Contributions to the Molecular Genetics of the
Narrow-leaf Lupin (Lupinus angustifolius L.) -
Mapping, Marker development and QTL analysis.
By:
Jeffrey George Boersma
BSc, MSc
This thesis is presented for the degree of Doctor of Philosophy of
The University of Western Australia
School of Earth and Geographical Sciences
Soil Science and Plant Nutrition
2007
Abstract
ABSTRACT
Narrow-leaf lupin (Lupinus angustifolius L.) was first recorded as having
been introduced into Germany during the mid-19th
century for use as green manuring
and as fodder crops. However, it was not until post World-War I that there was any
serious attempt to domesticate the species. Since that time several key domestication
genes have been incorporated to enable the species to be grown as a crop over a
range of climates, harvested as a bulk commodity and, the seed used for both animal
and human consumption. However, the recent domestication of this species has seen
a rather limited use of wild germplasm – largely as a result of the difficulty in
retaining these key domestication genes. To make the task of retaining these genes
manageable, it was decided to resort to molecular technology.
A mapping population of F8 derived recombinant inbred lines (RILs) has
previously been established by the Department of Agriculture and Food, Western
Australia, from a cross between a domesticated breeding line 83A:476 and a wild
type P27255 in narrow-leaf lupin. The parents together with 89 RILs (of a
population of 115) were subjected to DNA fingerprinting using microsatellite-
anchored fragment length polymorphism (MFLP) to rapidly generate DNA markers
for construction of a linkage map. Five hundred and twenty two unique markers of
which 21% were co-dominant, were generated and mapped. Phenotypic data for the
domestication traits: mollis (soft seeds), leucospermus (white flower and seed
colour); Lentus (reduced pod-shattering), iucundis (low alkaloid), Ku (early
flowering) and moustache pattern on seed coats; were included. Three to 7
molecular markers were identified within 5 cM of each of these domestication genes.
The anthracnose resistance gene Lanr1 was also mapped. Linkage groups were
constructed using MapManager version QTXb20, resulting in 21 linkage groups
consisting of 8 or more markers. The total map length was 1543 cM, with an
average distance of 3.2 cM between adjacent markers. This is the first
comprehensive published map for a lupin species. The map was subsequently used
to identify markers closely linked to the domestication genes suitable for conversion
into forms suitable for marker assisted selection.
Wild types of L. angustifolius require vernalisation to promote flowering.
Modern domesticated cultivars carry the early-flowering gene Ku which removes this
requirement. An MFLP marker was identified as co-segregating with the Ku gene
2
and excised from the gel. DNA sequencing showed that the marker contained a 7 bp
insertion/deletion polymorphism, as well as a single nucleotide polymorphism
(SNP). A pair of sequence-specific primers was designed and successfully converted
the size polymorphism into a simple PCR based co-dominant marker. This marker is
closely linked to the Ku gene, as it co-segregated with the Ku phenotyping in a
population consisting of 106 RILs.
Extinction of Lupinus angustifolius in the wild during periods of drought may
be avoided by production of seeds with coats that are impermeable to water,
preventing germination of a large percentage of the seed in any given year.
Domesticated cultivars of this species carry the recessive gene mollis, making the
seed coat permeable to water and, in turn promoting good crop establishment in the
year of sowing. A dominant MFLP candidate marker on the map was identified as
being tightly linked to mollis. The marker was excised from the original gel,
amplified by PCR, sequenced and extended beyond the SSR-end of the original
MseI-SSR fragment. Two SNPs were found within this extended sequence. Specific
primers were designed to create a marker 209 bp long. PCR products of these
primers run on a Single Strand Conformation Polymorphism (SSCP) gel resolved in
a co-dominant fashion. This marker will be used in marker assisted selection for
mollis when introgressing wild material into lupin breeding programs.
Wild types of narrow-leaf lupin also have seed pods that shatter upon
maturity, leading to the loss of their seeds before or during the harvest process. Two
recessive genes have been incorporated into domesticated cultivars of this species to
maximize harvest-ability of the produce. One of these genes is called lentus (le).
Two MFLP candidate markers were identified as closely linked to the le gene in the
wild x domestic RIL population. The candidate MFLP markers were isolated from
the gel, re-amplified by PCR, cloned and sequenced. The MFLP polymorphisms
were converted into dominant sequence-specific PCR-based markers. Linkage
analysis by MapManager indicated that one of the markers, LeM1, was 2.6
centiMorgans (cM) and the other, LeM2, was 1.3 cM from the gene, with both being
on the same side. The correlation between the marker genotype and the plant
phenotype for the le gene is 95% for the Australian cultivars, and approximately 36%
on wild types tested. These markers may be useful in marker assisted selection for
the le gene when introgressing wild material into lupin breeding programs.
3
The second reduced-shatter gene is called tardus (ta). The RIL marker
population was phenotyped and the gene mapped onto the previously created linkage
map (above). One of several MFLP candidate markers identified as closely linked to
the ta gene, was isolated from the gel, re-amplified by PCR, cloned and sequenced.
The MFLP polymorphism was converted into a sequence-specific PCR-based co-
dominant marker. Linkage analysis by MapManager indicated that the marker,
TaM1, was approximately 2.8 centiMorgans (cM) from the gene. The correlation
between the ta marker genotype and the plant phenotype was 100% for the 18
Australian cultivars tested, and approximately 45.5% on wild types tested. This
marker may be useful in marker assisted selection for the ta gene when introgressing
wild material into lupin breeding programs.
In this thesis I also report the first quantitative traits loci (QTL) mapped in the
same F8 RIL population of Lupinus angustifolius. Traits mapped were early vigour,
days to flowering, height at maturity and seed size. Twenty-two QTLs were found,
located on 13 linkage groups of the same map, with alleles beneficial to the crop
contributed by both parents. Early vigour was controlled by 8 QTLs on 7 linkage
groups. Time to flowering was controlled by 10 QTLs and the height at maturity
was found to be under the control of 4 QTLs. Seed size was linked to 2 QTLs. A
region linked to the Ku gene that promotes early flowering by removal of the
vernalisation requirement appeared to play a role in all 4 traits. The gene mollis
controlling soft-seededness appeared to also be linked to early vigour and; iucundis
controlling alkaloid production was linked to seed size. Five pairs of QTLs were
found to be involved in epistasis, 2 of these having an effect on early vigour and
another 3 influencing the time to opening of the first florets. Variation explained for
each trait ranged from 28% for seed size, to 88% for days to flowering. We showed
that it was possible to use this data to predict genotypes of superior progeny for these
traits under Mediterranean conditions. QTL regions were compared on a second
published linkage map and regions of conserved synteny with the model legume
Medicago truncatula high-lighted.
The work presented in this thesis demonstrates the importance of tight
linkage between markers and genes of interest. It is especially important when
dealing with genetically diverse material as found in the wild. One of the main
problems faced by molecular scientists is the phenomenon known as linkage
disequilibrium in marker populations caused by either small population size or
4
insufficient opportunity for recombination. This frequently results in the
development of markers with little or no application outside of the population in
which it was developed. Although the relatively small size of the population used in
this study exposes it to such constraints, in this case excellent and valuable results
were achieved in developing useful markers to at least 3 of the domestication traits
within a relatively short time period of less then 4 years.
v
ACKNOWLEDGMENTS
I wish to express my thanks to my supervisors, Professor Krishnapillai
Sivasithamparam (The University of Western Australia) and Dr Huaan Yang
(Department of Agriculture and Food, Western Australia (DAFWA)) for their
unwavering support and guidance over the course of this PhD research project.
Thanks are also due to the many staff at the DAFWA who encouraged my efforts,
gave advice, and contributed to my research more directly. Chief among these are
Dr Chengdao Li, Dr Mark Sweetingham, Dr Bevan Buirchell, Dr Mingpei You,
Colin Smith, Dr Nicolyn Short, Daniel Renshaw and Dr Jon Clements. Also
included is Dr Matthew Nelson from Plant Sciences at the University of Western
Australia. My thanks also to the staff manning the School of Earth and Geographical
Science offices who helped keep me on track in various ways. I also wish to
acknowledge collaboration with staff and students of the Institute of Plant Genetics
Polish Academy of Sciences, Laboratory of Structural Genomics in Poznań, Poland,
who contributed directly in a small way to my QTL analysis work. Finally, I wish to
thank the members of my family who supported and encouraged my endeavours in
achieving this milestone.
vi
PUBLICATIONS ARISING FROM THIS THESIS
The following articles arising from this thesis have been accepted for publication:
Boersma JG, Pallotta M, Li C, Buirchell BJ, Sivasithamparam K, Yang H
(2005) Construction of a genetic linkage map using MFLP and identification
of molecular markers linked to domestication genes in narrow-leafed lupin
Lupinus angustifolius L.). Cell Mol Biol Lett 10:331-344
Boersma JG, Buirchell BA, Sivasithamparam K, Yang H (2007a) Development
of a sequence-specific PCR marker linked to the Ku gene which removes the
vernalization requirement in narrow-leafed lupin. Plant Breeding 126:306-
309
Boersma JG, Buirchell BA, Sivasithamparam K, Yang H (2007b) Development
of Two Sequence-specific PCR Markers Linked to the le gene that Reduces
Pod Shattering in Narrow-leafed Lupin (Lupinus angustifolius L.). Genet Mol
Biol – In Press
Boersma JG, Buirchell BA, Sivasithamparam K, Yang H (2007c) Development
of a PCR marker tightly linked to mollis, the gene that controls seed
dormancy in Lupinus angustifolius L. Plant Breeding – In Press
The following article has been submitted for publication and is currently undergoing
review:
Boersma JG, Li C, Leśniewska K, Sivasithamparam K, Yang H (2007d)
Identification of quantitative trait loci (QTLs) influencing early vigour,
height, flowering date and seed size and their implications for breeding of
narrow-leafed lupin (Lupinus angustifolius L.). Aust J Agric Res
vii
STATEMENT OF CANDIDATE CONTRIBUTION
This thesis contains published work and work prepared for publication. Details of
the journals and publications involved have been listed on page vi. Each article
comprises one whole chapter of this thesis.
Chapters accepted for publication or submitted for publication are:
Chapter Two: Boersma et al. (2005) Cellular & Molecular Biology Letters.
Chapter Three: Boersma et al. (2007a) Plant Breeding.
Chapter Four: Boersma et al. (2007b) Genetics and Molecular Biology (In-
Press).
Chapter Six: Boersma et al. (2007c) Plant Breeding (In Press).
Chapter Seven: Boersma et al. (2007d) Australian Journal of Agricultural
Research (Under Review).
Except where duly acknowledged, all work presented in this thesis was performed by
the PhD candidate.
Dr Bevan Buirchell from the Department of Agriculture and Food (Western
Australia) supplied the germplasm used in this thesis project. Professor Krishnapillai
Sivasithamparam and Dr Hua’an Yang as PhD supervisors played an active role in
overseeing the project and reviewing manuscripts. Dr Yang advised on laboratory
procedures as necessary.
Chapter 2:
(1) Dr Margaret Pallotta provided significant support in the construction (computing)
of the map (Figure 2.1) from the markers that had been generated. She
contributed only to the computer analysis, estimated to be around 30% of the
presented information relating to the computer phase.
Chapter 7:
(1) Ms Karolina Leśniewska (Institute of Plant Genetics Polish Academy of
Sciences, Laboratory of Structural Genomics, Strzeszyńska 34 60-479, Poznań,
Poland) contributed the marker ‘mtmt_GEN_00024_04_1’ and contributed
viii
significantly to the work associated with testing of this marker, with the
exception of the actual map placement which was performed by the candidate (<
5% of the chapter).
(2) Dr Chengdao Li helped set up the data files for analysis with the program QTL
Network version 2.0 and, performed the analysis of the epistatic interaction
between two genes involved in Early Vigour of lupins (Section 7.3.6) using the
JMP statistic software (<5% of the chapter).
……………………………………… …………………………………………..
Jeffrey G Boersma Professor K. Sivasithamparam
Coordinating Supervisor
ix
TABLE OF CONTENTS
Abstract……………………………………………………………………………. i
Acknowledgments……………………………………………………….………… v
Publications arising from this thesis…………………………………………….. vi
Statement of Candidate Contribution………………………………………….. vii
Table of Contents………………………………………………………………… ix
Chapter One: Introduction
1.1 Lupins as a crop…………………………………………………….…… 2
1.2 Agronomy of Lupins………………………………………….…………. 4
1.2.1 The Domestication genes…………………………………………. 5
1.2.1.1 Low seed alkaloids…………………………………………... 5
1.2.1.2 Soft seeds……………………………………………………. 5
1.2.1.3 Non-shattering pods…………………………………………. 6
1.2.1.4 Early flowering……………………………………………… 7
1.2.2 Selection for Domestication genes ………………………………. 8
1.2.3 Disease and Pest Resistance………………………………………. 9
1.2.3.1 Brown Spot / Pleiochaeta root rot…………………………… 9
1.2.3.2 Anthracnose (Colletotrichum gloeosporoides)………..…….. 10
1.2.3.3 Phomopsis (Diaporthe toxica Williamson et al.)…………… 10
1.3 Breeding to improve lupins as a crop…………………………….…….. 12
1.3.1 Past practices………………………………………………………. 12
1.3.2 Wild genetic material……………………………………………… 12
1.3.3 Mutation breeding…………………………………………………. 12
1.3.4 Transgenic breeding……………………………………………….. 13
1.4 Molecular genetics and plant breeding………………………………… 13
1.4.1 Molecular markers………………………………………………… 13
1.4.2 Genetic mapping…………………………………………….…….. 14
1.4.2.1 Mapping and markers……………………………………….. 14
1.4.2.2 Mapping populations………………………………….…….. 15
x
1.4.2.3 Mapping……………………………………………….…….. 17
1.4.2.4 Mapping in lupins…………………………………………… 18
1.4.3 Quantitative trait loci……………………………………………… 19
1.4.4 Marker assisted breeding………………………………………….. 21
1.5 Current needs in lupin breeding……………………………………….. 23
1.6 Aims of this thesis……………………………………………………….. 23
1.7 References……………………………………………………………….. 24
Chapter Two: Construction of a genetic linkage map using MFLP,
and identification of molecular markers linked to domestication
genes in narrow-leafed lupin (Lupinus angustifolius L.)
2.1 Introduction……………………………………………………………… 34
2.2 Materials and methods………………………………………………….. 35
2.2.1 Plant material……………………………………………………… 35
2.2.2 Phenotyping……………………………………………………….. 35
2.2.3 DNA extraction……………………………………………………. 37
2.2.4 MFLP protocol…………………………………………………….. 37
2.2.5 Data analysis and map construction……………………………….. 38
2.2.6 Genome length estimates………………………………………….. 38
2.3 Results……………………………………………………………………. 39
2.3.1 Phenotyping……………………………………………………….. 39
2.3.2 Marker polymorphism and segregation…………………………… 39
2.3.3 Map construction………………………………………………….. 40
2.3.4 Mapping of domestication and anthracnose resistance genes…….. 42
2.3.5 Estimation of genome size of L. angustifolius…………………….. 43
2.4 Discussion………………………………………………………………… 46
2.5 References………………………………………………………………... 48
xi
Chapter Three: Development of a sequence-specific PCR marker
linked to the Ku gene which removes the vernalisation requirements
in narrow-leafed lupin.
3.1 Introduction……………………………………………………………… 54
3.2 Materials and Methods………………………………………………….. 55
3.2.1 Plant materials and phenotyping of Ku gene……………………… 55
3.2.2 Marker development………………………………………………. 55
3.2.3 DNA amplification and sequencing gel electrophoresis………….. 56
3.3 Results……………………………………………………………………. 56
3.3.1 Phenotyping of Ku gene…………………………………………… 56
3.3.2 DNA sequencing of the candidate MFLP marker…………………. 57
3.3.3 Marker KuHM1…………………………………………………… 58
3.4 Discussion………………………………………………………………… 60
3.5 References……………………………………………………………….. 63
Chapter Four: Development of two sequence-specific PCR
markers linked to the le gene that reduces pod shattering in narrow-
leafed lupin (Lupinus angustifolius L.)
4.1 Introduction……………………………………………………………… 66
4.2 Materials and Methods………………………………………………….. 67
4.2.1 Plant materials and phenotyping of le gene………………………. 67
4.2.2 Marker development……………………………………………… 68
4.2.3 Testing of converted markers…………………………………….. 68
4.2.4 Confirmation of linkage………………………………………….. 69
4.3 Results……………………………………………………………………. 69
4.3.1 Phenotyping of le gene……………………………………………. 69
4.3.2 DNA sequencing of candidate MFLP markers…………………… 69
4.3.2.1 Marker LeM1………………………………………………... 71
4.3.2.2 Marker LeM2………………………………………………… 72
xii
4.3.3 Confirmation of linkage…………………………………………… 73
4.4 Discussion………………………………………………………………… 77
4.5 References………………………………………………………………... 79
Chapter Five: Development of a sequence-specific PCR marker
linked to the tardus gene that reduces pod shattering in narrow-
leafed lupin (Lupinus angustifolius L.)
5.1 Introduction……………………………………………………………… 82
5.2 Materials and Methods………………………………………………….. 82
5.2.1 Plant materials and phenotyping of the ta gene…………………… 82
5.2.1.1 Field observations……………………………………………. 83
5.2.1.2 Laboratory observations……………………………………… 84
5.2.2 Marker development and mapping………………………………... 84
5.2.3 Testing of converted markers……………………………………… 85
5.2.3.1 Confirmation of linkage……………………………………… 85
5.3 Results…………………………………………………………………….. 86
5.3.1 Phenotyping of ta gene……………………………………………. 86
5.3.2 Map placement of ta and closely linked MFLP markers………….. 86
5.3.3 DNA sequencing of candidate MFLP marker…………………….. 87
5.3.3.1 Marker TaM1………………………………………………… 89
5.3.4 Confirmation of linkage…………………………………………… 89
5.4 Discussion…………………………………………………………………. 92
5.5 References………………………………………………………………… 94
xiii
Chapter Six: Development of a PCR marker tightly linked to
mollis, the gene that controls seed dormancy in Lupinus angustifolius
L.
6.1 Introduction……………………………………………………………… 98
6.2 Materials and Methods………………………………………………….. 99
6.2.1 Plant materials……………………………………………………... 99
6.2.2 DNA extraction for marker testing………………………………... 99
6.2.3 Phenotyping for mollis…………………………………………… 100
6.2.4 Marker development……………………………………………... 100
6.2.5 Confirmation of linkage………………………………………….. 102
6.3 Results…………………………………………………………………… 102
6.3.1 Phenotyping of mollis gene………………………………………. 102
6.3.2 DNA sequencing of the candidate MFLP marker……………….. 102
6.3.3 Co-dominant marker MoA……………………………………….. 104
6.3.4 Confirmation of linkage………………………………………….. 105
6.4 Discussion……………………………………………………………….. 108
6.5 References……………………………………………………………….. 110
Chapter Seven: Identification of quantitative trait loci (QTLs)
influencing early vigour, height, flowering date and seed size and
their implications for breeding of narrow-leafed lupin (Lupinus
angustifolius L.)
7.1 Introduction……………………………………………………………... 114
7.2 Materials and Methods…………………………………………………. 115
7.2.1 Plant materials……………………………………………………. 115
7.2.2 Genetic markers………………………………………………….. 116
7.2.3 Plant measurements……………………………………………… 116
7.2.4 Data analysis……………………………………………………... 117
7.3 Results…………………………………………………………………… 118
xiv
7.3.1 Marker mtmtGEN00024041……………………………………... 118
7.3.2 Genetic maps……………………………………………………... 118
7.3.3 Phenotypic variation of traits…………………………………….. 119
7.3.4 Detection of QTLs……………………………………………….. 121
7.3.4.1 Early vigour………………………………………………… 121
7.3.4.2 Height at maturity…………………………………………... 124
7.3.4.3 Days to flowering…………………………………………… 124
7.3.4.4 Seed weight…………………………………………………. 124
7.3.5 Comparison to Nelson et al. and synteny with M. truncatula……. 125
7.3.6 Superior genotype………………………………………………... 126
7.4 Discussion……………………………………………………………….. 127
7.5 References……………………………………………………………….. 131
Chapter Eight: General discussion and future directions
8.1 Introduction…………………………………………………………….. 136
8.2 Lupin breeding…………………………………………………………. 136
8.3 Marker development and marker assisted selection………………… 136
8.4 Molecular markers and mapping……………………………………... 139
8.5 Quantitative trait loci and their analysis……………………………... 140
8.6 Synteny………………………………………………………………….. 141
8.7 Future directions……………………………………………………….. 142
8.8 References………………………………………………………………. 144
Chapter Nine: Appendices
9.1 Anthracnose disease rating of RIL population and comparison
to AnM2 and nearby newly generated map markers………………... 150
9.2 Tardus shatter rating of RIL population and comparison to
nearby newly generated map markers including those of
Nelson et al. 2006……………………………………………………….. 153
xv
9.3 Domestication gene rating of RIL population (according to
parental phenotype) including seed ‘moustache’ but excluding
tardus rating……………………………………………………………. 157
9.4 Enzyme Buffers………………………………………………………… 161
9.5 PCR formulations as used in this thesis………………………………. 163
9.6 DNA extraction for MFLP – High quality but low yield…………….. 164
9.7 Example MFLP procedure (for developing a marker)……………… 165
9.8 Cloning and sequencing a DNA band…………………………………. 173
9.9 How to do mapping with MapManager……………………………….. 179
9.10 Protocol for producing MapChart chart from MapManager……….. 181
9.11 Articles published or In Press as at July 2007………………………... 188
9.12 Raw data for QTL analysis including plant heights for early vigour
and at maturity, seed weight and flowering date……………………..
214
Chapter One: Introduction
1
Chapter One
Introduction
Chapter One: Introduction
2
1.1 LUPINS AS A CROP
There are two centres of origin for lupins, the Mediterranean basin („Old
World‟) and the Americas („New World‟). Twelve distinct Old World species have
been described, but those from the New World are numerous and ill-defined
(Gladstones 1998).
Lupins have a long history as crop plants. Two species Lupinus albus and L.
mutabilis have been cultivated as grain legumes for at least 3000 years in the
Mediterranean basin and the South American highlands respectively (von
Sengbusch, 1953). The benefits of lupins in improving soils (and thus enhancing
yields of the following crop) have been known from antiquity, with early Greek
writers such as Theophrastsus, Varro and Columella all highlighting their values
(Gladstones 1970).
In classical Greek and Roman times L. albus was grown for both stock feed
and human consumption, having a reputation for their ability to grow on poor and
roughly cultivated land and improving these soils as a green manure (Gladstones
1970) by incorporating the standing crop into the soil. More recently, in the 1970s,
wild forms of L. angustifolius and L. cosentini were grown in the Perth citrus
orchards for the same purpose.
In general, only large-seeded lupin species have been exploited by humans.
Gladstones (1970) lists 12 species in this category, with only one (L. mutabilis)
originating from South America. Seven species have only recently been
domesticated (Gladstones 1998). The species L. angustifolius, commonly known in
Australia as „narrow-leafed lupin‟ is among them, having retained its wild
characteristics until modern times. It was referred to by the classical authors as a
„wild‟ lupin and more recently in the 18th
and 19th
century as L. varius (Gladstones
1970). One of the common names it was known by in Italy was „lupino salvatico‟
(Bauhin et al. 1651, Savi 1798) suggesting that it may have played an important role
in times of hardship (Gladstones 1970).
The first recorded introduction of narrow-leaf lupins into Germany occurred
during the mid 19th
century at or soon after the successful introduction of L. luteus,
with both crops being cultivated primarily for fodder and green-manuring (Hanelt
1960). Production declined as a result of stock losses due to lupinosis (caused by
Diaporthe toxica) in the 1860‟s and 1870‟s and the increasing availability of cheap
Chapter One: Introduction
3
nitrogenous fertilisers during the early part of the 20th
century (Gladstones 1970).
Meanwhile, at least one large population was reported to exist in Western Australia
in the Swan valley and Gingin as early as 1880 (Gladstones 1998).
A shortage of protein feeds in Germany during World War I (1914-1918)
stimulated a renewed post-war German interest in lupins (Gladstones 1970). It was in
this time that serious attempts were made to fully domesticate narrow-leaf lupins.
Subsequently, the species became established in such diverse regions as New
Zealand, Australia, South Africa and the USA. With the development of sweet (non-
bitter), soft-seeded cultivars in1928, seed production became the main economic
focus of this crop.
However, even though the plant may no longer be used as a green manure, it
still is of benefit to following crops. Numerous studies in especially Western
Australia have shown the benefits of cropping lupins in rotation with cereals –
especially wheat, and on its own merits. Perry et al. (1998) lists the following
benefits of lupins in southern Australia:
(i) Increases the yield and quality of wheat grown in rotation by providing:
Fixed nitrogen;
A break crop for fungal disease control;
An opportunity of grass weed control;
(ii) Improved soil structure and nutrient cycling;
(iii) Diversified sources of income from sale of high protein seed;
(iv) Seed for use in integrated livestock production (pigs, sheep, cattle);
(v) High value stubbles to complement ruminant livestock production.
He also cites lupins as being responsible for encouraging the adoption of
conservation tillage where cultivation was reduced and stubble retention increased.
In 1991/1992 the narrow-leaf lupin was reported as being grown
commercially in 17 countries world-wide – including Europe, Africa and North
America and the then USSR. Australia was by far the largest producer at 1.1 million
tonnes, followed by Poland at 150 000 tonnes and the USSR at 85 000 tonnes.
Portugal produced just 33 tonnes (Swiecicki & Swiecicki 1995, Cox. 1998). In 2005
commercial lupin production (all species) in Australia was estimated to be 1.05
million tonnes after peaking at 2 million tonnes in 1999/2000, with Western
Australia alone producing more then 1.5 million tonnes (Australian Bureau of
Chapter One: Introduction
4
Statistics (ABS) data). In 2006 (a drought year) total lupin production in Australia
was a mere 174000 tonnes, with production of lupins in Western Australia at 125000
tonnes – the lowest on record (Australian Bureau of Agricultural and Resource
Economics (ABARE), Feb 2007).
1.2 AGRONOMY OF LUPINS
Wild accessions of L. angustifolius are well adapted for survival in agricultural
environments without the intervention of man. This is facilitated by their
characteristics that:
(i) They have a mechanism to prevent the immediate germination of seeds in the
presence of moisture as may occur in a summer storm, or in years of drought
(hard seed);
(ii) Chemical defences against herbivore and insect attack (alkaloids);
(iii) Mechanisms for synchronising flowering to ensure cross-pollination and time to
fill the seed (vernalisation requirements, photo-period response) and;
(iv) A mechanism for ensuring dispersal of the seed upon maturity (shattering pods).
The above characters (and especially i, ii, iv) are undesirable in a crop because:
(a) Hard seed makes crop establishment difficult if not impossible due to poor
germination;
(b) Alkaloids are toxic to man as well as domestic animals, thus greatly devaluing
lupins as a food source.
(c) The requirement for vernalisation has a negative impact on the adaptability of the
species to warm, short season environments.
(d) A crop should not shed its seed, making it more amenable to mechanized
harvesting.
Chapter One: Introduction
5
1.2.1 The domestication genes
The Domestication genes are those considered essential to the successful
adaptation of a wild plant type into a crop. Five domestication genes have been
incorporated into narrow-leaf lupins. A brief description and history follows:
1.2.1.1 Low seed alkaloids
Efforts to domesticate the narrow-leaf lupin started to bear fruit in Germany
in 1928/9 (Hanelt 1960, Gladstones 1970) when von Sengbusch isolated the first
natural mutant, low alkaloid plants (von Sengbusch 1931). There appears to be no
knowledge of the mechanism by which alkaloid production is restricted. The trait
was found to be simply inherited as a recessive gene. Another gene for low alkaloids
was found independently in Russia a little later (Fedotov 1932, Hackbarth and Troll
1956, Hackbarth 1957). In all, Gladstones (1970) lists three different (natural) genes
causing reduced levels of alkaloids in this species. These are iucundis ((discovered
by) von Sengbusch, 1928/29), esculentis (von Sengbusch 1928/29) and, depressus
(Fedotov 1931, Troll 1942). He also lists a fourth gene tantalus (Zachow 1967) that
had been created by means of x-ray induced mutation. In his ground-breaking work
in Western Australia (W.A.), Gladstones used the gene iucundis for breeding low-
alkaloid narrow-leaf lupins suitable for the W.A. environment. This gene has been
carried through into all modern Australian cultivars.
Modern cultivars of L. angustifolius contain <200mg alkaloids per kg and are
commonly referred to as „sweet‟ to differentiate them from the wild, high-alkaloid
forms which may contain as much as 40g per kg and are bitter to the taste. Lower
alkaloid levels are achievable but are not necessary and, the cost of controlling insect
pests – especially aphids becomes prohibitive. A typical alkaloid profile of sweet
narrow-leaf lupin consists of lupanine (42-59%), 13-hydroxylupanine (24-45%),
angustofoline (7-15%), α-isolupanine (1-1.5%) and traces of other alkaloids (<1%)
(Harris and Jago 1984, Petterson 1998).
1.2.1.2 Soft seeds
One of the survival adaptations of many plant species including that of the
wild narrow-leafed lupin (Lupinus angustifolius L.) is the production of seeds with
testa (seed coats) that are impermeable to water, inducing dormancy and preventing
full germination of the seed in any one year (Quinlivan 1967, Forbes and Wells
Chapter One: Introduction
6
1968). This adaptation in lupins is also known as being „hard seeded‟. Dormancy is
a physical process that appears to be induced after maturity as the seed moisture
content drops below 14% and, is complete at between 9 and 11% moisture content
(Gladstones 1958). In the field, seed dormancy of L. cosentinii (formerly known as
L. varius) was found to gradually break down as a result of large daily (summer)
temperature fluctuations (Quinlivan 1966, 1968). Similar observations have also
been made for L. angustifolius. It was surmised that the fluctuating temperatures
caused the testa to crack in localised areas making it permeable, allowing a viable
seed to readily imbibe water and germinate (Quinlivan 1968).
High germination rates and plant densities in the year of sowing are
paramount for a crop species. The recessive gene mollis which is of unknown origin
(Mikolajczyk 1966; Forbes and Wells 1968) results in seeds developing a water
permeable testa at maturity, although the precise mode of action of mollis remained
unclear. Some researchers have found that the seed of soft-seeded lines and cultivars
have testa similar in thickness to hard-seeded lines (Clements et al. 2005), whereas
others found an alteration in the shapes and size of especially the outer palisade and
the hourglass cell layers of lupin seed testa (Miao et al. 2001) and that of other
legumes (Lush and Evans 1980). Recently, Garnczarska et al. (2007) determined
that the main site of water entry into the seed was through the micropyle and hilum,
suggesting that mollis has some control over how one or both these two structures
functions.
Troll first combined mollis with a low alkaloid line from von Sengbusch,
resulting in the release of the cv Müncheberger Blaue Süsslupine II in 1944
(Hackbarth and Troll 1956, Troll 1964). Not surprisingly, mollis has since
domestication of the narrow-leaf lupin been incorporated in all subsequent cultivars
of this species (Gladstones 1960; Cowling 1999).
1.2.1.3 Non-shattering pods
An essential characteristic of a modern grain crop is the ability to retain its
seeds long enough to allow mechanical harvesting at full maturity. In the genus
Lupinus, this characteristic has long been present in two species – Lupinus albus L.
and L. mutabilis (Gladstones 1967). Von Sengbusch and Zimmermann (1937) were
successful in selecting a strain of narrow-leaf lupin that had a reduced pod shatter,
Chapter One: Introduction
7
apparently related to a large reduction in the thickness of the pod wall (Atebekova
1958), but this character proved to be unstable (Hondelmann 1984).
In 1960 Gladstones discovered two natural mutant (recessive) genes, lentus
and tardus for reduced pod-shattering which, when combined, almost eliminated all
pod shatter. One of the genes for reduced pod-shatter, known as tardus (ta), affects
the sclerenchyma strips of the dorsal and ventral pod seams, fusing the two halves to
such an extent that separation of the two halves is greatly impeded. It was
considered analogous to a gene previously found in L. luteus. The second gene
lentus (le) modified the orientation of the sclerified endocarp of the pod, resulting in
a reduction of torsional forces upon drying, and hence reduced pod shatter. This
gene was also associated with a reduction in the thickness of the pod wall, but not to
the extent of the previously found reduced shatter strain of narrow-leaf lupin of von
Sengbusch and Zimmerman (1937), leading to the conclusion that the controlling
genes were not the same. This modification was associated with a change in internal
pod pigmentation that gave the immature pods a purplish tinge and the inside surface
of mature pods a bright yellowish-brown colour (Gladstones, 1967). The gene le has
also been associated with development of a reddish pigmentation within the stem of
plants older than two months (G. Thomas, per. comm.). The first Australian cultivar
to carry both these genes was Uniharvest, released in 1971. All subsequent
Australian cultivars carry both these genes. Many European cultivars carry at least
one of the two genes.
1.2.1.4 Early flowering
Early work by Gladstones to find a gene for early flowering used as a model
the pasture legume species Trifolium subterraneum. He noted that Morley and Evans
(Evans 1959, Morley and Evans 1959) had discovered that the initiation of flowering
was controlled by three complementary processes: (1) vernalisation, (2) dark period
inhibition or long day requirement, (3) high temperature requirement. It had already
been known for some time that lupins were vernalisable long-day plants – that is, it
was possible to bring forward the date of first flowering (anthesis) by subjecting the
plants to a period of low temperatures (Gladstones 1969).
Gladstones and Hill (1969) reported the discovery of a single dominant gene
(Ku) that effectively removed all requirements for vernalisation in narrow-leaf
lupins, advancing the date of anthesis by 2 – 5 weeks depending on location and
Chapter One: Introduction
8
sowing date, with plants sown late in colder areas showing the smallest response.
This gene had been detected in a single plant within a commercial crop of the
Swedish cultivar Borre.
In a subsequent study, Rahman and Gladstones (1972) reported that narrow-
leaf lupins responded to both periods of vernalisation and a long (24 hr) photo-
period. They found too that a 4-week vernalisation at 1-2o
C had a significant impact
on flowering in narrow-leaf lupin, reducing the time to flowering from 111.4 to 79.8
d in the cultivar Uniharvest. When the photo-period was increased from 10 h to 24 h
it also had a substantial effect, reducing the days to anthesis by 15.6 d from 53.3 to
37.7 d in a genotype possessing the gene Ku. This is supported by Dracup et al.
(1998) and Adhikari et al. (2004) who found that extending photoperiod to at least 16
h gave a significant reduction in the time to flowering. However, in their experiment,
cultivars having Ku showed a reduction of only 1 to 3 days whereas non-Ku lines
were up to 16 days earlier in reaching anthesis. In Western Australia the maximum
photo-period during April – October varies between 9.25 h in June and July and 11 h
d-1
in August, reaching a maximum of ~ 12.75 h d-1
in October
(http://www.bom.gov.au/climate/dwo/IDCJDW0600.shtml). The target date for anthesis is
early August (Nelson and Delane 1991). Thus, the impact of photoperiod would
most probably be greatly reduced, as in the earlier reported experiments of
Gladstones and Hill (1969).
Gladstones and Hill (1969) concluded that Ku greatly increased the flexibility
of lupins as a crop in that it enables them to be grown in warmer areas with
insufficient cold to satisfy the vernalisation requirements. This gene also would
allow them to be sown in areas with a short growing season as experienced in large
areas of the Western Australian grain-belt. In the last decade it was discovered that
another gene Julius (Mikolajczyk 1966) which is of unknown origin, is identical to
Ku (Cowling et al. 1998).
1.2.2 Selection for domestication genes
Until now, the only way to select for the domestication genes in lupins has
been by phenotyping and selection on the basis of physical characters. This can at
earliest be done at about 10 weeks (le gene), but could be as late as after seed harvest
(mollis). Phenotyping of tardis, is difficult and time consuming, being further
complicated if the cross also segregates for le. Ku, because it is a dominant gene
Chapter One: Introduction
9
requires a second generation (F3) to select lines homozygous for this gene, thus
causing considerable delays in selection (as well as increasing the numbers of plants
that need to be grown by approximately 4-fold). Because of this difficulty, there has
been a reluctance to introduce new wild material into the breeding cycle. The
development of molecular markers can overcome this difficulty, enabling selection
for all of these genes within the first weeks of the F2 stage.
1.2.3 Disease and pest resistance
Diseases and pests have only been recognised as being economically
important since lupins were domesticated as a low-alkaloid crop mid-way through
the last century. Most diseases of lupins are caused by fungi or viruses, there being
no known bacterial pathogens and very few reports of significant nematode damage
(Sweetingham et al. 1998).
In Western Australia, lupin breeders have concentrated primarily on
resistance to fungal and viral diseases. Some of the major fungal diseases to have
received the breeders‟ attention are:
1.2.3.1 Brown spot / Pleiochaeta root rot.
The diseases Brown spot and Pleiochaeta root rot are caused by the same
fungus Pleiochaeta setosa. It is widespread, being present in Europe as well as in
Australia, Africa and the Americas, although it is usually less damaging overseas.
The fungus survives as spores on the stubble or is transmitted by the seed. Foliar
infection of the plant by rain-drop splash can result in the defoliation of the plants
and even death. The same organism also causes root rot of seedling lupins, with
infection usually taking place soon after germination and the appearance of lesions 3
to 4 weeks later. The roots can completely rot away, resulting in the death of the
seedling. It is considered to be the most important root pathogen of lupins in
Australia (Sweetingham et al. 1998). Resistance to both Brown spot and Pleiochaeta
root rot are under polygenic control (Cowling 1988), with no major genes having
been found for either disease. Genes providing resistance to one form of the disease
do not necessarily provide resistance to the other form.
Chapter One: Introduction
10
1.2.3.2 Anthracnose (Colletotrichum gloeosporioides)
Anthracnose of lupins was first reported in south-eastern USA in 1939. It
was later found to be present in New Zealand, being responsible for the rapid decline
of L. arboreus in their pine forests from about 1988 and, in 1994 the first reported
outbreak of anthracnose occurred in breeders plots in Western Australia. The disease
spread rapidly causing widespread infection of commercial crops in the northern
grain-belt of W.A. and on the Eyre peninsula of South Australia in 1996, with
especially L. albus, but also L. angustifolius and L. cosentinii affected. Characteristic
symptoms of the disease are the bending over of stems and petioles with a lesion
inside the crook. These lesions can girdle and break off the stem or twist and deform
the pods. Lesions tend to be purplish or brown with masses of pink conidiospores.
Pods and seeds can also be infected (Sweetingham et al. 1998). Two strains have
been identified – vegetative compatibility groups (VCG) 1 and 2, with the more
virulent strain VCG 2 being the only one so far identified in W.A. (H Yang, pers.
comm.).
Single major resistance genes to anthracnose have been identified in each of
L. angustifolius and L. albus. Current breeding efforts are aimed at incorporating
these and any newly identified resistance genes into new cultivars. The first
anthracnose resistant cultivar of L. angustifolius, Tanjil was released in 1998, and the
first (slightly less) resistant cultivar of L. albus, Andromeda, was released in 2005 in
a bid to re-launch the species as a crop in Western Australia.
To improve the process of incorporating these genes into new varieties,
molecular genetic markers linked to these genes are being developed. Two closely
linked markers have been reported (Yang et al. 2004, You et al. 2005) for L.
angustifolius, although to date, no successful markers have been developed for the
resistance gene of L. albus.
1.2.3.3 Phomopsis (Diaporthe toxica Williamson et al.)
Phomopsis infection of lupins can result in a mycotoxicosis that can kill livestock
grazing on the stubble. This disease is a major problem in Australia and South
Africa, with the organism living parasitically in the living stems of the plant and
usually producing the deadly mycotoxin phomopsin in the plant stems after they
have senesced (Gardiner 1961, 1966). Infected plants develop dark purplish lesions
on infected stems and pods at maturity, or under conditions of stress induced by
Chapter One: Introduction
11
frost, drought or herbicide damage. Where pod lesions develop prior to harvest, seed
may also become infected, showing a gold or brown discolouration (Sweetingham et
al. 1998). Under Australian conditions, D. toxica over-summers in colonised stubble
as both perithecia and pycnidia. The stubble can serve as a source of inoculum for at
least two years (Wood and McLean 1982). To control this disease the only practical
means is by breeding for resistance. The first resistant cultivar of L. angustifolius,
Tanjil, was released in 1998. A molecular marker linked to a major gene conferring
resistance to Phomopsis has been developed (Yang et al. 2002) to enable improved
selection of resistant genotypes.
1.3 BREEDING TO IMPROVE LUPINS AS A CROP
1.3.1 Past practices
Following on from the completion of domestication of narrow-leaf lupins in
the late 1960‟s / early 1970‟s, the main emphases have been on increased yield,
higher protein content, environmental adaptation and disease and pest resistance. A
number of the major diseases of lupins have been covered in the previous section.
There is a general agreement that elimination of bitter types is important for the
survival of the lupin industry as a whole. Some countries, most notably Spain,
Portugal and Italy face difficulties in maintaining purity of low alkaloid lines because
of the proximity of bitter wild types that are common through that region. However,
even as recently as 1993, a bitter lupin crop was being promoted by a small group
within the European community for the production of various products including
purified alkaloids (Cowling et al. 1998).
1.3.2 Wild genetic material
Wild lupins have been exploited for resistance genes to various diseases
including Pleiochaeta setosa, Grey spot (caused by Stemphylium botryosum Wallr.,
Stemphylium solani Weber) and anthracnose. Frost tolerance is another trait
originally discovered in progeny of crosses with a wild type from Portugal (Wells
and Forbes 1982). In general, improvements in yield and disease resistance have
relied heavily on the domesticated germplasm, with only limited use of wild
accessions. The use of wild accessions has been limited primarily because of the
difficulties associated with the retention of domestication genes.
Chapter One: Introduction
12
1.3.3 Mutation breeding
Mutations have also played a role in breeding. All of the original
domestication genes (iuc, Ku, le, ta, moll) are natural mutations that were selected in
the field. However, an induced mutant for early flowering (efl) was used in breeding
the moderately early flowering cv. Chittick in W.A. (Anon 1982). Experiments with
induced mutants having a range of restricted branching patterns were carried out in
Western Australia in the early to mid 1990‟s but have since been abandoned.
Conversely, at least one such gene „mut1‟of L. angustifolius has been incorporated in
European cultivars (Bromberek et al. 1984) where early growth cessation and rapid
maturity are required for the short summer growing season (Cowling et al. 1989).
Current research focussing on development of herbicide-tolerant cultivars is aimed at
developing cultivars tolerant to the herbicide Metribuzin, using artificially induced
mutations (Si et al. 2007) as well as naturally occurring variation as sources of
genetic improvement (Si et al. 2006).
1.3.4 Transgenic breeding
Interest in transgenic lupins has been low – probably because of widespread
public resistance to transgenic crops. Molvig et al. (1997) reported producing a
transgenic narrow-leaf lupin with enhanced seed methionine levels by incorporating
a sunflower seed albumin gene and; Jones et al. (1999) reported producing a
transgenic lupin with increased tolerance to the herbicide Basta® (Glufosinate). The
Basta-resistant lupins have not been released to the public.
1.4 MOLECULAR GENETICS AND PLANT BREEDING
1.4.1 Molecular markers
A marker may be defined as a signpost for indicating an item or object of
value and is itself of no intrinsic value. In modern genetics, molecular markers are
used to sign-post genes including (hopefully) those of agronomic value. Jones et al.
