Date post: | 02-Dec-2014 |
Category: |
Documents |
Upload: | rehan-sadiq-shaikh |
View: | 223 times |
Download: | 0 times |
GLUTATHIONE-S-TRANSFERASES (GSTT1 & GSTM1) GENE DELETIONS
AND SUSCEPTIBILITY TO BREAST CANCER IN PAKISTAN
A THESIS SUBMITTED TO BAHAUDDIN ZAKARIYA UNIVERSITY
IN PARTIAL FULFILLMENT OF THE REQUIREMNT FOR THE DEGREE OF
MASTER OF PHILOSOPHY
IN
BIOTECHNOLOGY
By
ASMA SOHAIL
FEBRUARY - 2011
INSTITUTE OF BIOTECHNOLOGY BAHAUDDIN ZAKARIYA UNIVERSITY
MULTAN, PAKISTAN
Page | ii
GLUTATHIONE-S-TRANSFERASES (GSTT1 & GSTM1) GENE DELETIONS
AND SUSCEPTIBILITY TO BREAST CANCER IN PAKISTAN
A THESIS SUBMITTED TO BAHAUDDIN ZAKARIYA UNIVERSITY
IN PARTIAL FULFILLMENT OF THE REQUIREMNT FOR THE DEGREE OF
MASTER OF PHILOSOPHY
IN
BIOTECHNOLOGY
By
ASMA SOHAIL
SESSION 2008-10
INSTITUTE OF BIOTECHNOLOGY BAHAUDDIN ZAKARIYA UNIVERSITY
MULTAN, PAKISTAN
Page | iii
READ IN THE NAME OF ALLAH
Page | iv
Page | v
CERTIFICATE It is certified that the research work described in this thesis is the original work of ASMA
SOHAIL and has been carried out under my direct supervision. I have personally gone
through all the data reported in the manuscript and certify their correctness/authenticity. It
is further certified that the material included in this thesis have not been used in part or
full in a manuscript already submitted or in the process of submission in partial/complete
fulfillment of the award of any other degree from any other institution. It is also certified
that the thesis has been prepared under my supervision according to the prescribed format
and we endorse its evaluation for the award of M.Phil degree through the official
procedures of the University.
In accordance with the rules of the Institute, her data book is declared as unexpendable
document that will be kept in the registry of the Institute for a minimum of three years
from the date of the thesis defense examination.
SIGNATURE OF SUPERVISOR: _________________ NAME OF THE SUPERVISOR: PROF. DR. MUHAMMAD ALI
DIRECTOR, INSTITUTE OF BIOTECHNOLOGY BAHAUDDIN ZAKARIYA UNIVERSITY, MULTAN, PAKISTAN.
Page | vi
The Controller of Examination, Bahauddin Zakariya University, Multan. We the supervisory committee, certify that the contents and form of thesis submitted by
ASMA SOHAIL has been found satisfactory and recommend it for the award of degree of
M.Phil Biotechnology.
Supervisory Board
Supervisor ……………………… (Prof. Dr. Muhammad Ali) External Examiner ……………………… (……..........................) Director ……………………… (Prof. Dr. Muhammad Ali)
Page | vii
INDEX CERTIFICATE __________________________________________________________ v
SUPERVISORY BOARD ________________________________________________ vi
TABLE OF CONTENT __________________________________________________ vii
LIST OF TABLES ______________________________________________________ ix
LIST OF FIGURES ______________________________________________________ x
ACKNOWLEDGMENT __________________________________________________ xi
SUMMARY ___________________________________________________________ xii
INTRODUCTION ............................................................................................................... 1
OVERVIEW OF CANCER DISEASE ............................................................................... 3
Normal Cells & Tissues ....................................................................................................... 3
Control of Growth in Normal Tissues ................................................................................. 4
The Cell Cycle ..................................................................................................................... 5
The Process Of Tumor Growth & Carcinogenesis .............................................................. 6
CLASSIFICATION OF TUMORS ..................................................................................... 8
ETIOLOGY OF CANCER (CAUSES OF CANCERS) ..................................................... 8
Chemical Carcinogens ......................................................................................................... 9
Physical Carcinogens ........................................................................................................... 9
Biological Carcinogens ...................................................................................................... 10
Endogenous Processes ....................................................................................................... 10
EPIDEMIOLOGY & TYPES OF CANCERS .................................................................. 11
Leukemia & Lymphomas .................................................................................................. 13
Colon Cancer ..................................................................................................................... 13
Wilms Tumor (Nephroblastoma) ....................................................................................... 13
Cancers of Skin .................................................................................................................. 13
Bladder Cancer ................................................................................................................... 14
Renal Cell Carcinoma ........................................................................................................ 14
Liver Cancer ....................................................................................................................... 14
Stomach Cancer ................................................................................................................. 14
Prostate Cancer .................................................................................................................. 15
BREAST CANCER ........................................................................................................... 15
ETIOLOGY OF BREAST CANCER ................................................................................ 17
Factors Under Our control ................................................................................................. 17
Factors Which can’t Be controled ...................................................................................... 18
Page | viii
ROLE OF DIFFERENT GENES IN BREAST CARCINOGENESIS .............................. 18
Tumor Suppressor Genes ................................................................................................... 19
Proto-Oncogenes ................................................................................................................ 20
DNA Repair Gene .............................................................................................................. 20
Carcinogen Metabolism Genes .......................................................................................... 21
CELL PROTECTION MECHANISMS IN CANCER ...................................................... 21
Enzyme Systems Involved in Detoxification ..................................................................... 21
Regulation of Detoxification Activities ............................................................................. 23
Induction ............................................................................................................................ 23
Inhibition ............................................................................................................................ 25
EFFECT OF POLYMORPHISMS .................................................................................... 25
GLUTATHIONE CONJUGATION .................................................................................. 26
GLUTATHIONE-S-TRANSFERASES ............................................................................ 26
GSTM (µ)........................................................................................................................... 28
GSTT (Θ) ........................................................................................................................... 28
GST GENOTYPES & CANCER RISK ............................................................................ 29
MATERIAL AND METHODS ......................................................................................... 31
FIELD WORK ................................................................................................................... 31
Institutional Review Board (IRB) ...................................................................................... 31
Enrolment Of Subjects ....................................................................................................... 31
Collection Of Blood Samples ............................................................................................ 31
BENCH WORK ................................................................................................................. 32
DNA Extraction ................................................................................................................. 32
Quantification Of DNA ...................................................................................................... 32
GSTT1/GSTM1 Multiplex PCR & Analysis ..................................................................... 32
STATISTICAL ANALYSIS ............................................................................................. 34
RESULTS .......................................................................................................................... 35
DISCUSSION .................................................................................................................... 41
REFERENCES .................................................................................................................. 45
Page | ix
LIST OF TABLES
Table 1: Types and Examples of Human Carcinogens ____________________________ 9
Table 2: Stages of Breast Cancer ___________________________________________ 16
Table 3: Tumor Suppressor Genes: Their Role and Chromosomal Location __________ 19
Table 4: Proto-Oncogene: Function and Chromosomal Location __________________ 20
Table 5: Functions and Chromosomal Location of DNA Repair Genes _____________ 20
Table 6: Carcinogen Metabolism Genes: Function and Chromosomal Location _______ 21
Table 7: Oligonucleotides Primers Used In Amplification ________________________ 33
Table 8: Ingredients For Multiplex PCR Reaction Mixture _______________________ 34
Table 9: Selected Characteristic for Case & Controls Individuals __________________ 37
Table 10: Cross Tabulation of GSTM1 & GSTT1 with Breast Cancer _______________ 38
Table 11: Cross Tabulation of GSTM1 & GSTT1 Combination with Breast Cancer ____ 39
Table 12: Cross Tabulation of Gene Combinations of GSTM1, GSTT1 & Menopause with
Breast Cancer __________________________________________________________ 40
Table 13: Cross Tabulation of Gene Combinations of GSTM1, GSTT1 & Pesticide
Exposure with Breast Cancer ______________________________________________ 44
Table 14: Comparative frequency distribution of GSTM1 and GSTT1 in various
populations ____________________________________________________________ 44
Page | x
LIST OF FIGURES Figure 1: A typical tissue showing epithelial and mesenchymal components __________ 4
Figure 2: Cell Cycle ______________________________________________________ 6
Figure 3: Checkpoints control the ability of the cell to progress through the cycle ______ 7
Figure 4: Tumor development showing progression from normal to invasive tumor ____ 7
Figure 5: World Wide Incidence and Mortality Rate of Most Frequent Cancers _______ 12
Figure 6: Liver Detoxification Pathways & Supportive Nutrients __________________ 22
Figure 7: Cytochrome P450 in Human Liver __________________________________ 23
Figure 8: Major Phase II Detoxification Activities in Humans ____________________ 24
Figure 9: Mono & Multi Functional Inducers __________________________________ 25
Figure 10: 3D Structure of Glutathione S-Transferase ___________________________ 27
Figure 11: The GSTM1 gene cluster ________________________________________ 28
Figure 12: The GSTT1 gene cluster _________________________________________ 29
Figure 13: Profile of Multiplex PCR ________________________________________ 33
Figure 14: Ethidium bromide-stained electrophoresed PCR products samples ________ 35
Figure 15: Graph representing frequency of different age groups among affected and
normal subjects _________________________________________________________ 39
Figure 16: Graph representing frequency of menopause in different age groups among
affected and normal subjects _______________________________________________ 39
Page | xi
ACKNOWLEDGEMENTS
In whatever state we are, whatever the consequences we facing, if we are true Muslims
thank Allah. Definitely it will have to be compulsory for us to thank ALLAH, who gave
us ability to explore the things in the universe .This is only the because of Allah’s
blessings that I successfully completed this project and PROPHET MUHAMMAD
(P.B.U.H) is the source of all kinds of knowledge to me.
I would like to express my acknowledgements to Prof. Dr. Muhammad Ali my
supervisor and Director, IBT, who helped me a great for the completion of this project. I
am very thankful to my supervisor for providing me all the facilities required and for
sympathetic and encouraging behavior.
I would like to express my deepest gratitude to my husband Dr. Rehan Sadiq Shaikh. It
is well known to me that the completion of this project was not possible in any way
without his continuous guideline, assistance and inspiration.
I also express my gratitude to my teachers Dr. Zahid Mahmood, Dr. Babar, Mr.
Shahzad Anjam who always encourage me and help me during lab work.
I am thankful to my all class fellows especially Ms Sobia, Ms Nazia, Ms Farah, Ms
Sadia, Mr Imran Maqsood for their assistance in the field work as well as in lab work.
I am also thankful to my lab fellows for their co-operation.
I am also thankful to all the staff members of IBT for their assistance.
At the end, I am also thankful to all the volunteers who participate in this study by giving
their blood samples.
Last but not the least I am also thankful to all my family members especially my parents
for their prayers and continuos support.
I DEDICATE THIS WORK TO MY LOVELY FAMILY, ESPECIALLY TO MY
BETTER HALF.
ASMA SOHAIL
Page | xii
SUMMARY
Breast, cervical and colorectal cancers are among the major health issues all over the
world. According to GLOBOCAN 2008 cancer fact sheet it was found that breast cancer
is the most common cancer found in the women. Epidemiological figures showed that
most of human cancers are mainly caused by environmental exposure to genotoxic agents.
Human body constitutes a special mechanism of detoxification against these carcinogens.
Glutathione-S-transferases (GSTs), is a group of important enzymes having the basic
function of detoxification of several known and assumed carcinogens, including probable
breast carcinogens. Research has shown that a substantial proportion of different
populations have shown a homozygous deletion (null) of the GSTM1 or GSTT1 gene,
resulting in the less production of these isoenzyme. Pakistan being the agricultural and
over populated country provides more chances of people to be exposed to the
environmental carcinogens and hence there are more chances of them to be effected by
diseases like cancer.
Studies have shown that GSTM1 and GSTT1 null genotypes are involved in breast cancer
so a case control study was conducted, constituting 204 controls and 100 patients of
different age groups. A questionnaire was filled having different information of the
patients and controls. DNA was collected from blood samples and analysis of the GSTT1
& GSTM1 was performed by using a standard multiplex PCR protocol with some changes
to describe the presence or absence of GSTT1 and GSTM1.
Results have shown that null genotypes of both the studied gene had no significant role
towards breast cancer in our population. Only significant results are obtained with relation
to menopause showing that women with menopause are more prone towards breast
cancer. Our study also provided the frequency distribution of GSTM1 and GSTT1 in
women of southern Punjab (45.7% and 25.98% respectively). This was the first study of
its type to be conducted in Pakistan.
Glutathione‐S‐Transferases Gene Deletion & Breast Cancer Risk
Page | 1
INTRODUCTION
Human are exposed to the risk of several diseases and due to which the incidence and
death rates are increasing rapidly. Attempts are being made to decrease the incidence of
diseases, to minimize the death rates, to enhance the awareness of the people regarding
the causes of these diseases and to suggest various types of treatments. With the help of
medical research we are able to cure many major diseases but cancer is still considered to
be one of the fatal diseases and has become a constant physical and mental agony to a
great part of our population. The oncologist, statisticians, and medical research workers
all of them are required for their combined effort in diagnosing and analyzing the etiology
of cancer and to apply the results for the better health of mankind.
Cancer is one of the leading causes of death in U.S. Breast, cervical and colorectal
cancers are major health issues in all over the world. According to GLOBOCAN 2008
Cancer Fact Sheet it was found that breast cancer is the most common cancer found in the
women. It is estimated that about 23% of all the cancer cases are of breast carcinoma and
with this figure it ranks second among all the types. Breast cancer is most prevailing
cancer in both the developing and developed regions of the world. Incidence rate fluctuate
from 19.3 per 100,000women in Eastern Africa to 89.9 per 100,000 in Western Europe. It
is high in developed regions of the world (except for Japan) and low (less than
40/100,000) in under developed regions.
As per data of Karachi and Armed Forces Institute of Pathology (AFIP) tumor
registries breast carcinoma is among one of the common type of cancer in women of
southern and northern Pakistan. 26% and 42% of all malignancies reported during the last
decade at AFIP tumor registry and Shaukat Khanum Memorial Cancer Hospital showed
to be breast cancer, respectively (Jamal et al. 2006; Bhurgri et al. 2002; Cancer Registry
and Data Management, Shaukat Cancer Hospital and Research Center).
Breast cancer can be cured if detected at its earliest stage (Dollinger et al. 1991) and
for early diagnosis and prevention from it, knowledge regarding its risk factors and
genomic profiling is necessary. Major risk factors are categorized as family history of
breast cancer, age, hormones (endogenous and exogenous), socio-demographics factors,
and diet, biological and environmental factors (Hulka et al. 1995). But the total
prevention from this disease is difficult because many associated factors are endogenous
and thus difficult to control.
