+ All Categories
Home > Documents > Mosaicism in human embryos: Etiology and pregnancy ...cme-utilities.com/mailshotcme/Material for...

Mosaicism in human embryos: Etiology and pregnancy ...cme-utilities.com/mailshotcme/Material for...

Date post: 05-Sep-2020
Category:
Upload: others
View: 0 times
Download: 0 times
Share this document with a friend
45
Mosaicism in human embryos: Etiology and pregnancy outcome Santi Munné
Transcript
Page 1: Mosaicism in human embryos: Etiology and pregnancy ...cme-utilities.com/mailshotcme/Material for Websites/CoGEN...-Munne et al: human embryos with higher abnormal cell load perform

Mosaicism in human embryos: Etiology and pregnancy outcome

Santi Munné

Page 2: Mosaicism in human embryos: Etiology and pregnancy ...cme-utilities.com/mailshotcme/Material for Websites/CoGEN...-Munne et al: human embryos with higher abnormal cell load perform

disclosure

- Chief Scientific Officer of CooperGenomics

- Founder @ Reprogenetics (PGS/PGD company), sold to Cooper

- Founder @ Recombine (Carrier Screening company), sold to Cooper

- Founder @ Phosphorus (genomics as a service)

- Founder @ MedAnswers (DTC advise on genetics and infertility)

- Board advisors PreVivo (alternative to IVF)

Page 3: Mosaicism in human embryos: Etiology and pregnancy ...cme-utilities.com/mailshotcme/Material for Websites/CoGEN...-Munne et al: human embryos with higher abnormal cell load perform

Learning objectives

• What is the best technique to detect mosaicism?

• What is the incidence of mosaicism?

• Different types of mosaics have different ongoing potential?

• What is the chance of mosaics to reach term?

Page 4: Mosaicism in human embryos: Etiology and pregnancy ...cme-utilities.com/mailshotcme/Material for Websites/CoGEN...-Munne et al: human embryos with higher abnormal cell load perform

PGS v.2 PGD v.2

Methods for Comprehensive Chromosome Screening

Page 5: Mosaicism in human embryos: Etiology and pregnancy ...cme-utilities.com/mailshotcme/Material for Websites/CoGEN...-Munne et al: human embryos with higher abnormal cell load perform

Comparison of current PGS platforms

% embryos FISH qPCR aCGH

Embryo Vu

SNP array hr-NGS

Total Independent Data Signals* 11 96 2,700 26,000 32,000 700,000

Resolution in Mb arm 20M 6M 20M 6M 3M

Misdiagnosis aneuploides (a-f) 7% 1% 2% 3% d 2% 0%

Unbalanced translocations (g) 2% custom no yes no yes yes

Partial aneuploidies 5% no no yes some yes yes

Polyploidy 2% yes no no no yes yes

Mosaicism (h, i) 20% 20% no 4% no no 20%

Miscarriage rate (j, k) 10-20% 20% 13% unk unk 11%

a Gutierrez-Mateo et al (2011) Fertil Steril, b Scott et al. (2012), c Treff et al. (2012) Fertil Steril 97:819–24, d unpublished 7 misdiagnoses of 265 samples; e Kung et al. (2015) Reprod Biomed Online, , f Wells et al. (2014) J Med Genet, g Yeobah et al. (2015) ASRM, h Greco et al

(2016) NEJM, i Tormasi et al (2015) PGDIS, ASRM. J Rodriguez-Purata et al. (2016) JARG; k Friedenthal et al. (2017) ESHRE * 24M reads per run, 24 samples per run, 30% reads lost = 700,000 reads per sample

Page 6: Mosaicism in human embryos: Etiology and pregnancy ...cme-utilities.com/mailshotcme/Material for Websites/CoGEN...-Munne et al: human embryos with higher abnormal cell load perform

Evolution of PGS techniques

Year

Pro

ce

du

res

PGS data from Reprogenetics (2002 – 2016) + Genesis Genetics (2017) (*) annualized

0

5000

10000

15000

20000

25000

02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17(*)

NGS

aCGH

FISH

Page 7: Mosaicism in human embryos: Etiology and pregnancy ...cme-utilities.com/mailshotcme/Material for Websites/CoGEN...-Munne et al: human embryos with higher abnormal cell load perform