(1997) state that “Molecular markers (DNA markers) reveal neutral sites of variation
at the DNA sequence level. By „neutral‟ is meant that, unlike morphological
markers, these variations do not show themselves in the phenotype, and each might
be nothing more then a single nucleotide difference in a gene or a piece of repetitive
Chapter One: Introduction
13
DNA”. DNA markers can be classed into two categories depending upon how the
polymorphism is revealed, namely: hybridisation-based- and PCR-based-
polymorphisms.
The most common form of hybridisation-based polymorphism are RFLPs
(restriction fragment length polymorphisms) whose sequence(s) are unique. RFLPs
are generated due to events in the DNA chromosome such as point mutations,
inversions, deletions or translocations. The RFLPs are then used as labelled probes
(usually radioactive) on membranes to which have been attached the DNA of the test
organism after it has been digested with one or more restriction enzymes (Kumar
1999). The RFLP only binds to the complementary strand, thus identifying
organisms carrying a particular allele for a given gene.
In PCR, a pair of oligonucleotide primers oriented with their 3' end pointing
towards each other, are used to copy each strand of denatured DNA bearing a
complementary sequence (to which they have annealed), with the aid of a
polymerase which adds nucleotides starting from the 3' end of the primers. The three
steps of the PCR (template denaturation, annealing of primers and enzymatic
sequence extension) are cycled a large number of times to exponentially increase the
numbers of the fragments being copied to levels detectable upon electrophoresis in a
gel. In general, the size of the fragment amplified is below 2000-3000bp (base pairs)
(Kumar 1999). The most common forms of marker generated in this fashion include
AFLPs (amplified fragment length polymorphisms), SSR (simple sequence repeats
or microsatellites) and RAPDs (randomly amplified polymorphic DNA). A recently
developed form of PCR marker is the MFLP (microsatellite fragment linked
polymorphism). The MFLP technique was derived from a combination of the AFLP
concept with SSR-anchor primers (Yang et al. 2001) and is capable of producing
DNA markers with high efficiency, with each of the detected DNA polymorphisms
including an SSR motif (Yang et al. 2001, 2002, 2004).
AFLPs and RAPDs are expressed as „dominant‟ markers only (present or
absent), whereas RFLPs are generally considered to be „co-dominant‟ markers in that
two fragments are produced – one for each allele. SSRs too are frequently expressed
as co-dominant markers whereas MFLPs may be either dominant or co-dominant in
their expression. Co-dominant markers are considered superior to dominant markers
as they enable identification of individuals heterozygous for a particular gene as well
as those that are homozygous.
Chapter One: Introduction
14
1.4.2 Genetic mapping
1.4.2.1 Mapping and markers
PCR-based markers are increasingly popular in mapping because of the ease
with which they can be produced from even small amounts of DNA. In recent years,
the AFLP technique (Vos et al. 1995) has been widely used in plant genetic mapping
because of its high efficiency in generating large numbers of molecular markers
(Eujayl et al. 2002, Pearl et al. 2004, Yin et al. 2003). The use of SSR markers is
increasing in popularity because they occur at high frequencies in plant genomes (Li
et al. 2002) and exhibit high mutation rates (Vigouroux et al. 2002). MFLPs have
not previously been recorded as being used in genetic mapping.
1.4.2.2 Mapping populations
Selection of mapping populations is critical to successful map construction.
Because a map‟s economic significance will depend on marker-trait associations, as
many qualitatively inherited morphological traits as possible should be included in
the chosen parent lines (Staub et al. 1996).
It has long been considered that the most informative mapping population
was an F2 that had been fully characterised (Mather 1938), using a co-dominant
marker system such as RFLPs or SSRs. The main difficulties in dealing with an F2
population are that many lines (≥50%) are heterozygous and therefore cannot be
adequately characterised by dominant markers such as AFLPs (see below) and, they
have a limited life as a population because of the ongoing genetic segregation with
each generation. Consequently, they are frequently not the first choice in mapping.
The choice of mapping population therefore depends in part on the types of
markers that will be generated to produce the map, with dominant markers such as
AFLPs being best suited to Recombinant Inbred Lines (RILs) and Doubled Haploids
(DH), as they may yield inconclusive (and thus misleading) information if used on an
F2 population without doing extensive progeny testing which can also be expensive
and time consuming (Staub et al. 1996). MFLPs also come into this category as a
large percentage of the marker fragments produced are of a dominant nature (Yang et
al. 2001).
The most commonly used populations are DH and RILs. Doubled haploids
of F1 gametes are used to characterise especially cereals (e.g. Collard et al. 2005, Su
Chapter One: Introduction
15
et al. 2006), but also Canola (Pradham et al. 2003). Recombinant inbred lines have
similar characteristics, being single plant selections of F2 progeny – usually to either
the F7 or F8 generation and are mostly used on crops for which no DH technology
(yet) exists as in lupins and lentils, although it is sometimes used as an alternative to
DH (e.g. in wheat – Röder et al. 1998).
Fine mapping of traits has frequently presented difficulties. The problem
here is that most mapping populations are too small and have had too few
opportunities for recombination to occur – being constrained both in the number of
parents (only two) and the number of generations over which recombination is
allowed to occur before fixing of the alleles begins (just one). As a consequence, the
correlation between even distant markers and a gene (the Linkage disequilibrium or
LD) can be very high so that markers apparently closely linked to a particular gene
may prove ineffective when applied to a very different population.
Recently the more advanced methods of Linkage disequilibrium (LD)
mapping and Family-based linkage (FBL) mapping have gained greater interest.
Both methods, originally developed for human genetics, are especially powerful in
detection and mapping of quantitative trait loci (QTLs) (Mackay and Powell 2007)
and suited for use in a segregating population. In essence, LD mapping relies on the
weaker linkages (i.e. larger genetic distances) to gradually break down in a large,
randomly mating population, with the end result being that only very close linkages
between genes and markers are retained. One variation of LD mapping is the
Advanced Intercross where F2 individuals are inter-mated for several generations
prior to mapping, causing LD to decay and, the precision of QTL location to be
increased (Darvasi and Soller 1995). FBL mapping is based on the establishment of
a population based on a small number of founding individuals (parents), allowing
them to freely cross over a number of generations, with a similar end result to LD
mapping. In FBL it may be possible to select individuals with extreme phenotypes
(such as individuals exhibiting a particular disease) as the parents to ensure a
population segregating for most QTL associated with traits of interest (Mackay and
Powell 2006).
Other types of mapping populations have also been developed. Bulked
segregant analysis (BSA; Michelmore et al. 2001) uses two bulked DNA samples
drawn from the segregating population of a single cross to find markers linked to a
particular trait by identifying lines identical for this trait and screening them for
Chapter One: Introduction
16
common markers. It is similar in many ways to using near-isogenic lines (NILs) in
that both are used to screen for a particular trait, but without the problems associated
with developing an NIL (Staub et al. 1996). In tomatoes, inter-specific crosses have
resulted in production (via recurrent back-crossing) of an exotic library of
Introgression Lines (ILs) – a population consisting of a set of lines, each of which
carries a single, defined chromosome segment that originates from a donor species in
an otherwise uniform elite genetic background. It is not usually possible to produce
ordinary mapping populations from such crosses as plants produced frequently
exhibit partial sterility. Such a library is difficult to produce (Kumar 1999) and takes
about 10 generations. This population could then be used for fine mapping of QTLs
or, each line used directly for breeding (Eshed and Zamir 1995, Zamir 2001).
1.4.2.3 Mapping
Genetic mapping in its simplest definition is “putting markers in order,
indicating the relative genetic distances between them” (Jones et al. 1997). The
concept of creating a genetic map is not new, the aim commonly being to enable
improved understanding of genetic behaviour and the (efficient) selection (in crops
and stock) of superior genotypes. The earliest genetic maps were of a physical
nature – creating simple maps showing genetic linkages between morphological
traits and certain genes. One such example is that of Lindsley and Grell (1968) who
created a physical map for the fruitfly, Drosophila melanogaster. However, physical
markers to single genes are frequently difficult to find so that most early maps were
sparsely populated. In 1980, Botstein proposed the construction of a genetic linkage
map of humans using molecular markers (Botstein et al. 1980). Since then, this idea
has been implemented for a wide range of organisms, but especially to crops and
animals of commercial value.
Map construction requires the generation of suitable markers and incorporates
the calculated recombination values from all the pair-wise combinations of markers
to generate linkage groups. Traits controlled by major genes and segregating in that
population may be physically scored and mapped in the same manner as the markers
(Jones et al. 1997). The linear arrangement of these linkage groups should minimise
the number of recombination events between adjacent markers (Staub et al. 1996,
Jones et al. 1997).
Chapter One: Introduction
17
The relationships between map distance and recombination value is
characterised by a genetic mapping function (mf). An mf is a formula expressing
quantitative relationships between distances in a linkage map using crossover
frequency. They take into account the possibility that the existence of one crossover
may influence the likelihood of another one occurring within a certain distance. This
is known as interference. Staub and Serquen (1996) note that there are several mf
that can be applied but, that the most common mapping functions were developed by
Haldane (1919) and Kosambi (1944). While Haldane‟s mf assumes an absence of
interference, Kosambi‟s assumes positive interference (i.e., fewer double
recombinants when compared to no interference). Map distances are calculated as
centiMorgan (cM), with 1cM being approximately equal to a 1% recombination rate
between the two points (Kumar 1999).
There are a number of computer programs available to help order the markers
into linkage groups. Well known programs include Linkage 1 (Suiter et al. 1983),
MapMaker (Lander et al. 1987) and MapManager-QTX (Manly et al. 2001).
Mapping programs are not always correct in how they order markers and linkage
groups. Thus, it is normal to re-check the output of the program. In the process, it is
also wise to re-score any data that appears as a double recombinant in the map, since
such events are rare and may well be indicative of a scoring error (M. Pallotta, pers.
comm.). One of the many examples of maps constructed using one of these
programs is that by Tanksley et al. (1992) who used MapMaker to construct and
compare two high density linkage maps for the potato and tomato genomes. Many
more maps of varying density have been published for both animals and plants.
Included in the cultivated plant crops are published maps for arabidopsis, banana,
barley, bean, brassica, citrus, coffee, cotton, cucumber, lentil, mustard, rice, rye,
sorghum, soybean, sugar-beet, tomato (Staub et al. 1996, Eujayl et al. 1998, Pradhan
et al. 2003, Pearl et al. 2004), with other maps having been published for tree species
including pine (Travis et al. 1998, Hayashi et al. 2001, Yin et al. 2003 ) and
eucalyptus (Grattapaglia and Sederoff 1994).
1.4.2.4 Genetic mapping in lupins
Lupinus angustifolius is a diploid species having (2n) 40 chromosomes
(Gladstones 1970). A complete genetic map of this species would therefore be
expected to have 20 linkage groups representing the (1n) chromosomes. Wolko and
Chapter One: Introduction
18
Weeden (1994) estimated that the length of a complete map would most probably be
in excess of 1500cM – on the basis that the polyploid nature of lupins makes it likely
to be larger then that of the average diploid plant. They attempted to construct a
linkage map of an F2 population (n = 48 plants) using RAPDs as well as iso-enzymes
and were successful in linking 60 RAPD and 4 iso-enzyme markers into 17 groups
spanning a total of 986.7cM (Wolko and Weeden 1994, Kruszka and Wolko 1999).
Meanwhile Brien et al. (1999) also attempted to create a linkage map using an F2
mapping population. They generated 705 polymorphic AFLP markers that they
mapped into 52 linkage groups covering approximately 1000 cM. Later, the same
group of researchers (Scobie et al. 2002) reported having just 368 AFLP markers (In
an F8 RIL population?) in 61 linkage groups (LOD 4), with markers identified as
being linked to early maturity, reduced pod shatter, low alkaloid content, permeable
(soft) seed coat and flower colour. Clearly none of the maps were adequate – the
first and third having a very low density, the second and third having more then 2.5x
the expected number (20) of linkage groups. One probable reason for this is that
both RAPDs and AFLPs, being dominant markers fail to discriminate between
homozygous and heterozygous individuals and, failed PCR reactions may be difficult
to distinguish from a null-allele in a dominant marker, making mapping a much more
difficult exercise.
A start has also been made on physically mapping genes and molecular
markers, with the location of rDNA loci on particular chromosomes (Naganowska et
al. 2003). No comprehensive genetic map of L. angustifolius had yet been published
when work was started on this thesis (2003).
1.4.3 Quantitative trait loci
In nature a number of agronomically important traits such as yield, quality,
maturity, and resistance to biotic and abiotic stresses are considered to be polygenic,
displaying a large continuous range in variation approximating the Normal curve.
The continuous variation in phenotypic expression of such traits frequently cannot be
fitted to simple Mendelian ratios and are therefore generally considered to be the
product of the interaction of a number of gene loci (Johannsen 1909, Nilson-Ehle
1909, East 1916), commonly known as Quantitative Trait Loci (QTLs). To improve
crops all sources of superior genetics must be exploited. However, the very nature of
Chapter One: Introduction
19
QTLs makes them difficult to select in the field and necessitates the use of closely
linked unambiguous markers.
The development of molecular genetic maps now allows researchers to
identify QTLs and make detailed analysis of their inheritance and activity, as first
achieved by Paterson et al. (1988). Several reviews have discussed mapping of
QTLs, including Tanksley (1993), Young (1996) and Kumar (1999). Some of the
main areas of discussion have been covered in the following section.
QTLs cannot be mapped in the same way as a major (single) gene because
the individual loci cannot be directly identified. The principle of QTL mapping is to
associate QTLs with molecular markers in their common inheritance (Jones et al.
1997) and; to assign individual QTLs to a chromosomal location and determine the
alleles contributed by each parent (e.g. Tanksley 1993, Paterson 1995).
Early work on the analysis of QTLs used analysis of variance (ANOVA), also
known as single point analysis, to test the relationship between traits and markers.
This approach does not require a complete molecular linkage map (Tanksley 1993).
It had limitations in that:
(i) the further a QTL is from the marker gene, the less chance it had of being
statistically significant;
(ii) the magnitude of the QTL‟s effect would normally be underestimated due
to recombination between the marker and QTL.
(iii) the likelihood of further (linked) QTLs being missed if the genome was
not completely covered.
Tanksley (1993) considered that these problems would be minimised by a having a
complete linkage map with markers at intervals of less then 15cM.
The availability of complete linkage maps and computers has resulted in
interval mapping becoming the method most commonly used (at present). Interval
mapping (IM) (Lander and Botstein 1989) considers the linkages between markers
and uses the maximum likelihood equation to give an estimate, based on the
Logarithm of Odds threshold (LOD) score, of the probability of a QTL being present
in any interval based on flanking marker information (Kumar 1999). MapManager-
QTX (Manly et al. 2001) was developed for just this purpose. This method is
particularly useful when using a map on which the markers are moderately far apart
(>20cM), but becomes inefficient at large distances (e.g. >35cM) (Tanksley 1993).
Chapter One: Introduction
20
Interval mapping does not however, have the precision to distinguish multiple
linked QTL effects and, may result in QTLs being mapped to the wrong position
(Zeng 1993, 1994). This has led to investigating alternative methods of analysis
including the development of the Composite Interval Method (CIM). This method
combines multiple regression analyses with IM to help separate closely linked QTLs.
However, it lacks sensitivity in detecting especially smaller QTLs (Zeng 1993,
1994).
Recent work by Zhu and his co-workers in China have focused on analyses
based on a Mixed model Composite Interval Mapping (MCIM) method (Zhu 1998,
Yang and Zhu 2005). This method incorporates the use of matrices rather then IM
alone to allow mapping of QTLs with high precision, including analysis of gene
action (e.g. epistasis) and environmental interaction. An upgraded version of the
computer program became available during 2006 and is known as QTL Network
version 2.0 (Yang et al. 2005).
QTL analysis may be coupled to marker-assisted selection (below) in plant
breeding, enabling breeders to better select not only progeny but also potential
parents carrying desirable genes for a trait of interest. Kumar (1999) has tabulated
35 pest and disease organisms in 14 crops for which QTLs conferring resistance have
been mapped. In narrow-leafed lupins, it is already established that the only
resistance to Pleiochaeta setosa is polygenic in nature (Section 2, Disease and Pest
Resistance). By mapping QTLs associated with traits such as this one, the
opportunity arises to identify markers on the map closely linked to them and, to
develop them into PCR-friendly forms for implementation in breeding.
A further benefit of mapping QTLs is in exploiting synteny (conservation of
linkage). It is not uncommon for related species to have near identical coding
sequences for homologous genes (Moore et al. 1995), albeit not necessarily in
identical positions on the genome. By locating and sequencing a gene of interest it
may be possible to exploit synteny to locate that gene in a related species of interest.
1.4.4 Marker assisted breeding
To effectively and efficiently breed superior crops and livestock, it is
necessary to select parents carrying desirable alleles and combine them in the
offspring while eliminating those that are undesirable. Morphological markers are
Chapter One: Introduction
21
infrequent and may be only loosely linked to the genes of interest, necessitating a
better method of selection – namely molecular markers.
Marker assisted selection (MAS) is based on the premise that it is possible to
infer the presence of a gene from the presence of a marker tightly linked to that gene
– usually within a distance of no more then 5 cM. This technique would be most
useful for tracing the inheritance of QTLs and major genes where the procedures for
screening the plants (as in disease resistance genes) are labour intensive, or require
plants to be screened for several traits at the same time and, in an environment not
conducive to one or more of these traits to be expressed. For MAS to be efficient,
markers linked to genes of interest should be converted into a Sequence Tagged Site
(STS) by designing primers that will allow highly specific amplification (and
visualisation) of the marker by PCR (Kumar 1999) from relatively small amounts of
DNA.
Such relationships between the gene and marker may be determined by either:
(a) phenotyping a mapping population for the trait of interest and positioning the
gene on a molecular map prior to identification of closely linked markers
(Tanksley et al. 1992);
(b) generating and phenotyping a full-sib population, with the parents differing in the
gene of interest, followed by marker generation and evaluation (Yang 2002,
2004);
(c) by repeatedly back-crossing to generate near-isogenic lines (NILs) which differ
in the presence or absence of the target gene and a small region flanking the
target gene, followed by marker generation and evaluation (Kumar 1999),
(d) A variation of the last method (c) is to generate a population of introgression
lines (IL) using a closely related species as the donor parent (Eshed and
Zamir1995) and then generating and evaluating markers.
(e) Bulk segregant analysis (Michelmore et al. 2001)
The last four methods do not require the generation of a molecular map but could
also be useful in helping to saturate a map region associated with the trait of interest
but lacking in closely linked markers. It should be noted that methods (a) – (c) can
only apply to major genes, and methods (d) and (e) could be used for both major and
minor genes (QTLs). Having a good molecular map would make the process more
efficient.
Chapter One: Introduction
22
There are many examples in the literature of molecular markers being
developed for use in plant breeding. The crop most frequently reported is wheat (e.g.
Khabaz-Saberi et al. 2002, Collard et al. 2005, Sun et al. 2005, Distelfeld et al. 2006,
Su et al. 2006), although barley, canola, soybean, tomatoes and potatoes also are
actively researched.
Thus far, only a small number of molecular markers linked to major genes of
narrow-leaf lupins have been developed. These include:
(i) A CAPS (cleaved amplified polymorphic sequence) marker for the gene Ku
(Brien et al. 1999);
(ii) An MFLP marker linked to a gene conferring resistance to Phomopsis (Yang et
al. 2002);
(iii) Use of two MFLP markers linked to the one gene conferring resistance to
anthracnose (Yang et al. 2004; You et al. 2005).
1.5 CURRENT NEEDS IN LUPIN BREEDING
Recently there has been a recognition that the possible genetic gain for yield
and other traits including disease resistance will be increasingly limited if wild
accessions are not exploited more extensively. The reluctance to incorporate this
material can be largely attributed to the difficulties associated with the selection for
domestication traits, most of whom are recessive in nature and, of whom one or more
genes (e.g. reduced shattering (ta), early flowering) are difficult and laborious to
select for in the field.
The advent of molecular markers in lupin breeding could remove these
difficulties and radically alter the scene. However, to effectively use this technology
the lupin genome requires extensive characterisation – both morphologically and at a
molecular level. The combination of markers, genes and quantitative traits into a
molecular genetic map is therefore one of the highest priorities for ensuring steady
progress in the rate of genetic gain.
1.6 AIMS OF THIS THESIS
The aims of this thesis are therefore:
(1) To develop and characterise a mapping population of narrow-leafed lupin and; to
generate a comprehensive molecular map of lupins on which are placed all the
Chapter One: Introduction
23
domestication genes and the previously developed disease resistance genes (and
associated markers) – Chapter 2;
(2) To identify a molecular marker closely linked to the Ku gene and, to convert this
marker into an easily implementable, PCR-friendly form – Chapter 3;
(3) To identify molecular markers closely linked to the le gene and, to convert these
markers into an easily implementable, PCR-friendly form – Chapter 4;
(4) To identify a molecular marker closely linked to the ta gene and, to convert this
marker into an easily implementable, PCR-friendly form – Chapter 5;
(5) To identify a molecular marker closely linked to the moll gene and, to convert
this marker into an easily implementable, PCR-friendly form – Chapter 6;
(6) To phenotype a mapping population for a number of complex traits and to
analyse and map the QTLs that contribute to these phenotypes – Chapter 7.
1.7 REFERENCES
Anon (1982) Registration of Lupinus angustifolius L. (narrow-leaf lupin) cv.
Chittick. J Aust Inst Agric Sci 48:122-124
Adhikari KN, Galway NW, Dracup M (2004) Extending photoperiod and
increasing illuminance hastens flowering of narrow-leafed lupin (Lupinus
angustifolius L.) In: van Santen E, Hill GD (eds) Wild and cultivated lupins
from the tropics to the poles. Proc 10th
Int Lup Conf Laugarvatn, Iceland. Int
Lupin Assn, Canterbury, New Zealand. pp 271-274
Atebekova AI (1958) The dehiscence of the pods in the genus Lupinus (Tourn.) L.
Bull Moscow Soc Nat Res 63:89
Bauhin J, Cherlero JH, Chabraeus D, Agraffenried Fr. Historiae. Plantarum
universalis. Ebroduni (1651)
Botstein D, White RL, Skolnick M, Davis RW (1980) Construction of a genetic
linkage map in man using restriction fragment length polymorphisms. Am J
Hum Genet 32:314-331
Brien SJ, Cowling WA, Potter RH, O'Brien PA, Jones RAC, Jones MGK (1999)
A molecular marker for early maturity (Ku) and marker-assisted breeding of
Lupinus angustifolius. In: Proc 11th
Aust Plant Br Conf Adelaide 2. pp. 204-
205
Chapter One: Introduction
24
Bromberek S, Mikolajczyk J, Wiza M (1984) [Self-completing mutation of blue
lupin]. In: Proc 3rd
Int Lupin Conf. Int Lupin Assn, La Rochelle, France. pp.
566-567 (in French)
Clements JC, Dracup M, Buirchell BJ, Smith CG (2005) Variation for seed coat
and pod wall percentage and other traits in a germplasm collection and
historical cultivars of lupins. Aust J Agric Res 56:75-83
Collard BCY, Grams RA, Bovill WD, Percy CD, Jolley R, Lehmensiek A,
Wildermuth G, Sutherland MW (2005) Development of molecular markers
for crown rot resistance in wheat: mapping of QTLs for seedling resistance in
a „2-49‟ x „Janz‟ population. Plant Breed 124:532-537
Cowling WA (1988) Breeding for resistance to leaf and root rot caused by
Pleiochaeta setosa in narrow-leafed lupin. In: Proceedings of the fifth
international lupin conference PWRiL, Poznań, Poland, pp. 217-229
Cowling WA (1999) Pedigrees and characteristics of narrow-leafed lupin cultivars
released in Australia from 1967 – 1998. Agriculture Western Australia
Bulletin 4365
Cowling WA, Huyghe C, Swiecicki W (1998) Lupin Breeding. In: Gladstones JS,
Atkins C and Hamblin J (eds) Lupins as crop plants. CAB International,
University Press, Cambridge, UK. pp. 93-120
Cox B (1998) Marketing and trade (of lupins). In: Gladstones JS, Atkins C and
Hamblin J (eds) Lupins as crop plants. CAB International, University Press,
Cambridge, UK. pp. 437-454
Darvasi A, Soller M (1995) Advanced intercross lines, an experimental population
for fine genetic mapping. Genetics 164:741-745
Distelfeld A, Uauy C, Fahima T, Dubcovsky J (2006) Physical map of the wheat
high-grain protein content gene Gpc-B1 and development of a high-
throughput molecular marker. New Phytol 169:753-763
Dracup MR, Thomson R, Reader M, Kirby EJM, Shield I, Leach J (1998)
Daylength responses, flowering time and seed filling in lupins. Aust J Agric
Res 49:1047-1055
East EM (1916) Studies on size inheritance in Nicotiana. Genetics 1:164-176
Eshed Y, Zamir D (1995) An introgression line population of Lycopersicon
pennellii in the cultivated tomato enables the identification of fine mapping of
yield associated QTL. Genetics 141:1147-1162
Chapter One: Introduction
25
Eujayl I, Baum M, Powell W, Erskine W, Pehu E (1998) A genetic linkage map of
lentil (Lens sp) based on RAPD and AFLP markers using recombinant inbred
lines. Theor Appl Genet 97:83-89
Eujayl I, Sorrels M, Baum M, Wolters P (2002) Isolation of EST-derived
microsatellite markers for genotyping the A and B genomes of wheat. Theor
Appl Genet 104:399-407
Evans LT (1959) Flower initiation in Trifolium subterraneum L. 1. Analysis of the
partial processes involved. Aust J Agric Res 10:1
Fedotov VS (1932) Preliminary results of the searches for alkaloidless lupins. Trudŷ
prikl Bot Genet Selek (Suppl) 54:38-42
Forbes I, Wells HD (1968) Hard and soft seededness in blue lupine, Lupinus
angustifolius L.: Inheritance and phenotype classification. Crop Sci 8:195-
197
Gardiner MR (1961) Lupinosis, an iron storage disease of sheep. Aust Vet J 37:135
Gardiner MR (1966) Fungus-induced toxicity in lupinosis. Brit Vet J 122:508-516
Garnczarska M, Zalewski T, Kempka M (2007) Water uptake and distribution in
germinating lupine seeds studied by magnetic resonance imaging and NMR
spectroscopy. Physiol Planta 130:23-32
Gladstones JS (1958) The influence of temperature and humidity in storage on seed
viability and hardseededness in West Australian blue lupin (Lupinus digitatus
Forsk.). Aust J Agric Res 9:171-181
Gladstones JS (1967) Selection for economic characters in Lupinus angustifolius
and L. digitatus. 1. Non-shattering pods. Aust J Exp Agric and Anim Husb
7:360 – 366
Gladstones JS (1970) Lupins as crop plants. Fld Crop Abstr 23(2):123-148
Gladstones JS. Distribution, origin, taxonomy, history and importance (of lupins)
(1998). In: Gladstones JS, Atkins C and Hamblin J (eds) Lupins as crop
plants. CAB International, University Press, Cambridge, UK. pp. 1-39
Grattapaglia D, Sederoff R (1994) Genetic linkage maps of Eucalyptus grandis and
Eucalyptus urophylla using a pseudo-testcross: Mapping strategy and RAPD
markers. Genetics 137:1121-1137
Hackbarth J (1957) [The genes of the lupin species. 2.Narrow-leafed lupin (Lupinus
angustifolius L.).] Z PflZücht 37:85-91 (in German)
Chapter One: Introduction
26
Hackbarth J, Troll H-J (1956) [Lupins as grain legumes and fodder plants.]. In:
Kappert H and Rudorf W (eds) [Handbook of Plant Breeding, Part IV], 2nd
edn. Verlag Paul Parey, Berlin and Hamburg. pp.1-51 (in German)
Haldane JBS (1919) The combination of linkage values, and the calculation of
distance between the loci of linked factors. J Genet 8:299-309
Hanelt P (1960) [The Lupins]. A Ziemsen, Wittenberg 104 pp (in German)
Harris DJ, Jago J (1984) Report on chemical compositions of sweet lupin seed
from Western Australia. Government Chemical Laboratories, Perth, 12pp
Hayeshi E, Kondo T, Terada K, Kuramoto N, Goto Y, Okamura M, Kawasaki
H (2001) Linkage of Japanese black pine based on AFLP and RAPD markers
including markers linked to resistance against the pine gall midge. Theor
Appl Genet 102:871-875
Hondelmann W (1984) The lupin – ancient and modern crop plant. Theor Appl
Genet 68:1-9
Johannsen W (1909) Elemente der exakten Erblichkeitsliehre. Fisher, Jena
Jones MGK, Wylie SJ, Berryman D, Selladurai S, Brien SJ, Li D, Yang R, Ryan
K, Li H, Li L (1999) Biotechnological tools in lupin breeding and disease
diagnosis. In: Lupin, an ancient crop for the new millennium: Proceedings of
the 9th
international lupin conference, Klink/Muritz, Germany, 20-24 June
1999. International Lupin Association, Canterbury, New Zealand 2000:111-
114
Jones N, Ougham H, Thomas H (1997) Markers and mapping: we are all
geneticists now. New Phytol 137:165-177
Khabaz-Saberi H, Graham RD, Pallotta MA, Rathjen AJ, Williams KJ (2002)
Genetic markers for manganese efficiency in durum wheat. Plant Breed
121:224-227
Kosambi DD (1944) The estimation of map distance from recombination values.
Ann Eugenics 12:172-175
Kruszka K, Wolko B (1999) Linkage maps of morphological and molecular
markers in lupin. In: Proc 9th
Int Lupin Conf, Klink / Muritz, Germany.
International Lupin Association. pp. 100-105
Kumar LS (1999) DNA markers in plant improvement: An overview. Biotech Adv
17:143-182
Chapter One: Introduction
27
Lander ES Botstein D (1989) Mapping Mendelian factors underlying quantitative
traits using RFLP linkage maps. Genetics 121:185-199
Lander ES, Green P, Abrahamson J, Barlow A, Daly MJ, Lincoln SE, Newberg
L (1987) MAPMAKER, an interactive computer package for constructing
primary genetic linkage maps of experimental populations. Genomics 1:174-
181
Li YC, Korol AB, Fahima T, Beiles A, Nevo E (2002) Microsatellites: genomic
distribution, putative functions and mutational mechanisms: A review. Mol
Ecol 11:2453 – 2465
Lindsley DL, Grell EH (1968) Genetic variations of Drosophila melanogaster.
Carneg Inst Wash Publ 627. Washington D.C.
Lush WM, Evans LT (1980) The seed coats of cowpeas and other grain legumes:
Structure in relation to function. Fld Crop Res 3:267-286
Mackay I, Powell W (2007) Methods for linkage disequilibrium mapping in crops.
Trends Plant Sci 12(2):57-63
Manly KF, Cudmore Jr RH, Meer JM (2001) MapManager QTX, cross-platform
software for genetic mapping. Mammalian Genome 12:930-932
Mather K (1938) Measurement of linkage in heredity. Methuen and Co. London
Miao ZH, Fortune JA, Gallagher J (2001) Anatomical structure and nutritive value
of lupin seed coats. Aust J Agric Res 52:985-993
Michelmore RW, Paran I, Kesseli RV (1991) Identification of markers linked to
disease resistance genes by bulked segregant analysis: A rapid method to
detect markers in specific genomic regions using segregating populations.
Proc Natl Acad Sci USA 88:9828-9832
Mikolajczyk J (1966) Genetic studies in Lupinus angustifolius. 2. Inheritance of
some morphological characters in blue lupine. Genet Pol 7:153-180
Molvig L, Tabe LM, Eggum BO, Moore AE, Craig S, Spencer D, Higgins TJV
(1997) Enhanced methionine levels and increased nutritive value of seeds of
transgenic lupins (Lupinus angustifolius L.) expressing a sunflower seed
albumin gene. Proc Natl Acad Sci USA 94:8393-8398
Moore G, deVos KM, Wang Z, Gale MD (1995) Cereal genome evolution –
grasses, line up and form a circle. Curr Biol 5:737-739
Chapter One: Introduction
28
Morley FHW, Evans LT (1959) Flower initiation in Trifolium subterraneum L. 2.
Limitations by vernalization, low temperatures and photoperiod in the field at
Canberra. Aust J Agric Res 10:17
Naganowska B, Doležel J, Święcicki WK (2003) Development of molecular
cytogenetics and physical mapping of ribosomal RNA genes in Lupinus. Biol
Plantar 46(2):211-215
Nelson P, Delane R (1990, 1991) Producing lupins in Western Australia. In: E.
Lawson (ed) Bulletin 4179, Department of Agriculture Western Australia
Nilsson-Ehle H (1909) Kreuzunguntersuchungen an Hafer und Weizen. Lund
Paterson AH (1995) Molecular dissection of quantitative traits: Progress and
prospects. Genome Res 5:321-323
Paterson AH, Lander ES, Hewitt JD, Peterson S, Lincoln SE, Tanksley SD
(1988) Resolution of quantitative traits into Mendelian factors, using a
complete linkage map of restriction fragment length polymorphisms. Nature
335:721-726
Pearl HM, Nagai C, Moore PH, Steiger DL, Osgood RV, Ming R (2004)
Construction of a genetic map for arabica coffee. Theor Appl Genet 108:829-
835
Perry MW, Dracup M, Nelson P, Jarvis R, Rowland I, French RJ (1998)
Agronomy and farming systems (of lupins). In: Gladstones JS, Atkins C and
Hamblin J (eds) Lupins as crop plants. CAB International, University Press,
Cambridge, UK. pp. 291-338
Petterson DS. Composition and food uses of lupins (1998) In: Gladstones JS,
Atkins C and Hamblin J (eds) Lupins as crop plants. CAB International,
University Press, Cambridge, UK. pp. 353-384
Pradhan AK, Gupta V, Mukhopadhyay A, Arumugam N, Sodhi YS, Pental D
(2003) A high-density linkage map in Brassica juncea (Indian mustard) using
AFLP and RFLP markers. Theor Appl Genet 106:607-614
Quinlivan BJ (1966) The relationship between temperature fluctuations and the
softening of hard seeds of some legume species. Aust J Agric Res 12:1009-
1022
Quinlivan BJ (1967) Environmental variation in the long term pattern of hard seeds
of Lupinus varius. Aust J Exp Agric Anim Husb 7:263-265
Chapter One: Introduction
29
Quinlivan BJ (1968) The softening of hard seeds of sand-plain lupin (Lupinus
varius L.). Aust J Agric Res 19:507-515
Rahman MS, Gladstones JS (1972) Control of lupin flower initiation by
vernalization photoperiod and temperature under controlled environment.
Aust J Exp Agric Anim Husb 12:638-645
Röder MS, Korzun V, Wendehake K, Plaschke J, Tixier, M-H, Leroy, P, Ganal
MW (1998) A Microsatellite map of wheat. Genetic 149:2007-2023
Savi G (1798) Flora pisiana. Pisa, G. Giacomelli
Scobie MN, Brien SJ, Potter RH, Jones MGK (2002) Molecular mapping and
markers in sweet narrow-leafed lupins (L. angustifolius). In: Anon (eds) Plant
breeding for the 11th
millennium; 12th
Australasian plant breeding conference,
Perth, Western Australia p. 237
Sengbusch von R (1931) [Low alkaloid lupins. 2.] Züchter 3:93-109 (in German)
Sengbusch von R (1953) [A contribution to the evolutionary history of our
cultivated food plants with special reference to individual selection]. Züchter
23:353-364 (in German)
Sengbusch von R, Zimmermann K (1937) Die Auffindung der ersten gelben und
blauen Lupinen (Lupinus luteus und Lupinus angustifolius) mit
nichtplatzenden Hülsen und die damit zusammenhängenden Probleme,
insbesondere die der Süsslupinenzüchtung. Züchter 9:57-65
Si P, Buirchell B, Sweetingham MK (2007) Seed yield and anthracnose resistance
of Tanjil mutants tolerant to Metribuzin. In: Crop updates 2007, Lupins and
pulses updates. Department of agriculture and food, Western Australia.
pp.50-51
Si P, Sweetingham MW, Buirchell BJ, Bowran DG, Piper T (2006) Genotypic
variation in metribuzin tolerance in narrow-leafed lupin (Lupinus
angustifolius L.). Aust J Exp Agric 46:85-91
Staub JE, Serquen FC, Gupta M (1996) Genetic markers, map construction, and
their application in plant breeding. HortSci 31(5):729-741
Su J-Y, Tong Y-P, Liu Q-Y, Li B, Jing R-L, Li J-Y, Li Z-S (2006) Mapping
quantitative trait loci for post-anthesis dry matter accumulation in wheat. J
Integr Plant Biol 48(8):938-944
Chapter One: Introduction
30
Suiter KA, Wendel JF, Case JS (1983) Linkage-1: A pascal computer program for
the detection and analysis of genetic linkage. J Hered 74:203-204
Sun DJ, He ZH, Xia XC, Zhang LP, Morris CF, Appels R, Ma WJ, Wang H
(2005) A novel STS marker for polyphenol oxidase activity in bread wheat.
Mol Breed 16:209-218
Sweetingham MW, Jones RAC, Brown AGP. Diseases and pests (of lupins). In:
Gladstones JS, Atkins C and Hamblin J (eds) Lupins as crop plants. CAB
International, University Press, Cambridge, UK. (1998) 263-289
Swiecicki W, Swiecicki WK (1995) Domestication and breeding of narrow-leafed
lupin (Lupinus angustifolius L.). J Appl Genet 36:155-167
Tanksley SD (1993) Mapping polygenes. Annu Rev Genet 27:205-233
Tanksley SD, Ganal MW, Prince JP, de Vicente MC, Bonierbale MW, Broun P,
Fulton TM, Giovanni JJ, Grandillo S, Martin GB, Messeguer R, Miller
JC, Miller L, Paterson AH, Pineda O, Röder MS, Wing RA, Wu W,
Young ND (1992) High density molecular maps of the tomato and potato
genomes. Genetics 132:1141-1160
Travis SE, Ritland K, Whitham TG, Keim P (1998) A genetic linkage map of
pinyon pine (Pinus edulis) based on amplified fragment polymorphisms.
Theor Appl Genet 97:871-880
Troll H-J (1964) [Cultivation, breeding and seed problems in large seeded legumes
as contribution to the remedy of protein fodder-deficiency in particular in
reference to cultivation – competition between lupins and field peas].
Wissenschaftlich Zeitschrift der Karl-Marx-Universität 13:651-663 (in
German)
Vigouroux Y, Jaqueth JS, Matsuoka Y, Smith JSC, Doebley J (2002) Rate and
pattern of mutation at microsatellite loci in maize. Mol Biol Evol 19:1251-
1260
Vos P, Hogers R, Bleeker M, Reijans M, Lee T, Hornes M, Frijters A, Pot J,
Peleman J, Kuiper M., Zabeau M (1995) AFLP: A new technique for DNA
fingerprinting. Nucleic Acids Res 23:4407-4414
Wells HD, Forbes I (1982) Genetics and breeding of Lupinus for winter production
for the south of the United States of America. In: Gross R, Bunting ES (eds)
Agricultural and Nutritional aspects of lupines. Proc 1st Int lupine wrkshp.
GTZ GmbH, Eschborn, Germany. pp. 77-89
Chapter One: Introduction
31
Wolko B, Weeden NF (1994) Linkage map of isozyme and RAPD markers for the
Lupinus angustifolius L., In: Neves-Martins, J.M. and Beirão da Costa, M.L.
(eds) Advances in Lupin Research. Proc 7th
Int Lupin Conf, Evora, Portugal.
ISA Press, Portugal. pp. 42-49
Wood P McR, McLean GD (1982) Lupins-the disease problem. W.A. J Agric
16:31-32
Yang H, Boersma JG, You M, Buirchell BJ, Sweetingham MW (2004)
Development and implementation of a sequence-specific PCR marker linked
to a gene conferring resistance to anthracnose disease in narrow-leafed lupin
(Lupinus angustifolius L.). Mol Breed 14:145-151
Yang H, Shankar M, Buirchell BJ, Sweetingham MW, Caminero C, Smith
PMC (2002) Development of molecular markers using MFLP linked to a
gene conferring resistance to Diaporthe toxica in narrow-leafed lupin
(Lupinus angustifolius L.). Theor Appl Genet 105:265-270
Yang H, Sweetingham MW, Cowling WA, Smith PMC (2001) DNA
fingerprinting based on microsatellite-anchored fragment length
polymorphisms, and isolation of sequence-specific PCR markers in lupin
(Lupinus angustifolius L.). Mol Breed 7:203-209
Yang J, Zhu J (2005) Methods for predicting superior genotypes under multiple
environments based on QTL effects. Theor Appl Genet 110:1268-1274
Yang J, Hu CC, Ye XZ, Zhu J (2005) QTL Network 2.0. Institute of
Bioinformatics, Zhejiang University, Hangzhou, China.
(http://ibi.zju.edu.en/software/qtlnetwork)
Yin TM, Wang XR, Andersson B, Lerceteau-Köhler E. (2003) Nearly complete
genetic maps of Pinus sylvestris L. (Scots pine) constructed by AFLP marker
analysis in a full-sib family. Theor Appl Genet 106:1075-1083
You M, Boersma JG, Buirchell BJ, Sweetingham MW, Siddique KHM, Yang H
(2005) A PCR-based molecular marker applicable for marker-assisted
selection for anthracnose disease resistance in lupin breeding. Cell Mol Biol
Lett 10:123-134
Young ND (1996) QTL mapping and quantitative disease resistance in plants. Annu
Rev Phytopathol 34:479-501
Zamir D (2001) Improving plant breeding with exotic genetic libraries. Nature
Reviews – Genetics 2:983-989
Chapter One: Introduction
32
Zeng Z-B (1993) Theoretical basis of separation of multiple linked gene effects on
mapping quantitative trait loci. Proc Natl Acad Sci USA 90:10972-10976
Zeng Z-B (1994) Precision mapping of quantitative trait loci. Genetics 136:1457-
1468
Zhu J (1998) Mixed model approaches for mapping quantitative trait loci. Hereditas
(Bejing) 20(Sup):137-138
Chapter 2: Construction of a genetic linkage map
33
Chapter Two
Construction of a genetic linkage map using MFLP, and
identification of molecular markers linked to domestication
genes in narrow-leafed lupin (Lupinus angustifolius L.)
Chapter 2: Construction of a genetic linkage map
34
2.1 INTRODUCTION
The narrow-leafed lupin (Lupinus angustifolius L.) was grown as a crop in
classical Greek and Roman times (Gladsones 1970), being used for both stock feed
and human consumption. Plant breeding in L. angustifolius started in Germany early
last century, followed by extensive work in Australia in the 1950’s (Gladstones
1998). Key domestication genes incorporated into modern cultivars of L.
angustifolius include the low-alkaloid gene iucundis (iuc), seed coat permeability
gene mollis (moll), white flower gene leucospermum (leuc), nil vernalisation
requirement gene Ku and, reduced pod shattering genes tardus (ta) and lentus (le)
(Gladstones 1970, Pate et al. 1985, Swiecicki and Swiecicki 1995). Domesticated
cultivars of L. angustifolius are currently grown in Europe, Africa and North
America (Pate et al. 1985, Swiecicki and Swiecicki 1995), but Australia remains the
world's largest producer of this species with approximately 1.5 million hectares
planted annually in Western Australia alone (Brien et al. 1999). The objectives of
modern lupin breeding programs include improved yield, higher protein content,
environmental adaptation and disease and pest resistance, particularly resistance to
anthracnose which is the most devastating known disease of lupins (Yang and
Sweetingham 1998). Recently two molecular markers linked to the anthracnose
resistance gene Lanr1, have been developed and used in marker-assisted selection for
anthracnose resistance in breeding of lupins in Australia (Yang et al. 2004, You et al.
