+ All Categories
Home > Documents > MW  12:50-2:05pm in Beckman B302 Profs: Serafim Batzoglou & Gill Bejerano

MW  12:50-2:05pm in Beckman B302 Profs: Serafim Batzoglou & Gill Bejerano

Date post: 23-Feb-2016
Category:
Upload: jenis
View: 26 times
Download: 0 times
Share this document with a friend
Description:
CS273A. Lecture 8: Transcription Regulation II. MW  12:50-2:05pm in Beckman B302 Profs: Serafim Batzoglou & Gill Bejerano TAs: Harendra Guturu & Panos Achlioptas. Announcements. Did the tutorials clash with other classes? How’s HW1 going? - PowerPoint PPT Presentation
Popular Tags:
54
010101100010010100001010101010011011100110001100101000100101 Human Population Genomics ACGTTTGACTGAGGAGTTTACGGGAGCAAAGCGGCGTCATTGCTATTCGTATCTGTTTAG
Transcript
Page 1: MW   12:50-2:05pm  in Beckman B302 Profs: Serafim  Batzoglou  & Gill  Bejerano

010101100010010100001010101010011011100110001100101000100101

Human Population Genomics

ACGTTTGACTGAGGAGTTTACGGGAGCAAAGCGGCGTCATTGCTATTCGTATCTGTTTAG

Page 2: MW   12:50-2:05pm  in Beckman B302 Profs: Serafim  Batzoglou  & Gill  Bejerano

• Cost• Killer apps• Roadblocks?

How soon will we all be sequenced?

Time

2015?2020?

Cost

Applications

Page 3: MW   12:50-2:05pm  in Beckman B302 Profs: Serafim  Batzoglou  & Gill  Bejerano

The Hominid Lineage

Page 4: MW   12:50-2:05pm  in Beckman B302 Profs: Serafim  Batzoglou  & Gill  Bejerano

Human population migrations

• Out of Africa, Replacement– Single mother of all humans (Eve)

~190,000yr– Single father of all humans (Adam)

~340,000yr– Humans out of Africa ~50000 years

ago replaced others (e.g., Neandertals)

• Multiregional Evolution– Generally debunked, however,– ~5% of human genome in Europeans,

Asians is Neanderthal, Denisova

Page 5: MW   12:50-2:05pm  in Beckman B302 Profs: Serafim  Batzoglou  & Gill  Bejerano

Coalescence

Y-chromosome coalescence

Page 6: MW   12:50-2:05pm  in Beckman B302 Profs: Serafim  Batzoglou  & Gill  Bejerano

Why humans are so similar

Out of Africa

Oppenheimer S Phil. Trans. R. Soc. B 2012;367:770-784

Page 7: MW   12:50-2:05pm  in Beckman B302 Profs: Serafim  Batzoglou  & Gill  Bejerano

Some Key DefinitionsMary: AGCCCGTACGJohn: AGCCCGTACGJosh: AGCCCGTACGKate: AGCCCGTACGPete: AGCCCGTACGAnne: AGCCCGTACGMimi: AGCCCGTACGMike: AGCCCTTACGOlga: AGCCCTTACGTony: AGCCCTTACG

Alleles: G, T

Major Allele: GMinor Allele: T

Heterozygosity:Prob[2 alleles picked at random with replacement are different]

2*.75*.25 = .375

H = 4Nu/(1+4Nu)

G/GG/GG/TG/GG/GG/GG/GT/TT/GT/G

Recombinations:At least 1/chromosomeOn average ~1/100 Mb

Linkage Disequilibrium:The degree of correlation between two SNP locations

Mom Dad

Page 8: MW   12:50-2:05pm  in Beckman B302 Profs: Serafim  Batzoglou  & Gill  Bejerano

Human Genome Variation

SNP TGCTGAGATGCCGAGA Novel Sequence TGCTCGGAGA

TGC - - - GAGA

Inversion Mobile Element orPseudogene Insertion

Translocation Tandem Duplication

Microdeletion TGC - - AGATGCCGAGA Transposition

Large Deletion Novel Sequenceat Breakpoint

TGC

Page 9: MW   12:50-2:05pm  in Beckman B302 Profs: Serafim  Batzoglou  & Gill  Bejerano