High Resolution NGS

Page 8: Mosaicism in human embryos: Etiology and pregnancy ...cme-utilities.com/mailshotcme/Material for Websites/CoGEN...-Munne et al: human embryos with higher abnormal cell load perform

Normal Chromosome 8

ATTAGACTTAGCCTAGATTCCAATGACTGA

Thousands of DNA fragments are mapped to each chromosome

High Resolution Next Generation Sequencing (hr-NGS)

Page 9: Mosaicism in human embryos: Etiology and pregnancy ...cme-utilities.com/mailshotcme/Material for Websites/CoGEN...-Munne et al: human embryos with higher abnormal cell load perform

Chromosome 10 Chromosome 9

Enables Reliable Detection of Mosaicism

Chromosome 8 Normal Trisomy Mosaic

High Resolution Next Generation Sequencing (hr-NGS)

Page 10: Mosaicism in human embryos: Etiology and pregnancy ...cme-utilities.com/mailshotcme/Material for Websites/CoGEN...-Munne et al: human embryos with higher abnormal cell load perform

Validation of hr-NGS by reanalysis of blastocysts

Kung, Munné, Wells et al. (2015) Biomed Reprod Online; Fiorentino et al. (2014) F&S;

Wells, Kung, Munné et al. (2014) J Med Genetics;

Original Analysis method

Reanalysis method

Sample Confirmed Euploid

Confirmed abnormal

TOTAL

Kung et al. 2015 (Reprogenetics)

aCGH NGS Same biopsy

44/44 108/108 152/152

Fiorentino et al. 2014

aCGH NGS Same biopsy

67/67 141/141 208/208

Wells et al. 2014 (Reprogenetics)

aCGH NGS

Separate biopsy

13/13 28/28 41/41

Total 100% Sensitivity

100% Specificity

0% Error rate

Page 11: Mosaicism in human embryos: Etiology and pregnancy ...cme-utilities.com/mailshotcme/Material for Websites/CoGEN...-Munne et al: human embryos with higher abnormal cell load perform

Comparison between NGS and aCGH: by Type of Abnormality

(1) Ribustello et al. 2016, PGDIS, (2) Ribustello (2015) ESHRE (3) Bauckman (2016) ESHRE

Reanalysis by aCGH

Original (NGS) Euploid Aneuploid Segmental Ref

Euploid 196 0 0 1,2

Aneuploid 0 222 0 1,2

Mosaic 16 4 0 2

Polyploid 6 4 0 2

Segmental Translocation 0 0 69 3

Page 12: Mosaicism in human embryos: Etiology and pregnancy ...cme-utilities.com/mailshotcme/Material for Websites/CoGEN...-Munne et al: human embryos with higher abnormal cell load perform

NGS advantages

• Detection of triploidy 69,XYY and 69,XXY

• Higher resolution than other techniques (1.5Mb)

• Detection of mosaics (20-80% range of abnormal cells or 1/5)

Higher dynamic range than other techniques allows:

Page 13: Mosaicism in human embryos: Etiology and pregnancy ...cme-utilities.com/mailshotcme/Material for Websites/CoGEN...-Munne et al: human embryos with higher abnormal cell load perform

Detection of Mosaicism By hr-NGS

Page 14: Mosaicism in human embryos: Etiology and pregnancy ...cme-utilities.com/mailshotcme/Material for Websites/CoGEN...-Munne et al: human embryos with higher abnormal cell load perform

30% of day-3 embryos were mosaic by FISH. The majority with all cells abnormal: <49% abnormal 40 50-99% abnormal 124 100% abnormal 528

Mosaicism: Common in day 3 embryos

Munné S, Grifo J, Cohen J, Weier HUG Am J Hum Genet 1994; 55:150-159.