Research and epidemiological data show that most of human cancers are mainly
caused by the exposure to environmental genotoxic and carcinogenic agents such as
Glutathione‐S‐Transferases Gene Deletion & Breast Cancer Risk
Page | 2
polycyclic aromatic hydrocarbons (PAHs) found in tobacco, smoke, pesticide and urban
air etc. Moreover, incomplete burning of fuels such as gasoline, wood and diesel produce
PAHs which are known to form covalent adducts with DNA to cause permanent damage
leading to cancer (Guengerich 2003; Peluso et al. 2004; Tariq et al. 2007). Nature has
developed a cellular detoxifying system, comprised of Phase I and Phase II enzymes,
which protects the cells from DNA damage from various reactive substances. Phase I
enzymes (including cytochromeP450) are involved in the biotransformation of PAHs into
electrophilic intermediates, which are further detoxified by phase II enzymes, including
cytosolic glutathione S transferases (GSTs) (Guengerich 2000, Haydes & Pulford 1995).
Glutathione S transferases (GSTs) and glutathione peroxidase (GPx) are cell protective
enzymes that alter the action of different exogenous (xenobiotics) and endogenous agents.
The conjugation of tripeptide glutathione (GSH) is catalyzed by GSTs to a wide range of
endogenous and exogenous chemicals having the electrophilic functional groups (e.g.
carcinogens, environmental pollutants and products of oxidative stress), they neutralize
their electrophilic sites, and make the products more water-soluble (Haydes & Pulford
1995). On the basis of the immunological cross reactivity and sequence homology, human
cytosolic GSTs have been categorized into eight gene families, with each family encoded
by a separate gene (Mannervik et al. 1992; Pemble & Taylor 1992; Board et al. 2000).
Single nucleotide polymorphisms (SNPs) affecting genes function are commonly
observed but complete absence or deletion of a gene in form of a null allele is rarely
observed. That is why GSTM1 and GSTT1 null allele (-/-) genotypes have attracted much
consideration and over 500 publications on the subject have been published in recent
years. Moreover, considering the significance of GSTs in detoxification mechanism of
carcinogens, null genotypes of GSTM1 and GSTT1 are expected to weaken the ability to
eliminate carcinogenic compounds and may therefore placing individuals with GSTM1
and/or GSTT1 null alleles at higher cancer risk. Previously, studies have shown
relationship of GST genotypes with breast, lung, colon, brain, and various other types of
cancer in different populations (Rebbeck 1997; Dunning et al. 1999; Landi 2000, Strange
et al. 2000; Mohr et al. 2003; Bajpai et al. 2007; Hatagima et al. 2008).
Keeping in view the vital role of GSTM1 and GSTT1 in detoxification of carcinogens
and availability of no information on these null polymorphisms of GSTM1 and GSTT1 in
Pakistani population in relation to breast cancer, we intended to analyze the effect of
these null polymorphisms of GSTT1 and GSTM1 in our population. Further link between
GSTT1 and GSTM1 null alleles and breast carcinoma have been stated with contradictory
results. Therefore, in order to assess the influence of these GSTs genotypes in breast
Glutathione‐S‐Transferases Gene Deletion & Breast Cancer Risk
Page | 3
carcinoma, we planned to conduct this study for the first in Pakistan. Since Pakistan is a
thickly populated agricultural country and Southern Punjab population is highly exposed
to pesticides, so analysis of these deletion polymorphisms in GSTM1 and GSTT1
detoxifying enzymes are crucial for us as lack of a helpful detoxification system might
prove to be a risk factor for breast carcinoma in our population.
OVERVIEW OF CANCER DISEASE The term cancer basically depicts disorder of cells and it usually appears as a tumor
made up of a mass of cells, the tumor is visible after many years due to the chain of
reactions that might have taken place for long.
Cancer has been known since human societies first recorded their activities. It was
well known to the ancient Egyptians and to succeeding civilizations but, as most cancers
develops in the latter decades of life, until the expectation of life began to increase from
the middle of the nineteenth century onwards, the number of people surviving to this age
was relatively small. Now as infectious diseases, the major causes of death in the past
have been controlled by improvements in public health and medical care, the proportion
of the population at risk of cancer has increased significantly. Although diseases of the
heart and blood vessels are still the main cause of death in our ageing population, cancer
is now a major problem. For this reason, cancer avoidance and control are major health
issues. History tells us that a German microscopist, Johannes Mueller, about 140 years
ago, found that cancers were made up of cells, a discovery which began the search for
changes which would help to identify the specific distinction between cancer and normal
cells. In the intervening period a huge amount of information has been acquired about the
cancer cells. Particularly in the past two decades, rapid scientific progress has allowed us
to begin to dissect the cancer genome, transcriptome, and proteome in unparalleled detail
and today there seems no limit to the amount of information that can be achieved.
NORMAL CELLS & TISSUES The human body is comprised of four different main types of tissues:
1. The general supporting tissues jointly known as Mesenchyme.
2. The tissue-specific cells called as Epithelium.
3. The defense cells called as the Haemato-lymphoid system.
4. The Nervous system.
The mesenchyme comprised of connective tissue (fibroblasts) which make collagen
fibers and associated proteins, bone, cartilage, muscle, blood vessels, and lymphatics. The
epithelial cells are the specific, specialized cells of the different organs, for example, liver
glands skin, intestine, etc. The haemato-lymphoid system contains a wide group of cells,
mostly derived from precursor cells in the bone marrow giving rise to all the red and
Glutathione‐S‐Transferases Gene Deletion & Breast Cancer Risk
Page | 4
white blood cells. The nervous system is comprised of the central nervous system (spinal
cord and the brain) and the peripheral nervous system, which is comprised of nerves
leading from these central structures.
Thus, each tissue has its own specific cells, usually several different types, which
maintain the structure and function of the individual tissue. The specific cells are grouped
in organs which have a typical pattern (Fig: 1). There is a layer of epithelium, the tissue-
specific cells, separated from the supporting mesenchyme by a semi-permeable basement
membrane. The supporting tissues (or stroma) are made up of connective tissue (collagen
fibers) and fibroblasts (which make collagen), which may be supported on a layer of
muscle and/or bone depending on the organ. Blood vessels, nerves and lymphatic vessels
go through the connective tissue and provide nutrients and nervous control among other
things for the specific tissue cells.
Figure 1: A typical tissue showing epithelial and mesenchymal components. (Adopted from: Introduction to the cellular and molecular biology of cancer)
CONTROL OF GROWTH IN NORMAL TISSUES One of the most intensively studied areas in biology is the research on mechanism of
control of cell growth and proliferation. It is important to make the distinction between
the terms ‘growth’ and ‘proliferation’.
Growth refers to an increase in size of a cell, organ, tissue, or tumor and by means of
cell division the increase in number of cells is called proliferation. ‘Growth’ is frequently
used as a loose term for both of these processes but the difference is particularly
important now that factors controlling both of these processes are becoming obvious.
In normal development and growth there is a very defined mechanism that allows
individual organs to reach a particular size, which for all practical purposes, is never
exceeded. The surviving cells in most organs begin to divide to replace the damaged ones
if the tissue gets injured. When normal position is achieved, the process stops, this is the
normal control mechanism that persists throughout life. Although most cells in the
Glutathione‐S‐Transferases Gene Deletion & Breast Cancer Risk
Page | 5
embryo can proliferate, but not all of the adult cells preserve this ability. In most organs
there are special stem cells, which have the ability to divide in response to a stimulus such
as an injury to replace organ-specific cells. The highly differentiated cells like that of
muscle or nerve cells are more likely to have lost their ability to divide. In some organs,
particularly the brain, the nerve cells (highly differentiated), can only proliferate in the
embryo; while the special supporting cells in the brain continue to be able to proliferate.
That is why tumors of nerve cells are only found in the very young and tumors of the
brain in adults are derived from the supporting cell
Control of organ or tissue size is achieved by means of a fine balance between
stimulatory and inhibitory stimuli. When the tissue is damaged and repair is needed, that
is when the balance is shifted and a specific physiological stimulus is applied (for
example, hormonal stimulation), the component cells may respond in one of two ways to
attain these objectives. Either by hypertrophy, that is, an increase in size of individual
components, usually of cells which do not normally divide (example is the increase in
size of particular muscles in athletes) or by hyperplasia, that is, an increase in number of
the cells. When the stimulus is removed, commonly the situation returns to the status quo
as shown by the rapid loss of muscle mass in the lapsed athlete. Some of the stimuli
resulting in these compensatory responses are well-known growth factors and hormones.
THE CELL CYCLE All somatic cells increase in numbers in the same way which involves the growth of
all cell components (increase in cell mass) followed by division to generate two daughter
cells. The cell cycle is comprised of all the structural changes that take place during this
process have been known for many years. Four stages are recognized: G1, S, G2, and M
(Fig: 2).
G1 is a gap or pause after proliferative stimulation where little action occurs.
However, if the cell is defined to divide, there is much biochemical activity in G1 for
DNA replication (preparation). The second phase S is of DNA synthesis, which is meant
for chromosomes replication and increase. G2 is a second gap period following DNA
synthesis and thirdly M is the stage of mitosis leading to the breakdown of nuclear
membrane and as a result the condensed chromosomes can be visualized as they pair and
divide prior to division of the cytoplasm to produce two daughter cells. The last cell cycle
phase is recognized, G0, which is a resting phase in which non-cycling cells rest with a
G1 DNA content.
Glutathione‐S‐Transferases Gene Deletion & Breast Cancer Risk
Page | 6
Figure 2: Cell Cycle
Progression through the cell cycle is now known to be restricted at specific
checkpoints, one in G1 and others in S and G2/M (Fig: 3). These provide a chance for
cells to be diverted out of the cycle or to programmed cell death (apoptosis) if, for
example, there is DNA damage or inappropriate expression of oncogenic proteins. In
many of the cancers interruption of these cell cycle checkpoints or alterations to key cell
cycle proteins are found.
THE PROCESS OF TUMOR GROWTH & CARCINOGENESIS Carcinogenesis is a multistage process. In animals, the exposure to the carcinogen
(cancer-producing agent) does not lead to the immediate production of a tumor. Cancers
arise after a long latent period and after the multiple carcinogen effects. At least three
major stages are involved:
1: The first stage known as initiation, involves mutagenic effects of the carcinogen on
skin stem cells.
2: The second stage called promotion is stimulated by type of agents that are not
directly carcinogenic in their own right.
Glutathione‐S‐Transferases Gene Deletion & Breast Cancer Risk
Page | 7
3: Finally in the third stage, progression, some of these benign tumors either
spontaneously or following additional treatment with carcinogens, progress to malignant
tumors.
Ample time is required between the initiation and appearance of tumor. In man, it may
take over 20 years before tumors develop after exposure to industrial carcinogens. Even
in animals it may take up to a quarter or more of the total lifespan before tumors appear.
In the tumor that finally observed, most of the genetic and epigenetic changes seen are
clonal, that is they are present in the entire population of cells (Fig: 4).
Figure 3: Checkpoints control the ability of the cell to progress through the cycle by determining whether earlier stages have been completed successfully A horizontal red bar indicates the stage at which a checkpoint blocks the cycle.(Adopted from : Genes viii)
Figure 4: Tumor development showing progression from normal to invasive tumor via accumulation of heritable changes over a long period of time. The rate of acquisition of these changes will be influenced by environmental exposures and host response (Adopted from: Introduction to the cellular and molecular biology of cancer).
Glutathione‐S‐Transferases Gene Deletion & Breast Cancer Risk
Page | 8
CLASSIFICATION OF TUMORS The term tumor cannot be defined in absolute terms. Tumors have the quality that
these cells in contrast to the normal cells lack the response to normal control mechanism
and hence they show abnormal proliferation. As different factors are concerned with
tumor formation, but the abnormal cells may respond to some but not to others. Another
complication is that after transforming from normal cells, some of the tumor cells stop
their division.
So tumors can be classified into three main groups:
1: Benign Tumors which can arise in any tissue and grow locally. Damage is caused
by exerting local pressure or obstruction. They have the common character that they don’t
spread to distant areas.
2: In Situ Tumors, they are usually but not always small in size. They develop in
epithelium. Morphologically they resemble cancer cells but they remain in epithelium and
do not invade the basement membrane and mesenchyma.
3: Malignant Tumors, they are fully developed cancer and have specific capacity to
attack and destroy the underlying mesenchyma layer. These cells produce a range of
proteins via the nutrients obtained from blood stream, which stimulate the growth of
blood vessels into the tumor thus allowing the continuous growth. The new vessels are
not well developed and are easily injured so the invading tumor cells may penetrate these
and lymphatic vessels. Tumor fragments may be carried in the newly developed vessels to
local lymph nodes or to distant organs where they may grow into secondary tumors.
Cancers may arise in any tissue. Although benign tumors can develop into malignant,
this is far from invariable. Many benign tumors never become malignant. In order to
understand the confusion regarding these definitions we should have the knowledge of the
whole process of tumor induction and development.
ETIOLOGY OF CANCER (CAUSES OF CANCERS) The genetic makeup of mankind barely changes in hundred years and differs
somewhat due to geographical locations between human populations. Environmental
effects and geographical deviation are responsible for the changes in the individual
cancers incidences over time. Mainly Cancers are caused by are chemical, physical,
biological (exogenous) carcinogens and endogenous processes (Table 1). They act on
every human but due to diversity in human’s genetic makeup; differ in their ability to
show their results. Secondly because of the social, economic and psychological
conditions, different trends are shown by the human towards the exposure to carcinogens.
Glutathione‐S‐Transferases Gene Deletion & Breast Cancer Risk
Page | 9
TABLE 1: TYPES AND EXAMPLES OF HUMAN CARCINOGENS
CHEMICAL CARCINOGENS Human chemical carcinogenesis is a multistage process that results from exposures,
usually in the form of complex chemical mixtures, often encountered in the environment
or through our lifestyle and diet ( Poirier et al. 2000) Tobacco smoke is the major
example, which causes cancers of the head, neck, lung, and bladder (Peto et al. 2000;
Vineis et al. 2001). Most chemical carcinogens do not respond readily to nucleophilic
biochemicals, but metabolic processes activate them to carcinogenic and mutagenic
electrophiles. Electrophilic chemical species have natural attraction towards nucleophiles
like DNA and protein, and they covalently get bonded to deoxyribonucleic acid (DNA) as
a result genetic damage occurs. Once carcinogens become the part of the body they are
subject to challenge the processes of metabolic activation and detoxification, although
some chemical species can act directly. Variation among the human population in these
metabolic processes, as well as the capacity for repair of DNA damage and cellular
growth control results in inter individual distinction in cancer risk, and is an indication of
gene-environment interactions, which embodies the concept the effects of chemical
carcinogen exposure is modified due to genetic constitution of individuals (Shields &
Harris 2000). For example, among the tobacco smokers only 10% develop lung cancer.
PHYSICAL CARCINOGENS Energy-rich radiation having different dose and absorption rate, can work like a
carcinogen. On the other hand visible light is can't behave carcinogenic, except if
absorbed by photosensitizing agents, producing reactive oxygen species. Generally,
physical carcinogens constitute: mechanical traumas, electromagnetic radiations of
different kinds, low and high temperatures, alpha and beta radiations, solid and gel
materials, hard and soft materials, fibrous & non fibrous particles. Physical carcinogens
mainly produce effects not because of their chemical properties and actions, rather due to
their physical properties and effects. It was found for the first time scientifically by
Glutathione‐S‐Transferases Gene Deletion & Breast Cancer Risk
Page | 10
Turner that when Bakelite disks were set in rats, they motivated local fibro sarcomas
(Turner 1942).
