizobium recovered from Asian,

African and American deserts. BMC Genomics, 18 (2017) 85.

19 Choudhary S, Tak N & Gehlot HS, Phylogeny and genetic

diversity assessment of Ensifer strains nodulating Senegalia

(Acacia) senegal (L.) Britton. in arid regions of Western Rajasthan, India. Microbiology, 87 (2018) 127.

20 Samba RT, de Lajudie P, Gillis M, Neyra M, Spencer-Baretto

MM & Dreyfus B, Diversity of rhizobia nodulating Crotalaria

spp. from Senegal. Symbiosis, 27 (1999) 259.

21 Jourand P, Giraud E, Bena G, Sy A, Willems A, Gillis M,

Dreyfus B & de Lajudie P, Methylobacterium nodulans sp.

nov., for a group of aerobic, facultatively methylotrophic,

legume root-nodule forming and nitrogen-fixing bacteria. Int

J Syst Evol Microbiol, 54 (2004) 2269.

22 Liu XY, Wang ET, Li Y & Chen WX, Diverse bacteria

isolated from root nodules of Trifolium, Crotalaria and

Mimosa grown in the subtropical regions of China. Arch Microbiol, 188 (2007) 1.

23 Rocha AL, Isolation and characterization of bacterial symbionts

from Crotalaria spectabilis grown on trichloroethene

INDIAN J EXP BIOL, JUNE 2018

384

contaminated soil, Dissertation, Missouri University of Science

and Technology, Missouri, United States, 2011.

24 Singha B, Mazumder PB & Pandey P, Characterization of

plant growth promoting rhizobia from root nodule of

Crotalaria pallida grown in Assam. Indian J Biotechnol, 15

(2016) 210.

25 Vincent JM, A manual for the practical study of root-nodule

bacteria, (Blackwell Scientific Publications, Oxford), 1970.

26 Somasegaran P & Hoben HJ, The handbook for Rhizobia:

methods in legume Rhizobia technology, (Springer Verlag,

New York), 1994.

27 Cheng HR & Jiang N, Extremely rapid extraction of DNA

from bacteria and yeasts. Biotechnol lett, 28 (2006) 55.

28 Weisburg WG, Barns SM, Pelletier DA & Lane DJ, 16S

ribosomal DNA amplification for phylogenetic study. J

Bacteriol, 173 (1991) 697.

29 Richardson AE, Viccars LA, Watson JM & Gibson AH,

Differentiation of Rhizobium strains using the polymerase

chain reaction with random and directed primers. Soil Biol

Biochem, 27 (1995) 515.

30 Yanagi M & Yamasato K, Phylogenetic analysis of the

family Rhizobiaceae and related bacteria by sequencing of

16S rRNA gene using PCR and DNA sequencer. FEMS

Microbiol Lett, 107 (1993) 115.

31 Haukka K, Lindstrom K & Young JPW, Three phylogenetic

groups and nodA and nifH genes in Sinorhizobium and

Mesorhizobium isolates from leguminous trees growing in

Africa and Latin America. Appl Environ Microbiol, 64

(1998) 419.

32 Laguerre G, Nour SM, Macheret V, Sanjuan J, Drouin P &

Amarger N, Classification of rhizobia based on nodC and

nifH gene analysis reveals a close phylogenetic relationship

among Phaseolus vulgaris symbionts. Microbiology, 147

(2001) 981.

33 Thompson JD, Higgins DG & Gibson TJ, CLUSTAL W:

improving the sensitivity of progressive multiple sequence

alignment through sequence weighting, position-specific gap

penalties and weight matrix choice. Nucleic Acids Res, 22

(1994) 4673.

34 Tamura K, Stecher G, Peterson D, Filipski A & Kumar S,

MEGA6: Molecular Evolutionary Genetics Analysis Version

6.0. Mol Biol Evol, 30 (2013) 2725.

35 Zahran HH, Rhizobium–legume symbiosis and nitrogen

fixation under severe conditions and in an arid climate.

Microbiol Mol Biol Rev, 63 (1999) 968.

36 Tian CF, Zhou YJ, Zhang YM, Li QQ, Zhang YZ, Li DF,

Wang S, Wang J, Gilbert LB, Li YR & Chen WX,

Comparative genomics of rhizobia nodulating soybean

suggests extensive recruitment of lineage-specific genes in

adaptations. Proc Natl Acad Sci, 109 (2012) 8629.

37 Nick G, de Lajudie P, Eardly B, Soumalainen S, Paulin L,

Zhang X, Gillis M & Lindstrom K, Sinorhizobium arboris

sp. nov., and Sinorhizobium kostiense sp. nov., isolated from

leguminous trees in Sudan and Kenya. Int J Syst Bacteriol,

49 (1999) 1359.

38 de Lajudie P, Willems A, Pot B, Dewettinck D, Maestrojuan G,

Neyra M, Collins MD, Dreyfus B, Kersters K & Gillis M,

Polyphasic taxonomy of Rhizobia: Emendation of the genus

Sinorhizobium and description of Sinorhizobium meliloti

comb. nov., Sinorhizobium saheli sp. nov., and

Sinorhizobium teranga sp. nov. Int J Syst Bacteriol, 44

(1994) 715.

39 Yao ZY, Kan FL, Wang ET, Wei GH & Chen WX,

Characterization of rhizobia that nodulate legume species of the

genus Lespedeza and description of Bradyrhizobium

yuanmingense sp. nov. Int J Syst Evol Microbiol, 52

(2002) 2219.

40 Appunu C, N’Zoue A & Laguerre G, Genetic diversity of

native bradyrhizobia isolated from soybeans (Glycine max L.) in

different agricultural-ecological-climatic regions of India.

Appl Environ Microbiol, 74 (2008) 5991.

41 Brom S, Garcia-de los Santos A, Stepkowsky T, Flores M,

Davila G, Romero D & Palacios R, Different plasmids of

Rhizobium leguminosarum bv. phaseoli are required for

optimal symbiotic performance. J Bacteriol, 174 (1992)

5183.

42 Vinuesa P, Silva C, Werner D & Martinez-Romero E, Population

genetics and phylogenetic inference in bacterial molecular

systematics: the roles of migration and recombination

in Bradyrhizobium species cohesion and delineation. Mol

Phylogenet Evol, 34 (2005) 29.

43 Chen WX, Yan GH & Li JL, Numerical taxonomic study of

fast-growing soybean rhizobia and a proposal that Rhizobium

fredii be assigned to Sinorhizobium gen. nov. Int J Syst

Bacteriol, 38 (1988) 392.

44 Peng GX, Tan ZY, Wang ET, Reinhold-Hurek B, Chen WF

& Chen WX, Identification of isolates from soybean nodules

in Xinjiang Region as Sinorhizobium xinjiangense and

genetic differentiation of S. xinjiangense from Sinorhizobium

fredii. Int J Syst Evol Microbiol, 52 (2002) 457.