2005).
L. angustifolius is a diploid species containing (2n) 40 chromosomes
(Gladstones 1970). Molecular genetic mapping in L. angustifolius was first
attempted in Poland (Wolko and Weeden 1994, Kruszka and Wolko 1999), with 60
RAPD markers and 4 isozyme markers mapped into 17 groups. Brien et al. (1999)
generated 705 polymorphic AFLP markers, which mapped into 52 linkage groups
covering approximately 1000cM. To date, no comprehensive genetic map of L.
angustifolius has been published.
In recent years, the AFLP technique (Vos et al. 1995) has been widely used
in plant genetic mapping because of its high efficiency in generating large numbers
of molecular markers (Eujayl et al. 2002, Li et al. 2002, Pearl et al. 2004). The use of
simple sequence repeat (SSR) markers also known as microsatellite markers, is
increasing in popularity because they occur at high frequencies in plant genomes (Li
Chapter 2: Construction of a genetic linkage map
35
et al. 2002), and exhibit high mutation rates (Vigouroux et al. 2002). The MFLP
technique was derived from a combination of the AFLP concept with SSR-anchor
primers (Yang et al. 2001) and is capable of producing DNA markers with high
efficiency, with each of the detected DNA polymorphisms including an SSR motif
(Yang et al. 2001, 2002, 2004). The objectives of this study are (1) to employ the
MFLP technique to generate large numbers of DNA markers for construction of a
genetic map of Lupinus angustifolius and (2) to identify molecular markers linked to
the domestication genes and anthracnose resistance gene Lanr1.
2.2 MATERIALS AND METHODS
2.2.1 Plant material
An F8 RIL mapping population (DxW) was developed from a cross between a
domesticated line 83A:476 (maternal) and a wild type P27255 from Morocco
(paternal). This DxW population segregates for a number of traits and domestication
genes including: permeable (soft) seed coat gene mollis (Mikolajczyk 1963); non-
shattering genes lentus and tardus (Gladstones 1960); sweetness (low alkaloid) gene
iucundis (von Sengbusch 1930); early flowering gene Ku (Gladstones and Hill 1969)
and, white flower / seed colour gene leucospermus (Hallqvist 1921). In addition, it is
known that the domesticated parent carries the gene for resistance to anthracnose,
Lanr1 (Yang et al. 2004). A total of 89 sibs were used in this study.
2.2.2 Phenotyping
Mollis (moll). This gene is recessive (moll) and allows rapid imbibition and
germination of viable seeds when soaked in water (Forbes and Wells 1968). Thirty
seeds of each RIL were placed on filter papers in a Petri plate, moistened with
deionised water, placed on the bench and maintained at room temperature. Seeds
were monitored for imbibition and emergence of the radicle (germination) as
indicative of a permeable seed coat. Lines were considered to have permeable seeds
(soft seeded) when at least 75% of viable seed imbibed within 10 days. Seeds that
had not imbibed in that period had their seed coats scarified and were monitored for a
further 10 days to confirm their viability.
Chapter 2: Construction of a genetic linkage map
36
Leucospermus (leuc). This gene controls flower colour, which is either blue
(Leuc) or white (leuc). Both flower colour and the production of a white seed coat
have previously been found to be associated with this gene (Gladstones 1970,
Hallqvist 1921). Flower colours were confirmed on rows of plants grown in the
screen-house and single plants grown in the glasshouse. Seed coat background
colours, which are either grey (Leuc) or white (leuc), were also recorded.
Lentus and Tardus (le and ta). These two genes are complementary reduced
pod-shatter genes. Each individually reduces but does not eliminate pod shattering
after ripening. When a plant possesses both reduced shattering genes (genotype lele
tata), pod shatter is largely eliminated. The le allele when homozygous has
previously been found to be associated with orange-red pigmentation in the (living)
stem and mature inner pod walls (Gladstones 1967). When the Le allele is present,
no orange-red pigmentation is produced. No such association is known to occur for
ta. Plants were grown in the glasshouse and scored for the presence of the le gene on
the basis of presence or absence of orange stem pigmentation. They were allowed to
mature and dry, and monitored for pod shatter. Pods of plants having either none or
one of the two genes eventually shattered. Those having both genes remained intact.
Iucundis (iuc). This gene controls alkaloid levels. Plants with the Iuc allele
are bitter, and plants with the iuciuc genotype are sweet (Hackbarth and von
Sengbusch 1934). Plants grown in the screen-house and glasshouse were tested for
alkaloid levels by means of Dragendorff papers (Hackbarth and von Sengbusch
1934, Rogers and Bendich 1994). Sap from leaf petioles of flowering plants was
expressed onto the Dragendorff paper and inspected. Where the paper colour
remained unchanged the plant was considered to have low alkaloid levels (sweet).
Sap from plants having high alkaloid levels (bitter) turned the paper pink.
Ku. This gene controls the need for vernalisation. Plants with the Ku
genotype do not require vernalisation, resulting in early flowering (Gladstones and
Hill 1969). Rows of RILs were grown in the screen-house over two winters and
flowering dates recorded. They were designated as either late or early based on the
timing of opening their first flowers relative to parental types.
Anthracnose disease resistance (Lanr1). Seedlings were vernalised for three
weeks at 4°C before being planted in 25cm diameter pots filled with a mixture of
river sand and potting mix. Five single plants of different RILs were selected at
random and planted per pot. All treatments were replicated 4 times. Plants were
Chapter 2: Construction of a genetic linkage map
37
inoculated with conidial spore suspension of the strain “VCG-2” of Colletotrichum
lupini (Yang and Sweetingham 1998) (previously classified as Colletotrichum
gloeosporioides) ( Nirenberg et al. 2002). Details of disease inoculation and scoring
were the same as in the other studies (Yang et al. 2004).
Moustache (mou) patterning on seed coat. The moustache pattern, also
known as eyebrow or arrowhead (C. Smith, pers. comm.) is of no known agronomic
value but has been used by Australian plant breeders in lupin seed descriptions.
Mature seed of all RILs were examined and scored for the presence or absence of a
moustache pattern.
2.2.3 DNA extraction
Total genomic DNA was extracted from 0.5g of fresh leaf material for each
RIL using the CTAB extraction method as described by Rogers and Bendich (1994).
Extracted DNA was re-suspended in TE 0.1 buffer (10 mM TrisHCl, 0.1 mM EDTA).
2.2.4 MFLP protocol
DNA from each RIL line and the two parents was digested by the restriction
enzyme Tru9I (Roche Diagnostics, Australia), an isoschizomer of MseI. The MseI-
adaptor (Vos et al. 1995) was ligated onto the restriction fragments using T4 DNA-
ligase (Roche Diagnostics Australia). To reduce and optimise the number of DNA
bands on the sequencing gel, the template DNA was further digested with a frequent
cutter HpaII (recognition site 5’-C/CGG-3’, GeneWorks Pty Ltd, Australia).
Detailed methodology for MFLPs have been described elsewhere (Yang et al. 2001).
Pre-selective MFLP reactions were set up using 10 SSR-anchor primers
(Table 2.1), each in combination with an MseI-primer with one selective nucleotide
C at the 3’ end (5’-GAT GAGTCCTGAGTAAC-3’) (Vos et al. 1995). A total of
153 selective-MFLP reactions were run using the 10 SSR-anchor primers in
combination with 16 MseI primers having two additional selective nucleotides
(MseI-Cxx, (Vos et al. 1995)). The SSR-anchor primers of the selective-MFLP
reactions were labelled with -[33
P] (Yang et al. 2001, 2002). The PCR
amplification products of the MFLP were resolved on 5% denaturing sequencing gels
and, DNA polymorphisms were detected by autoradiography (Yang et al. 2001,
2002, 2004).
Chapter 2: Construction of a genetic linkage map
38
Table 2.1. DNA sequences of SSR-anchor primers used in MFLP
Primer Name Sequences (5’ - 3’)
MF128 DVDTCTCTCTCTCTCTCa
MF129 HVHTGTGTGTGTGTGTGb
MF51 GGGAACAACAACAAC
MF42 GTCTAACAACAACAACAAC
MF43 CCTCAAGAAGAAGAAGAAG
MF62 CCCAAACAACAACAAC
MF52 GGGAAGAAGAAGAAG
MF11 GGACCTCTCTCTCTCT
MF151 CACGTCTCTCTCTCTCT
MF152 GATGCTCTCTCTCTCTC
a D=A+G+T, V=A+G+C;
b H=A+C+T
2.2.5 Data analysis and map construction
The majority of SSR markers were scored as dominant and the remainder as
co-dominant markers. Ambiguous genotypes were treated as missing data. Marker
scoring was checked at least twice. Added to the data were phenotype scores given
each RIL for the traits and anthracnose resistance gene described above under 'plant
material'. Linkage group construction was accomplished with aid of the computer
program MapManager, version QTXb20 (Manly et al. 2001). Linkage groups were
determined to consist of markers linked with a minimum LOD score of 2.5. The
order of the markers in each linkage group was initially determined by
MapManager's 'find linkage groups' tool (Linkage evaluation: Self RI; Search Link
criterion P = 0.001; Map Function: Kosambi) followed by a critical visual evaluation
of all data. The map was drawn using the computer program MapChart (Voorrips
2002).
2.2.6 Genome length estimates
The recombination length of the L. angustifolius genome was estimated using
two methods, Hulbert et al. (1988)’s method-of-moment estimator and Chakravarti et
al. (1991)’s modification of this method which corrects for upward bias related to
Chapter 2: Construction of a genetic linkage map
39
chromosome ends. The confidence intervals (p = 0.05) for the latter method were
calculated as per Gerber and Rodolphe (1994).
2.3 RESULTS
2.3.1 Phenotyping
Phenotyping of parental lines confirmed that the domesticated parent
(83A:476) bore all the domestication genes (moll, leuc, iuc, le, and Ku), whereas the
wild parent (P27255) carried the wild type genes (Moll, Leuc, Iuc, Le and ku). Parent
83A:476 is resistant to anthracnose, whereas P27255 is susceptible. Testing of all
RILs for the domestication traits and for anthracnose resistance found most of the
phenotypes segregated in a 1:1 ratio (Table 2.2). These results support earlier
findings that those traits are controlled by single major genes (Hallqvist 1921,
Gladstones 1967, Gladstones and Hill 1969, Mikolajczyk 1963). Exceptions were
the phenotypes for low alkaloids (iuc) and anthracnose resistance (lanr1), both of
which have previously also been shown to be controlled by single genes (Yang et al.
2004, von Sengbusch 1930).
2.3.2 Marker polymorphism and segregation
MFLP polymorphisms were screened from 153 primer combinations (Table
2.3). A total number of 1083 polymorphic markers were scored. Marker fragment
lengths ranged from ~50 bp to 800bp, with the majority in the range of 100 - 450 bp.
The number of polymorphic markers detected for individual primer pairs ranged
from nil to 16 with the average number being 6.7 per primer combination. There
were 522 unique marker loci. It was calculated that 21% of markers were co-
dominant and 79% dominant. Upon closer inspection it was found that
approximately 65% of the map length was covered by the first 526 markers
generated (SSR anchor primers MF128, 129, 51, 42). The coverage was increased to
over 75% by inclusion up to marker DAWA639.150 (MF43).
Chi-squared analysis revealed that 91.2% of the mapped loci segregated in
the expected 1: 1 ratio, whereas 46 (8.8%) showed distortion at P < 0.05. The
majority of these markers were clustered in Linkage Groups (LG) 2 (8), LG 6 (5),
LG 9 (14), and LG 10 (7). Distortion in LG2 was in the region of the gene for
Chapter 2: Construction of a genetic linkage map
40
anthracnose resistance (Lanr1) and in LG 9 the distortion was in the region of the
iucundis gene (iuc). Of the other 13 distorted markers, in at least 3 cases the
distortion may be due to missing data (markers (DAWA)1046.125c; 948.215;
103.05). Overall, the ratio of maternal to paternal phenotypes within the distorted
sectors was 1:3.
2.3.3 Map construction
A framework linkage map was constructed for Lupinus angustifolius (Figure
2.1). Markers and trait phenotypes were placed into 21 linkage groups (LGs)
consisting of 8 or more markers. Linkage groups have been numbered in order of
decreasing marker numbers and length. The map distance covered by the 21 LGs
was 1543cM. Linkage distance spanned by the individual LGs ranged from 19.9cM
(LG 21) to 135cM (LG 1). Linkage groups had a mean length of 73.5 and a standard
deviation of 34.5cM. The average distance between adjacent markers was 3.3cM.
The longest distance between neighbouring markers (28cM) is located on LG 1.
Some clustering of markers was noted in most LGs.
Chapter 2: Construction of a genetic linkage map
41
Table 2.2. Chi-square test on the segregation ratios of domestication traits and
anthracnose disease resistance among the 89 RILs derived from cross 83A:476 x
P27255 of Lupinus angustifolius
Traits Observed segregation
(M: P) a
Expected
segregation
2 P
Seed coat permeability 36 : 51
(moll : Moll)b, c
43.5 : 43.5 2.586 0.108
Flower colour 43 : 42
(leuc : Leuc)d, c
42.5 : 42.5 0.012 0.914
Plant alkaloid 32 : 57
(Iuc : iuc)e
44.5 : 44.5 7.022 0.008 **
Early flowering 44 : 38
(Ku : ku)f, c
41 : 41 0.439 0.508
Reduced pod shatter 1 45 : 44
(le : Le) g
44.5 : 44.5 0.011 0.916
Seed Moustache 41 : 46
(Mou : mou)h,i,c
43.5 : 43.5 0.287 0.592
Anthracnose disease 31 : 49
(R : S)j,c
40 : 40 4.050 0.044 *
aM = maternal, P = paternal numbers;
bMoll = hard-seeded coat, moll = soft-seeded seed coat;
cTotal
plant numbers do not equal 89 as a result of either inconclusive phenotyping or early plant
mortality;.dLeuc = blue flower colour, leuc = white flower colour;
eIuc = bitter, iuc = sweet;
fKu =
early flowering, ku = late flowering; gLe = shattering, le = reduced shattering;
hMou = broad
moustache , mou = narrow moustache; iMou - parental dominance not determined;
jR = resistant to
anthracnose, S = susceptible to anthracnose.
Chapter 2: Construction of a genetic linkage map
42
Table 2.3. Primer combinations in MFLP giving rise to DNA polymorphic markers
for genetic linkage mapping in Lupinus angustifolius1
SSR-
anchor
primers
MseI-primers
-CAA -CAG -CAC -CAT -CGA -CGG -CGC -CGT -CCA -CCG -CCC -CCT -CTA -CTG -CTC -CTT
MF128 142 25 32 39 55 64 75 87 96 106 115 127 133 144 155 164
MF129 178 188 191 198 204 211 nil 216 221 227 234 240 246 254 262 269
MF51 281 289 299 312 320 324 325 347 351 355 359 367 376 385 396 410
MF42 413 421 425 436 443 444 451 461 464 474 478 493 503 507 512 520
MF43 527 532 546 558 564 566 571 575 579 593 599 601 603 613 620 632
MF62 641 644 649 657 661 670 678 686 692 701 709 723 733 738 742 747
MF52 748 758 770 776 787 789 792 796 798 808 815 823 829 837 844 853
MF11 869 873 885 895 902 912 920 928 935 945 951 961 973 976 988 995
MF151 1002 nil 1008 1012 1018 1021 1025 1027 1032 1038 1040 1047 1056 1058 1061 1068
MF152 1072 1085 1089 1091 nil nil 1094 nil 1095
1 The prefix DAWA applies to all markers listed in the table;
2Numbers within each cell denote the
first scored polymorphic marker for that particular primer combination; for example, primer
combination of MF128 with MseI-CAA gave rise to 11 markers from “DAWA14” to “DAWA24”. 3Nil means that no markers could be scored.
4Redundant markers included here are not shown on the
linkage map.
2.3.4 Mapping of domestication and the anthracnose resistance genes
Except for the reduced pod-shatter gene ta for which the phenotype data was
not yet complete, all domestication genes were integrated into the molecular genetic
map (Figure 2.1, Table 2.4). The low alkaloid gene iuc was found in LG 9. Seven
molecular markers flank the iuc gene on either side at distances of less than 5 cM,
among which the closest two markers flanking the gene are DAWA632.550 (1.1 cM
to iuc) and DAWA604.335 (1.2 cM to iuc). The gene for early flowering (Ku) in
LG 17 co-segregated with marker DAWA428.290 and is flanked by a further 5
markers within 5cM. The gene for soft-seeds (moll) was located in LG 8. This gene
was found to co-segregate with marker DAWA561.180. Two more markers,
DAWA783.180 and DAWA664.290 are positioned at 3.8 and 5.6cM from moll
respectively. The le gene, one of two reduced shattering genes, was located in LG13
flanked by markers DAWA964.275 (0.6cM) and DAWA323.150 (1.2cM). The
gene leuc was located on LG 11. It is flanked on one side by marker DAWA1045.15
at a distance of 0.7cM, and on the other by marker DAWA520.350 at a distance of
1.1cM. The anthracnose resistance gene Lanr1 and marker AntjM2 (You et al.
2005) were both located in LG2 separated by a distance of 2.6cM. The next nearest
Chapter 2: Construction of a genetic linkage map
43
marker to Lanr1 is DAWA224.170 at a distance of 4.1cM and on the far side of
Lanr1 to AntjM2. The anthracnose resistance marker AntjM1 (Yang et al. 2004)
was also tried but found to be monomorphic in this population.
Table 2.4. Characteristics of 21 LGs of L. angustifolius constructed with 454 MFLP
markers based on 89 RILs.
L G
No.
LG length
(cM)
No. of
markers
Density
(markers /
cM)
No. of
gaps a Morphological Traits ;
Marker numbers b,c Distortion regions
Marker interval b, (totals)
1 137.3 45 3.0 1 758.470 (1) P d
2 124.7 33 3.8 0 Lanr1; AntjM2b1,
224.170, 1019.350c
563.130 - 824.400 (5) P;
207.325 - 1019.350c (4) P
3 123.9 39 3.2 1 972.100c - 1046.125c (3) P
4 106.2 30 3.5 0
5 95.5 26 3.7 0
6 92.4 22 4.2 0
7 89.1 15 5.9 1
8 88.0 19 4.6 1 moll; 561.180, 783.180
9 85.5 29 2.9 0 iuc; 632.550, 604.335 305.278 - 679.430 (14) P
10 74.6 27 2.8 0 mou; 479.425, 198.450c 93.090 - 41.400 (7) P
11 73.4 24 3.1 0 leuc; 520.350, 1045.150
12 72.7 22 3.0 0
13 71.5 17 4.2 0 le; 323.15, 964.275
14 87.4 20 4.4 0
15 65.8 17 3.9 0 350.050 - 742.850 (4) M
16 36.9 17 2.2 0
17 33.0 14 2.4 0 Ku; 428.290, 306.255c 229.250, 193.240 (2) P
18 31.7 9 3.5 0
19 27.1 11 2.5 0 341.230 (1) M
20 26.4 11 2.4 0 948.215c (1) M
21 19.9 7 2.8 0
Total/
mean
1543
454
3.4
4
(42)
a A distance of more than 20cM between two adjacent markers is termed a 'gap'
b The pre-fix DAWA has been omitted from marker names for ease of reading.
b1 The prefix DAWA does not apply here.
c Only the two most closely associated markers are indicated for any given trait.
d The letter P represents distortion in favour of the paternal parent. M denotes distortion in favour of
the maternal parent.
2.3.5 Estimation of genome size of L. angustifolius
According to the method of Hulbert et al. (1988), the genome size of L.
angustifolius is expected to be in the range 1596cM (LOD 7.0) to 1896cM (LOD 3.0)
with an average value of 1746cM. Alternatively, by using the methods of
Chakravarti et al. (1991) and Gerber and Rodolphe (1994), the expected genome
length was calculated as being between 1407cM (LOD 7) and 1673cM (LOD 3) with
an average length of 1540cM.
Chapter 2: Construction of a genetic linkage map
44
Fig
ure
2.1
. G
enet
ic l
ink
age
map
of
Lup
inu
s an
gu
stif
oli
us
con
stru
cted
fro
m 8
9 F
8 d
eriv
ed r
eco
mb
inan
t in
bre
d l
ines
. E
ach
mar
ker
s h
as a
fir
st n
um
ber
den
oti
ng
th
e
nu
mer
ical
ord
er o
f m
ark
ers
(Tab
le 2
.3)
from
MF
LP
gel
s, a
nd
an
oth
er n
um
ber
aft
er t
he
dec
imal
den
oti
ng t
he
size
of
the
frag
men
ts i
n b
p.
Th
e su
ffix
'c' o
n t
he
end
den
ote
s th
at t
he
mar
ker
is
co-d
om
inan
t.
DA
WA
ref
ers
to D
epar
tmen
t of
Ag
ricu
lture
Wes
tern
Au
stra
lia.
G
enet
ic d
ista
nce
s o
n t
he
left
sid
e of
the
bar
are
in
cM
(Ko
sam
bi
fun
ctio
n).
G
enes
of
inte
rest
are
lo
cate
d i
n t
he
foll
ow
ing
Lin
kag
e gro
up
s: L
G2
– A
nth
racn
ose
res
ista
nce
gen
e L
an
r1;
LG
8 –
Mo
llis
; L
G9
– I
ucu
nd
is;
LG
10
– m
ou
stac
he;
LG
11 –
Leu
cosp
erm
us;
LG
13
– L
entu
s; L
G1
7 –
Ku
. D
isto
rted
lo
ci a
re m
ark
ed w
ith
* (
P<
0.0
5)
or
** (
P<
0.0
1).
Chapter 2: Construction of a genetic linkage map
45
Chapter 2: Construction of a genetic linkage map
46
2.4 DISCUSSION
This thesis has reported the first comprehensive linkage map for Lupinus
angustifolius, with an average distance of 3.2cM between adjacent markers. We
found 522 unique marker loci of which 89% could be connected into 21 linkage
groups covering 1543cM. We have identified a weak linkage between LGs 17 and
20 as well as between some of the other linkage groups and residual fragments (data
not presented). However, it was considered that these linkages were not sufficiently
strong for mapping purposes.
Some clustering of markers was observed in most linkage groups. Clustering
of markers is not an uncommon occurrence (Keim et al. 1990, Tanksley et al. 1992,
Vallejos et al. 1992, Reiter et al. 1992) and has been suggested to occur frequently
although not exclusively in centromeric regions, possibly as a result of reduced
recombination in such regions (Tanksley et al. 1992). Clustering in our linkage
groups has mostly been consistent with this theory in that several tend to be
approximately central. Exceptions including LGs 9, 10, 11 and 12 are probably the
result of incomplete linkage groups as suggested by the residual fragments.
Distorted sib segregation of markers in RIL populations have been reported
by others as being potentially indicative of non-random sib selection or the presence
of genes linked to either the maternal or paternal parent (Yin et al. 2003), or other
distorting factors (Zamir and Tadmore 1986). However the level of distortion, about
8.8% at P < 0.05 is low (2.9% at P < 0.01) and within the range reported as normal
by other workers (e.g. Yin et al. 2003).
When compared to the expected genomic map length as calculated using the
formulae of Chakravarti et al. (1991) and Gerber and Rodolphe (1994) and the limits
set by Hulbert et al. (1988)'s formula, it could be suggested that much of the genome
has been mapped. The close proximity of markers mapped and linked to each of the
domestication genes at a distance of 2cM or less is indicative of a good coverage of
the genome within the mapped regions. This is supported by our data for the
observed distance between Lanr1 and marker AntjM2 of 2.6cM c.f. the 2.3cM
measured by You et al. (2005) for 184 RILS of a cross between the cultivars Tanjil
(resistant) and Unicrop (susceptible). However, the presence of as yet un-linked
Chapter 2: Construction of a genetic linkage map
47
fragments and several larger gaps in the LGs, suggests that the map is not yet quite
complete.
Using MFLPs to construct a linkage map has the advantage of microsatellites
as many MFLP polymorphisms can easily be converted into simple PCR based
markers desirable for routine marker implementation in MAS (Yang et al. 2001,
2002, 2004). Some benefits of mapping the genome of Lupinus angustifolius are
already being realised. We are currently in the process of developing sequence-
specific PCR primers for several of the markers associated with the domestication
genes we have mapped. With the development of PCR primers for these markers it
will be possible to make a much greater use of wild plant accessions without the need
for lengthy phenotypic screening procedures to ensure retention of these important
domestication traits. The marker AntjM2 for the anthracnose resistance gene Lanr1
is already being used (You et al. 2005). With further development of this map and
the identification of QTLs for yield and other quality traits it is anticipated that the
breeding of lupins using MAS will be greatly enhanced, resulting in the release of
superior cultivars over a reduced time scale.
Acknowledgements
The help of Dr M. You (Department of Agriculture and Food; Western Australia.) in
carrying out DNA extractions and anthracnose disease screening is gratefully
acknowledged. Mr C. Smith (DAFWA) is thanked for his advice and contribution in
sourcing and sorting references and for scanning the linkage map.
Chapter 2: Construction of a genetic linkage map
48
2.5 REFERENCES
Brien SJ, Cowling WA, Potter RH, O'Brien PA, Jones RAC, Jones MGK (1999)
A molecular marker for early maturity (Ku) and marker-assisted breeding of
Lupinus angustifolius. In: Proc. 11th
Aust Plant Br Conf (Adelaide), pp204 -
205
Chakravarti A, Lasher LK, Reefer JE (1991) A maximum-likelihood method for
estimating genome length using genetic linkage data. Genetics 128:175-182
Eujayl I, Sorrels M, Baum M, Wolters P (2002) Isolation of EST-derived
microsatellite markers for genotyping the A and B genomes of wheat. Theor
Appl Genet 104:399-407
Forbes I, Wells HD (1968) Hard and soft seededness in blue lupine, Lupinus
angustifolius L.: Inheritance and phenotype classification. Crop Sci 8:195-
197
Gerber S, Rodolphe F (1994) An estimation of the genome length of maritime pine
(Pinus pinaster Ait.). Theor Appl Genet 88:289-292
Gladstones JS (1967) Selection for economic characters in Lupinus angustifolius
and L. digitatus. 1. Non-shattering pods. Aust J Exp Agric Anim Husb
7:360-366
Gladstones JS (1970) Lupins as crop plants. Fld Crop Abstr 23:123-148
Gladstones JS (1998) Distribution, origin, taxonomy, history and importance. In:
Gladstones JS, Atkins C, Hamblin J (eds) Lupins as Crop Plants: Biology,
Production and Utilization. CAB International, Oxon, U.K., pp1-39
Gladstones JS, Hill GD (1969) Selection for economic characters in Lupinus
angustifolius and L. digitatus. 2. Time of flowering. Aust J Exp Agric Anim
Husb 9:213-220
Hackbarth J, Sengbusch R von (1934) The inheritance of alkaloid freedom in
Lupinus luteus and Lupinus angustifolius. Züchter 6:249-255
Hallqvist C (1921) The inheritance of the flower colour and the seed colour in
Lupinus angustifolius. Hereditas 2: 299-363
Harborne JB (1984) Phytochemical Methods: A guide to modern techniques in
plant analysis. Chapman and Hall, London
Chapter 2: Construction of a genetic linkage map
49
Hulbert SH, Ilott TE, Legg EJ, Lincoln SE, Lander ES, Michelmore RW (1988)
Genetic analysis of the fungus, Bremia lactucae, using restriction fragment
length polymorphisms. Genetics 120:947-958
Keim P, Diers BW, Olson TC, Shoemaker RC (1990) RFLP mapping in soybean:
association between marker loci and variation in quantitative traits. Genetics
126:735-742
Kruszka K, Wolko B (1999) Linkage maps of morphological and molecular
markers in lupin. In: Proc 9th
Int Lupin Conf, Klink / Muritz, Germany.
International Lupin Association. pp. 100-105
Li YC, Korol AB, Fahima T, Beiles A, Nevo E (2002) Microsatellites: genomic
distribution, putative functions and mutational mechanisms: A review. Mol
Ecol 11:2453–2465
Manly KF, Cudmore Jr RH, Meer JM (2001) MapManager QTX, cross-platform
software for genetic mapping. Mammalian Genome 12:930-932
Mikolajczyk J (1966) Genetic studies in Lupinus angustifolius. 2. Inheritance of
some morphological characters in blue lupine. Genet Pol 7:153-180
Nirenberg HI, Feiler U, Hagedoorn G (2002) Description of Colletotrichum lupini
comb. Nov. in modern terms. Mycologia 94:307-320
Pate JS, Williams W, Farrington P (1985) Lupin (Lupinus spp.) In: Summerfield,
R.J. and Roberts, E.H. (eds) Grain Legume Crops. Collins, London, pp37-72
Pearl HM, Nagai C, Moore PH, Steiger DL, Osgood RV, Ming R (2004)
Construction of a genetic map for arabica coffee. Theor Appl Genet 108:829-
835
Reiter RS, Williams JGK, Feldmann KA, Rafalski JA, Tingey SV, Scolnik PA
(1992) Global and local genome mapping in Arabidopsis thaliana by using
recombinant inbred lines and random amplified polymorphic DNAs. Proc
Natl Acad Sci USA 89:1477-1481
Rogers SO, Bendich AJ (1994) Extraction of Total Cellular DNA from Plants,
Algae and Fungi. In: Gelvin SB and Schilperoort RA (eds) Plant Molecular
Biology Manual, 2nd Edition. Kluwer Academic Press, Dordrecht, The
Netherlands, D1. pp1-8
Sengbusch von R (1930) Lupins low in bitter substances. Züchter 2:1-2
Chapter 2: Construction of a genetic linkage map
50
Stermitz FR, Belofsky GN, Ng D, Singer MC (1989) Quinolizidine alkaloids
obtained by Pedicularis semibarbata (Scrophulariaceae) from Lupinus
fulcratus (Leguminosae) fail to influence the specialist herbivore Euphydryas
editha (Lepidoptera). J Chem Ecol 15:2521-2530
Swiecicki W, Swiecicki WK (1995) Domestication and breeding of narrow-leafed
lupin (Lupinus angustifolius L.). J Appl Genet 36:155-167
Tanksley SD, Ganal MW, Prince JP, de Vicente MC, Bonierbale MW, Broun P,
Fulton TM, Giovanni JJ, Grandillo S, Martin GB, Messeguer R, Miller
JC, Miller L, Paterson AH, Pineda O, Röder MS, Wing RA, Wu W,
Young ND (1992) High density molecular maps of the tomato and potato
genomes. Genetics 132:1141-1160
Vallejos CE, Sakiyama NS, Chase CD (1992) A molecular marker-based linkage
map of Phaseolus vulgaris L. Genetics 131:733-740
Voorrips RE (2002) MapChart: Software for the graphical presentation of linkage
maps and QTLs. J Hered 93:177-178
Vos P, Hogers R, Bleeker M, Reijans M, Lee T, Hornes M, Frijters A, Pot J,
Peleman J, Kuiper M, Zabeau M (1995) AFLP: A new technique for DNA
fingerprinting. Nucleic Acids Res 23:4407-4414
Wolko B, Weeden NF (1994) Linkage map of isozyme and RAPD markers for the
Lupinus angustifolius L., In: Neves-Martins, J.M. and Beirão da Costa, M.L.
(eds) Advances in Lupin Research. Proc 7th
Int Lupin Conf, Evora, Portugal.
ISA Press, Portugal. pp. 42-49
Yang H, Boersma JG, You M, Buirchell BJ, Sweetingham MW (2004)
Development and implementation of a sequence-specific PCR marker linked
to a gene conferring resistance to anthracnose disease in narrow-leafed lupin
(Lupinus angustifolius L.). Mol Breed 14:145 - 151
Yang H, Shankar M, Buirchell BJ, Sweetingham MW, Caminero C, Smith
PMC (2002) Development of molecular markers using MFLP linked to a
gene conferring resistance to Diaporthe toxica in narrow-leafed lupin
(Lupinus angustifolius L.). Theor Appl Genet 105:265-270
Yang H, Sweetingham MW (1998) The taxonomy of Colletotrichum isolates
associated with lupin anthracnose. Aust J Agric Res 49:1213-1223
Chapter 2: Construction of a genetic linkage map
51
Yang H, Sweetingham MW, Cowling WA, Smith PMC (2001) DNA
fingerprinting based on microsatellite-anchored fragment length
polymorphisms, and isolation of sequence-specific PCR markers in lupin
(Lupinus angustifolius L.). Mol Breed 7:203-209
Yin TM, Wang XR, Andersson B, Lerceteau-Köhler E. (2003) Nearly complete
genetic maps of Pinus sylvestris L. (Scots pine) constructed by AFLP marker
analysis in a full-sib family. Theor Appl Genet 106:1075-1083
You M, Boersma JG, Buirchell BJ, Sweetingham MW, Siddique KHM, Yang H
(2005) A PCR-based molecular marker applicable for marker-assisted
selection for anthracnose disease resistance in lupin breeding. Cell Mol Biol
Lett 10:123-134
Vigouroux Y, Jaqueth JS, Matsuoka Y, Smith JSC, Doebley J (2002) Rate and
pattern of mutation at microsatellite loci in maize. Mol Biol Evol 19:1251-
1260
Zamir D, Tadmore Y (1986) Unequal segregation of nuclear genes in plants. Bot
Gaz 147:355-358
Chapter Three: Marker for Ku gene
53
Chapter Three
Development of a sequence-specific PCR marker linked to
the Ku gene which removes the vernalisation requirements
in narrow-leafed lupin.
Chapter Three: Marker for Ku gene
54
3.1 INTRODUCTION
One of the climatic requirements of many wild narrow-leafed lupin (Lupinus
angustifolius L.) including those originating in the Mediterranean region is a period
of vernalisation to promote flowering (Gladstones 1970). Previous genetic studies
(Gladstones and Hill 1969) have shown that a single dominant gene Ku, originally
selected from a natural mutant of the Swedish cultivar Borre, had a major effect on
the initiation of flowering by removal of the need for vernalisation and advanced
flowering by 2 – 5 weeks (Gladstones and Hill 1969). This gene greatly increases
the flexibility of lupins as a crop in that it not only enables them to be grown in
warmer areas with insufficient cold to satisfy the vernalisation requirements, but also
allows them to be sown in areas with a short growing season as experienced in large
areas of the Western Australian wheat-belt (Gladstones and Hill 1969). Most
modern cultivars of L. angustifolius bred in Western Australia and Europe since 1971
carry this gene (Cowling 1999).
As a crop, L. angustifolius has a short history of only 80 years. Because the
gene pool in domesticated cultivars is very narrow, the inclusion of wild germplasm
into the lupin breeding program will give greater diversity and scope for increased
genetic gains by the inclusion of further desirable traits. However when a wild type
is crossed with a domesticated line it involves the risk of losing desirable
domestication genes if they are not actively selected for. Field based selection for
the Ku gene is time-consuming because a large number of progeny has to be
maintained until flowering prior to selection. Furthermore, it is impossible to
directly select plants with the homozygous early flowering genotype (KuKu) from
heterozygous early flowering individuals (Kuku) since both genotypes will exhibit
the early flowering phenotype in the field. The development of a molecular marker
linked to the Ku gene would greatly facilitate the selection of this important
domestication gene in lupin breeding programs by enabling selection at the F2 stage
and concomitant 75% reduction in plant populations in the same generation.
For marker-assisted selection (MAS) to be viable in a practical plant breeding
program, a molecular marker must possess the following characteristics (Eagles et al.
2001, Yang et al. 2004):
(1) The marker is closely linked to a gene of interest;
Chapter Three: Marker for Ku gene
55
(2) The operation of the marker must be more cost-effective than conventional
glasshouse or field based selection;
(3) The marker must be amenable to large numbers of samples.
The MFLP (microsatellite-anchored fragment length polymorphism) method
is capable of producing DNA polymorphisms with high efficiency (Yang et al.
2001). Recently, MFLP markers were used to construct a molecular map of L.
angustifolius (Chapter 2). Several domestication genes were also mapped. However
MFLP markers cannot be used directly for MAS because they are too time-
consuming and expensive to implement. The aim of this research is to develop a
sequence-specific, simple PCR based marker linked to the Ku gene desirable for
MAS in lupin breeding.
3.2 MATERIALS AND METHODS
3.2.1 Plant materials and phenotyping of Ku gene
An F8 recombinant inbred line (RIL) of a domestic x wild type (DxW)
population of Lupinus angustifolius was previously developed by the Department of
Agriculture and Food, Western Australia (DAFWA) using as parents lines P27255
(wild) and 83A:476 (domesticated). The resulting population from this cross has
been used to produce linkage maps for L. angustifolius (Chapter 2, Figure 2.1;
Nelson et al. 2006).
The parents and 106 RILs of this population were sown in the screen-house at
the beginning of winter as randomized plots each consisting of 3 plants. There were 3
replicates. Anthesis was determined as the first floret on the main stem of any one
plant having opened in a particular plot (Gladstones and Hill 1969, Rahman and
Gladstones 1972). The mean date for the 3 replicate plots was then used to place the
RILs and the parent lines into groups designated as either „kuku‟ (late flowering) or
„KuKu‟ (early flowering).
3.2.2 Marker development
The two parents and 89 RILs were subjected to MFLP tests involving 10
SSR-anchor primers each in combination with 16 MseI-primers (Table 2.1). MFLP
markers having the best correlation to the Ku phenotyping data were selected. DNA
Chapter Three: Marker for Ku gene
56
fragments of candidate MFLP markers were isolated from MFLP gels, re-amplified
by PCR, ligated into plasmids “pGEM-T Easy Vector” (Promega) and cloned into E.
coli according to the manufacturer‟s instructions. Plasmid DNA with MFLP
fragment inserts were isolated from E. coli, and sequenced using the BigDye
Terminator system (Applied Biosystems) as described by Yang et al. (2002, 2004).
A pair of sequence-specific primers was designed flanking the insertion/deletion site
(Yang et al. 2002, 2004; You et al. 2005). Primers were designed so that the
annealing temperature was approximately 54C based on calculations using the
nearest-neighbour model (http://www.sigmaaldrich.com).
3.2.3 DNA amplification and sequencing gel electrophoresis
Marker DNA fragments were amplified in a10 l PCR consisting of 1.5 l of
the template DNA and with one of the sequence-specific primers labelled with -33
P
as previously described by Yang et al. (2001, 2002). The selective PCR products
were separated on a 5% polyacrylamide denaturing sequencing gel (7 M urea) using
a 38x50 cm (0.4 mm in thickness) Sequi-Gen GT sequencing cell (Bio-Rad). After
electrophoresis at 55W for about 3 h, the gel was dried under vacuum on a gel drier
(Model 583, Bio-Rad). Marker bands were detected by autoradiography (Yang et al.
2002, You et al. 2005) with overnight exposure of the X-ray film on the dried gel.
The converted sequence–specific marker was tested on 106 F8 RILs of the
population derived from the DxW cross. The marker score data and the Ku
phenotyping data on the 106 F8 RILs were merged and analysed by the program
MapManager (Manly et al. 2001) to determine the genetic linkage between the
marker and the Ku gene.
3.3 RESULTS
3.3.1 Phenotyping of Ku gene
In 2005 the domesticated parent (83A:476) being early flowering (Ku),
reached anthesis 72 d after sowing. The wild parent (P27255; ku) reached anthesis
97 d after sowing. Field-testing of 106 RILs of the marker population showed that
anthesis dates could be clustered into a number of smaller groups contiguous with the
parental values (Table 3.1). There was a 5 day interval between these two groups
during which no RILs initiated flowering. Anthesis dates ranged from 69 to 84 d
Chapter Three: Marker for Ku gene
57
after sowing (KuKu) and 90 to 110 d after sowing (kuku) with the majority of RILs
flowering within 1 week of either parent. Combining these groups resulted in 53
RILs being designated as „Early Flowering‟ (Ku) and another 53 RILs being
designated as „Late Flowering‟ (ku) based on the method described by Rahman and
Gladstones (1972). The segregation of plants with the KuKu allele to plants with the
kuku allele fits perfectly with the expected 1:1 ratio for the F8 progeny.
Table 3.1. Phenotyping of the early flowering gene Ku on an F8 derived RIL
population from a cross 83A:476 (KuKu) x P27255 (kuku) in Lupinus angustifolius
L.
Flowering
Date (DAS
1)
65 –
69
70 -
742
75 -
79
80 -
84
85 -
89
90 -
94
95 -
993
100 -
104
105 -
110
Numbers of
RILS 1 7 33 12 0 14 24 12 3
Total
53 KuKu
53 kuku
1DAS = days after sowing;
2The domesticated parent 83A:476 flowered on day 72;
3The wild parent
P27255 flowered on day 97. There is a discontinuity between days 84 and 90 showing the boundary
between the two major groups based on the Ku gene.
3.3.2 DNA sequencing of the candidate MFLP marker
A dominant MFLP marker designated “DAWA428.290”, originally produced
during a mapping study (Chapter 2), co-segregated with the Ku phenotyping scores
of the RILs tested. This marker was selected as a candidate for development of a
sequence-specific marker tagging the Ku gene. Marker DAWA428.290 was
generated by SSR-anchor primer MF42 (5‟-GTCTAACAACAACAACAAC-3‟) in
combination with primer MseI-CAC (5‟- GATGAGTCCTGAGTAACAC-3‟).
DNA sequencing showed that the dominant marker DAWA428.290 was a
318 bp fragment with sequences of SSR-anchor MF42 and MseI-CAC at either end
as expected (Table 3.2). A sequence-specific primer “KuHMS1” (3‟-
AGACATACCT TGTATGCGG-5‟) was designed to replace primer MseI-CAC.
PCR amplification of this marker by primer KuHMS1 in combination with the SSR-
anchor primer MF42 and using as template the DNA from the two parents and 10
randomly selected RILs revealed a pair of co-dominant bands. Apart from the band
Chapter Three: Marker for Ku gene
58
produced by the 298 bp fragment of plants with the KuKu allele, plants with the kuku
allele produced a longer DNA band fragment that migrated more slowly (Figure 3.1).
DNA fragments from the ku allele were sequenced and aligned with the sequence
from the Ku allele (Table 3.2). It was revealed that the ku allele fragments contained
a 7 bp insertion, as well as a SNP of an Adenosine (A) substituting the Guanine (G)
in the Ku allele (Table 3.2).
Table 3.2. DNA sequence of the MFLP marker DAWA428.290 showing primers
giving rise to sequence-specific markers KuHM1 and KuHSNP.
The 7 bp insertion/deletion mutation site, and the SNP mutation site (G/A) are shown in bold italic.