Munné S, Weier HUG, Grifo J, Cohen J Biol. Reprod. 1994; 51:373-379

Colls et al. Fertil Steril 2007;88:53–61

1[13]1[16]2[18]2[21]1[22]

2[13]1[16]2[18]2[21]2[22]

1[13]1[16]2[18]2[21]1[22]

1[16] 2[13]2[16]2[18]2[21]2[22]

2[13]1[16]2[18]1[21]1[22]

2[13]3[18]1[21]1[22]

3[13]1[16]2[18]1[21]3[22]

1[13]1[16]1[18]1[21]1[22] 3[13]1[16]2[18]1[21]3[22]

Page 15: Mosaicism in human embryos: Etiology and pregnancy ...cme-utilities.com/mailshotcme/Material for Websites/CoGEN...-Munne et al: human embryos with higher abnormal cell load perform

Higher dynamic range allows NGS to detect mosaics

hr NGS

aCGH

Higher

dynamic

range

Page 16: Mosaicism in human embryos: Etiology and pregnancy ...cme-utilities.com/mailshotcme/Material for Websites/CoGEN...-Munne et al: human embryos with higher abnormal cell load perform

Example: Mosaic trisomy 5

Full trisomy limit

Full monosomy limit

Page 17: Mosaicism in human embryos: Etiology and pregnancy ...cme-utilities.com/mailshotcme/Material for Websites/CoGEN...-Munne et al: human embryos with higher abnormal cell load perform

Mosaicism by NGS: Mixing Experiment

46,XX

46,XY: -16, +18

Page 18: Mosaicism in human embryos: Etiology and pregnancy ...cme-utilities.com/mailshotcme/Material for Websites/CoGEN...-Munne et al: human embryos with higher abnormal cell load perform

90% 46,XX: 10% 46,XY; -16, +18

Page 19: Mosaicism in human embryos: Etiology and pregnancy ...cme-utilities.com/mailshotcme/Material for Websites/CoGEN...-Munne et al: human embryos with higher abnormal cell load perform

80% 46,XX: 20% 46,XY; -16, +18

Page 20: Mosaicism in human embryos: Etiology and pregnancy ...cme-utilities.com/mailshotcme/Material for Websites/CoGEN...-Munne et al: human embryos with higher abnormal cell load perform

70% 46,XX: 30% 46,XY; -16, +18

Page 21: Mosaicism in human embryos: Etiology and pregnancy ...cme-utilities.com/mailshotcme/Material for Websites/CoGEN...-Munne et al: human embryos with higher abnormal cell load perform

60% 46,XX: 40% 46,XY; -16, +18

Page 22: Mosaicism in human embryos: Etiology and pregnancy ...cme-utilities.com/mailshotcme/Material for Websites/CoGEN...-Munne et al: human embryos with higher abnormal cell load perform

50% 46,XX: 50% 46,XY; -16, +18

Page 23: Mosaicism in human embryos: Etiology and pregnancy ...cme-utilities.com/mailshotcme/Material for Websites/CoGEN...-Munne et al: human embryos with higher abnormal cell load perform

40% 46,XX: 60% 46,XY; -16, +18

Page 24: Mosaicism in human embryos: Etiology and pregnancy ...cme-utilities.com/mailshotcme/Material for Websites/CoGEN...-Munne et al: human embryos with higher abnormal cell load perform

30% 46,XX: 70% 46,XY; -16, +18

Page 25: Mosaicism in human embryos: Etiology and pregnancy ...cme-utilities.com/mailshotcme/Material for Websites/CoGEN...-Munne et al: human embryos with higher abnormal cell load perform

20% 46,XX: 80% 46,XY; -16, +18

Page 26: Mosaicism in human embryos: Etiology and pregnancy ...cme-utilities.com/mailshotcme/Material for Websites/CoGEN...-Munne et al: human embryos with higher abnormal cell load perform

10% 46,XX: 90% 46,XY; -16, +18

Page 27: Mosaicism in human embryos: Etiology and pregnancy ...cme-utilities.com/mailshotcme/Material for Websites/CoGEN...-Munne et al: human embryos with higher abnormal cell load perform

Walmsley et al. (2016) ESHRE * Each embryo was biopsied 2-5 times, each time is a tissue

• ICM plus 2-5 TE biopsies per embryo analyzed, analyzed by NGS

Multiple tissue analysis of Blastocysts (Walmsley et al. 2016)