The Fall in Heterozygosity

H – HPOP

FST = ------------- H

Page 10: MW   12:50-2:05pm  in Beckman B302 Profs: Serafim  Batzoglou  & Gill  Bejerano

• From bones, compared genomes of three different Neanderthals with five genomes from modern humans from different areas of the world

The Neanderthal Genome

Figure 1- R. E. Green et al., Science 328, 710-722 (2010)

Page 11: MW   12:50-2:05pm  in Beckman B302 Profs: Serafim  Batzoglou  & Gill  Bejerano

Neanderthal Genome

Page 12: MW   12:50-2:05pm  in Beckman B302 Profs: Serafim  Batzoglou  & Gill  Bejerano

Neanderthal Genome

Page 13: MW   12:50-2:05pm  in Beckman B302 Profs: Serafim  Batzoglou  & Gill  Bejerano

Denisovan – Another human relative

Page 14: MW   12:50-2:05pm  in Beckman B302 Profs: Serafim  Batzoglou  & Gill  Bejerano

The Neanderthal Whole Genome

Page 15: MW   12:50-2:05pm  in Beckman B302 Profs: Serafim  Batzoglou  & Gill  Bejerano

The Neanderthal Whole Genome

Page 16: MW   12:50-2:05pm  in Beckman B302 Profs: Serafim  Batzoglou  & Gill  Bejerano

Aboriginal Australian

Page 17: MW   12:50-2:05pm  in Beckman B302 Profs: Serafim  Batzoglou  & Gill  Bejerano

Benefits of Admixture

Page 18: MW   12:50-2:05pm  in Beckman B302 Profs: Serafim  Batzoglou  & Gill  Bejerano

Out of Africa Revisited

Ann Gibbons Science 28 January 2011: 

“Human uniqueness?”

Page 19: MW   12:50-2:05pm  in Beckman B302 Profs: Serafim  Batzoglou  & Gill  Bejerano

The HapMap ProjectASW African ancestry in Southwest USA 90CEU Northern and Western Europeans (Utah) 180CHB Han Chinese in Beijing, China 90CHD Chinese in Metropolitan Denver 100GIH Gujarati Indians in Houston, Texas 100JPT Japanese in Tokyo, Japan 91LWK Luhya in Webuye, Kenya 100MXL Mexican ancestry in Los Angeles 90MKK Maasai in Kinyawa, Kenya 180TSI Toscani in Italia 100YRI Yoruba in Ibadan, Nigeria 100

Genotyping:Probe a limited number (~1M) of known highly variable positions of the human genome

Page 20: MW   12:50-2:05pm  in Beckman B302 Profs: Serafim  Batzoglou  & Gill  Bejerano

Linkage Disequilibrium & Haplotype Blocks

pA pG

Linkage Disequilibrium (LD):

D = P(A and G) - pApG

Minor allele: A G

Page 21: MW   12:50-2:05pm  in Beckman B302 Profs: Serafim  Batzoglou  & Gill  Bejerano

Population Sequencing – 1000 Genomes Project

Page 22: MW   12:50-2:05pm  in Beckman B302 Profs: Serafim  Batzoglou  & Gill  Bejerano

Population Sequencing – 1000 Genomes Project

Page 23: MW   12:50-2:05pm  in Beckman B302 Profs: Serafim  Batzoglou  & Gill  Bejerano

Population Sequencing – 1000 Genomes Project

Page 24: MW   12:50-2:05pm  in Beckman B302 Profs: Serafim  Batzoglou  & Gill  Bejerano

Population Sequencing – UK10K

Page 25: MW   12:50-2:05pm  in Beckman B302 Profs: Serafim  Batzoglou  & Gill  Bejerano

Association Studies

Control

Disease

A/GA/GG/GG/GA/GG/GG/G

A/AA/GA/AA/GA/GA/AA/A

AA 0 4AG 3 3GG 4 0

p-value

Page 26: MW   12:50-2:05pm  in Beckman B302 Profs: Serafim  Batzoglou  & Gill  Bejerano

Wellcome Trust Case Control

Nature 447, 661-678(7 June 2007) Nature 464, 713-720(1 April 2010)