UVA increases the effect of UVB irradiation which is a main carcinogen in the skin.
Radiation from industrial, natural, and iatrogenic sources like that of used in X-ray
diagnostics penetrates into the body. Its carcinogenicity depends on the amount absorbed,
which damages the DNA and cells either directly or by producing reactive oxygen species
The amount of radioactive isotopes distributed in the body, determines its effect on
that body. For example, radioactive iodine causes only thyroid cancers because it is
accumulated in the thyroid gland, while radioactive cesium isotopes deposit mostly the
urinary bladder. The probable carcinogenicity caused by microwave and radio
wavelength electromagnetic radiation of course is debatable.
BIOLOGICAL CARCINOGENS Certain viruses and bacteria's are the main biological carcinogens in human. HPV16
and HPV18 are the particular strains of human papilloma viruses which are recognized as
the cause of cervical and other genital cancers. Moreover they also manipulate the cancers
of the head, neck and the skin. Epstein-Barr virus in lymphomas and Human herpes virus
8 in Kaposi sarcoma behave as carcinogens (Kieff & Rickinson 2001).
The viral etiology of infectious hepatitis had been recognized as early as 1885. The
hepatitis B virus and hepatitis C virus with their DNA and RNA genome, respectively, are
certainly concerned with the cause of liver cancer. HIV the human retrovirus assists the
growth of cancers most of the time by hindering the immune system, but on the other
hand human T-cell leukemia virus (HTLV1) is the basis of a rare leukemia and it shows
the effect by T cells' direct growth stimulation.
ENDOGENOUS PROCESSES Endogenous processes can also be the main cause of cancers. Carcinogenic
compounds such as aromatic amines, nitrosamines, reactive aldehydes and oxygen
species and quinones are generated by normal metabolism. Factors like diet or physical
activity vary the amount of these potential carcinogens. Several mechanisms like potent
protective and detoxification are working for many of these compounds but not perfectly.
The risk of cancer growth can be increased by some patho physiological conditions. In
particular chronic inflammation in many organs like stomach and colon might be linked
with increased risk of cancer. Numerous factors that favor the spread and growth of
tumors include secretion of cytokines, growth factors and proteases by different cell types
and raised production of reactive oxygen species (mutated) by inflammatory cells. So,
regeneration of tissues is generally linked with an elevated risk of cancer. Few of the
Glutathione‐S‐Transferases Gene Deletion & Breast Cancer Risk
Page | 11
carcinogens are supposed to act basically by provoking tissue growth and without being
mutagenic, rebuild themselves.
So we can conclude that both exogenous and endogenous factors are responsible for
the development of human tumors. In most of the cancers, their interaction is so
complicated that it is difficult to distinguish their contributions. Study of mutations can be
helpful in diagnosing the part played by some of the carcinogens. It is estimated that 5%
of all human cancers are because of occupational carcinogens.
EPIDEMIOLOGY & TYPES OF CANCERS Cancer is one of the basic threats to people's health and life, resulting in 13% of all
disease-causing deaths in the world (WHO Data & Statistics 2006). In 2007 about 7.6
million people expired of cancer in the world and over 1.4 million new cancer cases each
year were accounted in U.S in past years, hence it is reported to be the second leading
fatal disease after cardio vascular diseases.
According to the records of GLOBOCAN 2008 it was suggested that higher ratio of
cancer occurs in under developed regions, both in terms of cancer mortality (63% of
cancer casualties) and cancer incidence (56% of new cancer cases diagnosed in low
developed areas in 2008)
The majority of the prevailing cancers worldwide are lung (12.7% of the total), breast
(10.9% of total) and colorectal cancers (9.7% of total). The most fatal cancers are lung
(18.2% of the total), stomach (9.7% of total) and liver cancers (9.2% of total).
Remarkable differences in the prototype of cancer from area to area are found, like liver
and cervix are frequent in under developed regions of the world, on the other hand
prostate and colorectal cancers are more reported in developed areas.
Cancers can be categorized into three large groups. Those originating from epithelia
are known as carcinomas. These are among the widespread cancers overall (Fig: 5). Four
carcinomas are worth mentioning with reference to their occurrence as well as mortality
i.e. cancers of the lung and the large intestine (both genders), breast cancer in females and
prostate cancer in males. Second category of cancers is not as widespread as the above
mentioned cancers it includes carcinomas of the stomach, bladder, liver, pancreas, kidney,
ovary, cervix and esophagus. They contribute to the less percent of total mortality and
incidence of cancers. The most widespread cancers are of the skin. Only melanoma is
fatal among them. The third group is of rare cancers including tumors of brain, soft
tissues, bone, testes and other organs. They can direct to a noteworthy disease in specific
regions and age groups. Example is that of testicular cancer which affects the young adult
males having a rate of >1% in Switzerland
Glutathione‐S‐Transferases Gene Deletion & Breast Cancer Risk
Page | 12
Here are some main types of cancer which lead to overall cancer mortality each year:
Figure 5: World Wide Incidence and Mortality Rate of Most Frequent Cancers among Both Sexes
Glutathione‐S‐Transferases Gene Deletion & Breast Cancer Risk
Page | 13
LEUKEMIA & LYMPHOMAS These cancers are termed as hematological cancers because they arise from
hematopoetic lineage cells. Leukemias initiate from hematopoetic stem cells and spread
in the whole body. On the other hand Lymphomas arise from lymphoid cells in lymphoid
system and observed as localized cell masses. Hematological cancers can be categorized
according to their origin either from erythroid, myeloid, or lymphoid cells or they can be
only evident genetic aberration (comprising of chromosome gains and losses, but
distinctly translocations).
COLON CANCER Carcinomas of the rectum and colon are most common cancers in Western
industrialized countries. They are one of the lethal cancers and major health problem to
the population. Life style factors play an important role in the cause of the disease.
Dietary factors are one of the main reasons of disease. The cancer development ranges
from hyperplasia, benign adenomas and locally invasive carcinoma to systemic metastatic
disease. Colon cancer also spreads as a result of the chronic inflammatory bowel diseases
like that of ulcerative colitis.
WILMS TUMOR (NEPHROBLASTOMA) Wilms' tumor is also known as nephroblastoma. It is the most common kidney tumor
in children and is linked to various syndromes and hereditary anomalies. A lot of research
done in molecular biology and genetics has helped to increase our knowledge about this
disease, and side by side paving the way to discover the genes playing critical role in
cancerous process. Genetically the disease is heterogeneous and occurs rarely in 1:10,000
children, but it occurs more in patients with syndromes disturbing genitourinary tract
development such as the WAGR, Denys-Drash, and Beckwith- Wiedemann syndromes.
CANCERS OF SKIN The skin being the largest organ is the most common site for cancers development in
humans. Fair-skinned individuals are at about 40% of more risk to develop skin cancer.
Epidermis of the skin is an actively proliferating tissue due to which apoptosis-like event
are often found, as seen in the falling off of hair follicles (Sieberg et al. 1995; Lindner et
al. 1997) and in terminal differentiation (McCall & Cohen 1991; Haake & Polakowska
1993; Polakowska et al. 1994). When the epidermis is exposed to UVB, sun burn cells are
frequently observed. They have apoptotic quality of condensed nuclei (Young 1987;
Schwarz et al. 1995). When the body fails to repair this DNA damage, or fails to remove
the damaged cells by apoptosis, toxic mutations are replicated as a consequence and it
may lead to skin carcinogenesis (Griffiths et al. 1998). Other factors involved are genetic
disposition, immune response and viral infections such as HPV (Proby et al. 1996). Types
Glutathione‐S‐Transferases Gene Deletion & Breast Cancer Risk
Page | 14
of the skin cancers are squamous cell carcinoma, basal cell carcinoma (both are rarely life
threatening and common) and melanoma which is rare but increasing alarmingly.
BLADDER CANCER Another name for bladder cancer is urothelial cancer. Factors often involved are
chemical carcinogens (mainly aromatic amines). Genetic polymorphisms in carcinogen
metabolism genes alter risk of bladder cancer depending on exposure, while no high-risk
is evaluated showing it heritable predisposition. Urothelial cancers grow successively at
different sites. Important factors involved are true oligoclonality, spreading through urine
and migration of cancer cells within the epithelium.
RENAL CELL CARCINOMA Renal cell cancer (RCC) consists of highly heterogeneous epithelial tumors both
clinically and morphologically. They have the same origin of the renal tubule, having
similar antigenic phenotype, but they differ in genetic mutations. A number of factors are
reported and associated with elevated risk for example cellular, genetic, dietary, hormonal
and environmental factors while etiology of RCC is still not known. It is the most
widespread malignant tumor of the kidney, representing 85% all primary renal neoplasm
in elders. RCC is diagnosed more in males than in females and rarely it occurs in
adolescents and children. Geographical or ethnic preference is not observed (Muphy et al.
1994; Motzer et al. 1996).
LIVER CANCER Liver cancer is one of the major fatal malignancies all over the world. Hepatocellular
carcinoma is its subtype which is derived from hepatocytes which are the predominant
epithelial type of cells in the liver. It is due to the chronic inflammation and liver cirrhosis
caused by the hepatitis viruses HCV or HBV, by chronic alcohol use, or rarely by
hereditary diseases like hemochromatosis. Chemical carcinogens like aflatoxin B1
obtained from the mold Aspergillus flavus which activate the causes of inflammation, in
particular with chronic HBV infection is also one of the factors.
STOMACH CANCER Stomach cancer due to its low healing tendency and severe effect on quality of life,
causes a serious health problem. For several decades its incidence is decreasing in many
industrialized states fortunately. Altered diet, improved hygiene and extensive use of
antibiotics reducing the prevalence of Helicobacter pylori infection are responsible for the
reduction of this dilemma. Most of the cases of stomach cancer are associated with
Helicobacter Pylori infection. About 50% of the world population hold strains of the
bacterium, but <10% grow inflammatory disease and ulcers, and even fewer stomach
cancer.
Glutathione‐S‐Transferases Gene Deletion & Breast Cancer Risk
Page | 15
PROSTATE CANCER Prostate cancer is clinically noteworthy in about 10% of males in Western countries. It
is age related, rare in younger males, and its incidence increases with age. Clinically it
varies from minor tumors growing slowly for many years to chronic cancers spreading
locally and effecting the bones and organs leading to the death in few years. Androgens
and the androgen receptor (AR) have represented as major tool for treatment purposes.
Prostate cancers when treated with androgen receptor and depletion respond well. Genes
involved in ancestral prostate cancer are not same as classical tumor suppressors. Risk of
the prostate cancer is altered by the polymorphisms of the genes which are involved in
nucleotide metabolism, to hormone metabolism and action and cell protection.
BREAST CANCER
Breast cancer is one of the frequent ailment in women of developed and under
developed countries and it deals with the malignant tumor developed from cells in the
breast (Parkin et al. 2005). Besides being fatal disease, it affects the women’s quality of
life and society at large with reference to economic burden, such as premature death and
reduced productivity. The usual 5-year rate of survival for breast cancer in developing
and developed countries is 57% and 73% respectively (IARC Handbook on Cancer
Prevention). As a result of better techniques and awareness regarding the diagnosis and
treatment, in developed countries the breast cancer (age adjusted) death rate has declined
and unluckily due to lack of public and professional knowledge, attitudes and practice, it
is higher in under developed countries (Wilson et al. 2004).
Studies have shown that most cases are found in postmenopausal women, but a large
number of younger women are also seen affected, mostly in families having hereditary
tendency. The risk of breast cancer is about 10% for females, and almost 30% of all the
cases prove to be fatal. When talking about the Western countries, 50 yrs is the mean age
at menopause, all women between 45 and 55 have to face menopause. In women between
40-60 years of age, breast cancer is the common fatal disease. Its incidence rate is rising
in many countries.
Incidence rate of breast cancer ranges from 19.3/100,000 females belonging to Eastern
Africa to 89.9/100,000 in Western Europe and except for Japan its high in other
developed areas and its rate is low in less developed areas about 40/100,000 women. Due
to the survival of breast cancer patients in developed regions because of early diagnosis
and public awareness, the range of mortality rates is much less (Fig: 5).
Among the Asian populations, Pakistan has the highest rate of breast cancer
accounting to 40,000 deaths per year. It is estimated that 1 in 9 of Pakistani women will
Glutathione‐S‐Transferases Gene Deletion & Breast Cancer Risk
Page | 16
suffer from this disease at age in their lives. In Pakistan due to the lack of awareness most
of the times the cases are reported at a very complex stage (Sadiqui 2006). If breast
cancer is diagnosed at early stage than the chances of survival of patient are almost 90%.
Its incidence has been increasing alarmingly, due to the area, community, socio-economic
conditions, life-style, hereditary factors, especially eating habits. In Pakistan the peak age
range of breast cancer onset is between 35- 50 years, about 10 years earlier than in
Western populations. 20% of all breast cancer cases are diagnosed in women less than 40
years of age in Pakistan (Bhurgri et al. 2007). Hence it is important to screen the young
women for breast as a prime need of time. The studies reported that Asian women are
highly at risk to breast cancer, and therefore the genetic constitution that may influence
young Pakistanis women towards breast cancer needs to be explored
The types of breast cancer include invasive ductal carcinoma (IDC), ductal carcinoma
in situ (DCIS), invasive lobular carcinoma (ILC), male breast cancer, inflammatory breast
cancer, metastatic breast cancer, recurrent breast cancer, and more. Generally breast
cancer either initiates in the lobular cells, which are the milk-producing glands, or the
passages that drain milk from the lobules to the nipple. Rarely it can initiate in the stromal
tissues, including the fatty and fibrous connective tissues of the breast. As the time
passes, cancer cells attack healthy breast tissue making their way into the underarm
lymph nodes. Once they enter the lymph nodes, then they can extend into other parts of
the body.
The stages of breast cancer refer to how far the cancer cells have spread beyond the
original tumor (Table 2).
TABLE 2: STAGES OF BREAST CANCER
STAGE DEFINITION
STAGE 0 Cancer cells remain within the breast duct, it is not spread to normal adjacent breast tissue.
STAGE I Cancer is 2 cm or less and is restricted to the breast (lymph nodes are not affected).
STAGE IIA Cancer cells are diagnosed in axillary lymph nodes (under arm), tumor is not found in breast. OR the tumor size is less than or equal to 2cm and has spread to the axillary lymph nodes. OR the tumor size is 2-5cm and has not spread to the axillary lymph nodes.
STAGE IIB The tumor is 2-5cm big and has spread to the axillary lymph nodes. OR the tumor size is greater than 5 centimeters but has not spread to the axillary lymph nodes.