% euploid ICM

% euploid tissues*

71 embryos 252 tissues

complete aneuploid 0% 4%

complete segmental 0% 20%

Mosaic complex 11% 42%

mosaic segmental 41% 60%

mosaic aneuploid 44% 37%

Page 28: Mosaicism in human embryos: Etiology and pregnancy ...cme-utilities.com/mailshotcme/Material for Websites/CoGEN...-Munne et al: human embryos with higher abnormal cell load perform

Huang et al. (2017) J Assist Reprod Genet (2017) 34:487–493 * Each embryo was biopsied 4 times, each time is a tissue

• ICM plus 3 TE biopsies per embryo analyzed by aCGH

Multiple tissue analysis of Blastocysts (Huang et al. 2017)

% euploid ICM

% euploid tissues*

complete aneuploid (n=26) 0% 0%

complete segmental (n=33) 0% 3%

Mosaics (n=0) N/A N/A

Page 29: Mosaicism in human embryos: Etiology and pregnancy ...cme-utilities.com/mailshotcme/Material for Websites/CoGEN...-Munne et al: human embryos with higher abnormal cell load perform

Mosaicism rates by high resolution NGS Data from >100,000 embryos

• Mosaics are MITOTIC and therefore do not increase with age • Mosaics + Aneuploid and Mosaic show constant rates through age

Egg

donor <35 35-37 38-40 41-42 >42

Normal 59% 53% 44% 31% 19% 14% Mosaic 16% 18% 17% 13% 10% 8% Aneuploid (± mosaic) 18% 20% 28% 38% 41% 33% Complex (*) 7% 8% 10% 17% 28% 44% Polyploid 1% 1% 1% 1% 1% 1%

Total embryos analyzed 5659 10734 6697 6211 2656 1279

N = 103,405 embryos. Reprogenetics and Genesis Genetics data to 1/2017

* Complex: >2 full abnormalities

Page 30: Mosaicism in human embryos: Etiology and pregnancy ...cme-utilities.com/mailshotcme/Material for Websites/CoGEN...-Munne et al: human embryos with higher abnormal cell load perform

Meiotic errors: Difference statistically significant at P<0.05 and P<0.0001

Mitotic errors: No difference detected (P>0.05)

0%

20%

40%

60%

80%

100%

< 34 35-39 > 40

15%

36%

52%

24% 24% 26%

Maternal Age

Meiotic Errors

Mitotic Errors

Types of abnormalities and maternal age by karyomapping analysis

Page 31: Mosaicism in human embryos: Etiology and pregnancy ...cme-utilities.com/mailshotcme/Material for Websites/CoGEN...-Munne et al: human embryos with higher abnormal cell load perform

Center ID #

N Euploid % Aneuploid % Mosaic %

3 12 41% 37% 16%

4 41 57% 26% 18%

1 17 43% 30% 24%

8 40 45% 25% 29%

5 15 49% 17% 31%

2 26 53% 17% 31%

6 19 38% 27% 33%

7 21 47% 19% 34%

9 15 36% 18% 44%

206 p= 0.001

Significant difference in mosaicism between centers in egg donor embryos

Sachdev et al. (2016) ASRM

Page 32: Mosaicism in human embryos: Etiology and pregnancy ...cme-utilities.com/mailshotcme/Material for Websites/CoGEN...-Munne et al: human embryos with higher abnormal cell load perform

Clinical outcome of mosaics

Page 33: Mosaicism in human embryos: Etiology and pregnancy ...cme-utilities.com/mailshotcme/Material for Websites/CoGEN...-Munne et al: human embryos with higher abnormal cell load perform

Misdiagnosed by aCGH

• PGS: normal by aCGH • POC: Trisomy 16. • PGS reanalysis: normal by aCGH, Mosaic Trisomy 16 (70%) by NGS

aCGH

h-r NGS

Page 34: Mosaicism in human embryos: Etiology and pregnancy ...cme-utilities.com/mailshotcme/Material for Websites/CoGEN...-Munne et al: human embryos with higher abnormal cell load perform