Ku allele
ku allele
1 GATGAGTCCT GAGTAACAC1G AGACATACCT TGTATGCGGT CCTCATTGCC
AGACATACCT TGTATGCGG2T CCTCATTGCC
Ku allele
ku allele
51 AGAAATCTCA GCTTCGCTCA TAGTG -- -- -- -- AACAC CCTTCCTTTG GGCTTAGGTT
AGAAATCTCA GCTTCGCTCA TAGTG GCTTATT AACAC CCTTCCTTTG GGCTTAGGTT
Ku allele
ku allele
101 TTGTCGCTTG AGCAGTATTC ACTTATTCCT TTTTCAGTTT AGGGCACATC
TTGTCGCTTG AACAGTATTC ACTTATTCC3T TTTTCAGTTT AGGGCACATC
Ku allele
ku allele
151 GGCTTGATGT GTCTAGGATG GTTGCAGTGA TAACATACAG TGCAGTTGAC
GGCTTGATGT GTCTAGGATG GTTGCAGTGA TAACATACAG TGCAGTTGAC
Ku allele
ku allele
201 ACTGAAGTAA TTTCCTTTGC ACTTCGAACA CTAGGGTGGC GTGTTGTTGT
ACTGAAGTAA TTTCCTTTGC ACTTCGAACA CTAGGGTGGC GTGTTGTTGT
Ku allele
ku allele
251 TAGATTTCCC AACCGGTAAA CTCATTTTGT TGTCGTTATT ATTGTTTTTG4
TAGATTTCCC AACCAGTAAA CTCATTTTGT TGTCGTTATT ATTGTTTTTG
Ku allele
ku allele
301 TTGTTGTTGT TGTTAGAC
TTGTTGTTGT TGTTAGAC5
1Primer MseI-CAC (5‟-GATGAGTCCTGAGTAACAC-3‟)
2 Primer KuHMS1 (3‟-AGACATACCTTGTATGCGG-5‟).
3 Primer KuHMS2 (3‟-GAACAGTATTCATTATTCC-5‟)
4 Annealing site of primer KuHSR1 (3‟-CAAAAACAATAATAACGACAAC-5‟)
5 Annealing site of SSR-anchor primer MF42 (5‟-GTCTAACAACAACAACAAC-3‟)
Chapter Three: Marker for Ku gene
59
Figure 3.1. PCR amplification products of 12 RIL plants of Lupinus angustifolius
with sequence-specific primer KuHMS1 (3‟-AGACATACCT TGTATGCGG-5‟,
labelled with -33
P) in combination with SSR-anchor primer MF42 (5‟-
GTCTAACAACAACAACAAC-3‟).
Five plants having KuKu allele (298 bp band) are the domesticated parent 83A:476 (Lane 1), A13
(Lane 5), A14 (Lane 6), A15 (Lane 7), A17 (Lane 9). The 7 other plants including the wild parent
P27253 (Lane 2), A10 (Lane 3), A12 (Lane 4), A16 (Lane 8), A18 (Lane 10), A19 (Lane 11) and A21
(Lane 12) carry the kuku allele (305 bp band).
3.3.3 Marker “KuHM1”
Because the insertion/deletion site is within the SSR-MseI fragment, a second
sequence-specific primer, KuHSR1 (3‟-CAAAAACAATAATAACGACAAC-5‟)
was designed, flanking the mutation site on the side opposite to KuHMS1. The pair
of primers successfully converted the MFLP marker into a co-dominant, sequence-
specific, simple PCR based marker. We designate this marker as “KuHM1”. Marker
KuHM1 shows a 280 bp band for the Ku allele, and a 287 bp band for the ku allele
(Figure 3.2).
Chapter Three: Marker for Ku gene
60
Figure 3.2. Screening molecular marker KuHM1 on the parents and 28 F8 derived
RILs of Lupinus angustifolius using PCR with sequence-specific primer pair
KuHMS1 (3‟-AGACATACCT TGTATGCGG-5‟) and KuHSR1 (3‟-
CAAAAACAATAATAACGACAAC-5‟).
The parent plant 83A:476 (Lane 1) and 15 RILs: A64 (Lane 6), A65 (Lane 7), A69 (Lane 10), A70
(Lane 11), A73 (Lane 13), A74 (Lane 14), A75 (Lane 15), A76 (Lane 16), A77 (Lane 17), A78 (Lane
18), A83 (Lane 23), A84 (Lane 24), A86 (Lane 26), A87 (Lane 27), A93 (Lane 30) carrying the KuKu
allele produced a 280 bp band. The wild type parent P27253 (Lane 2) and 13 RILs: A61 (Lane 3),
A62 (Lane 4), A63 (Lane 5), A66 (Lane 8), A67 (Lane 9), A71 (Lane 12), A79 (Lane 19), A80 (Lane
20), A81 (Lane 21), A82 (Lane 22), A85 (Lane 25), A88 (lane 28), A92 (Lane 29) carrying the kuku
allele produced a 287 bp band.
Marker KuHM1 was tested on the parents and 106 RILs of the DxW
population. The score of marker and plant phenotypes showed perfect correlation on
all the RILs. All 53 RILs with the Ku allele developed the shorter band (280bp), and
the 53 RILs carrying the ku allele developed the longer band (287bp). Linkage
analysis by computer program MapManager suggested that the genetic distance
between the marker and the gene is less then 0.5 cM if we assume one cross-over in
that interval in a population of 107 or more.
3.4 DISCUSSION
Anthesis dates for this marker population were clustered around the parental
values, but showed signs of segregation that could be indicative of two or more genes
being involved. Rahman and Gladstones (1972) found that flowering behaviour of
non-Ku L. angustifolius cultivars was dominated by their high vernalisation
requirement and, that anthesis was also accelerated by increased photoperiod.
Higher growing temperatures, although a factor in several species did not appear to
significantly alter the time to anthesis in L. angustifolius (Rahman and Gladstones
Chapter Three: Marker for Ku gene
61
1972). It is therefore possible that in this population photo-period is also a factor
influencing anthesis. Nevertheless, since vernalisation has such a major effect
(Gladstones and Hill 1969, Rahman and Gladstones 1972) we could separate the
lines into two distinct groups, classifying RILs as either KuKu or kuku with
confidence.
DAWA428.290 was originally a dominant marker in MFLP fingerprinting.
However, after sequencing we were able to directly convert this MFLP candidate
marker into co-dominant marker KuHM1. Because the two alleles both gave
excellent DNA amplification when SSR-anchor primer MF42 is used in combination
with primer KuHMS1 (Figure 3.1), it suggests that there is no difference in DNA
sequences between the two alleles at the annealing site for primer SSR-anchor primer
MF42. It is possible that a mutation exists on the cutting site for restriction enzyme
MseI on the ku allele which prevented ligation of the MseI-adaptor (Yang et al.
2001), causing the MFLP to develop only a dominant band for the Ku allele.
Marker KuHM1 reported in this paper meets the requirements for a sequence-
specific, size based simple PCR marker of low-cost, making it potentially suitable for
routine MAS in lupin breeding (You et al. 2005). The marker bands can also be
amplified by PCR, using the one sequence-specific primer KuHMS1 with the SSR-
anchor primer MF42. However, replacement of the SSR-anchor primer with the
specific primer KuHSR1 increases the specificity and makes the PCR amplification
more robust giving a significant reduction in background signal (Figure 3.2).
The tight linkage of marker KuHM1 (derived from DAWA 428.290) to the
Ku gene is indicated by the perfect correlation between plant phenotype and the
marker score on the available RIL population, giving a distance estimate of less then
0.5 cM from the gene. However there were only 106 RILs available in this instance.
A more precise estimation of the genetic distance between the marker and the gene
would require further testing on a larger population. The usefulness of this marker
for practical lupin breeding needs to be further evaluated further by testing on a wide
range of wild accessions, breeder‟s lines and cultivars.
The co-dominant resolution of sequence-specific marker KuHM1 makes it
amenable to a simple PCR-based assay for the presence of the Ku gene in lupin, able
to distinguish homozygous lines from those heterozygous for the two alleles. This
feature should make it particularly useful for MAS in a high-throughput situation
(Kumar 1999). Furthermore, this marker could be used to probe a BAC library of
Chapter Three: Marker for Ku gene
62
this species to walk the chromosome to the actual gene. Successfully locating and
sequencing the Ku gene will enable development of a „perfect‟ marker that targets
the active gene sequence (e.g. Bradbury et al. 2005).
Acknowledgements
The help of Mr. D. Renshaw and Mr. C. Smith (Department of Agriculture and Food,
Western Australia) in data collection is gratefully acknowledged.
Chapter Three: Marker for Ku gene
63
3.5 REFERENCES
Bradbury LMT, Henry RJ, Jin Q, Renke RJ, Waters DLE (2005) A perfect
marker for fragrance genotyping in rice. Mol Breed 16:279-283
Cowling WA (1999) Pedigrees and characteristics of narrow-leafed lupin cultivars
released in Australia from 1967 – 1998. Agriculture Western Australia
Bulletin 4365
Dergam JA, Paiva SR, Schaeffer CE, Godinho L, Vieira F (2002)
Phylegeography and RAPD-PCR variation in Hoplias malabaricus (Bloch,
1794) (Pisces, Teleostei) in southeastern Brazil. Genet Mol Biol 25:379-387
Eagles HA, Bariana HS, Ogbonnaya FC, Rebetzke GJ, Hollamby GJ, Henry
RJ, Henschke PH, Carter M (2001) Implementation of markers in
Australian wheat breeding. Aust J Agric Res 52:1349-1356
Gladstones JS (1970) Lupins as crop plants. Fld Crop Abstr 23:123-148
Gladstones JS, Hill GD (1969) Selection for economic characters in Lupinus
angustifolius and L. digitatus. 2. Time of flowering. Aust J Exp Agric Anim
Husb 9:213-220
Kanazin V, Talbert H, See D, DeCamp P, Nevo E, Blake T (2002) Discovery and
assay of single-nuceotide polymorphisms in barley (Hordeum vulgare). Plant
Mol Biol 48:529-537
Koebner R, Summers R (2002) The impact of molecular markers on the wheat
breeding paradigm. Cell Mol Biol Lett 7:695-702
Kumar LS (1999) DNA markers in plant improvement: An overview. Biotech Adv
17:143-182
Manly KF, Cudmore RH Jr, Meer JM (2001) MapManager QTX, cross-platform
software for genetic mapping. Mammalian Gen 12:930-932
Nelson MN, Phan HTT, Ellwood SR, Moolhuijzen PM, Bellgard M, Hane J,
Williams A, O’Lone CE, Fosu-Nyarko J, Scobie M, Cakir M, Jones
MGK, Bellgard M, Książkiewicz M, Wolko B, Barker SJ, Oliver RP,
Cowling WA (2006) The first gene-based map of Lupinus angustifolius L. –
location of domestication genes and conserved synteny with Medicago
truncatula. Theor Appl Genet 113:225-238
Chapter Three: Marker for Ku gene
64
Orita M, Iwahana H, Kanazawa H, Hayashi K, Seriya T (1989) Detection of
polymorphisms of human DNA by gel electrophoresis as single-strand
conformation polymorphisms. Proc Natl Acad Sci USA 86:2766-2770
Pusch W, Wurmbach JH, Thiele H, Kostrzewa M (2002) MALDI-TOF mass
spectrometry-based SNP genotyping. Pharmacogenomics 3:537-548
Rahman MS, Gladstones JS (1972) Control of lupin flower initiation by
vernalization, photoperiod and temperature under controlled environment.
Aust J Exp Agric Anim Husb 12:638-645
Yang H, Sweetingham MW, Cowling WA, Smith PMC (2001) DNA
fingerprinting based on micro-satellite anchored fragment length
polymorphisms, and isolation of sequence-specific PCR markers in lupin
(Lupinus angustifolius L.). Mol Breed 7:203-209
Yang H, Shankar M, Buirchell BJ, Sweetingham MW, Caminero C, Smith PMC
(2002) Development of molecular markers using MFLP linked to a gene
conferring resistance to Diaporthe toxica in narrow-leafed lupin (Lupinus
angustifolius L.). Theor Appl Genet 105:265-270
Yang H, Boersma JG, You M, Buirchell BJ, Sweetingham MW (2004)
Development and implementation of a sequence-specific PCR marker linked
to a gene conferring resistance to anthracnose disease in narrow-leafed lupin
(Lupinus angustifolius L.). Mol Breed 14:145-151
You M, Boersma JG, Buirchell BJ, Sweetingham MW, Siddique KHM, Yang H
(2005) A PCR-based molecular marker applicable for marker-assisted
selection for anthracnose disease resistance in lupin breeding. Cell Mol Biol
Lett 10:123-134
Chapter Four: Markers for Reduced Pod Shattering in Lupin (No. 1)
65
Chapter Four
Development of two sequence-specific PCR markers linked
to the le gene that reduces pod shattering in narrow-leafed
lupin (Lupinus angustifolius L.)
Chapter Four: Markers for Reduced Pod Shattering in Lupin (No. 1)
66
4.1 INTRODUCTION
An essential characteristic of a modern grain crop is the ability to retain its
seeds long enough to allow mechanical harvesting at full maturity. In the genus
Lupinus, this characteristic has long been present in two species – Lupinus albus L.,
an old crop species of the Mediterranean region, and L. mutabilis (sweet) which has
been cultivated in the Peruvian Andes for over 2000 years (Gladstones 1967).
Narrow-leaf lupin (Lupinus angustifolius L.) is the most widely cultivated
grain legume crop in Australia. Originally introduced into Western Australia (W.A.)
towards the end of the 19th
century (Gladstones 1994) as a green manure crop, these
plants were essentially wild. Wild types of L. angustifolius have seed pods that
shatter upon maturity, making harvesting very difficult. Research aimed at finding
plants with non-shattering pods was reported to have begun in Germany in 1929
(Hanelt 1960). They were successful in selecting a strain that had a reduced pod
shatter (von Sengbusch and Zimmermann 1937) apparently related to a large
reduction in the thickness of the pod wall (Atebekova 1958). Domestication of this
species in W.A. began in 1960 with the discovery of two natural mutant (recessive)
genes, lentus and tardus for reduced pod-shattering (Gladstone 1967) and, in 1961 a
gene for nil-vernalisation requirement and early flowering (Gladstones 1969).
One of the genes for reduced pod-shatter, known as tardus (ta), affects the
sclerenchyma strips of the dorsal and ventral pod seams, fusing the two halves to
such an extent that separation of the two halves is greatly impeded. It was
considered analogous to a gene previously found in L. luteus. The second gene
lentus (le) modified the orientation of the sclerified endocarp of the pod, resulting in
a reduction of torsional forces upon drying, and hence reduced pod shatter. This
gene was also associated with a reduction in the thickness of the pod wall, but not to
the extent of the previously found strain of von Sengbusch and Zimmerman (1937),
leading to the conclusion that the controlling genes were not the same (Gladstones
1967). This modification was associated with a change in internal pod pigmentation
that gave the immature pods a purplish tinge and the inside surface of mature pods a
bright yellowish-brown color (Gladstones 1967). In addition, this trait is also
associated with development of a reddish pigmentation within the stem of plants
older than two months. The first Australian cultivar to carry both these genes was
Chapter Four: Markers for Reduced Pod Shattering in Lupin (No. 1)
67
Uniharvest, released in 1971. Apart from Fest (released 1973) all Australian and
many European cultivars released since then carry both of these genes.
Since field based selection for the le gene requires that the F2 progeny be
maintained for at least 8 weeks from sowing to ensure that this trait is retained, it
would be more efficient to use molecular markers that could be used to evaluate
progeny within the first weeks of growth. Recently, two molecular genetic maps
have been produced in L. angustifolius on which le has been mapped (Chapter 2,
Figure 2.1; Nelson et al. 2006). No marker was located within 5 centiMorgans (cM)
of the le gene on the map of Nelson et al. (2006). Conversely, several markers on
my map (Chapter 2) were closely linked to the le gene. However, the MFLP markers
in this map are not implementable in practical lupin breeding as the multiple bands
produced by their primer combinations may cause confusion, makes it impossible to
multiplex several markers for high efficiency and, is too tedious and expensive to be
implemented in a lupin breeding program for screening large numbers of plants. The
aim of this research is to develop simple, sequence-specific PCR based markers
linked to the le gene desirable for marker assisted selection (MAS) in lupin breeding.
4.2 MATERIALS AND METHODS
4.2.1 Plant materials and phenotyping of le gene
A population of F8 recombinant inbred lines (RILs) of a domestic x wild type
(DxW) cross of L. angustifolius was previously developed by the Department of
Agriculture and Food, Western Australia (DAFWA) using as parents lines P27255
(wild) and 83A:476 (domesticated). Part of the resulting RIL population has
previously been used to produce linkage maps for L. angustifolius (Chapter 2, Nelson
et al. 2006).
The full population consisting of two parents and 115 RILs, was sown in a
screen-house during the winter growing season with 25-30 plants of each RIL grown
in 1.5 meter rows. Plants were either rated as LeLe (wild, shattering; pigment absent)
or lele (domesticated, reduced shattering; pigment present) based on the method
described by Gladstones (1967).
Chapter Four: Markers for Reduced Pod Shattering in Lupin (No. 1)
68
4.2.2 Marker development
The parents and 89 RILs were previously subject to MFLP tests involving 10
SSR-anchor primers each in combination with 16 MseI-primers (Table 2.1). Two
MFLP markers having the best correlation to the le phenotyping data were selected.
DNA fragments from candidate MFLP markers were isolated from MFLP gels, re-
amplified by PCR, ligated into plasmids “pGEM-T Easy Vector” (Promega) and
cloned into E. coli according to the manufacturer‟s instructions. Plasmid DNA with
MFLP fragment inserts were isolated from E. coli, and sequenced using the BigDye
Terminator system (Applied Biosystems). To ensure the accuracy of DNA
sequencing, at least five clones of E. coli were used to prepare the plasmid DNA
containing the inserts, and sequenced separately. A sequence-specific primer was
designed near the MseI-end internal to the SSR-MseI fragment. (Yang et al. 2002,
2004; You et al. 2005). Primers were designed so that the annealing temperature
was approximately 54C based on calculations using the nearest-neighbor model
(http://www.sigmaaldrich.com).
4.2.3 Testing of converted markers
Testing of the converted markers was achieved by PCR, using the sequence-
specific primer in combination with the SSR anchor-primer from which the original
MFLP polymorphism was produced (Yang et al. 2001, 2002). Marker DNA
fragments were amplified in a10 l PCR consisting of 1.5 l of the template DNA
(approximately 100 ng), 0.5 unit of Taq polymerase (Fisher Biotec, Perth), 5 pmol of
each primers, 67 mM Tris-HCl (pH8.8), 2 mM MgCl2, 16.6 mM (NH4)2SO4, 0.45%
Triton X-100, 4 g gelatin, and 0.2 mM dNTPs. The sequence-specific primers were
labeled with -33
P based on a previously reported method (Yang et al. 2001, 2002,
2004). PCR was performed on a thermocycler (Hybaid DNA Express) with each
cycle comprising 30 s at 94C, 30 s at the annealing temperature (see below), and 1
min at 72C. The annealing temperature of the first cycle was 60C, and decreased
0.7C in each subsequent cycle until the temperature reached 54C. The final 25
cycles used an annealing temperature of 54C. The selective PCR products were
separated on a 5% polyacrylamide denaturing sequencing gel (7 M urea) using a
38x50 cm (0.4 mm in thickness) Sequi-Gen GT sequencing cell (Bio-Rad). After
electrophoresis at 55W for about 3 h, the gel was dried on a gel drier (Model 583,
Chapter Four: Markers for Reduced Pod Shattering in Lupin (No. 1)
69
Bio-Rad). Marker bands were detected by autoradiography (Yang et al. 2002, You
et al. 2004) with overnight exposure of the X-ray film to the dried gel.
4.2.4 Confirmation of linkage
The two converted sequence–specific markers were tested on all 115 F8 RILs
of the population derived from the DxW cross. The marker score data and le
phenotype data of the 115 F8 RILs were merged and analysed using “MapManager”
(Manly et al. 2001) to determine the genetic linkage between the markers and the le
gene.
Further testing of the markers was carried out on all 23 Australian historical
and current cultivars and on 36 landrace accessions from the Australian Lupin
Collection, to examine correlation of their phenotype with the le markers‟ genotypes.
Landrace accessions were selected on the basis of their geographic origins.
4.3 RESULTS
4.3.1 Phenotyping of le gene
Phenotyping on the individual plants from each of the 115 RILs revealed that
55 RIL lines were homozygous for le (reduced shatter), and 60 lines were
homozygous for Le (shattering). The segregation of RILs with the lele genotype to
plants with the LeLe genotype fits the expected 1:1 ratio (2 = 0.217, P = 0.641) for a
single gene.
4.3.2 DNA sequencing of candidate MFLP markers
Among the markers originated from 153 sets of MFLPs during a mapping
study (Chapter 2, Figure 2.1), two dominant markers designated as “DAWA323.150”
and “DAWA468.290” were identified as candidate markers for development as
sequence-specific markers tagging the le gene.
Marker DAWA323.150 mapped as1.2 cM from the le gene in the map based
on the 89 RILs (Chapter 2), was present in RILs with lele genotype, but was absent
in RILs with LeLe genotype (Figure 4.1). DNA sequencing found that MFLP marker
DAWA323.150 is a 157 bp fragment including the sequence of SSR-anchor primer
MF51 (5‟-GGGAACAACAACAAC-3‟) and the primer MseI-CGA (5‟-
GATGAGTCCTGAGTAACGA-3‟) (Table 4.1).
Chapter Four: Markers for Reduced Pod Shattering in Lupin (No. 1)
70
Figure 4.1. MFLP fingerprinting on 20 RILs derived from a domesticated x wild
cross in Lupinus angustifolius generated by SSR-anchor primer MF51 in
combination with primer MseI-CGA.
Eight RILs having the LeLe genotype are (DxW) 58 (Lane 2), 60 (Lane 4), 65 (Lane 6), 66 (Lane 7),
70 (Lane 9), 73 (Lane 10), 77 (Lane 13), and, 85 (Lane 19). Eleven RILs: (DxW) 57 (Lane 1), 59
(Lane 3), 64 (Lane 5), 69 (Lane 8), 74 (Lane 11), 76 (Lane 12), 78 (Lane 14), 82 (Lane 16), 83 (Lane
17), 84 (Lane 18), and 86 (Lane 20) have the genotype lele. Note that all of the 20 plants except one
(RIL 80, Lane 15) showed correct correlation between the le phenotype and the marker genotype.
Arrow indicates the candidate MFLP marker linked to the le allele at 157 bp.
Table 4.1. DNA sequence of the MFLP marker DAWA323.150 showing primers
giving rise to sequence-specific marker LeM1.
le allele 1 GATGAGTCCT GAGTAACGA1A CCTACCATTT G
2CCTAAACAA TATATTGTTT
le allele 51 ACTGGTTGTT GTTGTTGTTC TTCTTCTTCT TCCTCTTCTT CCTCTTCTTC
le allele 101 TTCTTCTTCT TACCATTTGC CTAAACAATA TATTGTTTAC TGGTTGTTGT
le allele 151 TGTTCCC3
1Primer MseI-CGA (5‟-GATGAGTCCTGAGTAACGA-3‟) is in italic.
2Sequence-specific primer LeBMS1 (5‟- TTAACGAACCTACCATTTG-3‟).
Note: The first 4 bp in primer LeBMS1 corresponds with the recognition site of MseI (T/TAA), while
the first nucleotide (T) was replaced by G when the MseI-adaptor was ligated onto the restriction
fragments in MFLP (Yang et al. 2001).
3Annealing site of SSR-anchor primer MF51 (3‟- GGGAACAACAACAAC-5‟)
Chapter Four: Markers for Reduced Pod Shattering in Lupin (No. 1)
71
Marker DAWA468.290 was also present in plants with lele genotype but absent in
plants with LeLe genotype (Figure 4.2). This marker had not been shown in the map
(Figure 2.1) as it was also calculated to be 1.2 cM from the le gene, and therefore co-
segregated with marker DAWA323.150.
Figure 4.2. MFLP fingerprinting on 20 RILs in Lupinus angustifolius generated by
SSR-anchor primer MF42 in combination with primer MseI-CCA.
RILs portrayed in this figure are the same as in Figure 4.1. Arrow indicates the candidate MFLP
marker linked to the le allele at 284 bp.
DNA sequencing revealed that marker DAWA468.290 is a 284 bp fragment
including the anchor primer sequence MF42 (3‟- GTCTAACAACAACAACAAC-
5‟) and the sequence of primer MseI-CCA (5‟- GATGAGTCCTGAGTAACCA-3‟)
(Table 4.2).
4.3.2.1 Marker “LeM1”
Based on the DNA sequence of MFLP marker DAWA323.150, a sequence-
specific primer “LeMS1” (3‟-TTAACGAACCTACCATTTG -5‟) was designed near
Chapter Four: Markers for Reduced Pod Shattering in Lupin (No. 1)
72
the MseI end of the original MFLP marker (Table 4.1). The dominant MFLP marker
was successfully converted into a dominant simple PCR based marker by using the
sequence-specific primer LeBMS1 in combination with SSR-anchor primer MF51.
F8 RILs with the genotype lele developed the 126 bp marker band, while plants with
genotype LeLe did not develop this band (Figure 4.3). We designated this sequence-
specific dominant marker linked to the le gene as “LeM1”.
Figure 4.3. Screening molecular marker LeM1 on the parents and 28 F8 derived
RILs of Lupinus angustifolius using PCR with sequence-specific primer LeMS1 (5‟-
TTAACGAACCTACCATTTG-3‟) and SSR anchor primer MF51.
Lines with the lele genotype which developed a 126 bp band include the domesticated parent plant
83A:476 (Lane 1) and 21 RILs: (DxW) 67 (Lane 4), 69 (Lane 5), 71 (Lane 7), 74 (Lane 9), 76 (Lane
11), 78 (Lane 13), 79 (Lane 14), 82 (Lane 17), 83 (Lane 18), 84 (Lane 19), 86 (Lane 21), 90 (Lane
23), 93 (Lane 25), 94 (Lane 26), 97 (Lane 29) 98 (Lane 30). Plants with the LeLe genotype which did
not produce the marker band are the wild type parent P27253 (Lane 2) and 11 RILs: 66 (Lane 3), 70
(Lane 6), 73 (Lane 8), 75 (Lane 10), 77 (Lane 12), 81 (Lane 16), 85 (Lane 20), 89 (Lane 22), 92 (Lane
24), 95 (Lane 27), 96 (Lane 28). RIL DxW 80 (Lane 15) also produced no band despite carrying the
lele allele.
4.3.2.2 Marker “LeM2”
A sequence-specific primer “LeMS2” (3‟- AGAAAAAGATGAATGCACG -
5‟) was designed near the MseI end based on the sequence of MFLP marker
DAWA468.290 (Table 4.2). The marker was successfully converted into a simple
PCR based marker by using primer LeMS2 in combination with SSR-anchor primer
MF42. Plants with genotype lele produced a 204 bp marker band, but the marker
fragment is absent in plants with LeLe genotype (Figure 4.4). We designated this
marker as “LeM2”.
Chapter Four: Markers for Reduced Pod Shattering in Lupin (No. 1)
73
Table 4.2. DNA sequence of the MFLP marker DAWA468.290 showing primers
giving rise to sequence-specific markers LeM2.
le allele 1 GATGAGTCCT GAGTAACCA1 C TCATAGTTTA TAAACTCTCC AATTGTTTGT
le allele 51 TATTCTCATG TATTATATCC TATCTCACAA AGAAAAAGAT GAATGCACG2A
le allele 101 GTTTTTTAGT ACAAATTTCA TCCTACACTG AATCTGTTGA AATTGAAATG
le allele 151 AATATCACAA AACATTTTGC TGCAGTGTCG GTCTTGCTTT ACCATTCGTG
le allele 201 GTGGCAACAC TTACACGTCA AGCAAAGTCA TTGATGGATG CCCCACCTAC
le allele 251 TGTGATAAAA GCTTGGTTGT TGTTGTTGTT AGAC3
1Primer MseI-CCA (5‟-GATGAGTCCTGAGTAACCA-3‟).
2 Sequence-specific primer LeMS2 (5‟-AGAAAAAGATGAATGCACG-3‟).
3Annealing site of primer MF42 (3‟-GTCTAACAACAACAACAAC-5‟).
Figure 4.4. Screening molecular marker LeM2 on the parents and 28 F8 derived
RILs of Lupinus angustifolius using PCR with sequence-specific primer LeMS2 (3‟-
AGAAAAAGATGAATGCACG-5‟) and SSR anchor primer MF42.
The length of the band fragment produced here is 204 bp. RILs portrayed in this figure are the same
as in Figure 4.3.
4.3.3 Confirmation of linkage
Markers LeM1 and LeM2 were tested on the parents and 115 RILs of the
DxW population. Marker results and RIL genotypes showed imperfect correlation,
with LeM1 having six differences and, LeM2 having three differences between the
marker result and RIL genotypes. The three RILs which showed inconsistence
between phenotype and marker genotype of LeM2 also showed the inconsistency
with LeM1. Map distances were calculated by MapManager (Manly et al. 2001) to
be 1.3 cM (LeM2) and 2.6 cM (LeM1) from the gene (Figure 4.5).
Chapter Four: Markers for Reduced Pod Shattering in Lupin (No. 1)
74
Figure 4.5. Genetic linkage of the two molecular markers LeM1 and LeM2 and the
reduced-pod-shatter gene lentus (le) of Lupinus angustifolius, as analysed by
MapManager.
Distances given in centiMorgans (above) between adjacent points on the linkage map are non-
cumulative
Among the 23 Australian cultivars, only the first released cultivar Uniwhite,
carries the shattering alleles LeLe, and all the other 22 cultivars have the reduced-
shattering genotype lele. The 22 cultivars having the lele genotype were correctly
scored by the markers. However, the marker genotype and Le phenotype of
Uniwhite did not match (Table 4.3).
The Australian lupin collection holds many accessions of wild and landrace
L. angustifolius collected or received from a range of locations. Most of these
accessions have been rated as either „shedding‟ (shattering; no le or ta), „reduced
shedding‟ (carrying at least one gene reducing pod shatter) or „non-shedding‟
(presumably carrying at least 2 genes for the reduction of pod shatter). Of the 36
landraces, marker LeM1 designated only six accessions as Le („shedding‟
(shattering)) and LeM2 designated seven as Le, despite all but one of them having
previously been rated as Le („Shedding‟, Australian Lupin Collection database,
2005). Only one of the accessions was designated as Le by both markers. Similarly,
both markers designated as le the one accession listed as “non-shedding”, received
from Belarus (Table 4.4). Accessions correctly designated as Le or le were collected
(or received) from eight countries including Belarus, France, Greece, Italy, Morocco,
Portugal, Spain, Syria. Accessions from the other eight source countries including
Cyprus, Chile, Germany, India, Israel, Turkey, USA and the USSR were incorrectly
genotyped using the two markers. In total, 13 out of 36 (36%) land-race accessions
showed a positive correlation between marker score and pod-shatter genotypes for
one or both markers.
Chapter Four: Markers for Reduced Pod Shattering in Lupin (No. 1)
75
Table 4.3. Correlation of marker score and Le phenotype of 23 Australian cultivars
of Lupinus angustifolius.
Cultivars Year of
release
Lentus
Phenotype
Presence of LeM1
marker band
Presence of LeM2
marker band
Uniwhite 1967 LeLe + +
Uniharvest 1971 lele + +
Unicrop 1973 lele + +
Marri 1976 lele + +
Illyarrie 1979 lele + +
Yandee 1980 lele + +
Chittick 1982 lele + +
Danja 1986 lele + +
Geebung 1987 lele + +
Gungurru 1988 lele + +
Yorrel 1989 lele + +
Warrah 1989 lele + +
Merrit 1991 lele + +
Myallie 1995 lele + +
Kalya 1996 lele + +
Wonga 1996 lele + +
Belara 1997 lele + +
Tallerack 1997 lele + +
Tanjil 1998 lele + +
Moonah 1998 lele + +
Quilinock 1999 lele + +
Jindalee 2000 lele + +
Mandelup 2004 lele + +
Note: Both LeM1 and LeM2 are dominant markers, where the marker band is linked to the le allele.
The one cultivar incorrectly identified by the markers, Uniwhite, is presented in bold.
+ = band present
- = band absent
Chapter Four: Markers for Reduced Pod Shattering in Lupin (No. 1)
76
Table 4.4. Correlation of marker score and Le phenotype of 36 Wild and Landrace
accessions of L. angustifolius from the Western Australian Lupin Collection.
Landrace
(Perth No.)
Origin Lentus
Phenotype
Presence of LeM1
marker band
Presence of LeM2
marker band
P20650 Portugal LeLe + +
P20653 Portugal LeLe + +
P20711 Italy LeLe + +
P20712 Italy LeLe + -
P20714 Italy LeLe + +
P20724 Italy LeLe + +
P20729 Russia LeLe + +
P20730 Russia LeLe + +
P20733 Germany LeLe + +
P20736 Israel LeLe + +
P21517 Israel LeLe + +
P21624 Turkey LeLe + +
P21625 Syria LeLe + +
P22609 Turkey LeLe + +
P22665 Spain LeLe - +
P22666 Spain LeLe - +
P22669 Spain LeLe + +
P22820 Portugal LeLe + -
P22829 Portugal LeLe + -
P23051 France LeLe + -
P24025 India LeLe + +
P26042 USA LeLe + +
P26045 Greece LeLe + +
P26235 Spain LeLe + -
P26263 Portugal LeLe + -
Chapter Four: Markers for Reduced Pod Shattering in Lupin (No. 1)
77
Landrace
(Perth No.)
Origin Lentus
Phenotype
Presence of LeM1
marker band
Presence of LeM2
marker band
P26307 Spain LeLe + +
P26308 Spain LeLe + +
P26436 Greece LeLe + +
P26465 Greece LeLe - +
P26652 Italy LeLe + +
P26675 Cyprus LeLe + +
P27055 Belarus lele + +
P27253 Morocco LeLe - -
P27434 Syria LeLe - +
P27968 Greece LeLe - +
P28003 Chile LeLe + +
Note: Both LeM1 and LeM2 are dominant markers, where presence of the marker band is linked to
the le allele. Accessions for which the Le phenotype correlates with either or both of the two
markers are presented in bold.
+ = band present
- = band absent
4.4 DISCUSSION
We have successfully developed two sequence-specific PCR markers linked
to the Le gene in L. angustifolius in this study. Both markers are simple PCR based,
are cost-effective, and could be used for MAS in lupin breeding. Previously, in
Chapter 2, marker DAWA323.150 from which LeM1 was derived, was mapped as
being only 1.2cM from the gene based on 89 RILs. This distance has now been re-
calculated as being 2.6cM from the gene on the basis of a population of 115 RILs,
including the 89 RILs previously used by them. LeM2, which had not previously
been placed on the map, has been positioned mid-way between the Le gene and
LeM1 at 1.3 cM. The genetic distance between the marker and the gene determines
the accuracy of marker assisted selection when the marker is used in the breeding
program. Since markers LeM1 and LeM2 are both on the same side of the le gene,
Chapter Four: Markers for Reduced Pod Shattering in Lupin (No. 1)
78
and LeM2 is closer to the gene than LeM1, it would be appropriate to use marker
LeM2 in MAS if both markers are applicable.
For MAS, it would be ideal to develop so-called “perfect Markers” where the
DNA fragments of the markers are actually on the gene of interest, in which case the
linkage between the markers and the gene is almost unbreakable (Ellis et al. 2002).
However, perfect markers are very difficult to develop. Most of the molecular
markers being implemented in practical plant breeding programs are “imperfect”
where certain genetic distances exist between the markers and the gene of interest in
the chromosomes (Staub and Serquen 1996, Gupta et al. 1999). The two markers
linked to the Le gene in lupin reported in this paper, are like-wise “imperfect”. Over
long periods of time and in the crossing in plant breeding programs, genetic
recombination may occur between the marker locus and the gene locus, and
consequently plants not having the target gene may carry the marker DNA sequence,
and vice versa (Sharp et al. 2001, You et al. 2005).
In MAS, a molecular marker can be used to screen the progeny from a cross
only if the marker is polymorphic among the parents so that the desirable allele can
be distinguished from the undesirable ones (Eagles et al. 2001). Fortunately, all the
modern Australian cultivars having the lele genotype show the target bands for
markers LeM1 and LeM2. However, testing of these markers on land-races that
were fully shattering (having the LeLe,TaTa genotype) resulted in only 13 of the 36
landrace accessions correlating the marker bands with genotype. Eleven of those 13
accessions were correctly identified by either one or the other of the two markers,
indicative of the degree of crossing over that has occurred between the marker and
the le gene in the wild even though it only occurs at an estimated 1.3 – 2.6% of the
time in any given cross. The results suggest that these markers may be of use in
MAS to screen the progeny of approximately one third of wild accessions when they
are crossed with modern Australian cultivars. This study although not exhaustive,
also suggests that these markers would be more likely useful when testing progeny of
seed material originating from Greece, Morocco (source of DxW parent P27255),
Portugal, Spain and Syria, although seed received from other sources including
collections (e.g. France, Belarus) should not be ruled out.
When markers LeM1 and LeM2 are used to screen the F2 progenies from
DxW crosses, they enable breeders to eliminate the approximately 25% of plants
which are homozygous for the LeLe allele. However, since both markers are
Chapter Four: Markers for Reduced Pod Shattering in Lupin (No. 1)
79
dominant, they cannot differentiate homozygous lele F2 plants from the heterozygous
Lele plants. Therefore, further selection for the lele genotype may be necessary in
later generations of the breeding cycle.
4.5 REFERENCES
Atebekova AI (1958) The dehiscence of the pods in the genus Lupinus (Tourn.) L.
Bull Moscow Soc Nat Res 63:89
Eagles HA, Bariana HS, Ogbonnaya FC, Rebetzke GJ, Hollamby GJ, Henry
RJ, Henschke PH, Carter M (2001) Implementation of markers in
Australian wheat breeding. Aust J Agric Res 52:1349-1356
Ellis MH, Spielmeyer W, Gale KR, Rebetzke GJ, Richards RA (2002) “Perfect”
markers for the Rht-B1b and Rht-D1b dwarfing genes in wheat. Theor Appl
Genet 105:1038 – 1042
Gladstones JS (1967) Selection for economic characters in Lupinus angustifolius
and L. digitatus. 1. Non-shattering pods. Aust J Exp Agric and Anim Husb
7:360 – 366
Gladstones JS (1969) Selection for economic characters in Lupinus angustifolius
and L. digitatus. 2. Time of flowering. Aust J Exp Agric Anim Husb 9:213 -
220
Gladstones JS (1994) An historical review of lupins in Australia. In: M. Dracup, J
Palta (eds) Proceedings of the first Australian lupin technical symposium.
Department of Agriculture, Western Australia, pp 1 – 38
Gupta PK, Varshney PK, Sharma PC, Ramesh B (1999) Molecular markers and
their applications in wheat breeding. Plant Breeding 118:369-390
Hanelt P (1960) The Lupins. A Ziemsen, Wittenberg, 104 pp
Manly KF, Cudmore Jr RH, Meer JM (2001) MapManager QTX, cross-platform
software for genetic mapping. Mammalian Gen 12:930-932
Chapter Four: Markers for Reduced Pod Shattering in Lupin (No. 1)
80
Nelson MN, Phan HTT, Ellwood SR, Moolhuijzen PM, Bellgard M, Hane J,
Williams A, O’Lone CE, Fosu-Nyarko J, Scobie M, Cakir M, Jones
MGK, Bellgard M, Książkiewicz M, Wolko B, Barker SJ, Oliver RP,
Cowling WA (2006) The first gene-based map of Lupinus angustifolius L. –
location of domestication genes and conserved synteny with Medicago
truncatula. Theor Appl Genet 113:225-238
Sengbusch von R, Zimmermann K (1937) Die Auffindung der ersten gelben und
blauen Lupinen (Lupinus luteus und Lupinus angustifolius) mit
nichtplatzenden Hülsen und die damit zusammenhängenden Probleme,
insbesondere die der Süsslupinenzüchtung. Züchter 9:57-65
Sharp PJ, Johnston S, Brown G, McIntosh RA, Pallotta M, Carter M, Bariana
HS, Khatkar S, Lagudah ES, Singh RP, Khairallah M, Potter R, Jones
MGK (2001) Validation of molecular markers for wheat breeding. Aust J
Agric Res 52:1357-1366
Staub JE, Serquen FC (1996) Genetic markers, map construction, and their
application in plant breeding. HortScience 31:729-740
Yang H, Sweetingham MW, Cowling WA, Smith PMC (2001) DNA
fingerprinting based on micro-satellite anchored fragment length
polymorphisms, and isolation of sequence-specific PCR markers in lupin
(Lupinus angustifolius L.). Mol Breed 7:203-209
Yang H, Shankar M, Buirchell BJ, Sweetingham MW, Caminero C, Smith,
PMC (2002) Development of molecular markers using MFLP linked to a
gene conferring resistance to Diaporthe toxica in narrow-leafed lupin
(Lupinus angustifolius L.). Theor Appl Genet 105:265-270
Yang H, Boersma JG, You M, Buirchell BJ, Sweetingham MW (2004)
Development and implementation of a sequence-specific PCR marker linked
to a gene conferring resistance to anthracnose disease in narrow-leafed lupin
(Lupinus angustifolius L.). Mol Breed 14:145-151
You M, Boersma JG, Buirchell BJ, Sweetingham MW, Siddique KHM, Yang H
(2005) A PCR-based molecular marker applicable for marker-assisted
selection for anthracnose disease resistance in lupin breeding. Cell Mol Biol
Lett 10:123-134
Markers for Reduced Pod Shattering in Lupin (No. 2)
81
Chapter Five
Development of a sequence-specific PCR marker linked to
the tardus gene that reduces pod shattering in narrow-leafed
lupin (Lupinus angustifolius L.)
Markers for Reduced Pod Shattering in Lupin (No. 2)
82
5.1 INTRODUCTION
Wild types of L. angustifolius have seed pods that shatter upon maturity,
making harvesting very difficult. Two major recessive genes which together remove
pod-shattering in narrow-leafed lupin were found by Gladstones and his co-workers
(1967) and subsequently incorporated into all cultivars of this crop species in
Australia. The first gene lentus (le) modified the orientation of the sclerified
endocarp of the pod, resulting in a reduction of torsional forces upon drying, and
hence reduced pod shatter. The second gene, known as tardus (ta), affects the
sclerenchyma strips of the dorsal and ventral pod seams and was considered
analogous to a gene previously found in L. luteus. It is difficult to phenotype and is
not easily selected for visually – especially when in the presence of le.
Since the expression of the ta gene is greatly influenced by environmental
factors (particularly the humidity and temperature), and is complicated by the
presence or absence of the le gene, accurate phenotyping of the ta gene is the most
difficult task when introgressing wild material in lupin breeding. The aim of this
research is to develop simple, sequence-specific PCR based markers linked to the ta
gene suitable for marker assisted selection (MAS) in lupin breeding.
5.2 MATERIALS AND METHODS
5.2.1 Plant materials and phenotyping of the ta gene
A population of F8 recombinant inbred lines (RILs) of a domestic x wild type (DxW)
cross of L. angustifolius was previously developed by the Department of Agriculture
and Food, Western Australia (DAFWA) using as parents lines P27255 (wild) and
83A:476 (domesticated). This population has previously been used to produce
linkage maps for L. angustifolius (Chapter 2; Nelson et al. 2006) and also to develop
2 markers linked to the le gene (Chapter 4).
The full population consisting of two parents and 115 RILs, was sown over
two successive winter growing seasons in a screen-house and in the open field.