Many associations of small effect sizes (<1.5)

Page 27: MW   12:50-2:05pm  in Beckman B302 Profs: Serafim  Batzoglou  & Gill  Bejerano

Heritability & Environment

Bienvenu OJ, Davydow DS, & Kendler KS (2011).  Psychological medicine, 41 (1), 33-40 PMID:

Page 28: MW   12:50-2:05pm  in Beckman B302 Profs: Serafim  Batzoglou  & Gill  Bejerano

Disease Clustering

• RA vs. ATD• RA vs. MS

– No recorded co-occurrence of RA and MS

SNP - Allele Gene Symbol

Genetic Variation Score (GVS)RA

(NARAC) RA AS T1D ATD MS (IMSGC) MS

rs11752919 - C ZSCAN23 -3.48 -3.21 -9.39 1.10 0.70 3.25 2.99

rs3130981 - A CDSN -0.46 -1.00 -9.47 -4.94 0.33 10.00 13.41

rs151719 - G HLA-DMB -6.71 -4.77 -1.08 -13.63 0.34 8.58 17.76

rs10484565 - T TAP2 25.52 8.37 1.34 15.74 -1.36 -0.56 -0.30

rs1264303 - G VARS2 11.51 7.36 18.76 0.89 -1.76 -1.85 -1.75

rs1265048 - C CDSN 6.59 2.97 50.13 6.34 -0.85 -2.39 -4.16

rs2071286 - A NOTCH4 5.30 0.78 6.42 4.04 -0.03 -1.89 -2.45

rs2076530 - G BTNL2 67.49 56.46 14.06 13.58 -6.41 -9.50 -18.52

rs757262 - T TRIM40 14.58 9.11 6.27 1.56 -0.79 -2.05 -7.34

Page 29: MW   12:50-2:05pm  in Beckman B302 Profs: Serafim  Batzoglou  & Gill  Bejerano

Global Ancestry Inference

Nature. 2008 November 6; 456(7218): 98–101.

Page 30: MW   12:50-2:05pm  in Beckman B302 Profs: Serafim  Batzoglou  & Gill  Bejerano

Ancestry Painting

?Danish

French

Spanish

Mexican

Page 31: MW   12:50-2:05pm  in Beckman B302 Profs: Serafim  Batzoglou  & Gill  Bejerano

Modeling population haplotypes – VLMC

Browning, 2006

Page 33: MW   12:50-2:05pm  in Beckman B302 Profs: Serafim  Batzoglou  & Gill  Bejerano

Identity By Descent

{ {

.

.

.

.

.

.

Page 34: MW   12:50-2:05pm  in Beckman B302 Profs: Serafim  Batzoglou  & Gill  Bejerano

IBD detection

H2H1 H4H3

IBD = F

H1

IBD = TH2

Hs

h

FastIBD: sample haplotypes for each individual, check for IBD

Browning & Browining 2011

Parente

Rodriguez et al. 2013

Page 35: MW   12:50-2:05pm  in Beckman B302 Profs: Serafim  Batzoglou  & Gill  Bejerano

Fixation, Positive & Negative Selection

Neutral Drift Positive SelectionNegative Selection

How can we detect negative

selection?

How can we detect positive

selection?

Page 36: MW   12:50-2:05pm  in Beckman B302 Profs: Serafim  Batzoglou  & Gill  Bejerano

How can we detect positive selection?

Ka/Ks ratio:Ratio of nonsynonymous tosynonymous substitutions

Very old, persistent, strong positive selection for a protein that keeps adapting

Examples: immune response, spermatogenesis

Page 38: MW   12:50-2:05pm  in Beckman B302 Profs: Serafim  Batzoglou  & Gill  Bejerano

Positive Selection in Human Lineage

Page 39: MW   12:50-2:05pm  in Beckman B302 Profs: Serafim  Batzoglou  & Gill  Bejerano

Positive Selection in Human Lineage

Page 40: MW   12:50-2:05pm  in Beckman B302 Profs: Serafim  Batzoglou  & Gill  Bejerano

X

X

X

Mutations and LD

Slide Credits:Marc Schaub

Page 41: MW   12:50-2:05pm  in Beckman B302 Profs: Serafim  Batzoglou  & Gill  Bejerano

Long Haplotypes –EHS, iHS tests

Less time:• Fewer mutations• Fewer recombinations

Page 42: MW   12:50-2:05pm  in Beckman B302 Profs: Serafim  Batzoglou  & Gill  Bejerano

• Study of genes known to be implicated in the resistance to malaria.