Mosaics by hr-NGS Miscarry more

* miscarriage rate after aCGH about 10%. Grifo et al. (2015) ASRM

MISCARRIAGES COULD BE FURTHER REDUCED BY 54% USING hr-NGS *

hr-NGS result Total

Euploid 46%

Triploid 4%

Mosaic euploid / aneuploid 29%

Mosaic euploid / segmental 13%

Mosaic euploid / Complex abnormal 8%

52 loses after aCGH “euploid” embryo transfers were reanalyzed by hr-NGS:

Page 35: Mosaicism in human embryos: Etiology and pregnancy ...cme-utilities.com/mailshotcme/Material for Websites/CoGEN...-Munne et al: human embryos with higher abnormal cell load perform

Mosaic embryos by hr-NGS implant less

Fragouli et al. (2016) PGDIS

Mosaics can progress to term but significantly less than euploid embryos

Mosaic (n=44)

Euploid (n=52)

Implantation 38% 58% p<0.001

Ongoing implantation 27% 46% p<0.001

Page 36: Mosaicism in human embryos: Etiology and pregnancy ...cme-utilities.com/mailshotcme/Material for Websites/CoGEN...-Munne et al: human embryos with higher abnormal cell load perform

4% of mosaic embryos detected by aCGH 33% (6/18) ongoing pregnancies

Mosaic embryos can result in healthy pregnancies (Greco et al. 2015)

Geco, Minasa, Fiorentino (2015) New Eng. J. Med

Page 37: Mosaicism in human embryos: Etiology and pregnancy ...cme-utilities.com/mailshotcme/Material for Websites/CoGEN...-Munne et al: human embryos with higher abnormal cell load perform

OPR of euploid vs. mosaic: One center experience (NYU)

MOSAIC EUPLOID

transferred 18 569

implantated 50% 72% p=0.06

miscarried 56% 12% p=0.006

ongoing 22% 63% p=0.001

Besser, Maxwell, Friedenthal, Munné, 𝑀cCaffrey, Grifo (data from NYU, submitted)

Page 38: Mosaicism in human embryos: Etiology and pregnancy ...cme-utilities.com/mailshotcme/Material for Websites/CoGEN...-Munne et al: human embryos with higher abnormal cell load perform

OPR by type of mosaic or by % abnormal cells (multicentric data)

Munné et al. (2017) Fertil Steril + Fiorentino (Genoma) data

• No difference

between monosomy

and trisomy

• Complex have the

worse OPR

• Not enough embryos

replaced with >40%

abnormal cells

Mosaic type % abnormal replaced ongoing

Complex mosaics

any 32 6% p<0.001

Aneuploid mosaics

20-40% 102 50% p<0.05

>40% 44 30%

Segmental mosacis

any 43 37%

Total mosaics

221 37%

p<0.001

Euploid <20% All IVF

centers 50-70%

Page 39: Mosaicism in human embryos: Etiology and pregnancy ...cme-utilities.com/mailshotcme/Material for Websites/CoGEN...-Munne et al: human embryos with higher abnormal cell load perform

High resolution NGS vs. aCGH: Two center experiences

Friedenthal, Maxwell, MD, Munné, Kramer, McCulloh, McCaffrey, Grifo (2017) ESHRE

aCGH NGS p-value

SET transfers 421 579

Age 35.9 35.6 NS

IR (%) 63.9% 71.6% 0.01

OPR (%) 53.1% 61.9% 0.009

aCGH NGS p-value

transfers 390 38

Age 36.0 36.0 NS

IR (%) 41.6% 57.8% <0.05

OPR (%) 44.0% 65.7% <0.02

Macer, Barritt, Surrey, Danzer, Ghadir, Wang, Pisarska (submitted PCRS)

Page 40: Mosaicism in human embryos: Etiology and pregnancy ...cme-utilities.com/mailshotcme/Material for Websites/CoGEN...-Munne et al: human embryos with higher abnormal cell load perform
Page 41: Mosaicism in human embryos: Etiology and pregnancy ...cme-utilities.com/mailshotcme/Material for Websites/CoGEN...-Munne et al: human embryos with higher abnormal cell load perform

Paradigm shift

Current: • Classify embryos as normal or abnormal • Error rate 2-10% • False positives, False negatives occur

New: • Classify embryos as normal, mosaic or abnormal • Minimal error rate • Deprioritize mosaics

Page 42: Mosaicism in human embryos: Etiology and pregnancy ...cme-utilities.com/mailshotcme/Material for Websites/CoGEN...-Munne et al: human embryos with higher abnormal cell load perform

PGDIS, COGEN Recommendations (outdated?)