In the first year just three plants were grown of each RIL in a single row in
the screen-house. Plants were grown to physiological maturity and the (still green)
tops of the plants enclosed in perforated clear plastic bread bags (holes ~ 0.5mm
diameter, 25 / cm2) to prevent seed and pod loss and aid observations as the plants
and pods dried. The second year, 25-30 plants of each RIL were grown in 1.5m long
Markers for Reduced Pod Shattering in Lupin (No. 2)
83
rows 50cm apart, with 3 replicates. Plants were grown to maturity and observations
taken without enclosing tops or pods.
5.2.1.1 Field observations
Because this population segregates for both reduced pod-shatter genes lentus
and tardus, all RILs were rated for the presence of le (Gladstones 1967, Chapter 4) in
green plants after 10 weeks on the basis of the presence (or absence) of a red stem
pigmentation.
This population is heterogeneous for maturity as a result of varying
vernalisation and day-length requirements for flower initiation. As pods and plants
matured, observations were made either every one or two days for pod shattering.
Daily observation was especially important in hot, dry conditions (≥ 35oC). Upon
observation of splitting or complete pod shatter in any particular RIL, both the
incidence of shatter and the plant‟s condition were recorded. All observations were
dated to ensure consistency in rating when plants and pods were dry and when
shattering occurred. Any rainfall events were recorded, and re-drying of plants and
pods carefully monitored.
At the occurrence of pod shatter plants were rated according to the following criteria:
Pod condition: Plant condition: Rating:
(a) recently dry (a) completely green, fully leaved 1 (fully shattering)
(b) dry (b) have slightly green stems 2
(c) just dry 3
(c) very dry; (d) very dry 4
5 (no shattering)
Note: Pods of plants carrying neither gene for reduced pod-shatter tend to shatter spontaneously when
the plants are still green and, in some cases fully leaved (rating = 1, 2). Plants carrying both genes for
reduced pod-shatter have greatly retarded or no pod-shatter at all (rating = 5). Those with only one of
the two genes tend to be intermediate to these two extremes (rating = 3, 4).
Markers for Reduced Pod Shattering in Lupin (No. 2)
84
5.2.1.2 Laboratory observations
Pod samples were collected from the field by carefully cutting plant stems
just below the mature (dry) pods and placing them into paper bags for later
examination. Plant materials were allowed to dry at room temperature in the
laboratory for at least another month prior to a physical and microscopic examination
of the pods.
Pods were examined for:
(i) ease of splitting:
(a) splits readily or even spontaneously
(b) difficult to split by finger pressure to the seams.
(ii) microscope examination as described by Gladstones (1967)
(a) pods split neatly, with a smooth break around the seam
(b) splitting does not always follow the seam but goes outside of it and is
jagged.
Pods of plants carrying the le gene had a yellow colouration inside and exhibited
some resistance to shattering. Those carrying ta also exhibited resistance to
shattering. When pods were forcibly split by applying pressure to the sides, those
carrying ta tended to split in a jagged fashion whereas those carrying le only or
neither gene, did not.
5.2.2 Marker development and mapping
The parents and 89 RILs were previously subject to MFLP tests involving 10
SSR-anchor primers each in combination with 16 MseI-primers (Table 2.1). The
phenotyping (ta gene) data was inserted into the map and the fit examined by
MapManager version QTXb20 (Manly et al. 2001) using the „Tools, Report‟
function. One MFLP marker having the best correlation to the ta phenotyping data
was selected. DNA fragments from candidate MFLP markers were isolated from
MFLP gels, re-amplified by PCR, ligated into plasmids “pGEM-T Easy Vector”
(Promega) and cloned into E. coli according to the manufacturer‟s instructions.
Markers for Reduced Pod Shattering in Lupin (No. 2)
85
Plasmid DNA with MFLP fragment inserts were isolated from E. coli, and sequenced
using the BigDye Terminator system (Applied Biosystems). To ensure the accuracy
of DNA sequencing, at least five clones of E. coli were used to prepare the plasmid
DNA containing the inserts, and sequenced separately. A sequence-specific primer
was designed near the MseI-end internal to the SSR-MseI fragment. (Yang et al.
2002, 2004; You et al. 2005). Primers were designed so that the annealing
temperature was approximately 54C based on calculations using the nearest-
neighbour model (http://www.sigmaaldrich.com).
5.2.3 Testing of converted markers
Testing of the converted marker was achieved by PCR, using the sequence-
specific primer in combination with the SSR anchor-primer from which the original
MFLP polymorphism was produced (Yang et al. 2001, 2002). Marker DNA
fragments were amplified in a10 l PCR consisting of 1.5 l of the template DNA
(approximately 100 ng), 0.5 unit of Taq polymerase (Fisher Biotec, Perth), 5 pmol of
each primers, 67 mM Tris-HCl (pH8.8), 2 mM MgCl2, 16.6 mM (NH4)2SO4, 0.45%
Triton X-100, 4 g gelatin, and 0.2 mM dNTPs. The sequence-specific primers were
labelled with -33
P based on a previously reported method (Yang et al. 2001, 2002,
2004). PCR was performed on a thermocycler (Hybaid DNA Express) with each
cycle comprising 30s at 94C, 30s at the annealing temperature (see below), and 1
min at 72C. The annealing temperature of the first cycle was 60C, and decreased
0.7C in each subsequent cycle until the temperature reached 54C. The final 25
cycles used an annealing temperature of 54C. The selective PCR products were
separated on a 5% polyacrylamide denaturing sequencing gel (7 M urea) using a
38x50 cm (0.4 mm in thickness) Sequi-Gen GT sequencing cell (Bio-Rad). After
electrophoresis at 55W for about 3 h, the gel was dried on a gel drier (Model 583,
Bio-Rad). Marker bands were detected by autoradiography (Yang et al. 2002, You
et al. 2004) with overnight exposure of the X-ray film to the dried gel.
5.2.3.1 Confirmation of linkage
The two converted sequence–specific markers were tested on all 115 F8 RILs
of the population derived from the DxW cross. The marker score data and ta
phenotype data were merged and analysed using “MapManager” (Manly et al. 2001)
to determine the genetic linkage between the markers and the ta gene.
Markers for Reduced Pod Shattering in Lupin (No. 2)
86
Further testing of the markers was carried out on 18 Australian historical and
current cultivars and on 33 wild and landrace accessions from the Australian Lupin
Collection, to examine correlation of their phenotype with the ta marker‟s genotype.
Accessions were selected on the basis of their geographic origins.
5.3 RESULTS
5.3.1 Phenotyping of ta gene
The complexity of phenotyping for ta resulted us spending 2 seasons
characterising the ta gene in the RILs involving both field and laboratory pod rating.
In the majority (113 / 115) of cases there was a good correlation between the two
methods employed, although for one RIL (line 107) results for both methods over 2
years and, a second RIL (Line 110), with only one year‟s data, were inconclusive.
Neither of these 2 RILs had been used in development of the map in Chapter 2.
Phenotyping of the 113 RILs suggested that 45 RIL lines were homozygous
for ta (reduced shatter), and 68 lines were homozygous for Ta (shattering). The
segregation of RILs with the tata genotype to plants with the TaTa genotype does not
fit the expected 1:1 ratio (2 = 4.68, P = 0.03) for a single gene. Similar outcomes
were previously observed for segments of the genetic maps developed in Chapter 2
and by Nelson et al. (2006) using this marker population.
5.3.2 Map placement of ta and closely linked MFLP markers
Among the markers originated from 153 sets of MFLPs during a mapping
study (Chapter 2), three markers ((DAWA) 169.305, 978.325, 1097.300c) were
found to be closely linked to ta. However, none of these had been placed on the
published map. Examination of the combined map of Nelson et al. (unpublished)
determined that Tardus ought to be placed in linkage group 1 in the vicinity of
marker DAWA821.140 (Figure 2.1). Based on the mapped population of 89 RILs
and using MapManager QTX (Manly et al. 2001), all three markers were determined
to be on the one side of ta, with DAWA1097.300c the closest at 2.1cM, and the two
other markers at 2.8cM from the gene. Further testing of Marker DAWA169.305 on
114 RILs (of a possible 115) of this population did not alter the distance between the
gene and this marker, there being 5 mis-matches between marker and RIL genotypes.
Markers for Reduced Pod Shattering in Lupin (No. 2)
87
The revised order of the original and new markers in this segment and, distances
between the markers is presented in Figure 5.1.
5.3.3 DNA sequencing of candidate MFLP marker
Marker DAWA169.305 was selected for conversion into a PCR-friendly
format. DNA sequencing revealed that marker DAWA169.305 is a 306 bp fragment
including the anchor primer sequence MF128 (3‟- AGTAGCTCTCTCTCTCTCTC -
5‟) and the sequence of primer MseI-CCT (5‟- GATGAGTCCTGAGTAACCT-3‟)
(Table 5.1). MF128 is a degenerate primer. Consequently the end of the sequence
varied between analyses.
Table 5.1. DNA sequence of the MFLP marker DAWA169.305 showing primers
giving rise to sequence-specific marker TaM1.
Ta allele 1 GATGAGTCCT GAGTAACTT1 AAATCATTAC TTCAAATTCA CCAATCCTCT
Ta allele 51 TATGCGAAAT TTTTGTTAGA TTGGGCCTAA ACAGAGGATT GCAAATC2GT
Ta allele 101 CACACATGTG CATTCACAGA ACCCAATGGA ATGATTAGTA GATTTGCATA
Ta allele 151 TGGTTGGATT TGAGATATCA CCACACAAAT AGTGAGTCAC ACGAGCTCCT
Ta allele 201 GATTAGGGGA ATCAGTTGAG GCTAACCCTG TTTTGCTGTT CCAAATGGGT
Ta allele 251 CAAAATTATA ATGCCAAAGG AGAATCAAAA TCATAGGAGA GAGAGAGAGA
Ta allele 301 ACCAAT3
1Primer MseI-CTT (5‟- GATGAGTCCTGAGTAA CTT -3‟).
2Sequence-specific primer TaMS1 (5‟-AACAGAGGATTGCAAATC-3‟).
3Annealing site of SSR-anchor primer MF128 (3‟- AGTAGCTCTCTCTCTCTCTC -5‟).
Note: MF128 is a degenerate primer. Consequently, the sequence from 301-306 does not correspond
fully to the reverse primer sequence. Sequence ACC (bp 301 -303) alternated with CTA and CCC in
5 otherwise identical sequences.
Markers for Reduced Pod Shattering in Lupin (No. 2)
88
Figure 5.1. Marker sequence and placement of the tardus gene in linkage group 1 of
the linkage map developed in Chapter 2.
DAWA700.150c0.0
Tardus23.8DAWA1097.300c25.9DAWA169.30526.6DAWA80.19035.1DAWA289.630c35.7DAWA821.14037.0DAWA109.260c DAWA956.29538.3DAWA749.46040.9DAWA532.48041.5DAWA377.35042.1DAWA930.135c42.8DAWA809.47544.3DAWA758.47046.4
DAWA765.18067.2DAWA523.29069.0DAWA516.29069.6
DAWA498.31075.0
LG1
Note: This segment represents the upper part of LG1in Figure 2.1 including a number of extra
markers as well as a rearrangement of the order for a better fit. All markers of the original map in this
sector are included. From DAWA516.290 (at 31.1cM in original map) onwards the linkage group is
unchanged. The new total length of LG1 is 175.8cM.
Markers for Reduced Pod Shattering in Lupin (No. 2)
89
5.3.3.1 Marker “TaM1”
Based on the DNA sequence of MFLP marker DAWA169.305, a sequence-
specific primer “TaMS2” (3‟- AACAGAGGATTGCAAATC -5‟) was designed near
the MseI end of the original MFLP marker (Table 5.1). The dominant MFLP marker
was successfully converted into a co-dominant simple PCR based marker by using
the sequence-specific primer TaMS2 in combination with SSR-anchor primer
MF128. F8 RILs with the genotype TaTa developed the faster (shorter) marker
band(s), while only plants with the genotype tata developed the slowest band with a
length of approximately 221bp. We designated this marker as “TaM1”. No attempt
was made to determine the sequence difference(s) between the bands, although a
visual inspection of the films suggests that the length difference between each of the
bands is 1bp.
Figure 5.2. Screening of molecular marker TaM1 on 20 wild and land-race
accessions from the Australian Lupin Collection (Perth, W.A.).
All of these accessions are known to lack the ta allele. Lines carrying the sequence associated with
the reduced shatter allele ta, are in lanes 1, 2, 4, 9, 10, 12, 13, 15, 17, 18, 20. Lines carrying the Ta
allele type 1 are in lanes 3, 11, 14. Lines carrying the Ta allele type 2 are in lanes 5, 8, 19. Lines
carrying the Ta allele type 3 are in lanes 6, 7. There is one line in lane 16 carrying the heterozygous
allele combination.
5.3.4 Confirmation of linkage
The converted marker TaM1 gave results matching those of DAWA169.305.
Testing of TaM1 on a selection of 18 Australian cultivars (Table 5.2) of narrow-leaf
lupin revealed no mis-matches. When tested on wild accessions (Figure 5.2), it was
found that there were three alleles for the wild genotype, in approximately equal
numbers. Of the 33 landraces and wild types (Table 5.3), marker TaM1 designated
14 accessions as Ta (“shattering”) and 1 as ta (“non-shattering”) correctly. Lines
Markers for Reduced Pod Shattering in Lupin (No. 2)
90
correctly identified as carrying the Ta allele were from Cyprus (1), France (1),
Greece (1), India (1), Israel (1), Italy (3), Morocco (1), Portugal (1), Spain (2), Syria
(1), Turkey (1). The one line from Belarus was correctly identified as carrying the ta
allele. Three of these lines ((P) 22829, 26235, 27055) were previously also found to
be amenable to selection for the gene lentus, with marker LeM2 (Chapter 4).
Table 5.2. Correlation of marker score and Ta phenotype of 18 Australian cultivars
of L. angustifolius.
Cultivar Year of
release
Tardus
Phenotype
TaM1 marker
rating
Marri 1976 tata tata
Illyarrie 1979 tata tata
Yandee 1980 tata tata
Chittick 1982 tata tata
Danja 1986 tata tata
Geebung 1987 tata tata
Gungurru 1988 tata tata
Yorrel 1989 tata tata
Warrah 1989 tata tata
Myallie 1995 tata tata
Kalya 1996 tata tata
Wonga 1996 tata tata
Belara 1997 tata tata
Tallerack 1997 tata tata
Moonah 1998 tata tata
Quilinock 1999 tata tata
Jindalee 2000 tata tata
Coromup 2006 tata tata
Markers for Reduced Pod Shattering in Lupin (No. 2)
91
Table 5.3. Correlation of marker score and Ta phenotype of 33 wild and landrace
accessions of Lupinus angustifolius from the Western Australian Lupin Collection.
Landrace
(Perth No.) Origin Tardus
Phenotype
TaM1 marker
Rating
P20650 Portugal Ta - tata
P20653 Portugal Ta - Tata
P20711 Italy Ta - TaTa (2)
P20712 Italy Ta - tata
P20714 Italy Ta - tata
P20724 Italy Ta - TaTa (2)
P20730 Russia Ta - tata
P20733 Germany Ta - tata
P20736 Israel Ta - TaTa (2)
P21625 Syria Ta - TaTa (1)
P22609 Turkey Ta - TaTa (3)
P22665 Spain Ta - tata
P22666 Spain Ta - tata
P22669 Spain Ta - tata
P22724 Spain Ta - TaTa (1)
P22820 Portugal Ta - tata
P22829 Portugal Ta - TaTa (2)
P22842 Morocco Ta - TaTa (3)
P23051 France Ta - TaTa (3)
P24025 India Ta - TaTa (2)
P26042 USA Ta - tata
P26045 Greece Ta - tata
P26235 Spain Ta - TaTa (1)
P26263 Portugal Ta - tata
P26308 Spain Ta - tata
P26436 Greece Ta - TaTa (1)
Markers for Reduced Pod Shattering in Lupin (No. 2)
92
Landrace
(Perth No.) Origin Tardus
Phenotype
TaM1 marker
Rating
P26465 Greece Ta - tata
P26652 Italy Ta - TaTa (3)
P26675 Cyprus Ta - TaTa (3)
P27055 Belarus tata tata
P27253 Morocco Ta - tata
P27434 Syria Ta - tata
P28003 Chile Ta - tata
Note: Accessions for which the Ta phenotype correlates with the marker are presented in bold. For
TaM1 there are 3 different wild-type alleles. The allele identified for a particular line has been
identified in brackets following the marker genotype.
5.4 DISCUSSION
The reduced-shatter gene tardus is of major importance in the domesticated
narrow-leafed lupin, being one of the two major genes having a controlling effect on
the elimination of pre-harvest shattering in pods (Gladstones 1967). The successful
phenotyping for this trait in the presence of the second major gene lentus (le)
required careful examination of plants in the field as well as a microscopic
examination of the pods after harvest. In most cases the results were clear-cut, with
only one RIL (17) giving conflicting results between field observations and pod
examination data. The conflict was resolved in favour of the pod examination that
had indicated that ta was present. This was done on two grounds: (a) The genetic
map data suggested the pod result (ta) to be the most probable correct result, (b) It is
possible in certain genotypes that ta is present but does not eliminate pod-shatter
when in the presence of le (Gladstones, pers. comm.). This outcome has allowed the
gene to be mapped into Linkage Group 1 (LG1) of my map (Chapter 2) and that of
Nelson et al. (unpublished) and the identification of three closely linked markers that
had been previously generated, but not placed in my map (Chapter 2). These results
are also indicative of the involvement of at least one more (unknown) gene in the
reduction / elimination of pod shattering in narrow-leaf lupins.
The candidate marker “DAWA169.305” was a dominant marker in the MFLP
fingerprint linked to the wild allele Ta. However, after DNA sequencing, the marker
Markers for Reduced Pod Shattering in Lupin (No. 2)
93
was converted into a co-dominant marker showing a band for both of the Ta and the
ta alleles but with a size difference. The successful DNA amplification of co-
dominant bands in the PCR indicates that both alleles have the identical annealing
sites for the primers TaMS2 and MF128. MF128 was also one of the two primers
involved in the generation of the original candidate marker DAWA169.305 in the
MFLP. It is likely that the DNA sequence of the ta allele has a mutation at the
restriction site which causes the enzyme Tru9I to be unable to recognise it. Hence
the MseI-adaptor could not be ligated onto the ta allele and the ta allele did not show
a corresponding band in the MFLP fingerprint.
The development of a sequence-specific co-dominant PCR marker linked to
the ta gene in L. angustifolius was successful. This marker correctly identified all
the 18 Australian cultivars tested as having the ta allele. Further testing of this
marker showed that it correctly identified the phenotype of 15 out of 33 lines
selected from the Australian lupin collection. However, in a further 7 cases no PCR
reaction product was produced. Of the 33 lines (above), one had been replicated but,
only one of the two replicate samples produced a PCR product, indicating a problem
in sample preparation to be the most probable cause for the failure of those PCRs.
Thus, on the basis of the 33 successful PCRs, marker TaM1 may be useful in as
many as 45.5% of potential crosses.
The random distribution of (positive) correlation between gene and marker
suggests that potential wild parents from any region have an equal chance of being
amenable to screening by TaM1 when in a cross with a domesticated parent. The
fact that 3 of these lines were found to be amenable to selection procedures with the
(now) existing markers for both lentus (Chapter 4) and tardus could make them good
candidates for a first attempt at introducing new genetic material into the narrow-leaf
lupin breeding program. Marker TaM1, being PCR based, is cost-effective and
would therefore being eminently suited to MAS in lupin breeding, but is limited in its
application.
Markers for Reduced Pod Shattering in Lupin (No. 2)
94
Acknowledgements:
The help of Mr. Colin Smith (DAFWA) in preliminary phenotyping work
and, the advice of Dr John Gladstones on particular aspects of phenotyping, are
gratefully acknowledged.
5.5 REFERENCES
Cowling WA, Huyghe C, Swiecicki W (1998) Lupin Breeding. In: Gladstones JS,
Atkins C and Hamblin J (eds) Lupins as crop plants. CAB International,
University Press, Cambridge, UK. pp. 93-120
Gladstones JS (1967) Selection for economic characters in Lupinus angustifolius
and L. digitatus. 1. Non-shattering pods. Aust J Exp Agric and Anim Husb
7:360 – 366
Gupta PK, Varshney PK, Sharma PC, Ramesh B (1999) Molecular markers and
their applications in wheat breeding. Plant Breeding 118:369-390
Manly KF, Cudmore Jr RH, Meer JM (2001) MapManager QTX, cross-platform
software for genetic mapping. Mammalian Gen 12:930-932
Nelson MN, Phan HTT, Ellwood SR, Moolhuijzen PM, Bellgard M, Hane J,
Williams A, O’Lone CE, Fosu-Nyarko J, Scobie M, Cakir M, Jones
MGK, Książkiewicz, Wolko B, Barker SJ, Oliver RP, Cowling WA
(2006) The first gene-based map of Lupinus angustifolius L. – location of
domestication genes and conserved synteny with Medicago truncatula.
Theor Appl Genet 113(2):225 – 238
Yang H, Sweetingham MW, Cowling WA, Smith PMC (2001) DNA
fingerprinting based on micro-satellite anchored fragment length
polymorphisms, and isolation of sequence-specific PCR markers in lupin
(Lupinus angustifolius L.). Mol Breed 7:203-209
Yang H, Shankar M, Buirchell BJ, Sweetingham MW, Caminero C, Smith,
PMC (2002) Development of molecular markers using MFLP linked to a
gene conferring resistance to Diaporthe toxica in narrow-leafed lupin
(Lupinus angustifolius L.). Theor Appl Genet 105:265-270
Markers for Reduced Pod Shattering in Lupin (No. 2)
95
Yang H, Boersma JG, You M, Buirchell BJ, Sweetingham MW (2004)
Development and implementation of a sequence-specific PCR marker linked
to a gene conferring resistance to anthracnose disease in narrow-leafed lupin
(Lupinus angustifolius L.). Mol Breed 14:145-151
You M, Boersma JG, Buirchell BJ, Sweetingham MW, Siddique KHM, Yang H
(2005) A PCR-based molecular marker applicable for marker-assisted
selection for anthracnose disease resistance in lupin breeding. Cell Mol Biol
Lett 10:123-134
Chapter Six: Development of a marker for seed dormancy
97
Chapter Six
Development of a PCR marker tightly linked to mollis, the
gene that controls seed dormancy in
Lupinus angustifolius L.
Chapter Six: Development of a marker for seed dormancy
98
6.1 INTRODUCTION
High germination rates and uniform plant densities in the year of sowing are
paramount for a crop species. One of the survival adaptations of many plant species
including that of the wild narrow-leafed lupin (Lupinus angustifolius L.) is the
production of seeds with testa (seed coats) that are impermeable to water, inducing
dormancy and preventing germination of all seed in any one year (Quinlivan 1967,
Forbes and Wells 1968). This adaptation in lupins is also known as being „hard
seeded‟. Dormancy is a physical process that appears to be induced after maturity as
the seed moisture content drops below 14% and, is complete at between 9 and 11%
moisture content (Gladstones 1958). In the field, seed dormancy of L. cosentinii
(formerly known as L. varius) was found to gradually break down as a result of large
daily (summer) temperature fluctuations (Quinlivan 1966, 1968). Similar
observations have also been made for L. angustifolius. It was surmised that the
fluctuating temperatures caused the testa to crack in localised areas making it
permeable, allowing a viable seed to readily imbibe water and germinate (Quinlivan
1968). Seeds having testa permeable to water, promoting rapid germination of
mature seed upon sowing are therefore a desirable feature for lupins grown as a seed
crop.
A single recessive gene mollis which is of unknown origin (Mikolajczyk
1966, Forbes and Wells 1968) results in seeds developing a water-permeable testa at
maturity, although the precise mode of action of mollis remains unclear. Some
researchers have found that the seed of soft-seeded lines and cultivars have testa
similar in thickness to hard-seeded lines (Clements et al. 2005), whereas others
found an alteration in the shapes and size of especially the outer palisade and the
hourglass cell layers of lupin seed testa (Miao et al. 2001) and that of other legumes
(Lush and Evans 1980). All seed crops of domesticated narrow-leafed lupin carry
this gene, mollis (Gladstones 1960; Cowling 1999).
The germplasm pool of domesticated L. angustifolius is very narrow, largely
because of its recent domestication. It is becoming increasingly obvious that there is
a need to widen the genetic base to promote gains in yield, disease resistance and
quality. Although sizeable collections are held in Australia and elsewhere, the use of
this material has been limited because of the difficulty in retaining domestication
traits such as mollis. The development of molecular markers specifically designed to
Chapter Six: Development of a marker for seed dormancy
99
identify the presence of such genes will greatly improve the rate at which new
material can be introduced into the breeding program by enabling screening of the F2
seedlings and selecting only individuals carrying the gene in a homozygous
condition. It is the aim of this research to develop a molecular marker tightly linked
to mollis, enabling rapid selection for this gene when doing intra-specific crosses
with wild accessions of L. angustifolius.
6.2 MATERIALS AND METHODS
6.2.1 Plant materials
The main marker population used in this study was an F8 recombinant inbred
line (RIL) of a domestic x wild type (DxW) cross of L. angustifolius (population 1)
previously developed by the Department of Agriculture and Food Western Australia
(DAFWA), using as parents lines P27255 (wild) and 83A:476 (domesticated). The
same population has also been used to produce linkage maps for L. angustifolius
(Figure 2.1; Nelson et al. 2006). The full population of this cross (115 RILs) was
used in initial testing of the developed marker. Other plant material used to test the
validity of the developed marker included 16 F2 plants (population 2) of a cross
between the Australian cultivar „Wonga‟ and the wild type P27253 and 36 landrace
(L. angustifolius) accessions from the Australian Lupin Collection, plus 24 historical
and current Australian cultivars.
6.2.2 DNA extraction for marker testing
Samples of three leaflets per plant were placed into wells of a 96-deep well
plate (Axygen, Union City, CA, USA) containing 600µl extraction buffer (Raeder
and Broda 1985) and one 4-mm diameter steel ball bearing (Consolidated Bearing
Co Pty Ltd, Perth, Australia). The leaf material was homogenised on a 2000
Geno/Grinder mill (SPEX Certiprep, Metuchen, N J, USA) for 6 min at 1300
strokes/min. The homogenised leaf material was heated in a water bath at 80oC for
30 min. After cooling down by floating on cold tap water for 10 min and chilling at -
20oC for 5 min, 300µl cold (4
oC) ammonium acetate was added to each well.
Samples were mixed and placed in the -20oC freezer to cool for a further 8 min.
Plates were centrifuged for 15 min at 3600rpm (maximum speed) in a bench top
centrifuge (Eppendorf 5804). The upper aqueous (180µl) was transferred to a new
Chapter Six: Development of a marker for seed dormancy
100
block containing 300µl extraction buffer per well and mixed. DNA was precipitated
by addition of 400µl isopropanol per well, mixed and left on the bench at room
temperature for 30 – 60 min before centrifuging at 3600 rpm for 15 min and
decanting the supernatant. Pellets were washed with 150µl 70% ethanol. Samples
were left on the bench top for 10 min, centrifuged 5 min (max speed), the liquid
decanted and air dried for 10 min. Pellets were dissolved in 100µl TE0.1 buffer
(10mM Tris, 0.1mM EDTA, pH 8).
6.2.3 Phenotyping for mollis
Plants were grown in the screen-house and seed produced oven-dried at 40oC
for two weeks before being phenotyped for mollis. Twenty seeds of each RIL and 30
seeds of each F2 plant were placed on moistened filter papers in Petri-plates at room
temperature and monitored for germination over a period of 10 days (Quinlivan,
1968). Seeds that failed to germinate were scarified to pierce the seed coat (Arrieta
et al. 1994) and monitored a further 10 days. Seeds that germinated without
scarification were designated as soft (moll / moll). Those that germinated only after
scarifying were designated as hard (Moll / -). Seed that failed to germinate after
scarifying were deemed non-viable. Similar procedures were followed when
phenotyping material obtained from the Australian Lupin Collection. When a mix of
hard and soft seeds were observed (population 2), the parent was deemed to be
heterozygous, since the seed testa is of the female parent (Arrieta et al. 1994)
6.2.4 Marker development
The two parents and 89 RILs (population 1) were subject to MFLP tests
involving 10 SSR-anchor primers each in combination with 16 MseI-primers (Table
2.1). One dominant MFLP marker having the best correlation to the mollis
phenotyping data was selected. DNA fragments from the candidate MFLP marker
was excised from MFLP gels, re-amplified by PCR, ligated into plasmids “pGEM-T
Easy Vector” (Promega, Annandale, NSW, Australia) and cloned into E. coli for
single-copy amplification, according to the manufacturer‟s instructions. Plasmid
DNA having MFLP fragment inserts were isolated from E. coli (Yang et al. 2002),
and sequenced using the BigDye Terminator system (Applied Biosystems, Foster
City, CA, USA).
Chapter Six: Development of a marker for seed dormancy
101
The dominant marker developed using primers MoAMS + MF43 also gave a
back-ground signal (see Results), necessitating extension of the sequenced DNA
beyond the SSR-end of the MseI-SSR fragment to enable design of a sequence-
specific primer replacing MF43. The method of DNA extension beyond the SSR-
end is the same as reported previously (You et al. 2004). Briefly, genomic DNA of
the two parental lines was digested with restriction enzyme HpaII (recognition site
5‟-C/CGG-3‟, not found in the initial sequence), followed by ligating the restriction
fragments with a modified MseI-adaptor (Vos et al. 1995) to fit the Csp6I restriction
sites (one string is 5‟- GACGATCAGTCCTGAA -3‟, and the other string is 5‟-
GCTTCAGGACTGAT -3‟). Specific fragment amplification by PCR was achieved
using the primer “HpaII-O” (5‟- CGATCAGTCCTGAACGG -3‟) in combination
with a sequence-specific primer “MoAMS” (5‟-
TAACATCAACAAGGTGAGAATC-3‟), designed from the previously sequenced
MseI-SSR fragment. The amplified fragments were cloned and sequenced. A new
sequence-specific primer, MoASR (5‟-GAAGCATTCGATGAATTC-3‟), was
designed to use in combination with MoAMS for amplifying the marker bands
tagging the gene Mollis by PCR. We designate this marker as “MoA”.
For routine screening of marker MoA, DNA fragments were amplified in a10
l PCR consisting of 1.5 l template DNA (approximately 100 ng), 0.5 unit of Taq
polymerase (Fisher Biotec, Perth, Australia), 5 pmol each of two sequence-specific
primers, 67 mM Tris-HCl (pH8.8), 2 mM MgCl2, 16.6 mM (NH4)2SO4, 0.45% Triton
X-100, 4 g gelatin, and 0.2 mM dNTPs. Primer MoASR was labelled with -33
P
based on a previously reported method (Yang et al. 2001, 2002). PCR was
performed on a thermocycler (Hybaid DNA Express) with each cycle comprising 30
s at 94C, 30 s at the annealing temperature (see below), and 1 min at 72C. The
annealing temperature of the first cycle was 60C, and decreased 0.7C in each
subsequent cycle until the temperature reached 54C. The final 25 cycles used an
annealing temperature of 54C. DNA samples were denatured at 94C for 3 minutes
before being loaded on an SSCP gel (which contains 6% acrylamide, 5% glycerol
and10% sucrose; Gonen et al. 1999) and resolved by electrophoresis at a constant
340 volts (about 12-14 mA) for 16 h at room temperature. Marker bands were
detected by autoradiography (Yang et al. 2002, You et al. 2004) with overnight
exposure of the X-ray film to the dried gel.
Chapter Six: Development of a marker for seed dormancy
102
6.2.5 Confirmation of linkage
The converted sequence–specific markers were tested on the F8 derived
population consisting of 115 RILs (population 1). The marker score data and the
mollis phenotyping data of the RILs were compared and analysed by MapManager
QTX (Manly et al. 2001) to determine the genetic linkage between the marker and
mollis. The marker was further evaluated against all Australian cultivars, a range of
wild and land-race accessions of this species obtained from the Australian Lupin
Collection and a number of hard and soft-seeded accessions from several other lupin
species. In addition, 16 F2 seedlings were tested – primarily to demonstrate the SNP
marker‟s properties in a segregating population.
6.3 RESULTS
6.3.1 Phenotyping of mollis gene
Of the DxW population (total 115 RILs), 71 RILs were found to be hard
seeded (Moll) and 44 RILs were soft seeded (moll). The segregation of plants with
the moll - moll genotype to plants with the Moll - Moll genotype deviates
significantly from the expected 1:1 ratio (2 = 6.33916, P = 0.01181) for the F8 RIL
population.
6.3.2 DNA sequencing of the candidate MFLP marker
A dominant MFLP marker designated “DAWA561.180”, originally produced
during the mapping study (Chapter 2), co-segregated with the Moll (hard seeded)
phenotyping scores of the 89 RILs investigated (Figure 6.1). This marker was
selected as a candidate for development of a sequence-specific marker tagging the
mollis gene. Marker DAWA561.180 was generated by SSR-anchor primer MF43
(5‟- CCTCAAGAAGAAGAAGAAG -3‟) in combination with primer MseI-CAT
(5‟- GATGAGTCCTGAGTAACAT-3‟).
DNA sequencing showed that the dominant marker DAWA561.180 was a
179 bp fragment with a sequence of SSR-anchor MF43 and MseI-CAT at each end as
expected (Table 6.1). A sequence-specific primer “MoAMS” (5‟-
TAACATCAACAAGGTGAGAATC-3‟) was designed to replace primer MseI-CAT.
PCR amplification of this marker by primer MoAMS in combination with the SSR-
Chapter Six: Development of a marker for seed dormancy
103
anchor primer MF43 using as template the DNA from the two parents and 10
randomly selected RILs resulted in amplification of a marker band (MoA) with the
same dominant band pattern (Moll) as DAWA561.180, but with a significant
background signal for the moll (soft seed) allele.
Figure 6.1. 33
P autoradiograph of MFLP fingerprinting on 20 RILs derived from a
domesticated x wild cross in Lupinus angustifolius generated by SSR-anchor primer
MF43 in combination with primer MseI-CAT.
MFLP PCR products were resolved on a 5% denaturing sequencing gel. A dominant marker with a
sequence length of 179 bp (arrowed) shows nine RILs with the Moll / Moll genotype in lanes 2, 4, 5,
6, 12, 14, 17, 18, 19. No band was generated for moll / moll genotypes.
Chapter Six: Development of a marker for seed dormancy
104
Table 6.1. DNA sequence of the candidate MFLP marker DAWA561.180, and the
sequence extended beyond the MF43-end. DNA sequences of the marker fragments
MoA amplified by pair MoAMS and MoASR contains two SNPs shown in bold and
italic.
moll allele Moll allele
GATGAGTCCT GAGTAACAT1C AACAAGGTGA GAATCAAGGT CATAGTGAAA ATCATCATCA
GATGAGTCCT GAGTAACATC AACAAGGTGA GAATC2AAGGT CAAAGTGAAA ATCATCATCA
moll allele Moll allele
CTCCCGAATT GTTGGTGAAG TGTTTTACCG
AATGCTTCAC GGAAGAGATT GGAGACTCGA CTCCCGAATT GTTGGTGAAG TGTTTTACCG
AATGCTTCAC GGAAGAGATT GGAGACTCGA
moll allele Moll allele
CAGAAGTCAG AGTAAAGTTG AAGCTGCTTT TCGGCATCGT CTTCTTCTAC TTCGGAGTCA CAGAAGTCAG AGTAAAGTTG AAGCTGCTTT TCGGCATCGT CTTCTTCTTC TTCGGAG
3TCA
moll allele Moll allele
TGGTGTGGGG TGAGGAATTC ATCGAATGCT TC4
TGGTGTGGGG TGAGGAATTC ATCGAATGCT TC
1Primer MseI-CAT (3‟-GATGAGTCCTGAGTAACAT -5‟).
2Primer MoAMS (3‟-TAACATCAACAAGGTGAGAATC-5‟)
3Annealing site of primer MF43 (5‟-CCTCAAGAAGAAGAAGAAG-3‟). Note: The genomic
sequence does not completely match the primer sequence at the 3‟-end.
4Annealing site of primer MoASR (5‟-GAAGCATTCGATGAATTC-3‟)
Extension of the sequence beyond that of primer MF43, resulted in the
designing of a second sequence-specific primer “MoASR” (5‟-
GAAGCATTCGATGAATTC-3‟) (Table 6.1). The PCR amplification products by
primer pair MoAMS and MoASR are 199 bp in length both for the Moll allele and
for the moll allele, but with two SNPs (Table 6.1). SNP1 was within the original
sequence at 43 bp, internal to primer MoAMS. The second SNP (SNP2) was within
the sequence of primer MF43 at 169 bp. SNP1 was a base substitution of T
(domesticated, soft-seeded) for A (wild, hard-seeded). SNP 2 had the reverse
substitution of A (domesticated, soft) for T (wild, hard). The distance between the
two SNPs was 126 bp.
6.3.3 Co-dominant marker “MoA”
On an SSCP gel, PCR products amplified by primer pair MoAMS and
MoASR showed a co-dominant segregation with the band of the moll allele moving
faster than band of the Moll allele (Figure 6.2). We designate this marker as “MoA”.
Chapter Six: Development of a marker for seed dormancy
105
Figure 6.2. SSCP gel screening of molecular marker MoA on 16 F2 sibs of a cross
between the cultivar Wonga and wild-type P27253 using a 33
P labelled PCR with
sequence-specific primers MoAMS5 and MoAB9SR5.
The length of the band fragment produced here is 212 bp. Plants in lanes 1, 5, 8 are soft seeded (moll
/ moll). Plants in lanes 2, 3, 4, 6, 7, 11, 14, 15 are heterozygous hard seeded (Moll / moll) and those in
lanes 9, 10, 12, 13, and 16 are homozygous hard seeded (Moll / Moll).
6.3.4 Confirmation of linkage
MoA was tested on 115 F8 RILs (population 1), confirming that the gene and
marker are very tightly linked. Linkage analysis by computer program MapManager
QTX (Manly et al. 2001) suggested that the genetic distance between the marker and
the gene is less then 0.4 cM if we assume one cross-over in that interval in a
population of 116 or more.
Further testing of the marker on 24 Australian cultivars and on 35 wild and
Landrace accessions from the Australian Lupin Collection confirmed the score of the
marker bands to be completely consistent with the phenotype for all of these lines
(Tables 6.2, 6.3), although we found 3 alleles for the hard-seeded phenotype (data
not presented). When MoA was tested on several other Lupin species including L.
albus and L. luteus, in some instances polymorphisms did develop but they appeared
to have no correlation to soft-seededness (data not presented).
Chapter Six: Development of a marker for seed dormancy
106
Table 6.2. Plant phenotype and Marker genotype scores of 24 Australian cultivars of
Lupinus angustifolius showing perfect correlation for Mollis.
Cultivar Year of
release
Plant
Phenotype
Marker
Genotype
Uniwhite 1967 moll moll
Uniharvest 1971 moll moll
Unicrop 1973 moll moll
Marri 1976 moll moll
Illyarrie 1979 moll moll
Yandee 1980 moll moll
Chittick 1982 moll moll
Danja 1986 moll moll
Geebung 1987 moll moll
Gungurru 1988 moll moll
Yorrel 1989 moll moll
Warrah 1989 moll moll
Merrit 1991 moll moll
Myallie 1995 moll moll
Kalya 1996 moll moll
Wonga 1996 moll moll
Belara 1997 moll moll
Tallerack 1997 moll moll
Tanjil 1998 moll moll
Moonah 1998 moll moll
Quilinock 1999 moll moll
Jindalee 2000 moll moll
Mandelup 2004 moll moll
Coromup 2006 moll moll
Moll = „hard‟ seeded
moll = „soft‟ seeded
Chapter Six: Development of a marker for seed dormancy
107
Table 6.3. Plant phenotype and marker genotype scores of 35 wild and Landrace
accessions of L. angustifolius from the Western Australian Lupin Collection showing
perfect correlation for Mollis.
Landrace
(Perth No.)
Origin Plant
Phenotype
Marker
Genotype
P20650 Portugal Moll Moll
P20653 Portugal moll moll
P20711 Italy moll moll
P20712 Italy Moll Moll
P20714 Italy Moll Moll
P20724 Italy Moll Moll
P20729 Russia moll moll
P20730 Russia moll moll
P20733 Germany moll moll
P20736 Israel Moll Moll
P21517 Israel moll moll
P21624 Turkey Moll Moll
P21625 Syria Moll Moll
P22609 Turkey Moll Moll
P22665 Spain Moll Moll
P22666 Spain Moll Moll
P22669 Spain Moll Moll
P22820 Portugal Moll Moll
P22829 Portugal Moll Moll
P23051 France Moll Moll
P24025 India Moll Moll
P26042 USA moll moll
P26045 Greece moll moll
P26235 Spain Moll Moll
P26263 Portugal Moll Moll
Chapter Six: Development of a marker for seed dormancy
108
Landrace
(Perth No.)
Origin
Plant
Phenotype
Marker
Genotype
P26307 Spain Moll Moll
P26308 Spain Moll Moll
P26436 Greece Moll Moll
P26465 Greece Moll Moll
P26652 Italy Moll Moll
P26675 Cyprus Moll Moll
P27055 Belarus moll moll
P27253 Morocco Moll Moll
P27434 Syria Moll Moll
P28003 Chile moll moll
Note: Moll = „hard‟ seeded
moll = „soft‟ seeded
6.4 DISCUSSION
The MFLP marker (DAWA 561.180) identified as being linked to the gene
controlling seed dormancy (mollis) of L. angustifolius in our material was found on
the basis of an examination of the genetic map (Figure 2.1). Phenotyping of this RIL
population for mollis, gave a somewhat anomalous result in which nearly 2/3 of the
population was found to be hard-seeded (Moll). This population was previously
found to segregate in a skewed fashion for mollis by Nelson et al. (2006), although
no satisfactory reason could be given for this anomaly other then the small
population size.
For routine screening, a dominant marker has the disadvantages of being
unable to differentiate between homozygous moll-moll plants from heterozygous
Moll-moll individuals. By extending the original sequence we were able to convert
the marker into co-dominant form based on the presence / absence of two SNPs, and
especially SNP number 2 (Table 6.1). This SNP (number 2) was only found in plants
carrying the allele for soft seeds (moll). SNP 1 is a reversal of SNP 2 but it appears
unlikely that this reversal is significant as testing of MoA on a highly diverse
population of wild types and Landraces revealed the presence of at least 3 alleles for
Chapter Six: Development of a marker for seed dormancy
109
hard-seed, possibly the result of alternative SNPs or even a deletion event within the
same sequence, although only the one allele was found for soft-seededness (moll-
moll) (data not presented). Consequently, the SNP marker could be successfully
implemented as a co-dominant by SSCP gel electrophoresis, capable of
differentiating heterozygous Moll-moll plants from homozygous moll-moll plants.
MoA correctly identified all tested accessions of L. angustifolius from the
Western Australian Lupin Collection, including at least 2 lines previously incorrectly
recorded as being hard-seeded. This indicates that linkage of this marker to mollis is
very tight. However, the failure of this marker when tested on other lupin species
may be an indication that it is not located within the gene sequence.
In conclusion; marker MoA is very tightly linked to the gene mollis in L.
angustifolius, with no sign found of the linkage having been broken in this species
across a diverse selection of both cultivated and wild types. It will be of great value
when introgressing wild material into the domesticated crop.