• Infectious disease caused by protozoan parasites of the genus Plasmodium

• Frequent in tropical and subtropical regions

• Transmitted by the Anopheles mosquito

Image source: wikipedia.org

Application: Malaria

Slide Credits:Marc Schaub

Page 43: MW   12:50-2:05pm  in Beckman B302 Profs: Serafim  Batzoglou  & Gill  Bejerano

Image source: NIH - http://history.nih.gov/exhibits/bowman/images/malariacycleBig.jpg

Application: Malaria

Slide Credits:Marc Schaub

Page 44: MW   12:50-2:05pm  in Beckman B302 Profs: Serafim  Batzoglou  & Gill  Bejerano

Image source: CDC - http://www.dpd.cdc.gov/dpdx/images/ParasiteImages/M-R/Malaria/malaria_risk_2003.gif

Application: Malaria

Slide Credits:Marc Schaub

Page 45: MW   12:50-2:05pm  in Beckman B302 Profs: Serafim  Batzoglou  & Gill  Bejerano

Results: G6PD

Source: Sabeti et al. Nature 2002.Slide Credits:Marc Schaub

Page 46: MW   12:50-2:05pm  in Beckman B302 Profs: Serafim  Batzoglou  & Gill  Bejerano

Results: TNFSF5

Source: Sabeti et al. Nature 2002.Slide Credits:Marc Schaub

Page 47: MW   12:50-2:05pm  in Beckman B302 Profs: Serafim  Batzoglou  & Gill  Bejerano

Malaria and Sickle-cell Anemia

• Allison (1954): Sickle-cell anemia is limited to the region in Africa in which malaria is endemic.

Image source: wikipedia.org

Distribution of malaria Distribution of sickle-cell anemiaSlide Credits:Marc Schaub

Page 48: MW   12:50-2:05pm  in Beckman B302 Profs: Serafim  Batzoglou  & Gill  Bejerano

Malaria and Sickle-cell Anemia

• Single point mutation in the coding region of the Hemoglobin-B gene (glu → val).

• Heterozygote advantage:• Resistance to malaria• Slight anemia.

Image source: wikipedia.orgSlide Credits:Marc Schaub

Page 49: MW   12:50-2:05pm  in Beckman B302 Profs: Serafim  Batzoglou  & Gill  Bejerano

Source: Ingram and Swallow. Population Genetics of Encyclopedia of Life Sciences. 2007.

Slide Credits:Marc Schaub

Lactose Intolerance

Page 50: MW   12:50-2:05pm  in Beckman B302 Profs: Serafim  Batzoglou  & Gill  Bejerano

LCT, 5’

LCT, 3’

Source: Bersaglieri et al. Am. J. Hum. Genet. 2004.Slide Credits:Marc Schaub

Lactose Intolerance

Page 51: MW   12:50-2:05pm  in Beckman B302 Profs: Serafim  Batzoglou  & Gill  Bejerano

Lactase persistence (litterature) Predicted lactase persistence

13910*T distribution

Source: Ingram et al. Lactose digestion and the evolutionary genetics of lactase persistence. Hum Genet. 2009 Jan;124(6):579-91.

Slide Credits:Marc Schaub

Page 52: MW   12:50-2:05pm  in Beckman B302 Profs: Serafim  Batzoglou  & Gill  Bejerano

Positive Selection in Human Lineage

Page 53: MW   12:50-2:05pm  in Beckman B302 Profs: Serafim  Batzoglou  & Gill  Bejerano

Orthology and Paralogy

HB Human

WB Worm

HA1 Human

HA2 Human

Yeast

WA Worm

Orthologs:Derived by speciation

Paralogs:Everything else

Page 54: MW   12:50-2:05pm  in Beckman B302 Profs: Serafim  Batzoglou  & Gill  Bejerano

Orthology, Paralogy, Inparalogs, Outparalogs


Recommended