STAGE IIIA No tumor is found in the breast. Cancer is found in axillary lymph nodes that are sticking together or to other structures, or cancer may be found in lymph nodes near the breastbone. OR the tumor is any size. Cancer has spread to the axillary lymph nodes, which are sticking together or to other structures, or cancer may be found in lymph nodes near the breastbone.
Glutathione‐S‐Transferases Gene Deletion & Breast Cancer Risk
Page | 17
STAGE IIIB The tumor may be any size and has spread to the chest wall and/or skin of the breast. AND may have spread to axillary lymph nodes that are clumped together or sticking to other structures or cancer may have spread to lymph nodes near the breastbone. Inflammatory breast cancer is considered at least stage IIIB.
STAGE IIIC There may either be no sign of cancer in the breast or a tumor may be any size and may have spread to the chest wall and/or the skin of the breast. AND the cancer has spread to lymph nodes either above or below the collarbone. AND the cancer may have spread to axillary lymph nodes or to lymph nodes near the breastbone.
STAGE IV The cancer has spread — or metastasized — to other parts of the body. ETIOLOGY OF BREAST CANCER
A “risk factor” is anything that increases your risk of developing breast cancer. Many
of the most important risk factors for breast cancer are beyond your control, such as age,
family history, and medical history. However, there are some risk factors you can control,
such as weight, physical activity, and alcohol consumption.
FACTORS UNDER OUR CONTROL Weight: Increased weight is linked with elevated risk of breast cancer especially on
post menopausal women. The ovaries discontinue the production of estrogen hormone
after menopause, so the fatty tissues are the only source of that hormone. Increased
deposition of fatty tissues means higher level of estrogen and hence increased risk of
breast cancer.
Diet: Although diet is known to be involved in several cancer types including breast
cancer, but still research has not proved the type of the risky food involved in the
occurrence of cancer. We should control the usage of red meat, animal fats including
dairy fats in milk, ice cream and cheese, as they may have certain hormones or other
growth factors which influence cancer. Some studies have reported that increased
consumption of cholesterol and other fats have proved to be the risk factors for cancer,
while few researchers have shown that too much use of red/processed meats is linked
with elevated breast cancer risk.
Exercise: It has been proven that exercise can play a vital role in reducing the risk of
breast cancer. The American Cancer Society recommends that one should engage
him/herself in 45-60 minutes of physical exercise for at least 5 or more days a week.
Alcohol Consumption: It has been reported in studies that alcohol consumption is
associated with increased breast cancer risk in women. As alcohol has the ability to
Alcohol can limit your liver’s ability to control blood levels of the hormone estrogen,
which in turn can increase risk.
Glutathione‐S‐Transferases Gene Deletion & Breast Cancer Risk
Page | 18
Smoking: Few studies have shown the association of smoking with the increased
breast cancer risk.
Exposure to Estrogen and Oral Contraceptives: Breast cell growth is stimulated by
the estrogen hormone; more exposure to estrogen for long periods increases the risk of
having breast cancer. When oral contraceptives are used by the women the risk is slightly
increased but if she has stopped taking the pills for more than 10 years the risk is almost
diminished.
FACTORS WHICH CAN’T BE CONTROLED Gender: Among the most significant risk factors linked with breast cancer is being a
female. Though we can also find a minute ratio of breast cancer in males also but due to
the activity of estrogen and progesterone hormones in women, the breast cell are under
constant change, this leads them towards the higher risk of having the breast carcinoma.
Age: Aging is another uncontrollable risk factor for mammary tumor. The risk is
0.43% in the age ranging between 30-39 years, while it increases to almost 4% when the
age reaches 60.
Family History of Breast Cancer: A woman is at higher risk of breast cancer if she
has a first degree relative (mother, daughter, sister) or multiple relatives suffering from
either breast or ovarian cancer.
Race: Fair women are slightly more likely to develop breast cancer than are African
American women. Hispanic, Native American and Asian women have a lower risk of
developing and dying from breast cancer.
Radiation Therapy: If someone has exposed to radiations especially to the chest area
as a child or adolescent, is more prone towards breast cancer. The risk increases when the
developing breasts are exposed to radiations for any other treatment.
Pregnancy and Breast Feeding: Breast feeding and pregnancy is known to be
negatively associated with breast carcinoma risk. Women getting pregnant after 30 years
of age or never having any pregnancy are at higher risk for breast cancer. Breast feeding
for 1.5-2years lowers the chances of getting breast cancer.
ROLE OF DIFFERENT GENES IN BREAST CARCINOGENESIS A cycle of genetic mutational actions that begin in a single cell are supposed to be
responsible for the development of breast cancer. Initially the number of normal cell is
increased by increased cell proliferation, then it is followed by additional mutations
which allow development of hyperplasia, dysplasia, carcinoma and ultimately, metastatic
disease. It is anticipated that 5–10% of all mammary tumor cases are inherited, and the
possibly associated genes i.e. BRCA1 and BRCA2 are responsible for about 21-40% of the
cases. Rests of the cases are sporadic and among them 70% of breast tumors are PR, ER
Glutathione‐S‐Transferases Gene Deletion & Breast Cancer Risk
Page | 19
and/or HER /neu positive. Genetic composition of every individual is responsible for the
wide variation in behavior and growth of cancer cells.
The genes involved in the breast carcinogenesis can be divided into four classes. These
are: (1) DNA repair genes (2) carcinogen metabolism genes (3) tumor suppressor genes
and (4) Proto-oncogenes
TUMOR SUPPRESSOR GENES Tumor Suppressor Genes are highly diverse and categorized as gate keepers because
they directly regulate the cell growth (RB1) or can be called as care takers as they are
responsible for the repair of DNA damage and maintenance of cell integrity (BRCA1/2).
When both alleles of the gene loss their function, the risk of cancer is increased. Breast
cancer is basically due to the genetic changes of normal cells which include either the loss
of heterzygosity or the point mutations. On the other hand not only the mutations but the
mechanisms such as methylation also interfere with the normal functioning of cell.
Mechanism of methylation is supposed to be the first step in carcinogenesis process
resulting in the silencing and activation of tumor suppressor genes and oncogenes
respectively and promoting the growth of abnormal cells.
Inherited genetic mutations of tumor suppressor genes involved in most common
hereditary cancer syndromes which are also associated in breast cancer are described in
the Table 3.
TABLE 3: TUMOR SUPPRESSOR GENES: THEIR ROLE AND CHROMOSOMAL LOCATION
Glutathione‐S‐Transferases Gene Deletion & Breast Cancer Risk
Page | 20
PROTO-ONCOGENES Proto-oncogenes basically promote cell division. Any genetic modification in them
can cause the proliferation of cells resulting in the growth of tumor. These mutant forms
of proto-oncogenes are known as oncogenes which are responsible for the induced or
continued uncontrolled cell division. Some of these genes are given in Table 4.
DNA REPAIR GENE The process by which a cell identifies and corrects damage to the DNA molecules is
referred to as DNA repair. Deficient function of DNA repair enzymes as a result of the
polymorphism of the DNA repair genes has been inconsistently associated with the risk
of familial breast cancer. Some the genes involved in DNA repair are listed in the Table
5.
TABLE 4: PROTO-ONCOGENE: FUNCTION AND CHROMOSOMAL LOCATION
TABLE 5: FUNCTIONS AND CHROMOSOMAL LOCATION OF DNA REPAIR GENES.
Glutathione‐S‐Transferases Gene Deletion & Breast Cancer Risk
Page | 21
CARCINOGEN METABOLISM GENES
These are of two types, firstly that who activate the carcinogens efficiently and gets
them into the cell like that of genes of phase I enzymes and secondly the ones which are
involved in the detoxification of carcinogens such as the genes for phase II enzymes some
of them are described in Table 6.
CELL PROTECTION MECHANISMS IN CANCER Specific cellular protections mechanisms (complex system of detoxification enzymes)
are involved in preventing the DNA from encountering the exogenous carcinogens
(xenobiotics) and potential mutagens arising from endogenous processes. These highly
diverse mechanisms serve as a further stage of cancer avoidance in addition to DNA
repair and apoptosis. They not only protect DNA, but cells in general from damage.
When talking about cancer, they are particularly important during carcinogenesis and
cancer therapy. This system is very complex showing variability in different individuals
and is extremely responsive to the individual's lifestyle, environment and the genetic
makeup. Detoxification is a chain of reactions involving methylation, conjugation and
sulfonation.
TABLE 6: CARCINOGEN METABOLISM GENES: FUNCTION AND CHROMOSOMAL LOCATION
ENZYME SYSTEMS INVOLVED IN DETOXIFICATION A set of enzymes is being used by the body having broad specificity to meet the
challenge of detoxification. At present, about 10 families of Phase I enzymes have been
Glutathione‐S‐Transferases Gene Deletion & Breast Cancer Risk
Page | 22
discovered including at least 35 different genes. Phase II reactions also involve multiple
gene families and are equally difficult to understand (Fig: 6).
The Phase I Detoxification System: Cytochrome P450 supergene family of enzymes
is the basic member of this system, and the first enzymatic defense against foreign
compounds. Most of the medications and carcinogens are metabolized by the process of
Phase I biotransformation. Oxygen and NADH is being used as a cofactor by cytochrome
P450 in a typical phase I reaction, to add a reactive group, such as a hydroxyl radical.
This step leads to the production of those reactive molecules which are more toxic than
the parent compound, and if these are not further treated by the phase II conjugation can
cause damage to DNA, RNA and proteins within the cell (Vermeulen 1996). Cyp1A1,
Cyp3A4, Cyp1A2, Cyp2C and Cyp2D6 are the main P450 enzymes involved in
metabolism of drugs or exogenous toxins (Fig: 7). The amount of these enzymes presents
in liver show the importance in the metabolism of different drugs (Vermeulen 1996;
Iarbovic et al. 1997; Benet et al. 1996)
Figure 6: Liver Detoxification Pathways & Supportive Nutrients
It has been proved by several studies that there lies an association between the induced
phase I and/or decreased Phase II activities and elevated risk of ailments such as
Parkinson's disease, cancer and systemic lupus erythematosus (Meyer et al. 1990; Ritchie
et al. 1980; Daly et al. 1993; Kawajiri et al. 1990; Nebert et al. 1991; Bandmann et al.
Glutathione‐S‐Transferases Gene Deletion & Breast Cancer Risk
Page | 23
1997). Adverse drug responses have also been reported due to compromised Phase I
and/or PhaseII activity (Meyer et al. 1990; Iarbovic et al. 1997; Lee. 1995).
The Phase II Detoxification System: Phase I activation is followed by the phase II
conjugation reactions, which converts the reactive molecule formed in phase I reaction to
a water-soluble compound which can be excreted out of body through urine or bile.
Sulfation, glucuronidation, glutathione and amino acid conjugation are among the types
of conjugation reactions which are present in the body (Fig: 8). Cofactors are required for
these reactions which must be replenished through dietary sources.
REGULATION OF DETOXIFICATION ACTIVITIES Specific detoxification pathways may be induced or inhibited depending on various
factors including the genetic polymorphisms, age, gender, dietary habits, and life style
habits like smoking, environment and diseases (Meyer et al. 1990; Benet et al. 1996; Park
et al. 1996; Vesell 1979; Goldberg 1996; Guengerich 1995).
Figure 7: Cytochrome P450 in Human Liver
INDUCTION
When a high xenobiotic load is faced by the body, the detoxification mechanism can
be fastened by the induction of phase I and/or phase II enzymes. Inducers can be mono-
functional or multi-functional (Fig: 9). Mono-functional inducers only affect one enzyme
or one phase of detoxification while a multi-functional inducer affects multiple activities
(Park et al. 1996).
Glutathione‐S‐Transferases Gene Deletion & Breast Cancer Risk
Page | 24
Induction of the Cyp1A1 and Cyp1A2 enzymes is done by mono-functional inducers,
leading to a substantial increase in phase I action such as polycyclic hydrocarbons from
cigarette smoke and aryl amines from charbroiled meats, and with little or no effect on
phase II activity (Kall & Clausen 1995; Joeres et al. 1988; Parsons & Neims 1978; Smith
& Yang 1994; Guengerich 1984). Initiation of Phase I enzymes activities without co-
induction of Phase II enzymes activities results in the disconnection of the Phase I and
Phase II balance of activity. As a result, reactive intermediates are produced in large
amounts, leading to the injury to DNA, RNA, and proteins (Elangovan et al. 1994).
Multifunctional inducers can be produced by the flavonoid molecules found in fruits
and vegetables. For example, ellagic acid present in garlic oil, red grape skin, rosemary,
cabbage, soy and brussels sprouts all contain compounds responsible for the induction
several Phase II enzymes and reduction of Phase I activity (Manson et al. 1997; Barch et
al. 1994; Barch et al. 1995; Pantuck et al. 1979; Offord et al. 1995; Ip & Lisk 1997;
Appelt & Reicks 1997).
The enzymes glutathione S-transferase and glucuronyl transferases are commonly
stimulated by multi-functional inducers. The increase n the amount of these enzymes is a
healthy sign for better detoxification in an individual and this increase also helps in
maintainence of a balance among the activities of both phases. That is why it is reported
in several studies that fruits and vegetables can perform the specific role to protect
various cancers.
Figure 8: Major Phase II Detoxification Activities in Humans
Glutathione‐S‐Transferases Gene Deletion & Breast Cancer Risk
Page | 25
Figure 9: Mono & Multi Functional Inducers
INHIBITION Whenever a competition is arose between two or more compounds for the same
enzyme for detoxification, inhibition can take place. Increased noxious load leads to
inhibition of detoxification of a number of compounds by devastating the systems and
competing for detoxification enzyme activities. Moreover, a few compounds selectively
inhibit only one detoxifying activity; for example Cimetidine is a compound that attaches
directly to the heme iron of the cytochrome P450 reactive site and slows down all
cytochrome- dependent Phase I enzyme activities (Benet et al. 1996).
The reduction of necessary cofactors is a common mechanism of inhibition for phase
II enzymes. Sulfation is more prone towards inhibition due to compromised cofactor
status in humans. Concentration of serum sulfate in the body is maintained by the balance
between absorption of inorganic sulfate and its production from cysteine, and its
excretion by urination and insertion into low molecular weight substrates of sulfation. Its
amount varies in humans throughout 24 hours (Levy & Yamada 1971; Slattery et al.
1987). Humans excrete about 20-25 mm of sulfate in 24 hours; so balance of sulfate
reserves should be maintained through dietary intake of sulfur containing amino acids or
inorganic sulfate.
EFFECT OF POLYMORPHISMS Variations in the genetic makeup of an individual to metabolize the toxic compounds
are associated with the presence of genetic polymorphisms. Cyp2D6 is the key example
showing the effect of genetic polymorphism on phenotype. This gene exists in several
forms in different populations. Some people have slow Cyp2D6 activity and hence are
Glutathione‐S‐Transferases Gene Deletion & Breast Cancer Risk
Page | 26
slow metabolizer and don't detoxify the carcinogens as fast as the persons with faster
acting enzyme. Another example is of polymorphism in N-acetyltranferases leading to
slow metabolism through its pathway and hence proved to be a risk factor for some types
of cancers and parkinson's disease (Meyer et al. 1990; Daly et al. 1993; Bandmann et al.