Chapter Six: Development of a marker for seed dormancy
110
6.5 REFERENCES
Arrieta V, Besga G, Cordero, S (1994) Seed coat permeability and its inheritance
in a forage lupin (lupinus hispanicus). Euphytica 75:173-177
Clements JC, Dracup M, Buirchell BJ, Smith CG (2005) Variation for seed coat
and pod wall percentage and other traits in a germplasm collection and
historical cultivars of lupins. Aust J Agric Res 56:75-83
Cowling WA (1999) Pedigrees and characteristics of narrow-leafed lupin cultivars
released in Australia from 1967 – 1998. Agriculture Western Australia
Bulletin 4365
Forbes I, Wells HD (1968) Hard and soft seededness in blue lupine, Lupinus
angustifolius L.: Inheritance and phenotype classification. Crop Sci 8: 195-
197
Gladstones JS (1958) The influence of temperature and humidity in storage on seed
viability and hardseededness in West Australian blue lupin (Lupinus digitatus
Forsk.). Aust J Agric Res 9:171-181
Gladstones JS (1960) Lupin cultivation and breeding. J Aust Inst Agric Sci 26:19-25
Gonen D, Veenstra-VanderWeele J, Leventhal B, Cooke EH (1999) High
through-put fluorescent CE-SSCP SNP genotyping. Mol Psych 4:339-343
Lush WM, Evans LT (1980) The seed coats of cowpeas and other grain legumes:
Structure in relation to function. Fld Crop Res 3:267-286
Manly KF, Cudmore RH Jr, Meer JM (2001) MapManager QTX, cross-platform
software for genetic mapping. Mammalian Gen 12:930-932
Miao ZH, Fortune JA, Gallagher J (2001) Anatomical structure and nutritive value
of lupin seed coats. Aust J Agric Res 52:985-993
Mikolajczyk J (1966) Genetic studies in Lupinus angustifolius. 2. Inheritance of
some morphological characters in blue lupine. Genet Pol 7:153-180
Chapter Six: Development of a marker for seed dormancy
111
Nelson MN, Phan HTT, Ellwood SR, Moolhuijzen PM, Bellgard M, Hane J,
Williams A, O’Lone CE, Fosu-Nyarko J, Scobie M, Cakir M, Jones
MGK, Bellgard M, Książkiewicz M, Wolko B, Barker SJ, Oliver RP,
Cowling WA (2006) The first gene-based map of Lupinus angustifolius L. –
location of domestication genes and conserved synteny with Medicago
truncatula. Theor Appl Genet 113:225–238
Quinlivan BJ (1966) The relationship between temperature fluctuations and the
softening of hard seeds of some legume species. Aust J Agric Res 12:1009-
1022
Quinlivan BJ (1967) Environmental variation in the long term pattern of hard seeds
of Lupinus varius. Aust J Exp Agric Anim Husb 7:263-265
Quinlivan BJ (1968) The softening of hard seeds of sand-plain lupin (Lupinus
varius L.). Aust J Agric Res 19:507-515
Raeder U, Broda P (1985) Rapid preparation of DNA from filamentous fungi. Lett
Appl Microbiol 1:17-20
Vos P, Hogers R, Bleeker M, Reijans M, Lee T, Hornes M, Frijters A, Pot J,
Peleman J, Kuiper M, Zabeau M (1995) AFLP: A new technique for DNA
fingerprinting. Nucleic Acids Res. 23:4407-4414
Yang H, Shankar M, Buirchell BJ, Sweetingham MW, Caminero C, Smith
PMC (2002) Development of molecular markers using MFLP linked to a
gene conferring resistance to Diaporthe toxica in narrow-leafed lupin
(Lupinus angustifolius L.). Theor Appl Genet 105:265-270
You M, Boersma JG, Buirchell BJ, Sweetingham MW, Siddique KHM, Yang H
(2005) A PCR-based molecular marker applicable for marker-assisted
selection for anthracnose disease resistance in lupin breeding. Cell Mol Biol
Lett 10:123-134
Chapter Seven: QTL analysis of narrow-leaf lupin
113
Chapter Seven
Identification of quantitative trait loci (QTLs) influencing
early vigour, height, flowering date and seed size and their
implications for breeding of narrow-leafed lupin (Lupinus
angustifolius L.)
Chapter Seven: QTL analysis of narrow-leaf lupin
114
7.1 INTRODUCTION Narrow-leafed lupin (Lupinus angustifolius L.) is a relatively new crop
species. In the18th and 19th centuries it was recorded as being used as a coffee
substitute and as cattle fodder (Gladstones 1970), emerging in the 20th century as a
food seed crop, primarily for stock feed (Edwards and van Barneveld 1998), but also
for human consumption (Petterson 1998). Active domestication and breeding of this
crop started soon after World War I in Germany and Poland, with an emphasis on
early vigour and maturity (Barbacki 1952, Hanelt 1960) and low alkaloids (von
Sengbusch 1930, 1931, 1938). Later efforts were aimed at developing soft-seeded
lines (Gladstones 1958; Quinlivan 1966, 1967, 1968), early flowering and, further
reductions in pod shattering (Gladstones 1967, 1977). Most of these traits were
found to be under the control of one or two major genes, and could be selected for
relatively easily upon incorporation into the domesticated crop. Today breeding of
narrow-leaf lupins is increasingly being focused on more complex traits – especially
yield, but also seed quality and resistance to pests and diseases.
In nature, many complex plant traits such as grain yield, display a large
continuous range in variation approximating a Normal curve. The continuous
variation in phenotypic expression of such traits frequently cannot be fitted to simple
Mendelian ratios and are therefore generally considered to be the product of the
interaction of a number of gene loci (Johannsen 1909, Nilson-Ehle 1909, East 1916),
commonly known as quantitative trait loci (QTLs).
Early vigour, plant height and yield are complex traits of which little are
known in lupins. The time to flowering too is controlled by more then one gene,
although one gene (Ku) was found to have the greatest impact in the Western
Australian environment (Rahman and Gladstones 1972). Farrington and Gladstones
(1974) carried out some work on yield, primarily in assessment of the effect of
recently incorporated domestication genes. There are also some reports of the effect
of the iucundis gene (for low alkaloids) on yield, dating from the late 1930’s (von
Sengbusch 1938, 1942; Hackbarth and Troll 1960, Kress 1964). Recently, Dr J.
Clements (pers. comm.) has carried out work on the early vigour of a range of
accessions from the Australian Lupin Collection, looking at early biomass
accumulation in relation to yield. But on the whole, analysis of such traits has been
Chapter Seven: QTL analysis of narrow-leaf lupin
115
ignored because of a lack of suitable technology for such an assessment and, the
expression of these genes is usually further complicated by environmental and gene x
gene or epistatic interactions (Young 1996).
The development of molecular genetic maps now allows researchers to locate
QTLs on a genetic map as first achieved by Paterson et al. (1988) and, make detailed
analysis of their inheritance and activity. Provided that the map density and the
study population are adequate, this can lead to improved prediction and selection of
superior genotypes. One computer program that provides this option is QTL
Network version 2.0 (Yang et al. 2005).
A further benefit of mapping QTLs is in exploiting synteny (conservation of
linkage). It is not uncommon for related species to have near identical coding
sequences for homologous genes (Moore et al. 1995), albeit not necessarily in
identical positions on the genome. By locating and sequencing a gene of interest it
may be possible to exploit synteny to locate that gene in a related species of interest.
Recently two molecular maps have been published for narrow-leafed lupin
(Lupinus angustifolius L), the latter one also determining regions of synteny with the
model legume species, Medicago truncatula. Genome coverage is estimated to be
80% at a moderate to high density (Chapter 2; Nelson et al. 2006). These maps
allow additional genes including QTLs to be mapped with a high degree of accuracy,
opening up possibilities for marker-assisted selection in the breeding program and
the future exploitation of any synteny discovered.
In this study, we examined the genetic basis of quantitative variation in early
plant vigour, plant height at maturity, days to flowering and seed weight. QTLs
found were positioned on the published maps and regions of micro-synteny with M.
truncatula identified.
7.2 MATERIALS AND METHODS 7.2.1 Plant materials
The marker population used in this study was an F8 recombinant inbred line
(RIL) of a domestic x wild type (DxW) cross of L. angustifolius previously
developed by the Department of Agriculture and Food Western Australia (DAFWA),
using as parents lines 83A:476 (domesticated) and P27255 (wild). The same 89
Chapter Seven: QTL analysis of narrow-leaf lupin
116
RILs that had been used in the mapping study (Chapter 2) were grown over four
years.
7.2.2 Genetic markers Several new markers were added to the map developed in Chapter 2. The
protocols and naming details of all but one are as described in that chapter. One
marker, mtmt_GEN_00024_04_1 (referred to as mtmtGEN00024041 from here on)
is of a type not previously described. Details are as follows:
The primers for marker mtmtGEN00024041 were designed using M.
truncatula databases. Primer sequences are: (mtmtGEN00024041_L:
TTGGTGATGGATGCTGTTGT; …………………………. mtmtGEN00024041_R:
CATCGTCATCTGTGTGACCC). PCR volumes were 20µl, including 25ng
template DNA, 0.25µM of each primer, 1.25 U Taq DNA polymerase, 1.5mM
MgCl2, 2µl 1x PCR buffer (Invitrogen), 0.25 µM dNTPs (Fermentas), and 2 µg BSA
(Sigma). The marker was amplified by PCR on an MJ Research PTC-200
thermocycler over 34 cycles after an initial denaturation at 95oC for 3 min, with each
cycle consisting of: 94oC for 20 s, 53.6oC for 20 s, 72oC for 2 min. The final
extension was 5 min at 72oC. PCR products were separated in a 2% agarose gel
(19.8 x 25 cm) at 120V over 4 h alongside a 100bp ladder (Fermentas No. SM0623).
They were visualised by staining with Ethidium Bromide and exposure to a U.V.
light source.
Segregation of all new markers were observed in the same RIL population as
described in the above reference and the markers placed into the map of Chapter 2
(Figure 2.1) using MapManager QTX (Manly et al. 2001).
7.2.3 Plant measurements Data was collected for two consecutive years - 2005, 2006 (winter sown) in a
screen-house and the adjacent field respectively as randomised plots, each with three
replicates. To ensure rapid germination, all hard-seeded lines were scarified prior to
sowing. In 2005, plots were arranged into three continuous rows with each plot
consisting of 3 plants in a 10cm interval. In 2006, plots were grown as individual
rows 1.5m long consisting of ~30 plants, with rows spaced at 50cm intervals. The
sowing date in 2006 was 2 calendar days later then in 2005. Plots were irrigated as
required.
Chapter Seven: QTL analysis of narrow-leaf lupin
117
Plant heights were measured to the nearest 0.5cm at 10 weeks after sowing
(early vigour) and, to the nearest 1cm at maturity just prior to senescence. Three
representative plants were measured for each plot.
The date on which the first floret was fully opened was taken as the date of
flowering for that particular plot.
Seed produced in 2005 and 2006 were not harvested. Instead, seed weights
for each RIL were determined as 100 seed weights (g) of seed produced in screen-
house plots during 2002 and 2003 under similar growing conditions.
7.2.4 Data analysis Initial data analysis carried out included a simple regression analysis giving
means and standard deviations for each trait and year. Further analysis was carried
out using the program QTL Network 2.0 (Yang et al. 2005) as detailed below.
The map depicted in Figure 2.1 was used to place the QTLs, the average
marker interval on this map being 3.2cM. Marker intervals were also identified on
the map by Nelson et al. (2006) in instances where synteny had been identified with
M. truncatula. In comparing the maps we also made use of a composite map created
by merging raw data from both original maps (Nelson et al. un-published).
Mapping data of Figure 2.1 was imported into the program QTL Network 2.0
from MapManager. Input of trait data was as 2 environments (years) and 3 replicates
(except seed weights). Seed weights based on 100 seeds per RIL were analysed
separately for 2 environments, but without replication. The significance threshold
chosen for declaring a putative QTL was at P = 0.05. Data was analysed at 1cM
intervals (‘walk speed’) with 1000 permutations. Putative QTLs were separated by a
minimum of 10cM (‘filtration window’) before a decision was made that more then 1
QTL was present in any one linkage group.
QTL Network 2.0 analyses the data as multi-factorial matrices using a Mixed
Model Composite Interval Mapping (MCIM) approach (Yang & Zhu 2005) to give
the following outputs for a RIL population:
(i) Population means and variances including Genetic (G), Environmental (E)
and GxE interaction variances.
(ii) QTL positions including range, Standard Error(s) (SE), Additive gene effect
(A), Additive x Environmental (AxE) effects and the Probability (P)-value of
each.
Chapter Seven: QTL analysis of narrow-leaf lupin
118
(iii) Epistatic gene positions and intervals including nomination of genes acted
upon.
(iv) Heritability estimates (narrow-sense)
(v) Genotype of a predicted superior offspring.
To confirm the veracity of detected epistasis’ and the predicted superior genotypes,
we conducted a further analysis on the early vigour of plants carrying the 4 possible
gene combinations of the epistatic gene pair located on LGs 17 (CQTL 3) and 23
using the ‘fit-model’ function of the JMP statistic software (SAS Institute).
7.3 RESULTS 7.3.1 Marker mtmtGEN00024041
The amplified Marker mtmtGEN00024041 product was found to segregate in
a dominant fashion, with RILs carrying the maternal allele showing a band with a
length of approximately 950bp.
7.3.2 Genetic maps QTL data was mapped to the previously developed map (Figure 2.1) and
compared to the one by Nelson et al. (2006). Eleven new markers including
mtmtGEN00024041 were added to the map of Figure 2.1 as two linkage groups (22,
23) with a combined length of 62.7cM (Figure 7.1) increasing the total map length to
1605.7cM. These two groups were found to carry QTLs for early vigour and time to
flowering (Table 7.2).
Several QTL regions were found to have both an additive and an epistatic
effect, or were active in more then one trait. We have designated such QTLs as a
‘Common QTL’ (CQTL) and numbered these from 1 – 5. In three instances it was
unclear whether the same QTL was involved or one that was closely linked to
another on the same linkage group. These were marked with an asterisk (Table 7.2).
Chapter Seven: QTL analysis of narrow-leaf lupin
119
Figure 7.1. Linkage groups 22 (L) and 23 (R) showing markers (RHS) in order and
cumulative distances (LHS) in centiMorgans.
7.3.3 Phenotypic variation of traits Table 7.1 shows parental, mean, minimum, maximum and standard deviation
of trait values over 2 years for early vigour, height at maturity, days to flowering and
seed weight. The traits measured in the present study mostly exhibit continuous
variation (Figure 7.2), indicative that they are under the influence of multiple genes,
with only days to flowering being clearly divisible into two major groups clustered
around the parental values. All traits showed transgressive segregation, indicating
that alleles with positive effects were distributed among the parents. There was no
obvious increase in early vigour over the domesticated parent, although there were
some RILs exhibiting a reduction in early vigour when compared to the wild parent.
Seed weight data were not as complete and more variable, with data for the wild
parent only available for year 1 (2002).
DAWA395.040c0.0
DAWA346.0854.0
DAWA358.17520.7DAWA151.11521.3
DAWA1094.4500.0
mtmtGEN000240415.9
DAWA729.200c22.5
DAWA252.14825.6
DAWA218.29028.1DAWA701.50030.0
DAWA103.05041.4
Chapter Seven: QTL analysis of narrow-leaf lupin
120
Figure 7.2. Character distribution for Early Vigour, Height at Maturity, Days
to Flowering and Seed Weight. Data are grouped into intervals, based on two
years results. Note: Early Vigour is measured as plant height at 10 weeks after sowing; Seed weights are
dry weights of mature, harvested seed.
Parent A = 84A:476 (domesticated)
Parent B = P27255 (wild)
Chapter Seven: QTL analysis of narrow-leaf lupin
121
Table 7.1. Phenotypic variations of the four investigated traits in the mapping population and their parents over the four growing seasons (2002, 2003, 2005, 2006)
Genotype Trial Year1
Trait E. Vigour
(cm) Mature Ht. 2
(cm) DTF 3 Seed Wt 4
(g)
Parents 84A:476 (A) 1 48.6 87.1 72 16.3 2 44.8 86.2 73 13.8 P27255 (B) 1 22.6 79.3 96 11.4 2 18.3 75.4 96 - Population Mean 1 28.7 81.0 86.2 13.1 2 25.2 83.0 85.2 12.2 Range 1 18.7-48.6 59.6-100.8 69-105 9.1-18.8 2 12.2-44.8 59.4-105.3 65-102 8.0-16.8 Standard deviation 1 6.2 9.5 10.2 2.3
2 6.7 11.2 11.3 1.7
1 Early Vigour, Height at maturity, Opening of First Floret (DTF) were measured in 2005, 2006. 2 Mature Ht = Height at Maturity 3 DTF = Days To Flowering after sowing, 4 Seed weights were determined from bulk-up plots in 2002 and 2003. 24 RILs were not included in 2002 and 9 RILs were not included in 2003. 5 RILs were missing in both years. Parent B was not grown in 2003.
7.3.4 Detection of QTLs Twenty-two QTLs were found for the four traits on 13 linkage groups
including the 2 additional linkage groups (Table 7.2, Figure 7.1).
7.3.4.1 Early vigour
Eight QTLs were found to influence the early vigour of lupins (Table 7.2,
Figure 7.3a) including two epistatic loci. All but one of the gene alleles contributing
to early vigour were from the domesticated parent. Linkage groups involved were 8,
10 (2), 13, 14, 17 (2), 18 and 23. Most of these showed no environmental
interaction, the exception being the locus on LG 8 (± 0.8cm). One locus on LG14
(CQTL 1) was also found to have an epistatic effect on a locus identified as active on
LG17 (CQTL 2) and, a second locus on LG17 (CQTL 3) was found to be epistatic on
one of the loci on LG23. The range of the locus on LG8 includes Mollis, the gene
associated with soft-seededness. The range of CQTL 2 on LG17 is closely linked to,
but does not include the Ku gene that removes the vernalisation requirement for
flowering. The two loci having the greatest effects were CQTLs 1, 2 on LGs 14, 17,
together accounting for approximately 43% of the observed phenotypic variation.
The 8 QTLs in total accounted for 61% of the variation, with 58.3% being due to
additive effects and a further 2.7% due to epistatic effects (additive x additive).
Chapter Seven: QTL analysis of narrow-leaf lupin
122
Chapter Seven: QTL analysis of narrow-leaf lupin
123
Figure 7.3a: Early Vigour
Figure 7.3c: Days to Flowering
Figure 7.3b: Height at Maturity Figure 7.3d: Seed Weight
Figure 7.3. Quantitative Trait Loci showing the locus interval, range and QTL
position as well as gene effects and epistatic interactions on and between linkage
groups (LG). Note: The upper figures denote the marker numbers without the prefix (DAWA) or
the suffix (denoting the approximate marker length). The lower figures are the marker positions (cM)
as on the Linkage map (Figure 2.1 or, as in Figure 7.1. The yellow coloured bar indicates the QTL
range and the estimated position and type of QTL is indicated by the ‘button’. Epistatic genes are
linked with a line.
Chapter Seven: QTL analysis of narrow-leaf lupin
124
7.3.4.2 Height at maturity
Four QTLs on Linkage groups 1, 4, 8 and 17 were found to influence the
height at maturity (Figure 7.3b), three with additive effects only and a fourth that had
both an additive and GxE effect. The first three loci, including one on LG17 were
contributed by the wild parent. The fourth QTL also exhibiting GxE was contributed
by the domesticated parent. The QTL on LG17 (range 11.9 – 15.0 cM) having the
greatest impact (25.7% of phenotypic variation) overlapped the corresponding one
for early vigour (CQTL 3), with the Ku gene just 2cM outside of that range. The
QTL on LG8 (range 51.9 – 67.9) was distant from the QTL for early vigour on the
same LG (range 15.2 – 19.6). The total amount of height variation that could be
explained by these QTLs was almost 40%, with 3 of the 4 QTLs conferring increased
height coming from the wild parent.
7.3.4.3 Days to flowering
Ten QTLs on 8 LGs were found to influence the time interval from sowing to
opening of the first floret (Figure 7.3c). Six loci had additive gene effects only. The
QTL on LG17 (CQTL 2) having the largest impact (A = (-)10.56 days, explaining
81% of the observed variation) also had a small but significant genotype x
environment (GxE) interaction. This locus (range 18.8 – 20.8) was positioned
adjacent to the mapped position of the gene Ku (17.0cM). Two of the additive QTLs
(LG13, 22) were also involved in epistatic interactions and a further two pairs of
QTLs were involved in separate epistasis’. The locus on LG13 is immediately
adjacent to Lentus, one of the two reduced-pod-shatter genes incorporated into
domesticated lupin at 35.5cM. In total, 88.6% of the variation in flowering could be
accounted for.
7.3.4.4 Seed weight
Two QTLs were found having an influence on seed weight. One QTL was
positioned on the gene Ku (LG17) and also had a substantial GxE interaction
component (Figure 7.3d). The positioning of this QTL is immediately adjacent to
and overlapping CQTL 2 and, 1cM downstream of CQTL 3. The second QTL on
LG9 was positioned on the gene Iucundis associated with plant alkaloid levels (von
Sengbusch 1930, Hackbarth and von Sengbusch 1934). Increased seed size was
positively correlated with the dominant allele associated with high alkaloids carried
Chapter Seven: QTL analysis of narrow-leaf lupin
125
by the wild parent. Together the 2 loci accounted for between 28 and 34% of all
variation in this trait with the QTL on LG17 having approximately twice as great an
impact as the QTL on LG9.
One QTL on LG17 (CQTL 2) was found to influence both early vigour and
time to opening of the first floret. A short segment of LG17 (CQTLs 2, 3; range 10.6
– 19.8cM) was associated with all four traits
7.3.5 Comparison to Nelson et al. (2006) and synteny with M. truncatula Several regions of synteny with M. truncatula could be identified when QTL
regions were super-imposed on the map by Nelson et al. (2006).
(i) The region on LG8 adjacent to Mollis and associated with early vigour, could
be matched to LG03 of the linkage map by Nelson et al. (2006) (Map 2),
being placed between Mollis and marker Lup111a. No syntenic region for
these markers was found in M. truncatula. The second region on LG8 (map
1) associated with height at maturity, was outside of the locus found to have
some synteny.
(ii) One of the two QTLs on LG13 corresponded to a region on LG05 of Map 2
between the Le gene and 212Len, while the second could be placed near
marker LSSR05. Neither of these 2 markers was associated with synteny in
the M. truncatula genome.
(iii) Common QTL 1 on LG14, associated with both early vigour and the opening
of the first floret, could be located on LG12 of Map 2 as corresponding to the
region of Lup251 and UWA064. Lup251 had also been mapped to a position
on pseudo-chromosome 5 of M. truncatula.
(iv) The two regions on LG17adjacent to the Ku gene could be transposed onto
LG01 of Map 2 although the marker order differed with that of map 1.
CQTL 2 (associated with three out of the four traits) appears to be aligned
with markers UWA232, Lup054 and UWA214 and includes the Ku gene.
CQTL 3, associated with both early vigour and height at maturity,
corresponded to the region of markers Lup158 and VBP1 on the far side of
the Ku gene. Both of these regions have some synteny on Medicago
truncatula pseudo-chromosome 7, albeit on three widely separated loci.
Chapter Seven: QTL analysis of narrow-leaf lupin
126
7.3.6 Superior genotype By assuming that the ideal genotype is at either one end of the phenotypic
spectrum or the other, we predicted a “superior” genotype (Table 7.2). For
maximum early vigour, only one epistatic allele was required from the wild parent.
For height at maturity to be maximised, three out of four alleles were required from
the wild parent. The earliest flowering offspring had two additional dominant alleles
from the wild parent. Seed weight was maximised by one allele for early flowering
from the domesticated parent and the other for high alkaloids from the wild parent.
An analysis of the 4 possible genotypes for early vigour of the epistatic QTL
pair CQTL 3 on LG17, and LG23 (Table 7.2), revealed (Figure 7.4) that the 10 week
height (indicative of early vigour) ranged from a mean low of 20.5cm for plants
carrying both wild type genes (BB) to a mean maximum height of 31.9cm for plants
carrying one domesticated and one wild type gene (AB). Plants having the parental
genotype (AA) were relatively shorter, having a mean height of 28.8cm and those
with the BA genotype were intermediate (although variable) to the two parental
genotypes at 24.8cm.
Figure 7.4. The effect of two epistatic genes located on LG17 and LG23 on the early
vigour of L. angustifolius. Note: The first allele in each gene combination is located on LG17 and the second on LG 23, with ‘A’
representing the allele originating from the domesticated parent and ‘B’ that from the wild parent.
Chapter Seven: QTL analysis of narrow-leaf lupin
127
7.4 DISCUSSION Lupinus angustifolius is still a relatively new crop and knowledge about
relationships between various traits and crop production is limited. It is generally
accepted that in Western Australia early flowering to avoid heat induced abortion
during flowering and drought stress at grain filling are desirable to maximise grain
yield and size. The present study investigated in two trials, some of traits thought to
be of importance in grain production and harvesting in a Mediterranean environment.
A number of observations were made, relating seed size as well as early
vigour to regions near the Ku gene on LG17. We have observed that there is linkage
between Ku and early vigour (CQTL 2). However, the role of this QTL in promoting
early vigour is not so pronounced. This could be explained by the presence of
several further QTLs with effects of similar magnitude (LGs 8, 10, 13, 14, 18) and,
the negative effect on early vigour of a second, epistatic locus on LG17 (CQTL 3)
not far away from CQTL 2. The linkage to a region adjacent to Mollis (LG 8) was
surprising in that seed of all hard-seeded RILs had been scarified to ensure rapid
imbibition and germination upon sowing. Consequently, no specific measurements
had been taken of emergence dates and casual observations at the time did not reveal
any obvious differences.
The first QTL for early vigour on LG17 (CQTL 2) was also found to have a
large, significant effect on days to flowering (DTF). From previous work
(Gladstones 1970, Gladstones and Hill 1969) we know that Ku is the only gene to
have a very large effect (2 – 5 weeks) on the reduction in DTF of narrow-leaf lupins.
It therefore appears appropriate that it should have been included in this locus as
occurs on Map 2 (Nelson et al. 2006) and may indicate that some revision of the map
order in this region (Map 1 – Figure 2.1) can be expected at a future date as more
suitable markers are generated.
Other QTL genes influencing DTF cumulatively have almost as great an
effect (A, AxA) on flowering date as Ku in this experiment (Table 7.2), although the
heritability of 4 of the 8 is low. In this particular population, DTF in two RIL lines
was advanced by just 3 days in 2006 from 73 days (domesticated parent) after
sowing (DAS) to 70 days by inclusion of two QTLs from the wild parent. Current
Australian cultivars have DTF (measured at 50% of first florets open) similar to this.
Chapter Seven: QTL analysis of narrow-leaf lupin
128
For example, Mandelup the earliest flowering cultivar has an approximate DTF of 68
days (B. Buirchell, pers. comm.).
Four QTLs having additive effects on mature plant heights were found. Lack
of rainfall can drastically reduce the plant height at maturity in a crop, while high
rainfall situations can lead to excessive vegetative growth and lodging. Both extreme
situations can make harvest difficult or even impossible. The gene combination of
the domesticated parent tending to reduce plant height (height QTL on LG1) would
therefore be suited to a relatively high rainfall area (e.g. 400mm p.a.), with a further
reduction in height potentially available under very high rainfall (> 450mm p.a.)
conditions. In a low rainfall situation there is the opportunity to breed for increased
height using the QTLs identified on LG’s 4 and 8. The QTL on LG17 (CQTL 3)
having by far the greatest (reducing) effect on height is in the vicinity of the Ku gene
and may be involved in promoting both early vigour and early flowering. It will be
necessary to further clarify the positions of Ku and both QTLs before their usefulness
in the manipulation of plant heights can be determined.
Early flowering and pod-set allows for a longer period of seed production –
both in the extension of the flowering period and seed growth and may result in a
significant increase in seed size as found by Farrington and Gladstones (1974). It is
therefore to be expected that a QTL with close linkage to Ku was found to have a
positive influence on seed size. The second QTL associated with development of
larger seeds centred on the gene Iucundis. The recessive form of this gene, one of
several known to limit development of alkaloids in L. angustifolius (Hackbarth and
von Sengbusch 1934, Gladstones 1970), has been incorporated into all modern
Australian cultivars and is here associated with a smaller seed size. This analysis
lends weight to the suggestion by some researchers that this gene causes a reduction
in yield (von Sengbusch 1938, 1942; Hackbarth and Troll 1960, Kress 1964, Oram
1983). However, these two QTLs only explain 30% of the observed variation in seed
size, probably indicative of insufficient replication in this particular trial and, of
further QTLs having a significant effect. For example, in cereals, a large number of
QTL have been reported to be involved in yield components such as ears per plant,
grain weight and number per ear (Börner et al. 2002, Huang et al. 2003, Quarrie et
al. 2005). There is some evidence that seeds per pod may also be an important
component of yield in lupins (B. Wolko et al., pers. comm.) and, it seems likely that
this would have a (negative) correlation with seed size.
Chapter Seven: QTL analysis of narrow-leaf lupin
129
The number of QTLs found here for each trait are in all probability only a
subset of the total number of controlling genes as not all environments will reveal
their presence (Tanksley 1993, Young 1996). It is also possible that in this particular
cross both parents carry the same set of alleles for a particular QTL. For instance,
lines have been found exhibiting far greater early vigour then demonstrated in this
population (J. Clements, pers. comm.) and, in the Australian Lupin Collection are
many lines (of L. angustifolius) that produce very small seeds. There are also a small
number of lines tending to produce seed larger then those produced by this particular
population. To locate all of the genes involved in these traits may require
substantially more and larger populations to be generated and grown over a number
of sites and years.
It was found that several lupin QTL regions corresponded to regions of
synteny on the M. truncatula pseudo-chromosome. Of particular interest are the
QTLs associated with early vigour and days to flowering. These two traits are
important to many crops including pasture legumes in dry Mediterranean
environments. The identification of syntenic regions on the M. truncatula genome
may thus lead to improved selection of superior lines by developing the appropriate
molecular markers into forms useful across one or more related species.
The prediction of a superior genotype is an important part of plant breeding
and the selection of parents has in the past frequently been on the basis of
observations of superior performance in the field without fully understanding its
genetic basis. For example, it had long been known that in China the F1 hybrid rice
‘Shanyou 63’ was superior to both parents. A careful QTL analysis of that particular
cross using the program QTL Network 1.0, revealed the basis for the superiority of
the F1 and, that there was still the potential to further increase yield gains from the
same parental combination (Yang and Zhu 2005). The outcome of our study
confirms that in this particular parental combination it is possible to select
individuals having a higher early vigour, demonstrating the potential to improve
narrow-leaf lupins by using a similar approach. Consequently, in Table 7.2 we
inserted a column titled ‘Superior genotype’ under which we have predicted plants
genotypes that are expected to lead to superior trait expressions as based on this
experiment. However as noted earlier, the optimum for a particular trait such as
height at maturity may in fact be somewhere between the two extremes in which case
the predicted superior genotypes ought to be re-assessed.
Chapter Seven: QTL analysis of narrow-leaf lupin
130
Low gene heritability is a common problem in breeding. In this study, some
of the least heritable QTLs were involved in either a GxE interaction or epistasis
(Table 7.2, Figure 7.4). By developing molecular markers closely linked to these
QTLs it may be possible to more efficiently select plants having the desirable alleles,
leading to enhanced rates of genetic improvement. The need for close linkage is
high-lighted in Figure 7.4 where especially the data for plants putatively of the BA
genotype showed a large range in height well beyond that found within the other
gene combinations, suggesting that cross-overs may have occurred between the QTL
gene and the nearest associated marker. The traits (for increased) early vigour,
height at maturity and especially (a reduction in the) days to flowering would benefit
from this approach as all three have several QTLs with substantial impact but of very
low heritability.
In conclusion, this work has shown that the currently available genetic maps
of narrow-leaf lupin have opened the door of opportunity to a careful analysis of
yield component (and other) traits with a view to improved selection of parental
genotypes and accelerated breeding gains. However, the current marker population
needs to be expanded to allow for fine mapping of certain traits. This is especially
important in the region of the Ku gene where there is still confusion over the true
order of the markers and consequently, the number of QTLs controlling the key traits
of early vigour, days to flowering and seed size.
Acknowledgements
I wish to acknowledge the help of Mr D. Renshaw in seed preparation, sowing and
plant observations. Also, Dr M. Nelson for inclusion of data from collaborative
work with myself on a combined genetic map. Marker mtmtGEN00024041 was
developed as part of the Sixth European Framework Programme “New strategies to
improve grain legumes for food and feed”.
Chapter Seven: QTL analysis of narrow-leaf lupin
131
7.5 REFERENCES Barbacki S (1952) Lupins. Warsaw.
Börner A, Schumann E, Fürste A, Cöster H, Leithold B, Röder M, Weber W
(2002) Mapping of quantitative trait loci determining agronomic important
characters in hexaploid wheat (Triticum aestivum L.). Theor Appl Genet
105:921-936
East EM (1916) Studies on size inheritance in Nicotiana. Genetics 1:164-176
Edwards AC, van Barneveld RJ (1998) Lupins for livestock and fish. In ‘Lupins as
crop plants: biology, production and utilisation’. (Eds JS Gladstones, C
Atkins, J Hamblin) pp 385-411. (CAB International, London)
Farrington P, Gladstones JS (1974) Effect of genotype on yield of narrow-leafed
lupin (Lupinus angustifolius) and sandplain lupin (Lupinus cosentinii). Aust J
Exp Agric Anim Husb 14:742-748
Gladstones JS (1958) The influence of Temperature and humidity in storage on seed
viability and hard-seededness in the West Australian blue lupin, Lupinus
Digitatus Forsk. Aust J AgricRes 9:171-181
Gladstones JS (1960) Lupin cultivation and breeding. J Aust Inst Agric Sci 26:19-25
Gladstones JS (1967) Selection for economic characters in Lupinus angustifolius
and L. digitatus 1. Non-shattering pods. Aust J Exp Agric Anim Husb 7:360-
366
Gladstones JS (1970) Lupins as crop plants. Fld Crop Abstr 23:123-148
Gladstones JS (1977) The narrow-leafed lupin in Western Australia (Lupinus
angustifolius L.). Western Australian Department of Agriculture Bulletin
3990
Gladstones JS, Hill GD (1969) Selection for economic characters in Lupinus
angustifolius and L. digitatus. 2. Time of flowering. Aust J Exp Agric Anim
Husb 9:213-220
Hackbarth J, Sengbusch von R (1934) The inheritance of alkaloid freedom in
Lupinus luteus and Lupinus angustifolius. Züchter 6:249-255 [in German].
Hackbarth J, Troll HJ (1960) Cultivation and use of sweet lupins. pp 115.
(Frankfurt on Main: DLG-Verlag)
Hanelt P (1960) The lupins 104 pp. (A Ziemson, Wittenberg) [in German]
Chapter Seven: QTL analysis of narrow-leaf lupin
132
Huang XQ, Cöster H, Ganal MW, Röder M (2003) Advanced backcross QTL
analysis for the identification of quantitative trait alleles from wild relatives
of wheat (Triticum aestivum L.). Theor Appl Genet 106:1379-1389
Johannsen W (1909) Elemente der exakten Erblichkeitsliehre. (Fisher, Jena)
Kress H (1964) On the position and perspective of lupin breeding in the D.D.R.
Wiss Z Karl-Marx-Univ Lpz 13:638 [in German]
Mazur B, Krebber E, Tingey S (1999) Gene discovery and product development
for grain quality traits. Science 285:372-375
Manly KF, Cudmore Jr RH, Meer JM (2001) MapManager QTX, cross-platform
software for genetic mapping. Mammalian Gen 12:930-932
Moore G, deVos KM, Wang Z, Gale MD (1995) Cereal genome evolution –
grasses, line up and form a circle. Curr Biol 5:737-739
Nelson MN, Phan HTT, Ellwood SR, Moolhuijzen PM, Bellgard M, Hane J,
Williams A, O’Lone CE, Fosu-Nyarko J, Scobie M, Cakir M, Jones
MGK, Książkiewicz M, Wolko B, Barker SJ, Oliver RP, Cowling WA
(2006) The first gene-based map of Lupinus angustifolius L. – location of
domestication genes and conserved synteny with Medicago truncatula. Theor
Appl Genet 113:225–238
Nilsson-Ehle H (1909) Kreuzunguntersuchungen an Hafer und Weizen. (Lund).
Oram RN (1983) Selection for higher seed yield in the presence of the deleterious
low alkaloid allele iucundis in Lupinus angustifolius L. Fld Crop Res 7:169-
180
Paterson AH, Lander ES, Hewitt JD, Peterson S, Lincoln SE, Tanksley SD
(1988) Resolution of quantitative traits into Mendelian factors, using a
complete linkage map of restriction fragment length polymorphisms. Nature
335:721-726
Petterson DS (1998) Composition and food uses of lupins. In ‘Lupins as crop plants:
biology, production and utilisation’. (Eds JS Gladstones, C Atkins, J
Hamblin) pp 353-384. (CAB International, London)
Quarrie SA, Steed A, Calestani C, Semikhodskii A, Lebreton C, Chinoy C,
Steele N, Pljevljakusić D, Waterman E, Wegen J, Schondelmaier J,
Habash DZ, Farmer P, Saker L, Clarkson DT, Abugalieva A,
Yessimbekova M, Turuspekov T, Abugalieva S, Tuberosa R, Sanguinet
M-C, Hollington PA, Aragués R, Royo A, Dodig D (2005) A high-density
Chapter Seven: QTL analysis of narrow-leaf lupin
133
genetic map of hexaploid wheat (Triticum aestivum L) from the cross Chinese
Spring x SQ1 and its use to compare QTLs for grain yield across a range of
environments. Theor Appl Genet 110:865-880
Quinlivan BJ (1966) The relationship between temperature fluctuations and the
softening of hard seeds of some legume species. Aust J Agric Res 12:1009-
1022
Quinlivan BJ (1967) Environmental variation in the long term pattern of hard seeds
of Lupinus varius. Aust J Exp Agric Anim Husb 7:263-265
Quinlivan BJ (1968) The softening of hard seeds of sand-plain lupin (Lupinus
varius L.). Aust J Agric Res 19:507-515
Rahman MS, Gladstones JS (1972) Control of lupin flower initiation by
vernalization photoperiod and temperature under controlled environment.
Aust J Exp Agric Anim Husb 12:638-645
Sengbusch von R (1930) Lupins low in bitter substances. Züchter 2:1-2
Sengbusch von R (1931) Low alkaloid lupins 2. Züchter 3:93-109
Sengbusch von R (1938) The breeding of sweet lupins. Herbage Rev 6:64
Sengbusch von R (1942) Sweet lupins and oil lupins: The history of the origin of
some new crop plants. Landw Jbr 91:719 [in German]
Tanksley SD (1993) Mapping polygenes. Ann Rev Genet 27:205-233
Yang J, Zhu J (2005) Methods for predicting superior genotypes under multiple
environments based on QTL effects. Theor Appl Genet 110:1268-1274
Yang J, Hu CC, Ye XZ, Zhu J (2005) QTL Network 2.0. Institute of
Bioinformatics, Zhejiang University, Hangzhou, China.
(http://ibi.zju.edu.en/software/qtlnetwork)
Young ND (1996) QTL mapping and quantitative disease resistance in plants. Ann
Rev Phytopathol 34:479-501
Chapter Eight: General discussion and future directions
135
Chapter Eight
General discussion and future directions
Chapter Eight: General discussion and future directions
136
8.1 INTRODUCTION The narrow-leaf lupin (Lupinus angustifolius L.) has a relatively short history
of domestication (Chapter 1.2 – The Domestication genes). A number of major
genes known as the ‘domestication genes’ have been incorporated into the species
over the last 90 years. These genes have helped improve the seed quality, adaptation
to large scale cropping and to the Western Australian Mediterranean climate and,
allow bulk mechanical harvesting, (von Sengbusch 1931, Hackbarth and Troll 1956,
Mikolajczyk 1966, Gladstones 1967, Gladstones and Hill 1969). This has helped
lupins to become a major field crop especially in Western Australia.
8.2 LUPIN BREEDING In breeding, the selection of any desirable trait – be it in a plant or animal is
dependent on the use of a linked marker – be it a visible morphological trait or a
molecular genetic factor. The reality is that frequently, physical traits are complex
and therefore are poor indicators of genotype.
The domestication genes of narrow-leaf lupins are mostly recessive in nature
and, are not always easily phenotyped (e.g. the reduced-shatter gene tardus;
Gladstones 1967). Consequently, following domestication, very few wild genotypes
have been used as parents over the years (see Figure 8.1), resulting in a narrow gene
pool with limited scope for improvement. To widen this gene pool it is necessary to
introduce new wild material (of which large collections exist in Western Australia
and elsewhere) and, at the same time retain the domestication genes. This may best
be achieved if there are the means to readily tag these genes – either by physical or
by genetic markers. Ideally, all of these genes should be identified at the earliest
opportunity in the breeding cycle – the seedling F2. Molecular markers create almost
limitless opportunity to do so.
Figure 8.1. Pedigree relationships among the main narrow-leafed lupin cultivars released in Australia 1967-2006. Circles indicate key single crosses; diamonds represent complex crosses. Bold lines indicate crosses involving Australian cultivars. Domestication genes: moll (soft seeds), iuc (sweet), ta (non-shattering), le (non-shattering), leuc (white flowers and seeds), Ku (early flowering). All cultivars released after Unicrop (1973) in this diagram have these genes apart from Marri (lacks Ku) and Chittick (efl rather than Ku). Abbreviations: Gls-R (grey leaf spot resistant), An-R (anthracnose resistant), Ph-R (phomopsis resistant), Bs-MR (brown spot moderately resistant), MRB (moderately restricted branching), Pop. E1.1 (population E1 – first cycle of recurrent selection) (adapted by BJ Buirchell, JG Boersma from Cowling, 1999)
New Zealand Blue moll
Borre (Sweden 1947) moll, iuc
Danja 1986
Marri 1976
Yandee 1980Illyarrie 1979
Warrah 1989 Ph-R
Yorrel 1989 Ph-R
Merrit 1991 Ph-R
Gungurru 1988Ph-R
Unicrop 1973moll,ta,le,iuc,leuc,Ku
Uniharvest 1971moll,ta,le,iuc,leuc
Uniwhite 1967moll,ta,iuc,leuc
Wild type fromIsrael
Wild types from Italy
Wild types from Spain, Morocco
79A078-14-10 (high yield)
[Pop. E2.1]
[Pop. E1.1]
84A086 F1
CE2-1-1 (high yield)
naturalmutant: leuc natural
mutant: ta
naturalmutant: Ku
natural mutant: le
P20661 mutant: efl)
Rancher (USA 1965) Gls-R, An-R
Fest 1973 moll,ta,le
Belara 1997 Ph-R
Kalya 1996 Ph-R, An-MR Tallerack 1997
Bs-MR, MRB
Myallie 1995 Bs-MR
Chittick 1982 efl
65G-251 USA frost-tolerant
[Pop. E1.2]Wonga 1996
An-R, Ph-R
Sweet mutant ex Germany 1928: iuc
Moonah 1998 Ph-R
Tanjil 1998 An-R, Ph-R
Landrace with soft seeds: moll
Quilinock 1999 Ph-R
75A54-5-8
84A086-73-10
Coromup 2006
Mandelup 2004 Ph-R, AnMR
84A086-12-17
Chapter Eight: General discussion and future directions
138
8.3 MARKER DEVELOPMENT AND MARKER ASSISTED
SELECTION Molecular markers that are tightly linked to desirable genes are becoming
increasingly important in many areas of genetic analysis including plant breeding.