• Report <20% as normal and >80% as abnormal (resolution limit)

• High priority mosaics: those with <40% abnormal cells

• Low priority mosaics: chaotic mosaics or those with >40% abnormal cells

• Low priority mosaics: - with chromosomes X, Y, 13, 18, 21 (live born viability) - with chromosomes 14, 15 (risk of UPD) - with chromosomes 2, 7, 16 (intrauterine growth retardation) But there is no evidence that mosaics at blastocyst

level have the same impact as mosaics in first trimester

Page 43: Mosaicism in human embryos: Etiology and pregnancy ...cme-utilities.com/mailshotcme/Material for Websites/CoGEN...-Munne et al: human embryos with higher abnormal cell load perform

Risk of embryonic mosaics producing fetal mosaics or full trisomies

Risk of a trisomic baby from mosaic embryos is <1%:

- 24/106 pregnancies miscarried (no data on aneuploid SABs)

- 82/106 pregnancies were ongoing and 100% euploid

(data from CooperGenomics + Genoma, unpublished)

2.1% of CVS are mosaic

Grati et al (in press) – data on n=72,472 CVS

Is Mosaicism at blastocyst stage and fetal mosaicism caused by different mechanisms?

- Bolton et al: implantation of mice mosaic blastocysts depends on abnormal cell load

- Munne et al: human embryos with higher abnormal cell load perform worse

- Weier et al: confined placental mosaicism arises in the placenta and not the embryo

Page 44: Mosaicism in human embryos: Etiology and pregnancy ...cme-utilities.com/mailshotcme/Material for Websites/CoGEN...-Munne et al: human embryos with higher abnormal cell load perform

hr-NGS mosaics: Summary

• NGS detects mosaicism better than other methods

• Mosaics miscarry more (only 4% euploid by hr-NGS miscarry)

• Mosaics implant less than euploid embryos (specially complex mosaics)

Recommended: • Transfer euploid first followed by mosaics • do Prenatal diagnosis (Amnio) for mosaic transfers

• 21% of blastocysts are mosaics

• 40% of mosaics can result in an ongoing pregnancy compared to 50-70% euploid

Page 45: Mosaicism in human embryos: Etiology and pregnancy ...cme-utilities.com/mailshotcme/Material for Websites/CoGEN...-Munne et al: human embryos with higher abnormal cell load perform

[email protected]

Scientists Santi Munné, PhD, CSO (US) Mark Hughes, MD, PhD (US) Jacques Cohen, PhD (US) Dagan Wells, PhD (UK) Elpida Fragouli, PhD (UK) Joson Horcajadas, PhD (LATAM) M. Konstantinidis, PhD (US) Samer Alfarawati, PhD (UK) Tomas Escudero, MSc (US) Josh Blazek, PhD (US) Mike Large, PhD (US) Katharina Spath, PhD (UK) Ryan Subaran, PhD (US) Sarthak Sawarkar, MSc (US) Dhruti Babariya, PhD (UK)

Pere Colls, PhD (US) Tony Gordon, PhD (UK) John Kitchen, PhD (US) Carles Gimenez, PhD (Spain) Mireia Sandalinas, PhD (Spain) Sophia Tormasi, MSc (US) Lia Ribustello, MSc (US) Katie Bauckman, MSc (US) Renata Prates, MSc (US) Luis Guzman, PhD (Peru) Muriel Roche, PhD (Japan) Dr. Araki, PhD (Japan)

Bioinformatics, VC scientists Arun Manoharan, PhD (US) Avinash Shanmugan, PhD (US) Ursula Schick, PhD (US) Lauren Hurd, PhD (US) Jim Hayes, PhD (US) Eric Proffitt, PhD (US) Genetic Councilors (R&D) Amy Jordan Erin Mills Rachael Cabey Dina Goldberg Haley Nisson


Recommended