1997).
Detoxification enzyme's activity and expression are also affected by other factors like
that of age, sex and hormones. Examples related to influence of hormones on detoxifying
enzymes is of Cyp3A, which is sensitive to hormones, similarly 30-40% more Cyp3A
activity is shown by premenopausal women than postmenopausal or men (Wacher et al.
1995; Gustavson & Benet 1994; Maurel 1996).
Health status of an individual also influences the detoxification mechanism. Liver is an
organ responsible for major detoxification activities, so if it is not functioning properly
due to any liver disease such as biliary cirrhosis, hepatocellular carcinoma etc, the
detoxification activity is slowed down (Lee 1995; Benet et al. 1996).
GLUTATHIONE CONJUGATION Glutathione is known as a defensive compound within the body for the elimination of
potentially toxic electrophillic compounds. Many pharmaceuticals either are, or can be
metabolized by phase I reactions to, strong electrophiles, and these in turn react with
glutathione to form non-toxic conjugates generally. The compounds conjugated to
glutathione include epoxides, haloalkanes, nitroalkanes, alkenes, and aromatic halo-and
nitro-compounds. The enzymes working as catalysts of above reactions are the
glutathione-S-transferases which are found in the cytosol of liver, kidney, gut and other
tissues. The glutathione conjugates may be excreted directly in urine, or more usually
bile.
The tripeptide glutathione (Gly—Cys—Glu), when attached to the acceptor molecule,
is attacked by a glutamyl transpeptidase & peptidase, which helps in removing the
glutamate and glycine respectively, and as a result the cysteine conjugate of xenobiotic is
formed. Afterwards the N-Acetylation of the cysteine conjugate occurs by the normal N-
acetylation pathway to produce the N-acetylcysteine conjugate or mercapturic acid. The
glycylcysteine and cysteine conjugates and the mercapturic acids all are found in
excretion products.
GLUTATHIONE-S-TRANSFERASES Glutathione S-transferases (GSTs) constitute a super family of omnipresent,
multifunctional enzymes, which play a vital role in cellular detoxification mechanisms,
and protect macromolecules from attack by reactive electrophiles (Strange et al. 2001).
Glutathione‐S‐Transferases Gene Deletion & Breast Cancer Risk
Page | 27
Glutathione S transferases (GSTs) and glutathione peroxidase (GPx) are cell protective
enzymes that alter the action of different exogenous (xenobiotics) and endogenous agents
(Fig: 10). The conjugation of tripeptide glutathione (GSH) is catalyzed by GSTs to a wide
range of endogenous and exogenous chemicals having the electrophilic functional groups
(e.g. carcinogens, environmental pollutants and products of oxidative stress), they
neutralize their electrophilic sites, and make the products more water-soluble (Haydes &
Pulford 1995).
Human cytosolic GSTs have been grouped into eight gene families: GST- alpha (GST-
α), GST-mu (GST-μ or GSTM),GST- pi (GST-π), GST-theta (GST-θ or GSTT), GST-
zeta (GST-ζ),GST-sigma (GST-σ), GST-kappa (GST-κ) and GST- omega (GST-Ω) , with
each family encoded by a separate gene based on sequence homology and immunological
cross reactivity (Mannervik et al. 1992; Pemble & Taylor 1992; Board et al. 2000).
Figure 10: 3D Structure of Glutathione S-Transferase
All the genes present in GSTs super family have probably begun from the same
precursor. On the other hand all the forms are diverse and specified from each other due
to the gene recombination, duplication and accumulation of mutations. As the GSTs have
a very vital role in the process of detoxification of xenobiotics, therefore because of their
genetic variation the scientist have been attracted towards them and several studies have
been conducted to observe their association with cancer risk. Various studies have shown
relationship of GST genotypes with lung, breast, brain, colon and various other types of
cancer (Rebbeck 1997; Dunning et al. 1999; Landi 2000).
GSTM1 and GSTT1 are the most commonly examined genes so we will discuss them
in detail only.
Glutathione‐S‐Transferases Gene Deletion & Breast Cancer Risk
Page | 28
GSTM (µ) The sub family GSTM is subfamily is represented by a 100Kb gene cluster at
chromosomal site 1p13.3 arranged as 5'-GSTM4-GSTM2-GSTM1-GSTM5- GSTM3-3'
(Pearson et al. 1993; Xu et al. 1998). Both the allels are affected when the gene is
deleted, which results in the null genotype, GSTM1-/-. When the detailed mapping is
studied, it was found that GSTM gene is flanked by two almost alike 4.2-kb regions (Fig:
11). Homologous recombination involving the left and right 4.2-kb repeats is responsible
for the GSTM1 null genotype (Xu et al. 1998). Similarly a missense SNP also occurs in
the GSTM1 gene, i.e. nucleotide 534 G/C (172 Lys/ Asn, resulting to GSTM1*A and
GSTM1*B, respectively), which does not appear to affect the enzyme function (Widersten
et al. 1991).
Numerous studies have analyzed the GSTM1 genotype using a PCR-based assay
designed to identify the wild-type allele of GSTM1 (Seidegard et al. 1988).
Figure 11: The GSTM1 gene is part of the Mu-class GST gene cluster at 1p13.3, which is arranged as 5`-GSTM4-GSTM2-GSTM1-GSTM5-GSTM3-3` (top of diagram). The GSTM1 gene (black box) consists of 8 exons, which range in size from 36 to 112 bp, while the introns vary from 87 to 2641 bp. GSTM1 is embedded in a region with extensive homologies and flanked by two almost identical 4.2-kb regions (gray boxes). The GSTM1 null allele arises by homologous recombination of the left and right 4.2-kb repeats, which results in a 16-kb deletion containing the entire GSTM1 gene (bottom of diagram). The point of deletion cannot be precisely localized because of the high sequence identity between the repeats. (Adopted from: Mini review on GST genotypes and cancer risk by Fritz F.Parl)
GSTT (Θ) Two genes GSTT1 and GSTT2 are present in GSTT subfamily, which are positioned at
chromosomal site 22q11.2 and distance between them is about 50 kb (Landi et al. 2000;
Coggan et al. 1998; Whittington et al. 1999). Both genes consist of five exons with the
same intron/exon boundaries but share only 55% amino acid identity (Fig: 12). It has been
reported that about 20% of Caucasians are homozygous for a GSTT1 null allele (GSTT1-/-
). The GSTT1 null genotype is more common in Asians, with frequencies 47-64% (Grate
et al. 2001; Nelson et al. 1995).
Glutathione‐S‐Transferases Gene Deletion & Breast Cancer Risk
Page | 29
Figure 12: The GSTT1 gene is part of the Theta-class GST gene cluster at 22q11.2 (top of diagram). GSTT1 and GSTT2 are separated by approximately 50 kb. GSTT2 lies head-to-head with a gene encoding the D-dopachrome tautomerase (DDCT). The GSTT2 and DDCT genes have been duplicated in an inverted repeat. The duplicated GSTT2 is a pseudogene (named GSTT2P) because an abnormal exon 2/intron 2 splice site causes a premature translation stop. The GSTT1 gene (black box) consists of five exons, which range in size from 88 to 195 bp, while the introns vary from 205 to 2363 bp. The GSTT1 gene is embedded in a region with extensive homologies and flanked by two 18 kb regions, HA3 and HA5 (gray boxes), which are more than 90% homologous. In their central portions HA3 and HA5 share a 403-bp sequence with 100%identity. (Adopted from: Mini review on GST genotypes and cancer risk by Fritz F.Parl)
The GSTT1-/- deletion similar to GSTM1-/- is probably due to a homologous
recombination event involving the left and right 403-bp repeats. Similar to GSTM1,
numerous studies of the GSTT1 genotype employed a PCR-based analysis that identified
the wild-type allele (Pemble et al. 1994).
GST GENOTYPES & CANCER RISK Carcinogen metabolism genes are commonly affected by the single nucleotide
polymorphisms (SNPs). The complete deletion of a gene in form of a null genotype is
rare. That is why GSTM1 and GSTT1 null genotypes have attracted so many concerns of
scientists and become the spotlight in more than 500 publications in the field molecular
epidemiology. Basically all the studies are conducted on the hypothesis that the activity of
GST enzymes either normal or increased is responsible for defending the susceptible cells
from DNA mutations by the attack of electrophilic carcinogens with the help of
detoxification mechanism. So because of their active role in the detoxification
mechanism, the homozygous deletions of both GSTT1 and GSTM1 are expected to have
disability to eliminate the carcinogens from the body therefore placing the persons with
GSTM1 and GSTT1 Null genotypes at higher cancer risk.
It is well known that GSTs have overlapping substrate specificities therefore
deficiency of an individual GST iso enzyme is supposed to be compensated by other
isoforms. This is the reason that assessment of all GST genotypes is a basic requisite for
reliable analysis of the role of the GSTs in cancer growth. A number of molecular studies
Glutathione‐S‐Transferases Gene Deletion & Breast Cancer Risk
Page | 30
have reported the association between genotypes of one, two, or three GST subtypes and
breast carcinoma risk (Dunning et al. 1999; Mitrunen et al. 2001,). Nothing can be
concluded on the results obtained. An association among GSTs and cancer if found in one
study is negated by the other studies (Ambrosone et al. 1995; Kelsey et al. 1997; Bailey et
al. 1998; Coughlin et al. 1999; Garcia-Closas et al. 1999; Zhao et al. 2001). The
differences in results of these studies may be because of the variations among the studied
populations and the exposure of the individuals to different environmental and dietary
factors. GSTM1 and GSTT1 are not truly genotyped in any of the previous studies. Roodi
et al. and Sprenger et al. described the positive identification of the wild-type and null
alleles for GSTM1 and GSTT1 respectively, which allowed the exact explanation of the -/-
, +/+ and +/- genotypes and diversity among low, high and none conjugator phenotypes.
Associations between GSTM1 and GSTT1 null genotypes and breast cancer have been
reported with inconsistent results (Gudmundsdottir et al. 2001; Helzlsouer et al. 1998;
Mitrunen et al. 2001, Millikan et al. 2000) Therefore; we planned to conduct this study
for the first time in Pakistan to evaluate the influence of these GST genotypes in breast
cancer susceptibility in Pakistani population.
Glutathione‐S‐Transferases Gene Deletion & Breast Cancer Risk
Page | 31
MATERIAL AND METHODS
The proposed study was conducted according to the work plan essentially divided into
two phases and further sub divided as depicted below:
ANALYSIS OF GSTT1 AND GSTM1 NULL ALLELES
FIELD WORK BENCH WORK A)APPROVAL OF STUDY FROM INSTITUTIONAL REVIEW BOARD. A) DNA EXTRACTION
B)IDENTIFICATION AND ENROLLMENT OF SUBJECTS B)QUANTIFICATION OF DNA
C)COLLECTION OF BLOOD SAMPLES C)ANALYSIS OF GSTT1 AND GSTM1 NULL ALLELES BY MULTIPLEX PCR
FIELD WORK INSTITUTIONAL REVIEW BOARD (IRB)
Approval for this study was obtained from the Institutional Review Board (IRB) of
Institute of Biotechnology, Bahauddin Zakariya University, Multan. Informed consent
forms had been designed containing risks, facts and discomforts that might be anticipated
to influence an individual’s willingness to participate as a volunteer in a research project.
ENROLMENT OF SUBJECTS The present study consisted of 100 case subjects (females) with pathologically
confirmed breast cancer that were recruited from Department of Radiology and
Oncology, Nishter Hospital, Multan. A total of 204 healthy volunteer females were
included in the study as controls samples. The volunteers that took part in this study
belong to Multan, Layyah, and D. G Khan and Rajanpur areas of Southern Punjab
(Pakistan) belonging to different ethnic groups, and age ranges. The nature and purposes
of this study were presented to all the subjects and a proper informed consent was
obtained from them. Each subject (patients and controls) was asked to provide
information regarding age, marital status, menopause, age at menopause, smoking status,
family history of cancer, pregnancies, nature of work etc.
COLLECTION OF BLOOD SAMPLES Blood sampling of controls samples was performed during May to August, 2009 and
that of case samples from May, 2009 to March, 2010 visiting Department of
Radiotherapy and Oncology, Nishter Hospital, from different areas of the Southern
Punjab. 5ml of blood from all subjects was collected using sterilized disposable syringes
in 15 ml Sterilin® falcon tubes having 400µl EDTA (Ethylene Diamine Tetra Acetic
Acid) as anticoagulant, stored at -70°C till further processing.
Glutathione‐S‐Transferases Gene Deletion & Breast Cancer Risk
Page | 32
BENCH WORK DNA EXTRACTION
The genomic DNA was extracted by using a standardized non organic method
(Grimberg et al. 1989). With this method, DNA was extracted from white blood cells
(WBC) because the white blood cells are the only blood cells which are nucleated. The
protocol for DNA extraction is as follows: In 15 ml Sterilin® falcon tubes, 3-5 ml blood
samples were collected containing 400µl of 0.5 M EDTA. Samples were freezed at -70°C
for at least 20-30 minutes before processing. Samples can also be stored at -20°C for long
duration. The blood samples were thawed before processing to lyses the red blood cells
(RBC). TE buffer (10 mM Tris Hcl, 2mM EDTA, pH8.0) was added to fill the falcon
tubes volume for washing of blood samples. Samples were centrifuged at 3000 rpm for 20
minutes and supernatant was discarded for washing out lysed RBCs. Washing was
repeated three to four times till the white blood cells are free of hemoglobin and pellet
appears whitish . Proteins in the pellets of WBC were digested by adding the 0.5 mg of
proteinase k along with 200µl of SDS buffer in the presence of 6 ml TNE buffer (10mM
Tris HCl, 2mM EDTA, 400mM NaCl). Samples were left in shaking water bath for
overnight at 37°C and at a speed of 250rpm. By this, mixing takes place and ultimately
proteins digested. These digested proteins can be precipitated by adding 1ml of
supersaturated NaCl, followed by vigorous shaking and chilling on ice for 15 minutes and
then centrifuged at 2400 rpm. Supernatant is shifted to another Sterilin® falcon tube and
DNA was extracted from the supernatant by adding equal volume of Isopropanol. Wash
the DNA pellet with freshly prepared 70% ethanol. Dissolved the DNA in TE (10mM
Tris HCl, 2m M EDTA) buffer and heat it on 70°C for one hour in water bath. By this any
remaining nucleases and proteins inactivated. DNA can be stored at-20°C for long time.
QUANTIFICATION OF DNA Concentration of DNA was measured using Spectrophotometer by following method:
The optical Density (OD) was measured by spectrophotometer (Perklin Elmer Ltd,
UK) at 260nm.
50µG /ML X OD 260NMX200
After calculation of DNA concentration, working dilutions were prepared with final
concentration of 25ng/ul conc. and 2-4ul of each DNA dilution was used for setting up a
PCR reaction.