There are many examples for both major genes and minor genes (QTLs) including:
resistance to powdery mildew of wheat (Hartl et al. 1993, Ma et al. 1994), leaf rust
of barley (Borovkova et al. 1997), resistance to the soybean cyst nematode (e.g.
Chang et al. 1997, Concibido et al. 1994, 1996, 1997) and, resistance to late blight of
potato (Leonards-Schippers et al. 1994).
The development of molecular markers to the domestication genes of lupins
was a logical development when considering the difficulty in phenotyping plants for
genes such as tardus, and the need to wait until after harvest to identify plants with
the soft seeds allele of mollis. Ku, being a dominant gene is also awkward, requiring
a third generation to be grown to determine which F2 plants are homozygous for the
Ku allele.
In this thesis I report the development of molecular markers for: Ku (early
flowering), lentus, tardus (reduced pod shatter) and mollis (soft seeds). A marker for
iucundis was also developed but found to be unsatisfactory when tested on both
cultivars and wild accessions, hence it is not reported. Two types of MFLP markers
were converted into PCR-based forms: (i) a fragment size polymorphism type and
(ii) a single nucleotide polymorphism (SNP) type. Both marker types are amenable
to high-throughput, low-cost MAS methods.
The relative ease with which these mapped markers could be converted to
forms useful for MAS means that potentially there are many more desirable genes to
which we already have molecular markers that may be readily converted for MAS
once the association between gene(s) and markers have been established.
Testing of molecular markers associated with the domestication traits in
lupins has highlighted the molecular diversity of this species and the need for
extremely close linkage between the gene and nearest marker(s). In this study it was
shown that markers commonly be considered to be closely linked to a gene at less
then 3cM may not be close enough for all breeding purposes when introgressing wild
material into the domesticated gene pool. Thus, the finding that markers as close as
Chapter Eight: General discussion and future directions
139
2.8cM from the gene tardus (Chapter 6), were correct less then 50% of the time in
identifying plants carrying the alleles for reduced pod-shatter. Similarly for the two
markers associated the with the gene lentus (Chapter 5). Even the marker developed
for mollis (Chapter 4) was applicable only to the narrow-leaf lupin, despite its
apparent perfect linkage and the belief that the mechanism for developing soft-
seededness is the same across the lupin species (Gladstones 1958; Quinlivan 1966,
1968; Arrieta et al. 1994).
The development of such highly specific PCR-based markers for the
domestication genes is however considered a major improvement for the agronomy
of the crop. Over the past 4 years, the Department of Agriculture and Food, WA
(DAFWA) has used molecular markers similar to those developed here, to screen
progeny of advanced breeding lines for the (rapid) incorporation of resistance to
especially anthracnose of lupins, but also phomopsis (both single major genes). Last
year approximately 20,000 plants were screened for one or both resistance genes,
multi-loading sequencing gels (a technique that I developed , Unpublished) so that on
average 642, and as many as 960 plants, could be tested in one gel run.
DAFWA intends to use the newly developed marker for tardus this season
(June / July 2007) to screen potential wild parents for their amenability to selection
procedures using this marker. Although only about 45% of wild accessions are
expected to be to screenable by the marker, this number may still make available as
many as 600 (out of a total of 1349 wild and landrace accessions in the Perth
collection) potential parents for crosses in which phenotyping of progeny will be
largely unnecessary. This will result in considerable savings in cost, with time and
space and, the need for experienced personnel to do the phenotyping being greatly
reduced.
The need to pre-screen potential parents to ensure the marker is valid,
highlights the desirability of developing ‘perfect’ markers to these genes (Ellis et al.
2002). This may be achieved by using the markers now developed as probes on a
Bacterial Artificial Chromosome (BAC) library (or similar) to walk the chromosome
to the gene, tracing the intervening genetic sequence via over-lap of the various
BACs. A BAC library has recently been developed for this species (Kasprzak et al.
2006) so that this option is now feasible. Currently work is under way in Poland to
find a better marker for the first known major resistance gene to anthracnose of
lupins (Yang et al. 2004, You et al. 2005) using this library (H. Yang, pers. comm.).
Chapter Eight: General discussion and future directions
140
8.4 MOLECULAR MARKERS AND MAPPING Research covered in this thesis includes the first comprehensive molecular
genetic map of lupins (Chapter 2). The map is estimated to cover at least 80% of the
genome at an average marker density of 1 marker every 3.2cM. This density makes
it probable that many genes of interest may be located with accuracy and, if the
flanking markers are converted into a useful form, ensures a high degree of precision
in following the gene pathway through successive plant generations. This map is
also the only one known to have used MFLP markers in its construction. At present
there also appears to be no published work on the use of MFLP markers in crops
other then lupins, although a small number of scientists have visited the developer of
this technique to learn the procedure (H. Yang, pers. comm.).
Using MFLP markers instead of AFLPs to construct a linkage map has been
shown to be of advantage. Unlike AFLPs, many MFLP polymorphisms (frequently
carrying a micro-satellite motif and co-dominant) can be converted into simple PCR
based markers desirable for routine marker implementation in MAS (Yang et al.
2001, 2002, 2004) with an ease comparable to that of microsatellites (SSRs).
However, MFLPs are similar to AFLPs in that neither requires the development of
specific primer pairs before they can be used for mapping purposes, as do SSRs (e.g.
Röder et al. 1998). This feature of MFLPs therefore allows the rapid generation of
markers for mapping purposes and, when found to co-segregate with genes of
interest, may in many instances be readily converted into sequence-specific PCR-
friendly markers. These findings have been reinforced in this thesis with a
successful conversion of almost all markers (to the domestication genes) attempted,
into a sequence-specific, PCR-friendly form, useful for implementation (MAS) in a
breeding program.
8.5 QUANTITATIVE TRAIT LOCI AND THEIR ANALYSIS MFLP markers, when generated in large numbers and arranged into a genetic map
also open up opportunities for identification of further genes of interest – especially
minor genes (QTLs) that in combination with others have a major effect on such
complex traits as yield and disease resistance. The work in this thesis is the first
reported to map QTLs controlling the flowering, plant height and seed weight of
Chapter Eight: General discussion and future directions
141
lupins. There are supporting evidence in the literature for some of these QTLs. In the
first instance, the effect of the gene iucundis on yield e.g. von Sengbusch 1938,
1942). One of the components of yield is seed size. In cereals, a longer period of
grain filling is known to promote large grains (Blacklow and Incoll 1981, Nicolas et
al. 1985, Borrell et al. 1989). A larger seed size is one outcome of the early
flowering promoted by the Ku gene of lupins. However, because the lupin is
indeterminate in its growth habit, this effect is greatly reduced and the rate of seed
filling is at least as important in determining seed size (Palta et al. 2001).
In the second instance, it has long been recognised that there are multiple genes
influencing flowering time, although none of them has as great an effect as does Ku
(Gladstones 1970, Gladstones and Hill 1969).
There is a possibility that the determination of (further) QTL gene positions
and values can be improved by increasing the size of the mapping population. Some
researchers (e.g. Lande and Thompson 1990, Zhang and Smith 1992, 1993;
Gimelfarb and Lande 1994, 1995) have recommended a population size in excess of
200 sibs when conducting QTL studies. These recommendations are on the basis of
older QTL mapping programs using linear programming methods rather then the
matrix method used here, although the impact of using this new method on numbers
required is unclear. There is some anecdotal evidence that more QTLs may be found
in a larger population. In the process of phenotyping for the tardus gene, it was
observed that there was still some variation in shattering that could not be explained
by the two genes lentus and tardus alone, suggesting the involvement of at least one
more gene (Discussion section, Chapter 6). An attempt to find this gene by means of
a QTL analysis (data not presented) failed – possibly as a consequence of the limited
population size.
It was not possible to greatly increase the number of sibs included in this
study for 2 reasons: (i) The full population for this cross is only 115 RILs, (ii) The
map on which the QTL study is centred consists of just 89 RILs. To extend the study
to the full population would have required genotyping the RILs not already included
on a framework skeleton of the map before they could be included in the analysis.
This was beyond the scope of this research project, and the improvement in outcome
is uncertain.
Chapter Eight: General discussion and future directions
142
8.6 SYNTENY The benefits of finding the sequence of a particular gene may potentially be
extended to other legume plant species on the basis of synteny. As already
mentioned in the Review of Literature (Chapter 1.6), researchers working on the
‘model’ plant species for legumes, Medicago truncatula, have also discovered
several regions of micro-synteny with narrow-leaf lupins (Nelson et al. 2006).
Synteny may be exploited in plant breeding by hunting for genes using known
sequences from other species to refine the search. For example, until now how there
has been no success in locating the genes controlling flowering in legume species
(M. Nelson, pers. comm.). By walking the lupin chromosome via the BACs and
finding the lupin gene Ku that promotes early flowering (by removal of vernalisation
requirements), it may be possible to find a comparable sequence having the same
function in the model and other legume species including important crops such as
soybean. Success in locating such a gene may aid in breeding plants suited to a
range of environments, on the basis of manipulated vernalisation requirements.
At the same time, by analysing the gene sequence and associated biochemical
pathways, a better understanding may be developed of the biological mechanisms
controlling the pathways to flowering for a range of plant species. One example of
such an analysis is that of Fridman et al. (2000) who examined the factors controlling
sweetness of tomatoes. By discovering an important gene controlling the sweetness
in tomatoes, they have opened the window of opportunity to exploit this gene by
selectively cross-breeding or even genetically modifying another plant species by
introducing this gene by either an inter-specific cross or directly by Genetic
Modification (Zamir 2001).
8.7 FUTURE DIRECTIONS The development of markers to the domestication genes of lupins, especially
that for tardus, has opened a window of opportunity to dramatically increase the
level of incorporation of wild material into the gene pool of cultivated narrow-leafed
lupin. This development has the potential to result in greater rates of gain in grain
yield and quality as new gene combinations, including quantitative genes, are
introduced.
Chapter Eight: General discussion and future directions
143
Further work on mapping, including QTL mapping in lupins looking at other
yield components would be beneficial in the long term. However, the current marker
population appears to either be too small or exhibit linkage disequilibrium (see
Literature Review – genetic mapping), as demonstrated by the (partial) failure of
apparently closely linked markers (to the genes iuc, le, ta) to reliably detect that wild
accessions were not carrying the domesticated gene allele. This phenomenon is not
unknown. Problems of a similar nature are well known in cereal breeding, it being
considered normal to validate the applicability of a marker to potential parents before
using it for screening (e.g. Sharp et al. 2001).
It may be of long-term benefit to create a new mapping / marker population.
This population should be developed using not only the current parents but also at
least one elite cultivar and one or more wild accessions (Mackay and Powell 2006) to
create a highly heterogeneous population segregating for major genes such as the
Phomopsis resistance genes and QTL traits of interest; displaying for example, early
vigour similar to the best discovered to date, but also retaining lines displaying very
low vigour. Retaining the parents of the current population would be an advantage in
that it increases the probability of being able to continue using (and improvement of)
the now (two) existing linkage maps for this species. It seems advisable that the
generation of new markers in such an instance be by means of MFLP, or a
comparable technique that allows markers to be easily converted for MAS as the
need arises, rather then by means of AFLPs, RAPDs or similar.
It is envisaged that the fine mapping of this species will yield markers and
gene information that will be cross-transferable to other legume species and, that
gene information may also flow in the reverse direction as the maps become more
defined.
Continued QTL analysis and gene mapping of the narrow-leaf lupin will
ultimately result in an understanding of the lupin genome comparable to that of
cereals. Using markers such as those developed using MFLPs gives breeders the
ability to rapidly incorporate and test for new genes in breeding lines, thus also
dramatically reducing the time and effort required to produce superior genotypes by
conventional breeding methods.
Chapter Eight: General discussion and future directions
144
8.8 REFERENCES Arrieta V, Besga G, Cordero S (1994) Seed coat permeability and its inheritance in
a forage lupin (lupinus hispanicus). Euphytica 75:173-177
Blacklow WM, Incoll LD (1981) Nitrogen stress of winter wheat changed the
determinants of yield and the distribution of nitrogen and total dry matter
during grain filling. Aust J Plant Physiol 8:191-200
Borovkova JG, Jin Y, Steffenson B, Kilian A, Blake TK, Kleinhofs A (1997)
Identification and mapping of a leaf resistance gene in barley line Q21861.
Genome 40:236-241
Borrell AK, Incoll LD, Simpson RJ, Dalling MJ (1989) Partitioning of dry matter
and the deposition and use of stem reserves in a semi-dwarf wheat crop. Ann
Bot (Lond) 63:527-539
Chang SJC, Doubler TW, Kilo VY, Abu-Thredeih J, Prabhu R, Freire V,
Suttner R, Klein J, Schmidt ME, Gibson PT, Lightfoot DA (1997)
Association of loci underlying field resistance to soybean sudden-death
syndrome (SDS) and cyst nematode (SCN) race 3. Crop Sci 37:965-971
Concibido VC, Denny RL, Boutin SR, Hautea R, Orf JH, Young ND (1994)
DNA marker analysis of loci underlying resistance to soybean cyst nematode
(Heterodera glycines Ichinohe). Crop Sci 34:240-246
Concibido VC, Denny RL, Lange DA, Orf JH, Young ND (1996) RFLP mapping
and MAS of soybean cyst nematode resistance in PI 209332. Crop Sci
36:1643-1650
Concibido VC, Lange DA, Denny RL, Orf JH, Young ND (1997) Genome
mapping of SCN resistance genes in Peking, PI 90763, PI 88788 using DNA
markers. Crop Sci 37:258-264
Cowling (1999) Pedigrees and characteristics of narrow-leafed lupin cultivars
released in Australia from 1967 to 1998. Agriculture Western Australia,
Bulletin 4365 pp 5
Ellis MH, Spielmeyer W, Gale KR, Rebetzke GJ, Richards RA (2002) “Perfect”
markers for the Rht-B1b and Rht-D1b dwarfing genes in wheat. Theor Appl
Genet 105:1038 – 1042
Chapter Eight: General discussion and future directions
145
Fridman E, Pleban T, Zamir D (2000) A recombination hotspot delimits a wild-
species qualitative trait locus for tomato sugar content to 484 bp within an
invertase gene. Proc Natl Acad Sci. USA 97:4718 – 4723
Gimelfarb A, Lande R (1994) Simulation of marker-assisted selection in hybrid
populations. Genetical Res 63:39-47
Gimelfarb A, Lande R (1995) marker-assisted selection and marker-QTL
associations in hybrid populations. Theor Appl Genet 91:522-528
Gladstones JS (1958) The influence of temperature and humidity in storage on seed
viability and hardseededness in West Australian blue lupin (Lupinus digitatus
Forsk.). Aust J Agric Res 9:171-181
Gladstones JS (1967) Selection for economic characters in Lupinus angustifolius
and L. digitatus. 1. Non-shattering pods. Aust J Exp Agric and Anim Husb
7:360 – 366
Gladstones JS, Hill GD (1969) Selection for economic characters in Lupinus
angustifolius and L. digitatus. 2. Time of flowering. Aust J Exp Agric Anim
Husb 9: 213-220
Hackbarth J, Troll H-J (1956) [Lupins as grain legumes and fodder plants.]. In:
Kappert H and Rudorf W (eds) [Handbook of Plant Breeding, Part IV], 2nd
edn. Verlag Paul Parey, Berlin and Hamburg. pp.1-51 (in German)
Hartl L, Weiss H, Zeller FJ, Jahoor A (1993) Use of RFLP markers for the
identification of alleles of the Pm3 locus conferring powdery mildew
resistance in wheat (Triticum aestivum L.). Theor Appl Genet 86:959-963
Kasprzak A, Šafář J, Janda J, Doležel J, Wolko B, Naganowska B (2006) The
bacterial artificial chromosome (BAC) library of the narrow-leafed lupin
(Lupinus angustifolius L.). Cell Mol Biol Lett 11:396-407
Lande R, Thompson R (1990) Efficiency of marker-assisted selection in the
improvement of quantitative traits. Genetics 124:743-756
Leonards-Schippers C, Gieffers W, Schafer-Pregl R, Ritter E, Knapp SJ (1994)
Quantitative resistance to Phtophthora infestans in potato, a case study for
mapping in an allogamous plant species. Genetics 137:67-77
Ma ZQ, Sorrels ME, Tanksley SD (1994) RFLP markers linked to powdery
mildew resistance genes Pm1, Pm2, Pm3 and Pm4 in wheat. Genome 39:830-
835
Chapter Eight: General discussion and future directions
146
Mackay I, Powell W (2007) Methods for linkage disequilibrium mapping in crops.
Trends Plant Sci 12(2):57-63
Mikolajczyk J (1966) Genetic studies in Lupinus angustifolius. 2. Inheritance of
some morphological characters in blue lupine. Genet Pol 7:153-180
Nelson, MN, Phan HTT, Ellwood SR, Moolhuijzen PM, Bellgard M, Hane J,
Williams A, O’Lone CE, Fosu-Nyarko J, Scobie M, Cakir M, Jones
MGK, Bellgard M, Książkiewicz M, Wolko B, Barker SJ, Oliver RP,
Cowling WA (2006) The first gene-based map of Lupinus angustifolius L. –
location of domestication genes and conserved synteny with Medicago
truncatula. Theor Appl Genet 113:225-238
Nicolas ME, Lambers H, Simpson RJ, Dalling MJ (1985) Effect of drought on
metabolism and partitioning of carbon in two wheat varieties differing in
drought-tolerance. Ann Bot (Lond) 55:727-742
Palta JA, Turner NL, French RJ, Buirchell B (2001) Terminal drought and seed
yield of lupin. (visited June 19, 2007)
http://www.regional.org.au/asa/2001/1/b/paltaj.htm
Quinlivan BJ (1966) The relationship between temperature fluctuations and the
softening of hard seeds of some legume species. Aust J Agric Res 12:1009-
1022
Quinlivan BJ (1968) The softening of hard seeds of sand-plain lupin (Lupinus
varius L.). Aust J Agric Res 19:507-515
Röder MS, Korzun V, Wendehake K, Plaschke J, Tixier, M-H, Leroy, P, Ganal
MW (1998) A Microsatellite map of wheat. Genetics 149:2007-2023
Sengbusch von R (1931) [Low alkaloid lupins. 2.] Züchter 3:93-109 (in German)
Sengbusch von R (1938) [Low alkaloid lupins. 3.] Züchter 10:42-43 (in German)
Sengbusch von R (1942) [Sweet lupins and oil lupins. The history of the origin of
some new crop plants.] Landw Jbr 91:719-880 (in German)
Sharp PJ, Johnston S, Brown G, McIntosh RA, Pallotta M, Carter M, Bariana
HS, Khatkar S, Lagudah ES, Singh RP, Khairallah M, Potter R, Jones
MGK (2001) Validation of molecular markers for wheat breeding. Aust J
Agric Res 52:1357-1366
Yang H, Boersma JG, You M, Buirchell BJ, Sweetingham MW (2004)
Development and implementation of a sequence-specific PCR marker linked
Chapter Eight: General discussion and future directions
147
to a gene conferring resistance to anthracnose disease in narrow-leafed lupin
(Lupinus angustifolius L.). Mol Breed 14:145-151
Yang H, Shankar M, Buirchell BJ, Sweetingham MW, Caminero C, Smith
PMC (2002) Development of molecular markers using MFLP linked to a
gene conferring resistance to Diaporthe toxica in narrow-leafed lupin
(Lupinus angustifolius L.). Theor Appl Genet 105:265-270
Yang H, Sweetingham MW, Cowling WA, Smith PMC (2001) DNA
fingerprinting based on microsatellite-anchored fragment length
polymorphisms, and isolation of sequence-specific PCR markers in lupin
(Lupinus angustifolius L.). Mol Breed 7:203-209
You M, Boersma JG, Buirchell BJ, Sweetingham MW, Siddique KHM, Yang H
(2005) A PCR-based molecular marker applicable for marker-assisted
selection for anthracnose disease resistance in lupin breeding. Cell Mol Biol
Lett 10:123-134
Zamir D (2001) Improving plant breeding with exotic genetic libraries. Nature Rev
Genetics 2:983-989
Zhang W, Smith C (1992) Computer simulations of marker-assisted selection
utilizing linkage disequilibrium. Theor Appl Genet 83:813-820
Zhang W, Smith C (1993) Simulation of marker-assisted selection utilizing linkage
disequilibrium: the effects of several additional factors. Theor Appl Genet
86:492-496
Chapter Nine: Appendices
Chapter Nine
Appendices
149
Chapter Nine: Appendices
9.1 ANTHRACNOSE DISEASE RATING OF RIL
POPULATION AND COMPARISON TO AnM2 AND NEARBY
NEWLY GENERATED MAP MARKERS.
RIL # Disease
rating (1-5)
Anthracnose
disease scores AnM2
DAWA
1019
DAWA
207
DAWA
224
W/D 8 1.625 A A B B B
W/D 9 5 B B B B B
W/D 10 4 B B B B B
W/D 12 4.375 B B B B B
W/D 13 3.833 B B B B B
W/D 14 3.375 B B B B B
W/D 15 1.125 A A A A A
W/D 16 3.125 B B _ B B
W/D 17 3.67 B B B B B
W/D 18 4 B B B B B
W/D 19 3.833 B B B B B
W/D 21 4 B B B B B
W/D 23 3.875 B B _ B B
W/D 24 1.25 A A A B B
W/D 25 3 B B B A A
W/D 26 1.25 A A ? ? A
W/D 27 1 A A A A A
W/D 28 3.625 B B B B B
W/D 34 1.375 A A A A A
W/D 35 4.5 B B _ A A
W/D 36 2 A A B A A
W/D 38 2 H A A A A
W/D 39 3.67 B B B B B
W/D 40 2.125 A B _ B B
W/D 41 _ _ B B B B
W/D 42 1.5 A A A B B
W/D 43 1 A A A A A
W/D 44 3.125 B B B B B
W/D 45 3.75 B B B B B
W/D 46 1.875 A B B B B
W/D 48 3.375 B B B _ B
W/D 49 2.25 A A A _ A
W/D 50 3 B B _ B B
150
Chapter Nine: Appendices
RIL # Disease
rating (1-5)
Anthracnose
disease scores AnM2
DAWA
1019
DAWA
207
DAWA
224
W/D 51 3.25 B B _ B B
W/D 52 1.75 A B B B A
W/D 53 1 A A A A A
W/D 54 3.75 B B B B B
W/D 57 1 A A A A A
W/D 58 1.625 A A A A A
W/D 59 1.75 A B B A A
W/D 60* 2.375 B B B B B
W/D 64 1.875 A A B A A
W/D 65 2.875 B B B B B
W/D 66 1.375 A A A A A
W/D 69 3 B B B B B
W/D 70 3.5 B B _ B B
W/D 73 3.75 B B B B B
W/D 74 3.125 B B B B B
W/D 76 2.5 B B B B B
W/D 77 1 A A A A A
W/D 78 3 B B B B B
W/D 80 1 A B B A A
W/D 82 4.25 B B B B B
W/D 83 1 A A A A A
W/D 84 2.25 A A A A A
W/D 85 2.5 B B B B B
W/D 86 1.25 A A A A A
W/D 89 1.75 A A A A A
W/D 90 2.125 A A _ A A
W/D 92 1.125 A B B A A
W/D 93 2.5 B B B B B
W/D 94 4.25 B B A B B
W/D 95 2.67 B B A B B
W/D 97 1.375 A A _ A A
W/D 98 4.25 B B B B B
W/D 99 - _ A _ A A
W/D 100 1.125 A A _ A A
W/D 102 4.25 B B B B B
W/D 104 1.875 A A A A A
W/D 106 3.75 B A B B B
151
Chapter Nine: Appendices
RIL # Disease
rating (1-5)
Anthracnose
disease scores AnM2
DAWA
1019
DAWA
207
DAWA
224
W/D 107 1 A A A A A
W/D 109 3 B B B B B
W/D 111 2.5 B B B A A
W/D 112 3.125 B B B B B
W/D 113 3.875 B B A B B
W/D 114 1 A A A A A
W/D 116 1.375 A A A A A
W/D 118 1.25 A A B A A
W/D 119 2 H A A B B
W/D 120 2.875 B B B B B
W/D 122 3.5 B B B B B
W/D 123 3.25 B B B B B
W/D 124 3 B B B B B
W/D 125 3 B B B B B
W/D 127 1.75 A A A A A
W/D 128 3.75 B B _ B B
W/D 130 1.5 B B B B B
W/D 132 2 A A _ A A
W/D 135 1.75 A B B B B
W/D 136 4 B B B B B
A 476 1.25 A A A A A
P27255 3.25 B B B B B
Marker
errors 8 12 11 11
Note: This experiment was restricted primarily to the population used in construction of the molecular
map (Chapter 2).
Missing values / data are marked with a dash.
Marker genotypes are bolded when they disagree with Disease rating.
152
Chapter Nine: Appendices
9.2 TARDUS SHATTER RATING OF RIL POPULATION AND
COMPARISON TO NEARBY NEWLY GENERATED MAP
MARKERS INCLUDING THOSE OF NELSON ET AL. 2006.
RIL # Tardus
scores
DAWA
169
DAWA
978
DAWA
1097c
Lup
214
Lup
001
UWA
244
W/D 8 A A A - A A -
W/D 9 B B B B B B -
W/D 10 B B B B B B B
W/D 11 B B - - B B B
W/D 12 A A A A A A B
W/D 13 A A A A A A A
W/D 14 B B B B B B B
W/D 15 A A A A A A A
W/D 16 B B B B - - -
W/D 17 A A A A A A A
W/D 18 A A A A A A B
W/D 19 B B B B B B A
W/D 21 A A A A A A A
W/D 23 B B B - B B B
W/D 24 B B B B B B B
W/D 25 B B B B B - B
W/D 26 B B - B B B B
W/D 27 B B B B B B B
W/D 28 B B B B B B B
W/D 32 A - - - A A A
W/D 33 B B - - B B B
W/D 34 B B B B B B A
W/D 35 B B B B - - -
W/D 36 B B B B B B B
W/D 37 B B - - A B B
W/D 38 A A A A B A A
W/D 39 B B B B B B B
W/D 40 A A A A A A A
W/D 41 B B B B B B B
W/D 42 B B B B B B B
W/D 43 B B B B - - -
W/D 444 B B B B A B H
153
Chapter Nine: Appendices
RIL # Tardus
scores
DAWA
169
DAWA
978
DAWA
1097c
Lup
214
Lup
001
UWA
244
W/D 45 A A A A A A -
W/D 46 B B B B B B B
W/D 47 B B - - B B B
W/D 48 B B - B B B B
W/D 49 A A A A - - -
W/D 50 B B B B - - -
W/D 51 B B B B A B B
W/D 52 B B B B B B B
W/D 53 A A A A A A A
W/D 54 A A A A B A A
W/D 55 B B - - - - -
W/D 56 A A - - - - -
W/D 57 A A A A A A A
W/D 58 A A A A A A -
W/D 59 B B B B B B B
W/D 601 A A A A - - -
W/D 61 B B - - B B B
W/D 62 B B - - B B B
W/D 63 A A - - A A A
W/D 64 B B B B - - -
W/D 65 B B B - B B -
W/D 66 B B B - B B B
W/D 67 B B - - B B B
W/D 69 B B B B B B A
W/D 70 A A A - - - -
W/D 71 B B - - B B B
W/D 73 B B B - B B B
W/D 74 B B B - B B B
W/D 75 B B - - B B B
W/D 76 B B B B B B -
W/D 77 A A - A - A A
W/D 78 A A A A A A A
W/D 79 B B - - - - -
W/D 80 B B B B B B -
W/D 81 A A - - A A A
W/D 82 B B B B B B B
W/D 83 B B B B B B B
W/D 84 B B - - B B B
154
Chapter Nine: Appendices
RIL # Tardus
scores
DAWA
169
DAWA
978
DAWA
1097c
Lup
214
Lup
001
UWA
244
W/D 85 A A A A A A A
W/D 86 A A A A A A A
W/D 89 B A - A A A B
W/D 90 A A A - - - -
W/D 92 A A A - A A A
W/D 93 B B B B B B B
W/D 94 A A A A A A A
W/D 95 A A A A A A A
W/D 96 B B - - - - -
W/D 97 B B B B B B B
W/D 98 A A A A A A A
W/D 99 A A A - - - -
W/D 100 A A A - A A A
W/D 101 B B - - B B B
W/D 102 A A A A A A A
W/D 104 B B B B B B -
W/D 105 A A - - A A A
W/D 1062 A A A A A A A
W/D 107 B A A B A A B
W/D 108 B B - - - - -
W/D 109 A A A A A A A
W/D 110 - B - - - - -
W/D 111 A A A A A A A
W/D 112 B B B B B B B
W/D 113 B B B B A - H
W/D 114 B B B B B B B
W/D 115 A A - - - - A
W/D 116 A A A A - - -
W/D 117 B B - - B B B
W/D 118 B B B B B B B
W/D 119 B B B B B B B
W/D 120 B B B B B B A
W/D 121 A A - - - -
W/D 122 B B B B B B B
W/D 123 A A A A A - A
W/D 124 A A A A A - A
W/D 125 B A A A B - B
155
Chapter Nine: Appendices
RIL # Tardus
scores
DAWA
169
DAWA
978
DAWA
1097c
Lup
214
Lup
001
UWA
244
W/D 126 B B - - - - -
W/D 127 B B B B B - B
W/D 128 B B B B - - -
W/D 130 A A A A A - A
W/D 131 B A - - - - -
W/D 132 A A - - - - -
W/D 135 A A - - A - A
W/D 136 A B B B B - B
A 476 A A A A A A A
P27255 B B B B B B B
Marker
errors3 4 2 2 7 2 7
1RIL 60 is suspected to not be the original line 60 as that one is supposed to have died out at an earlier
stage. 2RIL 106. This line appeared to be a mixture. In 2006 one plant was shedding while the stem was
still green, whereas others did not shed before all were fully dry. 3Errors. Assuming that phenotyping is correct (bar RIL 44) and ignoring missing data (-),
discrepancies between marker and population phenotypes have been totalled. 4 It is almost certain that RIL 44 is heterozygous.
156
Chapter Nine: Appendices
9.3 DOMESTICATION GENE RATING OF RIL POPULATION
(ACCORDING TO PARENTAL PHENOTYPE), INCLUDING
SEED ‘MOUSTACHE’, BUT EXCLUDING TARDUS RATING.
RIL # Alkaloid Flowering
time
Flower
colour Lentus Mollis moustache
W/D 8 B A A B A B
W/D 9 B B A B B B
W/D 10 A B B A A A
W/D 11 B B B A A -
W/D 12 B B A B B A
W/D 13 B A B A B A
W/D 14 A A A A B B
W/D 15 A A B B A A
W/D 16 A B B B B A
W/D 17 B A B A A B
W/D 18 B B A B A B
W/D 19 B B B A B B
W/D 21 B B A B B A
W/D 23 B A A A B B
W/D 24 A A B B B B
W/D 25 B B A B B A
W/D 26 B A A B A B
W/D 27 A A A B B B
W/D 28 A B B B B B
W/D 32 A B A B B -
W/D 33 B A B B B -
W/D 34 A A A B A B
W/D 35 A A B A B B
W/D 36 B B B B B A
W/D 37 A A B A B -
W/D 38 B B A B A A
W/D 39 H B B B B A
W/D 40 B B A B A A
W/D 41 B B A B B B
W/D 42 A A B A B B
W/D 43 A A A A A A
W/D 44 A B A B A A
157
Chapter Nine: Appendices
RIL # Alkaloid Flowering
time
Flower
colour Lentus Mollis moustache
W/D 45 A B B A B B
W/D 46 B B A B A B
W/D 47 B A B B B -
W/D 48 A B A A B B
W/D 49 B A B A B B
W/D 50 B A A A B A
W/D 51 A B B A B B
W/D 52 B A A B A A
W/D 53 A A A B B A
W/D 54 A B B A A A
W/D 55 B A A B A -
W/D 56 B A B B B -
W/D 57 B B B A A A
W/D 58 B B A B A B
W/D 59 A A B A B A
W/D 601 B A B B A A
W/D 61 B B H2 B B -
W/D 62 A B A B B -
W/D 63 A B B B A -
W/D 64 B A A A B B
W/D 65 B A A B A B
W/D 66 B B A B B A
W/D 67 B B A A B -
W/D 69 B A A A A A
W/D 70 B A B B A A
W/D 71 B B A A B -
W/D 73 B A A B B B
W/D 74 B A B A A A
W/D 75 B A B B B -
W/D 76 A A A A B A
W/D 77 A A B B B B
W/D 78 B A B A B A
W/D 79 B B? B A B -
W/D 80 B B B A A B
W/D 81 A B B B B -
W/D 82 B B B A A B
W/D 83 A A B A A B
W/D 84 B A B B H -
158
Chapter Nine: Appendices
RIL # Alkaloid Flowering
time
Flower
colour Lentus Mollis moustache
W/D 85 A B B B A A
W/D 86 B A A A B B
W/D 89 B B B B A A
W/D 90 B B A A B B
W/D 92 B B B B A B
W/D 93 B A B A A A
W/D 94 B A B A B B
W/D 95 A B B B B A
W/D 96 A A B B B -
W/D 97 B A B A B A
W/D 98 B A A A A A
W/D 99 A B B A B B
W/D 100 A A B A B B
W/D 101 A A B B B -
W/D 102 B B A A B B
W/D 104 A B A A A A
W/D 105 B B B B A -
W/D 106 B B B B A B
W/D 107 A B A B B A
W/D 108 A B B A B -
W/D 109 B B A B B A
W/D 110 B A B B B -
W/D 111 A A A B B B
W/D 112 B B B B B B
W/D 113 A B B A B B
W/D 114 B A B B A A
W/D 115 B B B A A -
W/D 116 B B A A A A
W/D 117 B B A B B -
W/D 118 B B A A B A
W/D 119 B A B A B A
W/D 120 B A A B A B
W/D 121 B B B A B -
W/D 122 B A B B B A
W/D 123 A B B A A B
W/D 124 A B B B B A
159
Chapter Nine: Appendices
RIL # Alkaloid Flowering
time
Flower
colour Lentus Mollis moustache
W/D 125 B A A B B B
W/D 126 A B A? A A -
W/D 127 B A B A A B
W/D 128 B A A B A B
W/D 130 B A B A B B
W/D 131 A B A B A -
W/D 132 B A A H B A
W/D 135 A B B A B A
W/D 136 B A A A B A
83A:476 A A A A A A
P27255 B B B B B B
Note:
The domesticated parent (A) has the following characteristics:
(i) Low in alkaloids (iuc – recessive);
(ii) Flowers early (Ku – dominant);
(iii) Has white flowers (leuc – recessive);
(iv) Has the reduced shatter gene le (recessive);
(v) Soft seeds (mollis – recessive);
(vi) Moustache pattern on seeds (mou) – gene dominance uncertain.
Missing values / data are marked with a dash. In some instances a tentative phenotype has been
inserted followed by a question mark. 1RIL 60 is suspected to not be the original line 60 as that one is supposed to have died out at an earlier
stage. 2RIL 61 was found originally to be heterozygous for flower colour. However, my notes suggest that
the white flowers were subsequently rogued out.
160
Chapter Nine: Appendices
9.4 ENZYME BUFFERS
1. Boehringer Mannheim
Component (mM) Buffer “A”
Buffer “B”
Buffer “L”
Buffer “M”
Buffer “H”
T4 DNA Ligase
In MFLP
Tris-acetate 33 - - - - Tris-HCl - 10 10 10 50 66 50 Magnesium acetate 10 - - - - MgCl2 - 5 10 10 10 5 10 KCl 66 - - - - NaCl - 100 - 50 100 30 Dithioerythritol (DTE) - - 1 1 1 Dithiothreitol (DTT) 0.5 - - - - 5 ATP 1 1 2-Mercaptoethanol - 1 - - - pH 7.9 8.0 7.5 7.5 7.5 7.5 7.8
2. Fermentas (and Geneworks)
Component (mM) Buffer “Tango”
Buffer “B”
Buffer “G”
Buffer “O”
Buffer “R”
T4 DNA Ligase
In MFLP
Tris-acetate 33 - - - Tris-HCl 10 10 50 10 66 50 Magnesium acetate 10 - - - MgCl2 10 10 10 10 10 Potassium acetate 66 - - - NaCl 100 50 100 - 5 30 KCl 100 Dithioerythritol (DTE) - Dithiothreitol (DTT) - - - - 5 1 BSA 0.1
mg/ml 0.1
mg/ml 0.1
mg/ml 0.1
mg/ml
ATP - - - 1 pH 7.5 7.5 7.5 7.5 8.5 7.5 7.8 Like Like B Like M Like H
161
Chapter Nine: Appendices
Enzyme Buffer in
Fermentas
T4 DNA ligase Tru1I = MseI (t/taa)
Fermentas R Use MFLP recipe
Csp6 I (G/TAC) Fermentas B Use buffer provided, but add10x ligate additive (below)
Hpa II (c/cgg) Fermentas Tango Use buffer provided, but add10x ligate additive (below)
TaqI (T/CGA) Boehringer Buffer B Boehringer Buffer B, but add10x ligate additive (below)
EcoRI (G/AATTC) Fermentas O or R Use MFLP recipe 10x ligate additive
10X stock = Molecular weight Making 10 mL stock will need:
50 mM NaCl 58.4 28.2 mg 100 mM DTT (Boehringer cat.# 197 777)
154.3 154 mg
10 mM ATP (Boehringer cat.# 519 979)
605.2 60.5 mg
250 μg/mL BSA (Boehringer cat.# 238031)
2.5 mg
Stir to dissolve, adjust pH to 7.8. Add water to 10 mL
162
Chapter Nine: Appendices
9.5 PCR FORMULATIONS AS USED IN THIS THESIS
A typical 10 μL PCR includes the following: DNA 1.5 μL 33P labelled primer 0.5 μL the other primer 0.5 μL PCR mix 7.5 μL Method of 33P labelling: (1) Calculation: Label 1 μL Label 120 μL Primer (30 ng/μL) 0.333333 40 μL Sterile water 0.233333 28 μL 5X kinase buffer 0.2 24 μL T4 polynucleotide kinase (10 U/μL) 0.033333 4 μL 33P ATP 0.2 24 μL Total 120 μL
163
Chapter Nine: Appendices
9.6 DNA EXTRACTION FOR MFLP - HIGH QUALITY, BUT LOW YIELD
1. Harvest about 10 to 14 full-size young leaves. Put the leaves in a mortar, add
liquid nitrogen, and grind into powder.
2. Immediately add 4 mL DNA extraction buffer, and mix.
3. Take a 1.5 mL blue tip, cut the tip off, and transfer 0.8ml of the mixture into a
1.5 mL Eppendorf tube
4. (Transfer the remaining leave slurry into a vial, label them, and store at –
20°C for future use.)
5. Add 0.5 mL phenol/chloroform / iso-amyalcohol (25:24:1), mix it with a
plastic tag (do not vortex!);
6. Centrifuge at 13,200 rpm for 30 min;
7. Take a new tube, add 5 μL RNase. Transfer 500 μL aqueous to this new
tube and mix. Incubate on bench for 5 min (not longer, as some batch of
RNase can also damage DNA).
8. Add 0.4 mL chloroform. Mix it with a plastic tag (flicking externally).
9. Centrifuge for 13,200 rpm 10 min;
10. Transfer 300 μL upper aqueous phase to new tube. Add 400 μL extraction
buffer, mix. Add 560 μL isopropanol, mix, leave on bench for 20 to 30 min,
11. Centrifuge at 11,000 rpm for 20 min. Suck away all aqueous.
12. Add 150 μL 70% ethanol. Mix by inverting a few times. Leave on bench for
1 hr, or overnight.
13. Spin 5 min. Suck away all aqueous using P200 pipette.
14. Spin 10 second. Such away all remaining aqueous using P10 pipette.
15. Open lid, leave on bench for 5 min.
16. Add 30 μL TE0.1 buffer. Leave the tubes in the fridge overnight.
17. The next day, gently mix by sucking it up and down using a cut-off yellow
tip.
164
Chapter Nine: Appendices
9.7 EXAMPLE MFLP PROCEDURE
Development of molecular markers for anthracnose and phomopsis
resistance in narrow-leaf lupin. 1. Choose F8 plants for running MFLP
Note: (1) ‘Tanjil’ and ‘Unicrop’ are the two parents
(2) In this example, we need 12 plants for MFLP, but we start with 14
plants, just in case if one or two plants do not work.
(3) The plants chosen will enable you to search markers for anthracnose
resistance and phomopsis resistance at the same time.
Plant no. 5 7 Tanj 20 33 9 15 18 Uni 25 29 11 17 13 Anthracnose R R R R R R R R S S S S S S Phomopsis R R R R R S S S S S S R R R
2. Estimate DNA concentration of each plant In this example the DNA concentration is measured as in the following second table 3. Set up Restriction-Ligation (1). Prepare the adaptor: Adaptor of Yang Take the “MseI Adapter”, heat in a water bath at 95°C
for 5 min. Cool on bench for 20 min, brief spin. (2). Prepare the following “Master mix”
For each sample For 18 samples
water 6.6 μL 118.8 μL Yang’s 10 X T4 ligase buffer
2 μL 36 μL
0.5 M NaCl 1 μL 18 μL 0.5 mg/mL BSA 2 μL 36 μL Yang’s MS adopter 2 μL 36 μL Tru 9I (same as MseI) (10U/μL)
0.6 μL 10.8 μL
T4 ligase (5U/μL) 0.8 μL 14.4 μL DNA sample
Subtotal: 15.0 μL Total: 270.0 μL
165
Chapter Nine: Appendices
4. Prepare the following R-L reactions • Add DNA in each tube, add water to make the volume of 5 μL. Add 15 μL
Master mix, so the final volume is 20 μL.
Lane no. /Plant DNA conc.
(ng/μL) DNA
needed (μL)
water needed (μL)
The above “Master mix”
(μL)
Final name after HaellI
1 Tanjil 400 0.7 4.3 15 HaeIII TanB1
2 20 200 1.5 3.5 15 HaeIII F8B2
3 33 150 2.0 3.0 15 HaeIII F8B3
4 9 100 3.0 2.0 15 HaeIII F8B4
5 15 150 2.0 3.0 15 HaeIII F8B5
6 18 80 4.0 1.0 15 HaeIII F8B6
7 Unicrop 150 2.0 3.0 15 HaeIII UniB7
8 25 100 3.0 2.0 15 HaeIII F8B8
9 29 150 2.0 3.0 15 HaeIII F8B9
10 11 80 4.0 1.0 15 HaeIII F8B10
11 17 80 4.0 1.0 15 HaeIII F8B11
12 13 150 2.0 3.0 15 HaeIII F8B12
13 5 100 3.0 2.0 15 HaeIII F8B13
14 7 100 3.0 2.0 15 HaeIII F8B14
Mix, spin down, incubate at 37°C in water bath for 2 hr.
5. Digest with HaeIII
To the above 20 μL R-L mix, add 80 μL TE0.1., Extract with 100 μL chloroform.
Transfer 80 μL aqueous in a new tube, add 200 μL ethanol and leave for 30 min.
Spin 15 min, pour off ethanol; spin 3 sec, and such all the ethanol. Add 20 μL Hae
III digestion mix (17 μL water, 2 μL Buffer M, 1 μL (5 U) HaeIII). Incubate at
37C for 2 hr. Add 130 TE0.1 and mix. This mix will be the “DNA” used in the
following “Pre-Selective Amplification”.