GSTT1/GSTM1 MULTIPLEX PCR & ANALYSIS Analysis of the GSTT1 & GSTM1 was performed by using a standard multiplex PCR
protocol with some changes to describe the presence or absence of GSTT1 and GSTM1
(Shaikh et al. 2010). This technique does not distinguish between the heterozygosity or
Glutathione‐S‐Transferases Gene Deletion & Breast Cancer Risk
Page | 33
homozygosity in genotypes of GSTT1 and GSTM1, but identifies the null genotypes i. e.
homozygous deletion. β-globin used as internal control to confirm the PCR amplification.
100ng of DNA was amplified in a total volume of 25 µl reaction mixture containing
8pmol of each primer (Table 7). Primers of GSTT1, GSTM1 and β-globin were got
synthesized commercially from Centre for Applied Molecular Biology (CAMB) Lahore,
Pakistan (Table 8). Multiplex PCR was performed with initial denaturation at 95°C for 5
minutes followed by 40 cycles of 94°C for 45 sec, annealing at 60°C for 45 sec and
extension at 72°C for 45 sec. Final extension was at 72°C for 7 mins (Fig: 13). PCR
products were electrophoresed on 2% agarose gel, stained with ethidium bromide and
visualized it on UV light. Presence and absence of bands represent the presence or
absence of null alleles of GSTT1and GSTM1. GSTT1 has a product size 473bp, β-globin
has 260bp product while the third GSTM1 has 210bp size. If β-globin band is absent it
means PCR reaction has failed.
TABLE 7: OLIGONUCLEOTIDES PRIMERS USED IN AMPLIFICATION
Figure 13: Profile of Multiplex PCR
GENES PRIMER TYPE SEQUENCE PRODUCT SIZE
GSTT1 FORWARD 5’TTCCTTACTGGTCCTCACATCTC3’ 473BP
REVERSE 5’ TCACCGGATCATGGCCAGCA 3’
GSTM1 FORWARD 5’GAACTCCCTGAAAAGCTAAAGC3’ 210BP
REVERSE 5’GTTGGGCTCAAATATACGGTGG3’
B-GLOBINS FORWARD 5’ CAACTTCATCCACGTTCACC3’ 260BP
REVERSE 5’ GAAGAGCCAAGGACAGGTAC3’
Glutathione‐S‐Transferases Gene Deletion & Breast Cancer Risk
Page | 34
TABLE 8: INGREDIENTS FOR MULTIPLEX PCR REACTION MIXTURE
INGREDIENTS CONCENTRATION VOLUME TAKEN FOR MULTIPLEX PCR REACTION (µL)
10X PCR BUFFER 10MM 2. 5
MAGNESIUM CHLORIDE 50MM 1.25
DNTPS 2. 5MM 0. 8
PRIMERS GSTT1 FORWARD 8µM 0. 5
REVERSE 0. 5
GSTM1 FORWARD 0. 5
REVERSE 0. 5
Β-GLOBIN
FORWARD 0. 5
REVERSE 0. 5
TEMPLATE DNA 25NG 4.0
TAQ DNA POLYMERASE 5U 0. 4
DISTILLED WATER 13.05
TOTAL REACTION MIX 25
STATISTICAL ANALYSIS Null allele frequency of GSTM1and GSTT1 in case and control subjects from Southern
Punjab was determined according to the Hardy–Weinberg equilibrium. Chi-Square test
was applied to evaluate the relation between null alleles of GSTM1 and GSTT1 with
disease, smoking, and age groups, pesticide, menopause etc using the SPSS 17 statistical
package for Windows.
Glutathione‐S‐Transferases Gene Deletion & Breast Cancer Risk
Page | 35
RESULTS
For the present study 204 healthy individual and 100 female patients of breast cancer
were enrolled. GSTM1 and GSTT1 genetic polymorphisms were analyzed using a
multiplex PCR procedure. The presence or absence of the genes was detected by the
presence or absence of 473 bp, 260bp and 210 bp bands corresponding to GSTT1, β-
globin and GSTM1 genes respectively. Β-globin was used as internal control to document
the successful PCR amplification. A picture of multiplex PCR products run on 2%
agarose gel stained with ethidium bromide is given below (Fig: 14).
Figure 14: Ethidium bromide-stained electrophoresed PCR products samples: 1 kb ladder (lane 9); GSTM1 and GSTT1 wild type (lanes 3, 4, 12 and 13, representing individuals BC 04, 06, 10, 12); GSTM1 null (lanes 5, 6, 14 and 15, representing individuals BC 07, 08, 11 ,25); GSTT1 null genotype (lanes 7, 8, 16 and 17, representing individuals BC 14, 15, 16, 17); concomitant deletion of both GSTM1 and GSTT1 (lanes 1, 2, 10 and 11, representing individuals BC 21, 30, 40, 49).
Different biological/physiological and environmental factors, thought to play some
role in breast cancer predisposition were considered and analyzed during the study (Table
9). Among the biological factors, age was firstly considered and individuals were
distributed in five age groups. It was observed that females belonging to the age group
36-45 years are more prone towards the breast cancer. Although age is significantly
related to breast cancer (p=0.00, Table 9, Fig: 15) but we cannot conclude any strong
association between age and disease as random sampling was done.
Results have shown that 49% of the patients had menopause, which are almost three
folds that of controls samples with menopause (11.3%, p=0.00). It was also observed that
more breast cancer patients (24%) belonged to same age group (36-45years) as mentioned
above (Table 9, Fig: 16). 20% of the patients reported a history of cancer in their family.
Our data suggest that individuals who have more than 3 pregnancies are exposed to a
higher risk of getting breast cancer (p=0.018, Table 9). Statistics show that marriage,
breast feeding, etc has no significant association with the genes and breast cancer.
However a weak association of breast cancer was observed with environmental factor
like smoking (p=0.078) and a significant association with pesticides exposure (p=0.042),
Glutathione‐S‐Transferases Gene Deletion & Breast Cancer Risk
Page | 36
though on further analysis of pesticides exposure along with GSTM1, GSTT1 genes and
breast cancer no significant evidence was observed (p=0.559, Table 13).
It was observed that null genotype of GSTT1 is present in 25.98 % (79) of individuals
while 225 of the total 304 individuals (74.01%) carry the wild type genotype. GSTT1 wild
genotype was present almost in the same ratio in normal and affected persons i.e. 74.5%
and 73% respectively, while its null genotype was found at a little higher percentage
(27%) in breast cancer patients as compared to (25. 5 %) in control individuals (Table
10). Above allele frequencies and statistical analysis clearly depicts that GSTT1 is not
associated with breast cancer (p=0.08, Table 10).
GSTM1 wild type allele was present in 54.27% (165) individuals while its null allele
was found in 45.7% (139) individuals. Presence of the GSTM1 wild type allele among the
control and case was found to be 52.9% and 57% respectively, while 46.1% and 43% of
normal and affected individuals, respectively, carry null allele of GSTM1 (Table 10).
Statistically no significant relationship was found between the patient’s phenotype and
different categories of GSTM1 (p=0.445) and hence we may conclude that distribution of
GSTM1 null genotype remains the same for normal as well as affected individuals.
Cross tabulation of GSTT1 and GSTM1 with the disease represents that 9.86% (30) of
the all the individuals showed null mutation for both GSTM1 and GSTT1 genes and
38.15% of the individuals had both the wild type GSTT1 and GSTM1 genes, while
51.97% of individuals have either any one of the both genes deleted. As frequency of null
alleles of GSTM1 and GSTT1 genes is almost similar in patients and control so no
significant association of these genes was detected with the breast cancer, moreover, it is
proved that presence and absence of one gene has no effect on the occurrence of other
gene (Table 11).
Statistical analysis between the two genes (GSTM1 & GSTT1), menopause and the
breast cancer show significant results, that with null mutation of both the genes the
percentages of patients either having menopause or no menopause was similar i.e. 50%.
On the contrary, percentage of null mutations of both the genes in normal individuals
having menopause or no menopause are 10% and 90%, respectively, showing a
significant association with the disease either due to genes deletion or combination with
menopause. While when only GSTM1 or GSTT1 was deleted the percentage of patients
having menopause is 54.5% and 58.5%, respectively, which is more than those without
menopause, 45.5% and 41.2%, respectively (Table 12).
Glutathione‐S‐Transferases Gene Deletion & Breast Cancer Risk
Page | 37
TABLE 9: SELECTED CHARACTERISTIC FOR CASE & CONTROLS INDIVIDUALS OF SOUTHERN PUNJAB, PAKISTAN.
CHARACTERISTICS CATEGORY NORMAL N=204
AFFECTED N=100
CHI SQUARE TEST /P-VALUE
AGE 15-25Y 65 (31.9%) 1 (1%) 65.27/P<0.001*** 26-35Y 68 (33.3%) 19 (19%) 36-45Y 8 (3.9%) 24 (24%) 46-55Y 15 (7.4%) 20 (20%) 60+Y 1 (0.5%) 5 (5%)
MENOPAUSE NO 181 (88.7%) 51 (51%) 52.839/ P<0.001*** YES 23 (11.3%) 49 (49%)
AGE AT MENOPAUSE
N/A 181 (88.7%) 52 (52%) 54.992/ P<0.001*** 26-35 0 (0) 4 (4%) 36-45 8 (3.9%) 24 (24%) 46-55 15 (7.4%) 20 (20%)
MARRIAGE NO 40 (19.6%) 3 (3%) 15.241/ P<0.001*** YES 164 (80.4%) 97 (97%)
MARRIAGE AGE NO 41 (20.1%) 4 (4%) 17.138/ P=0.001*** 10-20Y 119 (58.3%) 60 (60%) 21-30Y 42 (20.6%) 34 (34%) 31-40Y 2 (1%) 2 (2%)
BREAST CANCER AGE
NO 204 (100%) 0 (0%) 304.0/ P<0.001*** 15-25Y 3 (3%) 26-35Y 23 (23%) 36-45Y 43 (43%) 46-55Y 22 (22%) 56+ Y 9 (9%)
HISTORY OF BREAST CANCER
YES 0 (0%) 20 (20%) 43.673/ P<0.001*** NO 100 (100%) 80 (80%)
AGE AT FIRST PREGNANCY
NO 53 (26.0%) 13 (13.0%) 12.573/P=0.014*** 10-15Y 10 (4.9%) 3 (3%) 16-20Y 74 (36.3%) 32 (32%) 21-30Y 63 (30.95%) 48 (48%)
TOTAL NUMBER OF PREGNANCIES
NO 53 (26%) 14 (14%) 13.169/P=0.018** 1-3 TIMES 62 (30.4%) 22 (22%) 4-6TIMES 52 (25.5%) 44 (44%)7-9TIMES 28 (13.7%) 16 (16%) 10-12TIMES 7 (3.4%) 3 (3%)
BREAST FEEDING NO 78 (38.2%) 18 (18%) 12.717/P<0.001*** YES 126 (61.8%) 82 (82%)
LAST BREAST FEEDING AGE
NO 57 (27.9%) 16 (16%) 12.897/P=0.005*** 15-25Y 35 (17.2%) 8 (8%)26-35Y 79 (38.7%) 52 (52%) 36-45Y 33 (16.2%) 24 (24%)
SMOKING NO 184 (90.2%) 96 (96%) 3.109/P=0.078NS YES 20 (9.8%) 4 (4%)
EDUCATION NO 94 (46.1%) 62 (62%) 7.071/P=0.132NS UP TO MIDDLE
52 (25.5%) 17 (17%)
UP TO 10TH 38 (18.6%) 13 (13%) UP TO 12TH 9 (4.4%) 3 (3%)
PESTICIDES NO 150 (73.5%) 84 (84%) 4.151/P=0.042* YES 54 (26.5%) 16 (16%)
***: Highly Significant, **: Significant, *: Marginally Significant, NS: Non Significant
Hence collectively we can say that though data has shown that the percentage of
women having GSTM1 null mutation (43%) are more sufferers of breast carcinoma than
those with the GSTT1 null mutation (27%) but due to non significant results obtained it
Glutathione‐S‐Transferases Gene Deletion & Breast Cancer Risk
Page | 38
cannot be concluded that deletion of these genes is associated with breast cancer in our
population (Table 10). Although it can be concluded that menopause and gene deletions
are collectively increasing the tendency of women to be exposed to breast cancer (Table
12).