166
Chapter Nine: Appendices
6. Pre-Selective MFLP Amplification MseI-primer:
MseI-C GAT GAG TCC TGA GTA A --C SSR Primer: PRIMERS:
MF203 GGGA (TTC)4T MF204 CCCT (TTC)4
• For each plant you add:
(1) 3 μL DNA sample
(2) 1 μL of SSR-primer (30 ng/μL),
(3) 1 μL of MS primer (30 ng/μL),
(4) 15 μL Fisher Biotech PCR mix
PCR tube
Template Primers (30 ng each)
Pre-amp code
PCR tube
Template Primers (30 ng each)
Pre-amp code
1 HaeIII TanB1
MS-C + MF203
MF203C TanB1
21 HaeIII TanB1
MS-C + MF204
MF204C TanB1
30g MS
2 HaeIII F8B2
MS-C + MF203
MF203C F8B2
22 HaeIII F8B2
MS-C + MF204
MF204C F8B2
30 ng SSR
3 HaeIII F8B3
MS-C + MF203
MF203C F8B3
23 HaeIII F8B3
MS-C + MF204
MF204C F8B3
4 HaeIII F8B4
MS-C + MF203
MF203C F8B4
24 HaeIII F8B4
MS-C + MF204
MF204C F8B4
5 HaeIII F8B5
MS-C + MF203
MF203C F8B5
25 HaeIII F8B5
MS-C + MF204
MF204C F8B5
6 HaeIII F8B6
MS-C + MF203
MF203C F8B6
26 HaeIII F8B6
MS-C + MF204
MF204C F8B6
7 HaeIII UniB7
MS-C + MF203
MF203C UniB7
27 HaeIII UniB7
MS-C + MF204
MF204C UniB7
8 HaeIII F8B8
MS-C + MF203
MF203C F8B8
28 HaeIII F8B8
MS-C + MF204
MF204C F8B8
9 HaeIII F8B9
MS-C + MF203
MF203C F8B9
29 HaeIII F8B9
MS-C + MF204
MF204C F8B9
10 HaeIII F8B10
MS-C + MF203
MF203C F8B10
30 HaeIII F8B10
MS-C + MF204
MF204C F8B10
11 HaeIII F8B11
MS-C + MF203
MF203C F8B11
21 HaeIII F8B11
MS-C + MF204
MF204C F8B11
12 HaeIII F8B12
MS-C + MF203
MF203C F8B12
32 HaeIII F8B12
MS-C + MF204
MF204C F8B12
13 HaeIII F8B13
MS-C + MF203
HaeIII F8B13
33 HaeIII F8B13
MS-C + MF204
MF204C F8B13
14 HaeIII F8B14
MS-C + MF203
HaeIII F8B14
34 HaeIII F8B14
MS-C + MF204
MF204C F8B14
• PCR cycles: MFLP pre-selective (94°C for 2 min. 25 cycles of 94°C 30 sec,
52°C 30 sec, 72°C 1 min, hold at 4°C)
167
Chapter Nine: Appendices
• Take 10 μL of the above PCR mix, mix with 5 μL gel loading dye. Run 6%
acrylamide gel at 100V for 2 hr. If you see the “smear” bands, it means you are
successful. 7. Selective MFLP Amplification (1) 33P Primer labelling for the SSR primers Step 1. Prepare the following master mix
Components Final Volume Prepare the following:
5 X Kinase buffer 42 [γ-33P] ATP 42 T4 polynuceotide kinase (10 U/μL)
7
Sterile water 49
Total volume 140 Step 2. Prepare the following master mix
MF203 (30 ng/μL)
MF204 (30 ng/μL)
Primer stock 35 μL 35 μL The above master mix 70 μL 70 μL
Incubate the above tube at 37°C for 60 min. Then heat at 70°C to kill the enzyme.
168
Chapter Nine: Appendices
(2) Set up Selective MFLP PCR Sequencing Gel “Tanjil – 1” • Each gel has 96 PCR samples, which is 12 plant x 8 primer combinations. • Annealing temperature of selective MFLP cycles: Starting annealing at 60°C,
decrease 0.7°C per cycle until you reach 54°C. 25 cycles annealing at 54°C. • Run 38x50 cm sequencing gel (0.4 mm thick), 5% denaturing polyacrylamide, at
55 W for 3.5 hours. Dry the gel, and expose X-ray film for 3 days.
Step 2: Set up Master mix for each group of 12 samples
MseI-primer 6.5 μL
Step 1: add 1.5 μL template DNA in 8 groups of 12 plants each 33P Labelled SSR-primer 6.5 μ 1 MF203C
TanB1 PCR mix 105 μL
2 MF203C F8B2
Step 3: Add 8.5 μL into each tube of each group (below)
3 MF203C F8B3
4 MF203C F8B4
PCR tubes Selective primers
5 MF203C F8B5
1-12 MSCAA + MF203***
6 MF203C F8B6
13-24 MSCAG + MF203***
7 MF203C UniB7
25-36 MSCAC + MF203***
8 MF203C F8B8
37-48 MSCAT + MF203***
9 MF203C F8B9
49-60 MSCGA + MF203***
10 MF203C F8B10
61-72 MSCGG + MF203***
11 MF203C F8B11
73-84 MSCGC + MF203***
12 MF203C F8B12
85-96 MSCGT + MF203***
169
Chapter Nine: Appendices
Sequencing Gel “Tanjil – 2”
• Each gel has 96 PCR samples, which is 12 plant x 8 primer combinations.
• Annealing temperature of selective MFLP cycles: Starting annealing at 60°C,
decrease 0.7°C per cycle until you reach 54°C. 25 cycles annealing at 54°C.
• Run 38x50 cm sequencing gel (0.4 mm thick), 5% denaturing polyacrylamide, at
55 W for 3.5 hours. Dry the gel, and expose X-ray film for 3 days.
Step 2: Set up Master mix for each group of 12 samples
MseI-primer 6.5 μL
Step 1: add 1.5 μL template DNA in 8 group 12 plant each
33P Labelled SSR-primer 6.5 μ
1 MF203C TanB1 PCR mix 105 μL
2 MF203C F8B2
3 MF203C F8B3
Step 3: Add 8.5 μL into each tube of each group (below)
4 MF203C F8B4 PCR tubes Selective primers
5 MF203C F8B5 1-12 MSCCA + MF203***
6 MF203C F8B6 13-24 MSCCG + MF203***
7 MF203C UniB7 25-36 MSCCC + MF203***
8 MF203C F8B8 37-48 MSCCT + MF203***
9 MF203C F8B9 49-60 MSCTA + MF203***
10 MF203C F8B10 61-72 MSCTG + MF203***
11 MF203C F8B11 73-84 MSCTC + MF203***
12 MF203C F8B12 85-96 MSCTT + MF203***
Continue new MFLPs using all available primer combinations as required.
170
Chapter Nine: Appendices
Addendum (1) MseI-Adaptor
MSAD1 GAC GAT GAG TCC TGA G MSAD2 TA CTC AGG ACT CAT 1. Purchase the above oligo the same way as primer. Make MSAD1 and MSAD2 at
100 pM/μL as stock.
2. Mix the above two with equal volume to form a 50 pM/μL adaptor solution. Put
50 μL such mix in each tube and store at –20 freezer (each tube enough for one
experiment).
(2) AFLP primers used in MFLP:
In Pre-selective MFLP amplification, we routinely use only one MseI primer (MS-C) MS-C GAT GAG TCC TGA GTA A –C
In Selective MFLP amplification, we use the following 16 MseI primers. Therefore,
one pre-selective MFLP will run 16 selective MFLP amplifications
MSCAA GAT GAG TCC TGA GTA A –CAA MSCAG GAT GAG TCC TGA GTA A –CAG MSCAC GAT GAG TCC TGA GTA A –CAC MSCAT GAT GAG TCC TGA GTA A –CAT MSCGA GAT GAG TCC TGA GTA A –CGA MSCGG GAT GAG TCC TGA GTA A –CGG MSCGC GAT GAG TCC TGA GTA A –CGC MSCGT GAT GAG TCC TGA GTA A –CGT MSCCA GAT GAG TCC TGA GTA A –CCA MSCCG GAT GAG TCC TGA GTA A –CCG MSCCC GAT GAG TCC TGA GTA A –CCC MSCCT GAT GAG TCC TGA GTA A –CCT MSCTA GAT GAG TCC TGA GTA A –CTA MSCTG GAT GAG TCC TGA GTA A –CTG MSCTC GAT GAG TCC TGA GTA A –CTC MSCTT GAT GAG TCC TGA GTA A –CTT
171
Chapter Nine: Appendices
(3) Yang’s 10x T4 ligation buffer (Yang made using the same recipe as MFLP)
10X = MWT For 1 L For 1 mL For 10 mL
500 mM Tris 121.1 61.5 g 61.5 mg 615 mg
100 mM MgCl2.6H2O 203.3 20.3 g 20.3 mg 203 mg
100 mM DTT 154.3 15.4 g 15.4 mg 154 mg
10 mM ATP 605.2 6.05 g 6.05 mg 60.5 mg
250 μg/mL BSA 2.5 mg
pH7.8
Water till 10 mL
(4) TE0.1:
10mM Tris, 0.1 mM EDTA, pH 8.0. Autoclave. (5) Fisher Biotech PCR mix Attention: Chris Fisher Department: Fisher Biotech, P.O. Box 169, Subiaco, WA 6904 Fax no: (08) - 9322 3868 Telephone: (08) - 9322 6866
Product Name Cat. No. Pack size No. of Packs
Price
Taq polymerase TAQ-3 1000 units 1 $450 5 x polymerisation buffer
PB-10 10 mL 1 90
Note: “25 mM MgCl2" is included when you buy the Taq polymerase Procedures:
1. Take a 100 mL yellow-cap tube. Add 9.22 mL PCR grade water in using a 10-
mL sterile pipette;
2. Add 4 mL 5X polymerisation buffer;
3. Add 1.6 mL 25 mM MgCl2 ;
4. Spin the 4 tubes of Taq polymerase for 10 sec;
5. Take 200 μL, mix from the bottle, and add into each of the Taq polymerase
tubes, and gently mix. Transfer all of the enzyme into the bottle;
6. Gentle mix the bottle by shaking in circle motion;
7. Put 880 μL the mix in each of the 1.5 mL eppendorf. Store at –20°C until use.
(each eppendorf is enough for one sequencing gel of 96 MFLPs).
172
Chapter Nine: Appendices
9.8 CLONING AND SEQUENCING A DNA BAND
I. PCR re-amplify a MFLP band
1. Cut the DNA band from a dried sequencing gel through the X-ray film, put the
piece of the gel into an eppendorf tube (0.5 ml); 2. Add 100 μL TE buffer (10 mM Tris, 1 mM EDTA, pH 8) to suspend the gel.
Heat at 94°C for 15 min. Brief spin. 3. Set up 2 tubes of the following PCR for each band, each tube with 50 μL, using
the following steps • Spin the DNA sample of “Gelboil” at top speed for 5 min so that you will
not collect gel residue when you take the DNA sample. • Set up the follow PCR: 7.5 μL DNA template (the supernatant of “Gelboil”), 2.5 μL MseI-primer,
2.5 μL SSR-primer 37.5 μL PCR mix
• Run PCR program “52C25CL” in the “PCRs” folder (=25 cycles at 94°C for 30 s, 52°C for 30 s, 72°C for 2 min)
II. Clean up the PCR product using Roche Diagnostics clean up kit
Roche Diagnostics Kit: “High Pure PCR Product Purification Kit” Cat. No. 1 732 668 for 50 reactions, cost $121 per kit, Or Cat. No. 1 732 676 for 250 reactions, cost $504 per kit.
1. Add 500 μL “Binding buffer” to the 100 μL PCR mixture. Mix well. 2. Load the mix into the “filter tube”, which is set on a “Collection tube”, spin 30
seconds at top speed using a bench centrifuge; 3. Pour off liquid in the collection tube. Add 500 μL “washing buffer” on the
filter tube, spin 30 s; 4. Pour off liquid in the collection tube. Add 200 μL “washing buffer” on the
filter tube, spin 30 s; 5. Take the filter tube (make sure it does not have any liquid on it) and put it on a
1.5 ml new tube as collection tube. Add 80 μL water (PCR grade) into the filter tube, leave it for 2 min, then spin 30 seconds.
III. Run a gel to check DNA concentration For each sample, take 10 μL above DNA, mix with 5 μL loading dye. Run
1.5% agarose mini gel at 70V for 1 h. One lane is 2 μL DNA mass ladder as standard. Take a photo using the digital camera, calculate DNA concentration.
173
Chapter Nine: Appendices
IV. Ligate and transform E. coli using Promega’s kit
Promega’s kit: “pGEM-T Easy Vector, System I” Cat. # A1360 $242 per kit, consisting of the vector, ligase, and buffer.
Promega’s competent cells: JM109 Competent Cells, 1 ml (5 x 200 μL), Cat.# L2001, $189 per pack
1. SET WATER BATH AT 42°C 2. Make a 1.5 % agarose mini gel (1.5 g agarose, 100 ml TBE, 3 μL ethidium
bromide stock). Load 5 μL of the above DNA sample, together with the DNA mass standard, run at 70V for about 1 h.
3. Take a photo using the digital camera. Calculate the amount of DNA of each band in each sample,
4. Calculate the volume of DNA needed for each transformation.
Amount of DNA needed = (? ng vector x insert DNA band in kb / plasmid size in kb) x ratio for insert: plasmid. In our case, we use 50 ug vector, and the ratio of (insert:plasmid) is 3 For example: Band Y21 is 443 bp, and is 157 ng in the photo, which we loaded with 5 μL, Therefore it is 31.4 ng/μL The DNA needed = (50 ng vector x 0.443 kb / 3 (the plasmide pGEM-T is 3 kb) x 3 = 22 ng The volume needed = 22 / 31.4 = 0.7 μL
5. Set up ligation by combining: For example for Band Y21: ? μL DNA 1 μL vector 1 μL T4 ligase (use ONLY the T4 ligase provided by Promega!!!) 5 μL 2x butter
Add water to make the total volume of 10 μL
Mix by pipetting. Leave on bench for 1 h (or for best results, leave at 4°C overnight). HEAT AT 70°C FOR 10 MIN TO KILL THE ENZYME, leave on ice, then SPIN down.
6. Take out the competent E. coli cells (“JM109” from Promega) from freezer, and leave on ice for at least 10 min (the cells are fragile, and need to be warmed up very slowly).
7. Add 5 μL the Ligation mix into a new 1.5 ml tube. 8. Take a yellow tip, and cut off the sharp tip head, then take a tube of E.coli, and
mix the bacterial cells gently.
174
Chapter Nine: Appendices
9. Add 50 μL JM109 cells into the tube, gently mix by stirring with tip (do not suck and squeeze!), place the tube on ice for 20 min.
10. Heat shock at exactly 42°C water bath for 50 seconds (do not shake); 11. Immediately put the tube on ice for 2 min. 12. Add 0.5 ml LB medium (4°C), incubate at 37°C with shaking (≈200 rpm) for
1h. 13. Take three (3) “LB-IPTG-X-Gal petri plates”. Mixing E. coli cells in the tube
by pipetting. Add 50 μL E. coli culture in the first petri plate, spread with a glass rod. Add 150 μL E. coli culture in the second petri plate, spread with a glass rod. Add all the remaining (300 μL) E. coli culture to the third petri plate, spread with a glass rod. Spread with a glass rod. Write the name of the band on the plates. Incubate the plates at 37°C overnight.
14. The next day, put the plate in a cold room for 1 h (during which the blue colour will become darker, easier for the next step (Keep it in the dark).
15. Take another LB-IPTG-X-Gal petri plate, draw 30 - 50 squares on back. Transfer 30 - 40 white colonies of E. coli for each DNA band, one on each square. (Note: colonies with slight blue colour are OK) Have a blue colony as a control. Incubate at 37°C for 20 h. Keep at cool-room until the next step.
LB medium liquid media or LB Agar media: 10 g Bacto- tryptone
5 g Bacto - yeast extract 5 g NaCl
*** do not add agar if it is LB liquid media *** do add 20g agar if it is LB Agar media Add water to 1 litre. Autoclave for 15 min
For LB ampicillin plates:
After autoclaving, allow them to cool to 50°C. Add 2 ml Ampicillin stock per litre agar medium (Ampicillin stock = 100 mg/ml). Pour 20 ml per petri plate. Store at 4°C for up to 1 month, or room temperature up to 1 wk (ampicillin goes off).
LB-IPTG-X-Gal petri plate
To LB ampicilim plates, spread 100 μL of IPTG stock (0.1g/ml), and 20 μL of X-gal Stock (=50 mg/ml). Allow 30 min for the agar to absorb before use.
Ampicillin (= 100 mg/ml) stock: Dissolve ampicillin in water. Filter to sterilise.
Store at –20°C. IPTG stock (0.1g/ml): dissolve 1 g in 10 ml water, sterilise by filtration, keep stock
at –20°C. (IPTG = Isopropyl-b-D-thiogalactopyranoside).
X-gal Stock (50 mg/ml): Dissolve 0.5 g X-Gal in 10 ml of dimethylformamide. The solution needs to be wrapped in foil to avoid light damage. Keep the solution at (-20°C) freezer. Sterilising the solution by filtration is not necessary. (X-Gal = 5’-Bromo-4-chloro-3-indolyl-b-D-galactopyranoside).
175
Chapter Nine: Appendices
V. Clone PCR (Optional, especially useful when there are some unwanted DNA bands mixed in the re-amplified PCR product)
Take some E. coli cells, mix with some water. Do several E. coli clones per
DNA band. Take 1 μL of such cell suspension as template DNA, to run PCR using the same primers, PCR mix and thermocycler program as the selective PCR by which the original band was produced. Run a 1% agarose gel to check the size, keep the clones which have the right sized insert for the next step. Discard clones with inserts of the wrong size.
VI. Mini plasmid preparation using Bresatec’s kit Geneworks kit: “UltraClean Mini Plasmid Prep Kit”, Cat.# MB-12300-250,
250 preparations, $408 1. Late afternoon the day before doing plasmid extractions, put 50 ml LB
medium into a bottle, add 100 μL Ampicillin stock (= 100 mg/ml), mix. Put 6 ml into each bottle.
2. Inoculate one clone of E. coli for each bottle, incubate at 37°C for overnight WITH SHAKING.
• For the steps 3-17, do 2 tubes of plasmid extraction for each E.coli clone
3. The next morning, fill 1.8 ml (twice 0.9 ml) E. coli culture into a collection tube. Spin 30 s. Pour off supernatant.
4. Fill in another 1.8 ml (twice 0.9 ml) E. coli culture into the tube, spin 30 s. Pour off supernatant
5. Fill in another 1.8 ml (twice of 0.9 ml) E. coli culture into the tube, spin 30 s. Pour off supernatant.
6. Spin 10 s. Suck off ALL aqueous with a pipette; 7. Add 50 μL Solution 1. 8. Cut off the tip of a yellow tip, stir tip in solids until the E. coli cells are
completely suspended in the solution. (Try to minimise sucking). 9. Check Solution 2, - if precipitated, heat to dissolve. 10. Gently add 100 μL Solution 2 by pipetting onto the wall of the tube. 11. Mixing by inverting the tube twice. Leave on bench for 5 min. 12. Open the lids of all the tube, leave on bench for 5 minutes until the sticky stuff
on the lids disappears (in theory). 13. Gently add 325 μL Solution 3 by pipetting onto the wall of the tube. Mix by
inverting the tube twice. 14. Leave on bench for 30 min to 1 h 15. Spin first replicate tube of each clone at top speed for 15 min. 16. Transfer ALL of the clear liquid supernatant to a spin filter (avoid white
precipitate); 17. Spin starting from very slow, and gradually increase to top speed then stay for
30 s. Suck away of the waste aqueous in the bottom of the tube.
• Be careful here – look at the instructions!
18. Spin the second replicate tube of each clone at top speed for 15 min.
176
Chapter Nine: Appendices
19. Transfer ALL of the clear liquid supernatant into the same spin filter tube from above!
20. Spin starting from very slow, and gradually increase to top speed then stay for 30 s.
21. Suck away the aqueous in the collecting tube using a P1000 pipette. 22. Add 300 μL Solution 4 to the spin filter. Leave on bench for 5 min. 23. Spin starting from very slow speed, and gradually increase to top speed then
stay for 30 s. 24. Transfer the column (without disturbing the aqueous below!!) onto a new 2 ml
tube (provided), add 50 μL water onto the column, leave for 10 min. 25. Spin 30 s. Discard the filter, close tube lid. Check the plasmid DNA – optional
Set up EcoRI restriction to 5 μL the above plasmid 1 μL 10x buffer H 1 μL EcoRI 3 μL water incubate at 37C for 1 h
Load the whole mix with 3 μL loading buffer in a 1.5% agarose gel at 60V for 40 min to check the size of insert.
If the plasmid DNA concentration is too low, increase the concentration by the following
Precipitate the remaining 45 μL plasmid DNA by adding 4.5 μL 3 M NaAc pH 5, and 100 μL 100% ethanol, leave in freezer for 1 h. Spin 15 min. Pipette away the aqueous, wash with 70% ethanol, dissolve the DNA in 10 μL water.
VII. Set up sequencing reaction
BigDyeTM mix Applied Biosystems Ph. 1800 033 747 BDT version 3.1: Cat. #: 4337455, contain BDT 800 ul, for $1520 +$30 delivery
• Typical Sequencing reaction:
The above plasmid DNA 5 μL (100 ng plamid) Primer (10 ng/μL) 1 μL BigDyeTerminator 2 μL 2.5x sequencing buffer 2 μL (if there is no sequencing butter, add 4 μL BigDyeTerminator in total)
177
Chapter Nine: Appendices
Run sequencing PCR
4 min at 96°C 28 cycles 96°C 30 s, 20 s at annealing temperature (50°C for T7 and M13S; 43°C for SP6), 4 min at 60°C Hold at 4°C
Clean up sequencing PCR mix • Take a P100 pipette and set at 25μL. Take 25μL 100% ethanol by sucking up
and down then suck again to make sure it is 25μL. Mix this 25μL ethanol with the 10 μL sequencing PCR mix, and transfer into a 0.5 ml tube. Leave in freezer for 30 min (overnight is also acceptable).
• Spin at maximum speed for 15 min. Remove as much liquid as possible. • Add 50 μL 70% ethanol. Leave for 10 min. • Spin 10 min at maximum speed. Suck away as much ethanol as possible using
a P100 pipette. • Spin 30 s. Suck away remaining ethanol using a P10 pipette. • It is very important to remove ALL aqueous. • Open up the lid, put the tubes in the desiccator. • Vacuum dry for 5 min. • Close the lids, put tubes in a small plastic bag, fold it in foil paper. Send the
sample to RPH (they run the sequencing gel for you) to run gel.
178
Chapter Nine: Appendices
9.9 HOW TO DO MAPPING WITH MAPMANAGER
(1) Set up data in Excel. Type data as:
a. Individual RILs in columns
b. Markers or traits in rows.
c. Score data as ‘A’ or ‘B’ (according to parentals) or ‘H’
(heterozygote). Using 1’s and 2’s is also possible (I think)
d. Missing data must be replaced with a dash.
(2) Save the Excel file as a text file in the following format:
a. Tab delimited
b. Make sure there are no missing points.
(3) Start Mapmanager
(4) Select: Import the text file (above)
a. Set edit: Put in Progeny number (the number of columns you have)
b. Delete all other
c. Press “Apply”
d. Press “OK”
(5) Select your File you wish to import (and it’s location)
(6) “Import Text” – edit the boxes
a. Data-set – tick. Do not tick any other boxes.
b. Chr – no ticks at all.
c. Locus – tick ‘Geno’ only!
d. Between Items – ‘Tab’
e. Between Records – ‘Line Feed’
f. Between Genotypes – ‘Tab’
The little box that pops up should give you:
(i) Total number of rows (e.g. 50 / 50)
(ii) Total number of progeny (e.g. 90 / 90)
179
Chapter Nine: Appendices
(7) Select “Options” –
a. Tick Kosambi (or Haldane)
b. Tick Self RI (or double Haploid if applicable)
c. Tick the appropriate ‘P’ value
Note (1): each step may take up a minute or more!
Note (2): The more stringent your ’P’ values, the shorter your linkage groups, the
quicker the analysis.
(8) Select “Tools”
a. Select “Make Linkage Groups”
b. Create a file to save data
c. Linkage groups will now appear on the screen.
d. Click on each to view the group. You can view them as either map or
genotype etc – just play with the available options in the top boxes.
(9) Examine your ‘map’ and data carefully. If you high-light a particular maker,
in your options, you can select ‘Tools’ then ‘Links Report’. This will list all
markers related to this one and the strength of the linkage (LOD value). You
may now wish to go ahead with manipulating and modifying your map.
Note: Heterozygotes can be a problem if you are scoring dominant markers. For the
same reason, the scoring in this protocol is unsuitable when dealing with an F2 or
similar segregating population. In such a case a more complicated method of scoring
is required (consult the web-site of MapManager for details).
180
Chapter Nine: Appendices
9.10 PROTOCOL FOR PRODUCING MAPCHART CHART
FROM MAPMANAGER.
To produce a Map from MapManager (MM) data using MapChart (MC) is
relatively easy but does require editing of the exported file for MapChart to read.
The following protocol was produced by Dr. Margaret Pallotta and has been edited
and verified by Jeff Boersma.
(1) Check that the MM file is set to “cumulative” in the ‘Options / Chromosome
Map View’ menu.
(2) Go to ‘File’ menu and select “Export” / “Map”. Select “All”.
(3) Use Excel to open the exported file (‘all files’).
(4) In the options, select “Fixed Width” column spacing. Preview the data and
move the column dividing line to the most suitable position. In the next field,
check that the “column data format” is ‘general’. Press “finish”. In Excel,
stretch the columns so that you can see the full data. The resultant data set
should appear as follows (next page).
(5) Check data again to make sure that the columns were well separated and that
numbers do not cross over into the next column.
181
Chapter Nine: Appendices
Data set as first imported into Excel from MapManager
#Boersma publ ished.map() with Kosambi map function on 02/07/2006 14:16DAWA758.470 0.021442DAWA809.475 0.037072DAWA930.135c 0.043922DAWA377.350 0.049736DAWA532.480 0.05576DAWA749.460 0.105928DAWA821.140 0.118751DAWA289.630c 0.124499DAWA80.190 0.143026DAWA956.295 0.149199DAWA109.260c 0.291372DAWA765.180 0.309673DAWA523.290 0.315697DAWA516.290 0.369963DAWA498.310 0.375916DAWA400.300c 0.38173DAWA394.070c 0.405845DAWA478.500 0.471149DAWA91.195 0.5291DAWA545.140 0.535857DAWA808.500 0.564459DAWA793.405 0.576366DAWA682.240 0.582319DAWA792.425 0.588272DAWA180.240 0.594019DAWA181.210 0.606367DAWA261.060 0.625126DAWA392.190 0.64278DAWA30.050 0.701878DAWA1078.225 0.715394DAWA612.130 0.752045DAWA299.680 1.02108DAWA631.170 1.122446DAWA919.090c 1.155829DAWA789.560 1.161854DAWA486.270 1.167668DAWA339.250 1.21153DAWA194.238 1.229184DAWA627.250 1.279991DAWA101.235c 1.298072DAWA391.200 1.32341DAWA772.330c 1.350102DAWA894.120 1.356275DAWA403.208 1.376556DAWA1065.250 ---DAWA563.130c 0.006024DAWA531.125c 0.131547
182
Chapter Nine: Appendices
(6) You now need to edit the file so that it appears as below:
(7) To do that, the steps are:
(a) “clear all” in the top header row that contains the export information i.e.
#Boersma published map () with Kosambi map function…
(b) Clear the third last cell (and any other like it) that contains “---“ .
(c) Re-align the map distances down 1 cell by inserting a new cell at the top.
Put a “0” (zero) in the new top cell next to the first marker for each
linkage group (was “---“originally).
(d) Add a title for each group. This needs to start with “Group” or “Chrom”.
Both of these headers are OK. Check MapChart for other naming options
if you want to have another label at the top of the chromosome images.
You can have a space after “Group” but then the rest of the chromosome /
group title cannot have spaces so you either need to put in underscores or
dashes (for example: Chrom CxS _1H), or you can enclose the name in
double quotes (for example: Chrom “CxS 1H”).
(e) The map distances need to be changed to whole numbers i.e. from
“0.021”to “2.1”. This can be done easily in Excel by creating another
column next to the first one (of distances) and using the “=cell*100”
function to generate the correct format. Then “copy” this column and do
“paste special”(select ‘values’) (so that we get values and not formulas)
into a new column next to these.
(f) Delete the two original columns of distances, keeping the “paste
special” column. Check the column and delete any zeros in line
with headers to linkage groups.
(g) Save the file as a “formatted text (space delimited)” file.
183
Chapter Nine: Appendices
Data set in Excel after editing.
Group LG1 DAWA758.470 0 DAWA809.475 2.1442 DAWA930.135c 3.7072 DAWA377.350 4.3922 DAWA532.480 4.9736 DAWA749.460 5.576 DAWA821.140 10.5928 DAWA289.630c 11.8751 DAWA80.190 12.4499 DAWA956.295 14.3026 DAWA109.260c 14.9199 DAWA765.180 29.1372 DAWA523.290 30.9673 DAWA516.290 31.5697 DAWA498.310 36.9963 DAWA400.300c 37.5916 DAWA394.070c 38.173 DAWA478.500 40.5845 DAWA91.195 47.1149 DAWA545.140 52.91 DAWA808.500 53.5857 DAWA793.405 56.4459 DAWA682.240 57.6366 DAWA792.425 58.2319 DAWA180.240 58.8272 DAWA181.210 59.4019 DAWA261.060 60.6367 DAWA392.190 62.5126 DAWA30.050 64.278 DAWA1078.225 70.1878 DAWA612.130 71.5394 DAWA299.680 75.2045 DAWA631.170 102.108 DAWA919.090c 112.2446 DAWA789.560 115.5829 DAWA486.270 116.1854 DAWA339.250 116.7668 DAWA194.238 121.153 DAWA627.250 122.9184 DAWA101.235c 127.9991 DAWA391.200 129.8072 DAWA772.330c 132.341 DAWA894.120 135.0102
184
Chapter Nine: Appendices
DAWA403.208 135.6275 DAWA1065.250 137.6556 Group LG2 DAWA563.130c 0 DAWA531.125c 0.6024
(8) You should now be able to open the file from MapChart. Use the option “all
files” under the file type to see the text file.
If all of the data is read correctly, MapChart will immediately produce a graph.
However, often small errors in separating columns and inserting corrected values
occur. When this happens, MapChart will give you an error message. You should
be able to access the data-set in MapChart and manually correct the data. Usually
the error is due to insufficient separation of the columns when first importing into
Excel so that one or more letters from the marker labels have ended up in the
distances column. Correct the values and try again.
Data set as opened in MapChart Group LG1 DAWA758.470 0 DAWA809.475 2.1442 DAWA930.135c 3.7072 DAWA377.350 4.3922 DAWA532.480 4.9736 DAWA749.460 5.576 DAWA821.140 10.5928 DAWA289.630c 11.8751 DAWA80.190 12.4499 DAWA956.295 14.3026 DAWA109.260c 14.9199 DAWA765.180 29.1372 DAWA523.290 30.9673 DAWA516.290 31.5697 DAWA498.310 36.9963 DAWA400.300c 37.5916 DAWA394.070c 38.173 DAWA478.500 40.5845 DAWA91.195 47.1149 DAWA545.140 52.91 DAWA808.500 53.5857 DAWA793.405 56.4459 DAWA682.240 57.6366 DAWA792.425 58.2319
185
Chapter Nine: Appendices
DAWA180.240 58.8272 DAWA181.210 59.4019 DAWA261.060 60.6367 DAWA392.190 62.5126 DAWA30.050 64.278 DAWA1078.225 70.1878 DAWA612.130 71.5394 DAWA299.680 75.2045 DAWA631.170 102.108 DAWA919.090c 112.2446 DAWA789.560 115.5829 DAWA486.270 116.1854 DAWA339.250 116.7668 DAWA194.238 121.153 DAWA627.250 122.9184 DAWA101.235c 127.9991 DAWA391.200 129.8072 DAWA772.330c 132.341 DAWA894.120 135.0102 DAWA403.208 135.6275 DAWA1065.250 137.6556 Group LG2 DAWA563.130c 0 DAWA531.125c 0.6024
186
Chapter Nine: Appendices
DAWA758.4700.0DAWA809.4752.1DAWA930.135c3.7DAWA377.3504.4DAWA532.4805.0DAWA749.4605.6DAWA821.14010.6DAWA289.630c11.9DAWA80.19012.4DAWA956.29514.3DAWA109.260c14.9DAWA765.18029.1DAWA523.29031.0DAWA516.29031.6DAWA498.31037.0DAWA400.300c37.6DAWA394.070c38.2DAWA478.50040.6DAWA91.19547.1DAWA545.14052.9DAWA808.50053.6DAWA793.40556.4DAWA682.24057.6DAWA792.42558.2DAWA180.24058.8DAWA181.21059.4DAWA261.06060.6DAWA392.19062.5DAWA30.05064.3DAWA1078.22570.2DAWA612.13071.5DAWA299.68075.2DAWA631.170102.1DAWA919.090c112.2DAWA789.560115.6DAWA486.270116.2DAWA339.250116.8DAWA194.238121.2DAWA627.250122.9DAWA101.235c128.0DAWA391.200129.8DAWA772.330c132.3DAWA894.120135.0DAWA403.208135.6DAWA1065.250137.7
LG1
DAWA563.130c0.0DAWA531.125c0.6
LG2
MapChart chart output
187
Chapter Nine: Appendices
9.11 ARTICLES PUBLISHED OR IN PRESS AS AT JULY 2007 Publication 1 (pages 189 – 202):
Construction of a genetic linkage map using MFLP and identification of molecular
markers linked to domestication genes in narrow-leafed lupin (Lupinus angustifloius
L.) Cellular & Molecular Biology Letters 10, 331-344 (2005).
Publication 2 (pages 203 – 206):
Development of a sequence-specific PCR marker linked to the Ku gene which
removes the vernalization requirement in narrow-leafed lupin. Plant Breeding 126,
306 – 309 (2007).
Publication 3 (pages 207 – 213):
Development of two sequence-specific PCR markers linked to the le gene that
reduces pod shattering in narrow-leafed lupin (Lupinus angustifolius L.) Genetics
and Molecular Biology 30, xxxx (2007). In Press.
188
Chapter Nine: Appendices
9.12 RAW DATA FOR QTL ANALYSIS INCLUDING PLANT
HEIGHTS FOR EARLY VIGOUR AND AT MATURITY, SEED
WEIGHT AND FLOWERING DATE.
RIL # 1Early
Vigour (1)
Early
Vigour (2)
Mature
Height (1)
Mature
Height (2)
2Seed
Weight (1)
Seed
Weight (2)
Flowering
DAS3 (1)
Flowering
DAS (2)
W/D 8 32.3 31.0 73.3 91.3 15.9 16.4 75 74
W/D 9 23.2 19.0 83.0 93.9 15.3 12.3 96 97
W/D 10 24.2 21.8 93.4 93.4 12.3 11.9 96 96
W/D 12 23.3 23.6 94.8 95.9 14.8 14.2 105 102
W/D 13 27.8 24.7 73.7 78.4 11.7 9.7 81 76
W/D 14 29.8 24.0 59.6 66.6 14.0 10.7 75 75
W/D 15 29.9 28.0 73.3 78.2 13.0 12.1 80 79
W/D 16 24.9 20.0 86.6 75.9 9.1 8.0 95 96
W/D 17 35.7 34.2 82.7 86.0 15.0 - 76 73
W/D 18 21.9 21.9 84.8 89.6 - 12.6 98 96
W/D 19 28.5 18.0 96.8 90.3 10.2 10.5 95 94
W/D 21 18.8 12.2 85.3 76.1 10.8 12.4 101 101
W/D 23 32.2 21.7 73.0 68.9 14.0 13.1 77 75
W/D 24 33.8 19.8 80.9 71.1 11.1 10.6 75 77
W/D 25 25.3 24.8 89.4 101.2 15.0 12.6 100 102
W/D 26 36.6 24.4 84.1 75.4 14.5 13.1 76 77
W/D 27 31.0 24.8 74.8 61.4 - - 76 74
W/D 28 21.8 17.7 83.0 84.3 9.3 9.5 94 97
W/D 34 31.9 25.1 75.7 70.7 13.9 10.2 79 78
W/D 35 39.3 25.2 73.8 66.2 - - 73 74
W/D 36 24.2 15.8 85.1 78.8 - 9.7 101 99
W/D 38 28.1 22.7 86.7 96.8 11.2 - 97 98
W/D 39 28.1 27.3 84.6 93.9 - - 93 92
W/D 40 29.8 19.7 86.3 87.7 11.5 13.5 93 96
W/D 41 18.7 12.7 71.1 72.6 - 12.1 95 97
W/D 42 31.9 29.1 71.3 70.8 13.6 10.6 77 74
W/D 43 33.7 35.6 60.9 73.4 - 12.4 73 70
W/D 44 24.4 24.2 90.8 97.8 14.0 12.0 97 97
W/D 45 25.8 14.3 87.2 80.1 - 10.3 93 97
W/D 46 21.2 20.3 79.8 79.4 10.5 - 93 93
W/D 48 27.7 14.7 91.1 75.9 10.7 10.8 95 96
W/D 49 36.1 26.0 88.6 91.0 - 14.1 78 77
W/D 50 22.3 23.1 72.4 79.7 - 9.3 83 79
214
Chapter Nine: Appendices
RIL # 1Early
Vigour (1)
Early
Vigour (2)
Mature
Height (1)
Mature
Height (2)
2Seed
Weight (1)
Seed
Weight (2)
Flowering
DAS3 (1)
Flowering
DAS (2)
W/D 51 20.9 18.0 81.6 93.3 10.2 9.9 94 95
W/D 52 35.6 30.4 76.3 82.8 13.9 12.6 76 74
W/D 53 31.3 30.3 73.0 76.0 14.2 12.0 78 78
W/D 54 28.4 23.7 84.2 93.0 10.9 10.2 94 93
W/D 57 30.8 31.8 89.9 98.4 14.5 12.3 91 95
W/D 58 20.5 23.3 72.9 91.2 - 14.4 95 92
W/D 59 35.5 33.0 78.4 77.3 13.6 9.5 81 77
W/D 60 28.6 25.2 72.4 72.0 12.6 10.6 83 78
W/D 64 38.4 27.4 85.3 74.4 - 14.2 75 75
W/D 65 28.0 32.2 61.6 81.5 - 13.5 78 72
W/D 66 22.4 26.2 72.0 89.8 11.1 10.7 95 97
W/D 69 35.8 28.7 66.3 76.4 14.4 11.8 75 75
W/D 70 26.1 26.3 73.1 66.0 - 13.4 83 80
W/D 73 40.7 36.0 84.3 79.2 16.5 13.7 75 73
W/D 74 35.7 31.0 83.3 70.9 17.8 13.4 79 76
W/D 76 28.6 24.4 75.9 66.0 - 12.7 77 74
W/D 77 35.6 24.7 67.1 70.4 - 14.4 73 74
W/D 78 42.8 30.9 87.0 83.1 14.0 11.3 72 71
W/D 80 25.0 22.2 72.1 90.8 - 11.3 93 95
W/D 82 28.2 19.7 97.0 99.3 10.2 - 98 101
W/D 83 28.8 24.3 64.3 59.4 12.3 10.8 76 74
W/D 85 28.9 30.7 100.8 104.2 12.0 11.6 100 100
W/D 86 37.3 30.5 75.3 71.3 16.6 12.0 73 71
W/D 89 36.2 38.3 95.3 99.7 14.0 12.8 84 80
W/D 90 23.0 17.2 85.7 91.8 - - 97 99
W/D 92 20.9 20.0 78.4 100.1 13.2 12.9 97 97
W/D 93 40.6 33.8 75.4 67.0 14.8 13.0 69 67
W/D 94 33.5 26.7 81.2 83.8 15.9 12.8 78 75
W/D 95 20.7 14.8 81.7 88.6 11.0 11.6 96 99
W/D 97 34.5 31.5 75.8 80.6 16.2 14.6 79 78
W/D 98 39.0 42.0 73.2 89.5 17.3 16.8 76 75
W/D 99 19.8 15.0 72.4 76.2 - - 95 96
W/D 100 - 29.3 - 70.7 13.1 12.2 75
W/D 102 28.7 19.0 92.4 88.2 11.8 12.9 95 96
W/D 104 29.2 23.2 96.6 92.0 - 9.7 95 97
W/D 106 24.7 22.2 93.2 101.4 10.6 - 100 101
W/D 107 24.3 22.7 75.6 91.2 10.6 11.0 95 95
215
Chapter Nine: Appendices
RIL # 1Early
Vigour (1)
Early
Vigour (2)
Mature
Height (1)
Mature
Height (2)
2Seed
Weight (1)
Seed
Weight (2)
Flowering
DAS3 (1)
Flowering
DAS (2)
W/D 109 26.2 19.2 99.9 98.7 10.2 12.5 96 98
W/D 111 27.6 22.3 75.4 62.0 14.4 12.0 79 79
W/D 112 28.7 16.9 79.1 91.6 11.3 11.8 93 92
W/D 113 27.8 23.0 83.5 86.9 11.5 11.7 91 91
W/D 114 30.1 28.8 74.1 83.3 16.7 11.5 84 79
W/D 116 25.1 21.3 92.1 105.3 - 13.6 98 98
W/D 118 24.2 19.7 96.4 99.1 10.6 11.0 103 98
W/D 119 30.6 26.9 69.1 65.1 10.6 9.9 77 71
W/D 120 37.5 35.3 83.3 75.9 18.8 14.2 75 74
W/D 122 39.2 26.1 88.5 83.8 12.6 13.9 81 79
W/D 123 25.1 21.7 94.3 93.7 11.6 13.2 94 96
W/D 124 20.4 16.6 89.8 91.9 11.1 13.3 101 99
W/D 125 36.2 36.4 82.4 95.5 16.1 14.3 77 72
W/D 127 32.7 29.2 70.7 67.9 - 12.9 75 72
W/D 128 31.8 37.0 73.6 87.3 - 15.9 79 78
W/D 130 38.1 38.5 65.4 74.3 15.0 11.8 70 65
W/D 132 30.6 27.7 80.6 79.1 - 14.5 79 78
W/D 135 26.2 16.1 99.7 89.1 10.2 10.9 100 98
W/D 136 48.6 44.8 83.4 80.0 14.6 12.0 72 71
83A:476 48.6 36.9 87.1 79.6 16.3 13.8 72 72
P27255 22.6 12.4 79.3 75.4 11.4 - 96 96
Note: In 2005, the trial was sown on May 31st and, in 2006 the trial was sown on June 2nd. Plant
heights were measured in centimetres (average of 3 reps x 3 plants); seed weights as grams per 100
seeds. Missing data are denoted by a dash (-). 1Data for year one (1) was collected in 2005 from plants grown in a screenhouse. Data for year two
(2) was collected in 2006 from plants grown in the field adjacent to the screenhouse. 2 Data for seed weight was collected in 2002 (year 1) and 2003 (year 2). 3DAS is days after sowing.
216