TABLE 10: CROSS TABULATION OF GSTM1 & GSTT1 WITH BREAST CANCER
TABLE 11: CROSS TABULATION OF GSTM1 & GSTT1 COMBINATION WITH BREAST CANCER
***: Highly Significant, **: Significant, *: Marginally Significant, NS: Non Significant
GENES NORMAL
N=204
AFFECTED
N=100
TOTAL
N=304
STATISTICAL TESTS
CHI SQUARE
STATISTIC/P-
VALUE
LIKELIHOOD
RATIO
STATISTIC/P-VALUE
GSTT1
(+/+ , +/-)
152 (74.5%) 73 (73%) 225 (74.01%) 0.782/P=0.080NS 0.778/0.079
GSTT1
(-/-)
52 (25.5%) 27 (27%) 79 (25.98%)
GSTM1
(+/+ , +/-)
108 (52.9%) 57 (57%) 165 (54.27%) 0.541/P=0.445NS 0.504/0.446
GSTT1
(-/-)
96 (46.1%) 43 (43%) 139 (45.7%)
GENES NORMAL
N=204
AFFECTED
N=100
TOTAL
N=304
GSTM1-/GSTT1- 20 (9.8%) 10 (10%) 30 (9.86%)
GSTM1-/GSTT1+ 76 (37.25%) 33 (33%) 109 (35.85%)
GSTM1+/GSTT1- 32 (15.68%) 17 (17%) 49 (16.11%)
GSTM1+/GSTT1+ 76 (37.25%) 40 (40%) 116 (38.15%)
Glutathione‐S‐Transferases Gene Deletion & Breast Cancer Risk
Page | 39
Figure 15: Graph representing frequency of different age groups among affected and normal subjects
Figure 16: Graph representing frequency of menopause in different age groups among affected and normal subjects
TABLE 12: CROSS TABULATION OF GENE COMBINATIONS OF GSTM1, GSTT1 & MENOPAUSE WITH BREAST CANCER
TABLE 13: CROSS TABULATION OF GENE COMBINATIONS OF GSTM1, GSTT1 & PESTICIDE EXPOSURE WITH BREAST CANCER
***: Highly Significant, **: Significant, *: Marginally Significant, NS: Non Significant
GENE COMBINATION
POST MENOPAUSE PRE MENOPAUSE TOTAL STATISTICAL TESTS
CHI-SQUARE LIKELIHOOD RATIO
NORMAL AFFECTED NORMAL AFFECTED STATISTIC/P-VALUE
STATISTIC/P-VALUE
GSTM1-/GSTT1- 2(10%) 5(50%) 18(90%) 5(50%) 30(9.86) 5.963/P=0.015** 5.73/0.017 GSTM1-/GSTT1+ 7(9.2%) 18(54.5%) 69(90.8%) 15(45.5%) 109(35.8) 26.755/P=0.00*** 25.196/0.00 GSTM1+/GSTT1- 5(15.6%) 10(58.8%) 27(84.4%) 7(41.2%) 49(16.11) 9.754/P=0.002*** 9.592/0.002
GSTM1+/GSTT1+ 9(11.8%) 16(40%) 67(88.2%) 24(60%) 116(38.15) 12.29/P=0.00*** 11.779/0.001
GENE COMBINATION
PESTICIDE EXPOSED PESTICIDE NOT EXPOSED
TOTAL STATISTICAL TESTS
CHI-SQUARE LIKELIHOOD RATIO
NORMAL AFFECTED NORMAL AFFECTED STATISTIC/P-VALUE
STATISTIC/P-VALUE
GSTM1-/GSTT1- 6(20%) 2(6.7%) 14(46.7%) 8(26.7%) 30(9.86) 0.341/P=0.559NS 0.330/0.566 GSTM1-/GSTT1+ 17(15.6%) 5(4.6%) 59(54.1%) 28(25.7%) 109(35.8) 0.744/P=0.388 NS 0.775/0.379GSTM1+/GSTT1- 10(20.4%) 4(8.2%) 22(44.9%) 13(26.5%) 49(16.11) 0.342/P=0.569 NS 0.331/0.569 GSTM1+/GSTT1+ 21(18.1%) 5(4.3%) 55(47.4%) 35(30.2%) 116(38.15) 3.451/P=0.063* 3.71/0.054
Glutathione‐S‐Transferases Gene Deletion & Breast Cancer Risk
Page | 41
DISCUSSION
We know that GSTs (GSTT1 & GSTM1) belong to the group of low penetrance genes,
which might be involved in the process of carcinogenesis. Primary reason to study
GSTM1 and GSTT1 polymorphisms and their possible correlation to breast cancer is
based on the fact that Southern Punjab is an agricultural and highly populated areas and
lack of an efficient detoxification system might increase the risk of getting breast cancer
in this population. The GST family catalyzes reactive carcinogenic intermediates,
produced through the phase I metabolism of environmental toxins. The genes of the GST
families are under the control of the aryl hydrocarbon receptor, which binds toxic
chemicals such as dioxin, an environmental pollutant thought to be involved in breast
cancer development (Perera et al. 1995). The influence of these deletion polymorphisms
has already been determined in other cancers such as lung cancer, ovarian cancer (Perera
et al. 1995), bladder cancer (Song et al. 2009), Colon cancer (Huang et al. 2006), oral
cancer (Sreelekha et al. 2001), Acute Lymphoblastic Leukemia (Chacko et al. 2004), lung
cancer (Sreeja et al. 2005) in various populations, which lead us to hypothesize that
GSTM1 and GSTT1 null mutations may also contribute to the origin of breast cancer in
our population.
In the present study, it is found that frequency of GSTM1 null genotype in Southern
Punjab women of Pakistan is 45.7%, which is significantly higher than all Indian
populations (Table 14). Similarly, GSTT1 null genotype frequency (25.98%) is also
higher than North and South Indian populations, whereas it is lower than that of Delhi
population (Table 14). While our results are found to be in line with the results of a
previous study on frequency distribution of GSTT1 and GSTM1 in Pakistani Population
(Shaikh et al. 2010). From these results, it is suggested that Population of Southern
Punjab is distinctive and are not descendant of migrants from India during 1890–1947.
These opinions are further supported by some previous studies in which researchers
compared Indian populations and some populations of Singapore based on frequencies of
GSTM1 and GSTT1 null genotypes, suggesting that Singapore populations were
descendants of migratory Indian population (Lee et al. 1995; Zhao et al. 1995). Similar
results were also observed in frequency distribution of CYP2D6 gene in Malaysian
Indians and South Indians (Adithan et al. 2003). However, to confirm this hypothesis
genotyping of more individuals is necessary. In addition, frequency of GSTM1 and
GSTT1 null allele is higher in Chinese and Japanese populations than that in population
from Southern Punjab indicating that population from Southern Punjab is distinct from
Glutathione‐S‐Transferases Gene Deletion & Breast Cancer Risk
Page | 42
both these racial groups (Table 14). Although Polish and Italian populations are
comparable in frequency distribution of GSTM1 null allele but Southern Punjab
population has a significantly higher frequency of GSTT1 null allele, suggesting that
Southern Punjab population is distinct from both Polish and Italian populations (Table
14).
Our case control study of South Punjab population showed that GSTM1 and GSTT1
null genotypes were not associated with breast cancer among the Pakistani women. But a
higher risk was observed for either the deletions of both GSTT1 and GSTM1 or only one
of them, with menopause, depicting that the post menopausal women are more prone
towards the breast cancer either due to gene deletions or any hormonal effect. Previous
studies conducted on post menopausal women of Iowa showed that the null genotypes of
GSTM1 or GSTT1 are associated with an elevated risk of breast cancer compared with
women who had both genes (Zheng et al. 2001).
Previous studies on the role of these genotypes in breast carcinoma had shown
discrepant results (Ambrosone et al. 1995; Chacko et al. 2005; Curran et al. 2000; Egan
et al. 2004; Garcia et al. 1999; Gudmundsdottir et al. 2001; Helzlsouer et al. 1998;
Mitrunen et al.2001). The first possible link between GSTM1 deletion and breast cancer
risk was suggested from a hospital based case-control study, in which 47.7% of cases and
41.8% of controls were found to have the null GSTM1 genotype (Zhong et al.1993).
Several successive case-control studies (Charrier et al.1999; Ambrosone et al.1995;
Zheng et al.2001) also found a weak to moderate positive association. The strongest
association was reported by Helzlsouer et al.1998 they found a 2.5-fold elevated breast
cancer risk among postmenopausal women with the null GSTM1 genotype. In another
study done on Southern Taiwan's women, poor detoxification ability in the GST group
was hypothesized to contribute to an increased risk of breast cancer, and women
harboring putative high-risk alleles ( GSTM1 and GSTT1 deletion alleles) were considered
to be at higher risk of cancer (Wang et al. 2006).
In contrast to above findings and analogous to our results, several other studies
including the nurses' health study (Bailey et al. 1998; Milikan et al.2000; Garcia et al.
1999) showed no association between the GSTM1 genotype and breast cancer risk.
Another report based on a study in breast cancer cases irrespective of family history in
South Indian population also showed no significant role for GSTM1 in breast
carcinogenesis (Samson et al.2007).
Although not as extensively investigated as the GSTM1 polymorphism, GSTT1
deletion has also been evaluated in relation to the risk of breast cancers in five
Glutathione‐S‐Transferases Gene Deletion & Breast Cancer Risk
Page | 43
epidemiologic studies with conflicting results. A positive association between GSTT1
polymorphism and breast cancer was found by two previous studies (Gudmundsdottir et
al. 2001; Helzlsouer et al. 1998). While our findings were supported by the three other
studies, in which, GSTT1 deletion was not related to the risk of breast cancer (Garcia et
al. 1999; Curran et al. 2000; Milikan et al. 2000). In fact, the risk was even reduced in
certain subgroups of women who had the GSTT1 null genotype (Garcia et al. 1999;
Curran et al. 2000).
Thus our results are in line with the results of the previous studies on South Indian
populations (Samson et al.2007) as well as that of another case-control study conducted
on women in urban Shanghai which was the largest and most comprehensive examination
of GST polymorphisms in relation to breast cancer risk which also indicated no overall
relationship of the GSTM1 or GSTT1 deletion variants with breast cancer risk in
premenopausal or in postmenopausal women (Kathleen et al.2004).
To end with we can conclude that the frequency of GSTM1 and GSTT1 null genotype
in Southern Punjab population is different from those found in other populations as well
as the deletion of these genes is not associated with breast cancer in our population. The
reason behind can be postulated as, because Southern Punjab population differs
considerably in the rate of metabolism, activation/deactivation of xenobiotics than other
populations of the world. We suppose that this data will provide a basic record for the
future clinical and genetic studies related to variability in the response or toxicity to
xenobiotics/drugs known to be substrates of glutathione-S-transferases. It is suggested
that comprehensive and vast studies are highly recommended in order to expose the
genetic as well as environmental factors in cancer disposition.
Glutathione‐S‐Transferases Gene Deletion & Breast Cancer Risk
Page | 44
TABLE 14: COMPARATIVE FREQUENCY DISTRIBUTION OF GSTM1 AND GSTT1 IN VARIOUS POPULATIONS
Population/Country N GSTM1 Null % GSTT1 Null % Reference Pakistan 304 45.7 25.98 Present Study Southern, Pakistan 111 45 23 Shaikh et al. 2010 North India 370 33 18.4 Mishra et al. 2004 South India 517 30.4 16.8 Naveen et al. 2004 Delhi, India 309 21 27.4 Singh et al. 2009 Newcastle, England 178 50.8 16.9 Welfare et al. 1999 Turkish 133 51.9 17.3 Ada et al. 2004 Italians 273 46.9 19 D’Alo et al. 2004 Polish 233 47.6 16.3 Kargas et al. 2003 Chinese 477 51 46 Setiawan et al. 2000 Caucasian 166 48.8 19.9 Gsur et al. 2001 Japanese 150 51.3 54 Naoe et al. 2000 Slovenia 102 52 25.5 Garte et al. 2001 Spain 312 49.7 20.5 Garte et al. 2001 Greek 165 38.8 18.8 Stavropoulou et al. 2007 Finnish Caucasians 478 41.8 13.2 Mitrunen et al. 2001 African Americans 271 28 17 Millikan et al. 2000 Whites (USA) 392 52 16 Millikan et al. 2000 Brazilian non Whites 272 34.2 25.7 Rossini et al. 2002 Brazilian Whites 319 48.9 25.1 Rossini et al. 2002 Ovambos (Namibia) 134 11.2 35.8 Fujihara et al. 2009 Mongolians (Ulaanbaatar)
207 46.6 25.6 Fujihara et al. 2009
Glutathione‐S‐Transferases Gene Deletion & Breast Cancer Risk
Page | 45
REFERENCES
Ambrosone CB, Freudenheim JL, Graham S, Marshall JS, Vena JE, Brasure JR et al
(1995) Cytochrome P4501A1 and glutathione S-transferase (M1) genetic polymorphisms
and postmenopausal breast cancer risk. Cancer Res 55: 3483–3485
Appelt LC, Reicks MM Soy feeding induces Phase II enzymes in rat tissues. Nutr
Cancer 28(3): 270-275
Bailey LR, Roodi N, Verrier CS, Yee CJ, Dupont WD, Parl FF (1998) Breast cancer
and CYP1A1, GSTM1, and GSTT1 polymorphisms: evidence of a lack of association in
Caucasians and African Americans. Cancer Res 58: 65–70
Bandmann O, Vaughan J, Holmans P et al (1997) Association of slow acetylator
genotype for Nacetyltransferase 2 with familial Parkinson’s disease. Lancet 350:1136-
1139
Barch DH, Rundhaugen LM (1994) Ellagic acid induces NAD(P)H:quinone reductase
through activation of the antioxidant responsive element of the rat NAD(P)H:quinone
reductase gene. Carcinogenesis 15:2065-2068
Barch DH, Rundhaugen LM, Pillay N (1995) Ellagic acid induces transcription of the
rat glutathione S-transferase-Ya gene. Carcinogenesis 16:665-668
Benet LZ, Kroetz DL, Sheiner LB (1996) Pharmacokinetics: The dynamics of drug
absorption, distribution, and elimination. In: Molinoff PB, Ruddon RW, Goodman
Gilman A (eds) The Pharmacological Basis Of Therapeutics. 9thedn. New York,
McGraw-Hill, pp 3-27
Bhurgri Y, Bhurgri A, Hasan SH, Usman A, Faridi N, Malik J et al (2002) Cancer
pattern in Karachi division (1998-1999). J Pak Med Assoc 52: 244-6
Board PG, Coggan M, Chelvanayagam G, Easteal S, Jermiin LS, Schulte GK et al
(2000) Identification, characterization and crystal structure of the omega class glutathione
transferases. J Biol Chem 275: 24798–24806
Chacko P, Joseph T, Mathew BS et al (2005) Role of xenobiotic metabolizing gene
polymorphisms in breast cancer susceptibility and treatment outcome. Mutat Res 581:
153–163
Chang TW, Wang SM, Guo YL, Tsai PC, Huang CJ, Huang W. (2006) Glutathione S-
transferase polymorphisms associated with risk of breast cancer in southern Taiwan.
Breast 15 (16): 754–761
Glutathione‐S‐Transferases Gene Deletion & Breast Cancer Risk
Page | 46
Charrier J, Maugard CM, LeMevel B, Bignon YJ (1999) Allelotype influence at
glutathione S-transferase M1 locus on breast cancer susceptibility. Br J Cancer 79: 346–
353
Coggan M, Whitbread L, Whittington A, Board P (1998) Structure and organization of
the human theta-class glutathione Stransferase and D-dopachrome tautomerase gene
complex. Biochem J 334: 617–623
Coughlin SS, Piper M (1999) Genetic polymorphisms and risk of breast cancer.
Cancer Epidemiol Biomark Prev 8: 1023–1032
Curran JE, Weinstein SR, Griffiths LR (2000) Polymorphisms of glutathione S-
transferase genes (GSTM1, GSTP1 and GSTT1) and breast cancer susceptibility. Cancer
Lett 153: 113–120
Daly AK, Cholerton S, Gregory W, Idle J (1993) Metabolic polymorphisms. Pharmac
Ther 57:129-160
Dunning AM, Healey CS, Pharoah PDP, Teare MD, Ponder BAJ, Easton DF (1999) A
systematic review of genetic polymorphisms and breast cancer risk. Cancer Epidemiol
Biomark Prev 8: 843–854
Egan KM, Cai Q, Shu XO et al (2004) Genetic polymorphisms in GSTM1, GSTP1,
and GSTT1 and the risk for breast cancer: results from the Shanghai Breast Cancer Study
and meta-analysis. Cancer Epidemiol Biomarkers Prev 13: 197–204
Egan KM, Cai Q, Shu XO, Jin F, Zhu TL, Dai Q, Gao YT, Zheng W. (2004) Genetic
Polymorphisms in GSTM1, GSTP1, and GSTT1 and the Risk for Breast Cancer: Results
from the Shanghai Breast Cancer Study and Meta-Analysis Cancer Epidemiology
Biomarkers & Prevention 13(2): 197–204
Elangovan V, Sekar N, Govindasamy S (1994) Chemopreventive potential of dietary
bioflavonoids against 20-methylcholanthreneinduced tumorigenesis. Cancer Lett 87:107-
113
Garcia CM, Kelsey KT, Hankinson SE, Spiegelman D, Springer K, Willett WC et al
(1999) Glutathione S-transferase mu and theta polymorphisms and breast cancer
susceptibility. J Natl Cancer Inst 91: 1960–1964
Garte S, Gaspari L, Alexandrie, Ambrosone C, Autrup H, Aurup JL et al (2001)
Metabolic gene polymorphism frequencies in control populations. Cancer Epidemiol
Biomark Prev 10: 1239–1248
Goldberg RJ (1996) The P-450 System: Definition and relevance to the use of
antidepressants in medical practice. Arch Fam Med 5: 406-412
Glutathione‐S‐Transferases Gene Deletion & Breast Cancer Risk
Page | 47
Gudmundsdottir K, Tryggvadottir L, Eyfjord JE (2001) GSTM1, GSTT1, and GSTP1
genotypes in relation to breast cancer risk and frequency of mutations in the p53 gene.
Cancer Epidemiol Biomarkers Prev 10: 1169–1173
Guengerich FP (1984) Effects of nutritive factors on metabolic processes involving
bioactivation and detoxification of chemicals. Ann Rev Nutr 4:207-231
Guengerich FP (1995) Influence of nutrients and other dietary materials on
cytochrome P450 enzymes. Am J Clin Nutr 61 (3 Suppl): 651S-658S.
Gustavson LE, Benet LZ (1994) Menopause: Pharmacodynamics and
pharmacokinetics. Exp Gerontol 29: 437-444
Haydes JD, Pulford DJ (1995) The glutathione S-transferase supergene family:
regulation of GST and the contribution of the isoenzymes to cancer chemoprotection and
drug resistance. Crit Rev Biochem Mol Biol 30: 445–600
Helzlsouer KJ, Selmin O, Huang H, Strickland PT, Hoffman S, Alberg AJ, Watson M,
Comstock GW, Bell D (1998) Association between glutathione S-transferase M1, P1, and
T1 genetic polymorphisms and development of breast cancer. J Natl Cancer Inst 90: 512–
518
Huang K, Sandler RS, Milikan RS, Schroeder JC, North KE (2006) GSTM1 and
GSTT1 polymorphisms, cigarette smoking, and risk of colon cancer: a population-based
case-control study in North Carolina (United States). Cancer Causes Control 17: 385–394
Hulka BS, Stark AT (1995) Breast cancer: Causes and Prevention. Lancet 346:883-
887
Iarbovici D (1997) Single blood test might predict drugs’ effects on patients. J NIH
Res 9: 34-45
International Agency for Research on Cancer (IARC) (2002) IARC Handbook on
Cancer Prevention No. 7: Breast Cancer Screening. Lyon, France: IARC Press.
Ip C, Lisk DJ (1997) Modulation of Phase I and Phase II xenobiotic-metabolizing
enzymes by selenium-enriched garlic in rats. Nutr Cancer 28: 184-188
Jamal S, Moghal S, Mamoon N, Mushtaq S, Luqman M, Anwar M (2006) The pattern
of malignant tumours: Tumour registry data analysis, AFIP, Rawalpindi Pakistan. J Pak
Med Assoc 56: 359-62
Joeres R, Klinker H, Heusler H et al (1988) Influence of smoking on caffeine
elimination in healthy volunteers and in patients with alcoholic liver cirrhosis.
Hepatology 8: 575-579
Glutathione‐S‐Transferases Gene Deletion & Breast Cancer Risk
Page | 48
Joseph T, Kusumakumary P, Chacko P et al (2004) Genetic polymorphism of
CYP1A1, CYP2D6, GSTM1 and GSTT1 and susceptibility to acute lymphoblastic
leukaemia in Indian children. Pediatr Blood Cancer 43: 560–567
Kall MA, Clausen J (1995) Dietary effect on mixed function P450 1A2 activity
assayed by estimation of caffeine metabolism in man. Hum ExpToxicol 14: 801-807
Kawajiri K, Nakachi K, Imai K et al (1990) Identification of genetically high risk
individuals to lung cancer by DNA polymorphisms of the cytochrome P4501A1 gene.
FEBS Lett 263: 131-133
Kelsey KT, Hankinson SE, Colditz GA, Springer K, Garcia-Closas M, Spiegelman D
et a (1997) Glutathione S-transferase class m deletion polymorphism and breast cancer:
results from prevalent versus incident cases. Cancer Epidemiol Biomark Prev 6: 511–515
Kieff E, Rickinson AB (2001) Epstein-Barr virus and its replication. In: Knipe DM,
Howley PM (ed) Fields virology. Philadelphia: Lippincott Williams & Wilkins. pp 2511-
73
Landi S (2000) Mammalian class theta GST and differential susceptibility to
carcinogens: a review. Mutation Res 463: 247–283
Lee WM (1995) Drug-induced hepatotoxicity. N Engl J Med 333: 1118-1127
Levy G, Yamada H (1971) Drug biotransformation interactions in man III:
Acetaminophen and salicylamide. J Pharmaceut Sci 60: 215- 221
Mannervik B, Awasthi YC, Board PG, Hayes JD, Ilio CD, Ketterer B et al (1992)
Nomenclature for human glutathione transferases. Biochem J 282: 305–308
Manson MM, Ball HWL, Barrett MC et al (1997) Mechanism of action of dietary
chemoprotective agents in rat liver: induction of phase I and II drug metabolizing
enzymes and aflatoxin B1 metabolism. Carcinogenesis 18: 1729-1738
Maurel P (1996) The CYP3 Family. In: Ioannides C (ed) Cytochromes P450:
Metabolic And Toxicological Aspects. Boca Raton, FL: CRC Press, Inc, pp: 241-270
Meyer UA, Zanger UM, Skoda RC et al (1990) Genetic polymorphisms of drug
metabolism. Prog Liver Dis 9:307-323
Millikan R, Pittman G, Tse C-K, Savitz DA, Newman B, Bell D (2000) Glutathione S-
transferases M1, T1, and P1, and breast cancer. Cancer Epidemiol Biomark Prev 9: 567–
573
Mitrunen K, Jourenkova N, Kataja V, Eskelinen M, Losma V-M, Benhamou S, Vainio
H, Uusitupa M, Hirvonen A, GlutaW Zheng et al (2001) thione S- transferase M1, M3,
P1, and T1 genetic polymorphisms and susceptibility to breast cancer. Cancer Epidemiol
Biomark Prev 10: 229–236
Glutathione‐S‐Transferases Gene Deletion & Breast Cancer Risk
Page | 49
Monks TJ, Anders MW, Dekant W, Stevens JL, Lau SS, van Bladeren PJ (1990)
Glutathione conjugate mediated toxicities. Toxicol Appl Pharmacol 106: 1–19
Motzer RJ, Bander NH, Nanus DM (1996) Renal-cell carcinoma. The New England
journal of medicine 335 (12): 865-875
Murphy WM, Beckwith JB, Farrow GM (1994) Tumors of the kidney, bladder, and
related urinary structures. Armed Forces Institute of Pathology, Washington, DC.
Nebert DW, Petersen DD, Puga A (1991) Human AH locus polymorphism and cancer:
inducibility of CYP1A1 and other genes by combustion products and dioxin.
Pharmacogenetics 1: 68-78
Nelson HH, Wiencke JK, Christiani DC, Cheng TJ, Zuo ZF, Schwartz BS et al (1995)
Ethnic differences in the prevalence of the homozygous deleted genotype of glutathione
S-transferase theta. Carcinogenesis 16: 1243– 1245
Offord EA, Mace K, Ruffieux C et al (1995) Rosemary components inhibit
benzopyrene induced genotoxicity in human bronchial cells. Carcinogenesis 16: 2057-
2062
Pantuck EJ, Pantuck CB, Garland WA et al (1979) Stimulatory effect of brussels
sprouts and cabbage on human drug metabolism. Clin Pharm Ther 25: 88-95
Park BK, Kitteringham NR, Pirmohamed M, Tucker GT (1996) Relevance of
induction of human drug-metabolizing enzymes: pharmacological and toxicological
implications. Br J Clin Pharmacol 41: 477-491
Parkin, DM, Bray F, Ferlay J, Pisani P (2005) Global cancer statistics, 2002. CA: A
Cancer Journal for Clinicians 55(2): 74-108
Parsons WD, Neims AH (1978) Effect of smoking on caffeine clearance. Clin
Pharmacol Ther 24: 40-45
Pearson WR, Vorachek WR, Xu SJ, Berger R, Hart J, Vannais D, Patterson D (1993)
Identification of class-mu glutathione transferase genes GSTM1–GSTM5 on human
chromosome 1p13. Am J Hum Genet 53: 220–233
Pemble S, Schroeder KR, Spencer SR, Meyer DJ, Hallier E, Bolt HM et al (1994)
Human glutathione Stransferase theta (GSTT1): cDNA cloning and the characterization
of a genetic polymorphism. Biochem J 300: 271–276
Pemble SE, Taylor JB (1992) An evolutionary perspective on glutathione transferases
inferred from class-theta glutathione transferase cDNA sequences. Biochem J 287: 957–
963
Glutathione‐S‐Transferases Gene Deletion & Breast Cancer Risk
Page | 50
Perera FP, Estabrook A, Hewer A, Channing K, Rundle A, Mooney LA, Whyatt R,
Phillips DH (1995) Carcinogen-DNA adducts in human breast tissue. Cancer epidemiol
Biomarkers and Prevention 4: 233-238
Peto R, Darby S, Deo H et al (2000) Smoking, smoking cessation, and lung cancer in
the UK since 1950: combination of national statistics with two case-control
studies. BMJ 321: 323–9
Poirier MC, Santella RM, Weston A (2000) Carcinogen macromolecular adducts and
their measurement.Carcinogenesis 21: 353–9
Rebbeck TR (1997) Molecular epidemiology of the human glutathione S-transferase
genotypes GSTM1 and GSTT1 in cancer susceptibility. Cancer Epidemiol Biomark Prev
6: 733–743
Ritchie JC, Cloan TP, Idle JR, Smith RL (1980) Ciba Foundation Symposium 76:
Toxicological implications of polymorphic drug metabolism. Excerpta Medica 219-244.
Roodi N, Dupont WD, Moore JH, Parl FF (2004) Association of homozygous wild-
type glutathione S-transferase M1 (GSTM1) genotype with increased breast cancer risk,
Cancer Res 64: 1233–1236
Samson M, Swaminathan R, Rama R et al (2007) Role of GSTM1 (Null/Present),
GSTP1 (Ile105Val) and P53 (Arg72Pro) genetic polymorphisms and the risk of breast
cancer: a case control study from South India. Asian Pac J Cancer Prev 8(2): 253–257
Seidegard J, Vorachek WR, Pero RW, Pearson WR (1988) Hereditary differences in
the expression of the human glutathione transferase active on trans-stilbene oxide are due
to a gene deletion. Proc Natl Acad Sci USA 85: 7293–7297
Shields PG, Harris CC (2000) Cancer risk and low-penetrance susceptibility genes in
gene-environment interactions. J Clin Oncol 18: 2309–15
Slattery JT, Wilson JM, Kalhorn TF, Nelson SD (1987) Dose-dependent
pharmacokinetics of acetaminophen: Evidence of glutathione depletion in humans. Clin
Pharmacol Ther 41: 413-418
Smith TJ, Yang CS (1994) Effects of food phytochemicals on xenobiotic metabolism
and tumorigenesis. In: Food Phytochemicals I: Fruits and Vegetables. Washington, DC.
American Chemical Society Press 17-48
Sprenger R, Schlagenhaufer R, Kerb R, Bruhn C, Brockmoller J, Roots T, Brinkmann
U (2000) Characterization of the glutathione S-transferase GSTT1 deletion:
discrimination of all genotypes by polymerase chain reaction indicates a trimodular
genotype–phenotype correlation. Pharmacogenetics 557–565
Glutathione‐S‐Transferases Gene Deletion & Breast Cancer Risk
Page | 51
Sreeja L, Syamala V, Hariharan S et al (2005) Possible risk modification by CYP1A1,
GSTM1 and GSTT1 gene polymorphisms in lung cancer susceptibility in a South Indian
population. J Hum Genet 50: 618–627
Sreelekha TT, Ramadas K, Pandey M et al (2001) Genetic polymorphism of CYP1A1,
GSTM1 and GSTT1 genes in Indian oral cancer. Oral Oncol 37: 593–598
Strange RC, Spiteri MA, Ramachandran S, Fryer A (2001) Glutathione-S-transferase
family of enzymes. Mutat Res 482: 21–26
Turner FC (1941) Sarcomas at sites of subcutaneous implanted Bakelite disks in rats. J
Natl Cancer Inst 2: 81
Vermeulen NPE (1996) Role of metabolism in chemical toxicity. In: Ioannides C (ed).
Cytochromes P450: Metabolic And Toxicological Aspects. Boca Raton, FL: CRC Press,
Inc. pp 29-53
Vesell ES (1979) Pharmacogenetics: Multiple interactions between genes and
environment as determinants of drug response. Am J Med 66: 183-187
Vineis P, Marinelli D, Autrup H et al (2001) Current smoking, occupation, N-
acetyltransferase-2 and bladder cancer: a pooled analysis of genotype-based studies.
Cancer Epidemiol Biomarkers Prev 10: 1249–52
Wacher VJ, Wu C-Y, Benet LZ (1995) Overlapping substrate specificities and tissue
distribution of cytochrome P450 3A and P-glycoprotein: Implications for drug delivery
and activity in cancer chemotherapy. Mol Carcinog 13: 129-134
Whittington A, Vichai V, Webb G, Baker R, Pearson W, Board P (1999) Gene
structure, expression and chromosomal localization of murine theta class glutathione
transferase mGSTT1-1. Biochem J 337: 141–151
Widersten M, Pearson WR, Engstrom A, Mannervik B (1991) Heterologous
expression of the allelic variant mu-class glutathione transferases mu and psi. Biochem J
276: 519–524
Wilson CM, Tobin S, Young RC (2004) The exploding worldwide cancer burden: the
impact of cancer on women. International Journal of Gynecological Cancer 14: 1-11
Xu SJ, Wang YP, Roe R, Pearson WR (1998) Characterization of the human class mu
glutathione S-transferase gene cluster and the GSTM1 deletion. J Biol Chem 273: 3517–
3527
Zhao M, Lewis R, Gustafson DR, Wen WQ, Cerhan JR, Zheng W (2001) No apparent
association of GSTP1 A313 G polymorphism with breast cancer risk among
postmenopausal Iowa women. Cancer Epidemiol Biomark Prev 10: 1301–1302. 34–39
Glutathione‐S‐Transferases Gene Deletion & Breast Cancer Risk
Page | 52
Zhong S, Wyllie AH, Barnes D, Wolf CR, Spurr NK (1993) Relationship between the
GSTM1 genetic polymorphism and susceptibility to bladder, breast and colon cancer.
Carcinogenesis 14: 1821–1824
Web Resources:
Cancer Registry and Data Management (CRCDM). Shaukat Khanum Memorial
Cancer Hospital and Research Center (SKMCH & RC) Report based on cancer cases
registered at SKMCH &RC in 2004 and from Dec 1994- Dec 2004. Available from URL:
http://www.shukatkhanum.org.pk/research.html.
WHO.Data and statistics. World Health Organization; 2006. Globocan 2008 IARC
Books: