i
NFIC REGULATES AR MEDIATED
TRANSCRIPTION BY MULTIPLE MECHANISMS
YANG CHONG
B.Eng. (Hons.), NTU
A THESIS SUBMITTED
FOR THE DEGREE OF DOCTOR OF PHILOSOPHY
NUS GRADUATE SCHOOL FOR INTEGRATIVE SCIENCES
AND ENGINEERING
NATIONAL UNIVERSITY OF SINGAPORE
2013
ii
DECLARATION
8th
November 2013
iii
ACKNOWLEDGEMENTS
First and foremost, I would like to express my sincere thanks to my Ph.D
supervisors, Dr. Yong Eu Leong and Dr. Edwin Cheung, for taking me as their
student for my Ph.D study. Dr. Edwin Cheung who has been a dedicated mentor
and provided valuable guidance and encouragement to me throughout the past
four years of my Ph.D studies, therefore I owe him the deepest gratitude. I would
also greatly appreciate the collaborative opportunities that he had provided me
with great research scientists within and outside of GIS. I also want to thank my
TAC members, Dr Yu Qiang, Dr Paul Yen and the annual GIS graduate seminar
committee for their insightful advice and opinions on the future directions to this
project.
I would like to give thanks to my colleagues who offered help on this work.
Special thanks to Dr Chng Kern Rei for his efforts in preliminary characterization
of NFIC in LNCaP cell line. I also would like to thank Dr Tan Peck Yean for the
generation of AR and FoxA1 ChIP-Seq datasets that facilitated my study on
NFIC. Thanks to Mr. Chang Cheng Wei for his extensive efforts in guiding our
group in the usage of computational programs so that we can be self-sufficient in
performing basic analyses on whole genome dataset.
iv
I wish to acknowledge Dr. Pan You Fu, Dr. Liu Mei Hui, Dr. Chuah Shin Chet,
Dr Tan Sikee and Dr. Sung Ying Ying for their valuable advice and insights
during the course of my study. It is a great pleasure to have met my present and
former colleagues in GIS who have always been encouraging and made my stay
enjoyable. I would like to convey thanks to the GTB sequencing group in GIS for
their commitment in generating high quality sequencing data.
More importantly, I would like to give thanks to the NUS Graduate School of
Integrative Science and Engineering (NGS). Without the financial support and
sponsorship from NGS, I wouldn’t be able to conduct the research for this thesis.
Last but not least, I would like to send my heartfelt gratitude to my parents
overseas for their caring and spiritual support throughout the four year of my
Ph.D studies.
.
v
TABLE OF CONTENT
DECLARATION .................................................................................................... II
ACKNOWLEDGEMENTS .................................................................................. III
TABLE OF CONTENT ......................................................................................... V
SUMMARY ....................................................................................................... VIII
LIST OF TABLES ................................................................................................. X
LIST OF FIGURES .............................................................................................. XI
ABBREVIATIONS ........................................................................................... XIII
PUBLICATION ...................................................................................................... II
CHAPTER 1 INTRODUCTION ............................................................................ 1
1.1 Prostate development and prostate cancer .....................................................1
1.2 Androgen and Androgen receptor .................................................................4
1.3 AR structure and its mode of action in prostate cancer .................................5
1.4 AR interacting proteins in AR mediated transcription ................................10
1.5 Decoding AR cistromes in prostate cancer cells .........................................11
1.6 Well Characterized AR collaborative factors ..............................................14
1.6.1 FoxA1 .................................................................................................14
1.6.2 GATA2 and Oct1 ...............................................................................17
1.6.3 NKX3.1 .............................................................................................18
1.6.4 ETS family of transcription factors ...................................................18
1.7 Pioneering factors as potential drug targets ................................................19
1.8 NFI family of transcription factors ..............................................................24
vi
1.9 NFIC CCAAT binding transcription factor .................................................28
1.10 Aim of the study ........................................................................................29
CHAPTER 2. MATERIALS AND METHODS .................................................. 30
2.1 Reagents and antibodies ..............................................................................30
2.2 Cell culture ..................................................................................................30
2.3 Cryogenic preservation and recovery of cells .............................................31
2.4 Western Blot Analysis .................................................................................31
2.5 RNA Isolation and Real-time Reverse Transcription reaction (RT-qPCR) 32
2.6 Chromatin Immunoprecipitation assays .....................................................33
2.7 Short interfering RNA (siRNA) studies ......................................................34
2.8 ChIP-Sequencing .........................................................................................34
2.9 Co-immunoprecipitation (Co-IP) ................................................................35
2.10 Microarray expression profiling ...............................................................35
2.11 Gene Ontology (GO) Analysis ..................................................................36
CHAPTER 3. RESULTS ...................................................................................... 37
3.1 NFIC as a novel AR collaborative factor ...................................................37
3.1.1 Identification of NFIC as a potential AR cofactor in LNCaP prostate
cancer cells .........................................................................................................37
3.1.2 Generation of NFIC binding cistromes in LNCaP prostate cancer cell
line ......................................................................................................................41
3.1.3 NFIC cistromes overlap with AR binding events ..............................44
3.1.4 NFIC mediates AR transcriptional activity ........................................49
3.2 Characterization and Validation of NFIC as pioneering factor to AR ........51
3.2.1 NFIC binding events at ARBS are independent of androgen
stimulation ..........................................................................................................51
3.2.2 NFIC and AR do not regulate each other ...........................................56
3.2.3 NFIC mediate AR dependent transcription ........................................59
vii
3.3 FoxA1 form co-regulatory complex with NFIC in Mediating AR
Transcriptional Regulation.....................................................................................64
3.4 NFIC has multiple mechanisms in distinct ARBS defined by FoxA1 ........79
3.4.1 FoxA1 regulated a large number of genes also regulated by NFIC ...79
3.4.1 NFIC plays the role of pioneering factor instead of FoxA1 at FoxA1
independent ARBS .............................................................................................82
3.4.2 NFIC collaborate with FoxA1 to contribute to AR transcription at
FoxA1 pioneered ARBS.....................................................................................95
DISCUSSION ..................................................................................................... 108
CONCLUSION, FUTURE DIRECTIONS AND PERSPECTIVES.................. 113
BIBLIOGRAPHY ............................................................................................... 116
APPENDIX I ...................................................................................................... 125
APPENDIX II ..................................................................................................... 130
APPENDIX III .................................................................................................... 132
viii
SUMMARY
Androgen receptor (AR) has been shown to play a key role in mediating the
transcriptional regulatory network directing prostate cancer initiation,
development and progression. To gain insights into the AR-dependent
transcriptional regulatory network, we utilized the ChIP-Seq approach and
generated genome-wide binding maps of AR in the LNCaP prostate cancer cell
line. From our bioinformatic analyses of AR binding sites (ARBS), we found an
enrichment of motifs belonging to the NFI family. We demonstrated that a
member of the NFI family, NFIC, shown to be over-expressed in clinical prostate
tumors, overlaps with a large fraction of ARBS across the genome. Our analysis
revealed that the recruitment of NFIC was independent of androgen treatment,
indicating NFIC as a potential pioneer factor. In addition, we showed that NFIC
was required for the global modulation of AR-dependent target genes including
KLK2, KLK3, and TMPRSS2. Interestingly, we found another well characterized
AR pioneering factor, FoxA1, to be recruited to the ARBS associated with these
genes. However, the expressions of these genes were FoxA1 independent,
suggesting NFIC was the more important pioneering factor at these ARBS. We
hypothesized that NFIC and FoxA1 could co-pioneer AR and went on to
demonstrate that NFIC and FoxA1 played distinct roles globally for different
classes of AR modulated genes and their associated ARBS. Collectively, our
ix
study suggests NFIC is a novel pioneering factor that is complementary to FoxA1
in AR-mediated transcription.
x
LIST OF TABLES
Table 1. Summary of ChIP-seq analysis ............................................ 66
xi
LIST OF FIGURES
Figure 1.1 H&E stain of micrograph showing prostate gland disorders ............................. 3
Figure 1.2 Schematic diagram featuring structural domains of the two isoforms
(AR-A and AR-B) of the human androgen receptor. .......................................................... 7
Figure 1.3 AR mode of action in prostate cancer ............................................................... 9
Figure 1.4 Model of AR coregulatory network ................................................................ 13
Figure 1.5 Diagram showing the model for FoxA1 mediated reprogramming of
distinct classes of AR enhancers in the LNCaP prostate cancer cells. ............................. 16
Figure 1.6 Cell type specific FoxA1 recruitment recognized by the lineage-
specific H3K4 methylation distributions .......................................................................... 22
Figure 1.7 Domains and alternative splicing of vertebrate NFI genes. ............................ 27
Figure 3.1 NFI motifs are highly enriched in AR binding peaks...................................... 40
Figure 3.2 Generation of NFIC ChIP-seq library in LNCaP cells .................................... 43
Figure 3.3 AR and NFIC are co-localized in LNCaP cells ............................................... 48
Figure 3.4 Ligand dependent response at ARBS requires AR and NFIC ......................... 50
Figure 3.5 NFIC genome wide recruitment is ligand independent ................................... 55
Figure 3.6 NFIC and AR do not regulate each other ........................................................ 58
Figure 3.7 NFIC regulates AR dependent genes ............................................................. 63
Figure 3.8 FoxA1 is a potential interplayer of AR/NFIC network ................................... 69
Figure 3.9 FoxA1 binding is highly enriched in AR/NFIC overlapping regions ............. 72
Figure 3.10 NFIC and FoxA1 pioneer AR recruitment at NFIC unique and FoxA1
unique ARBS respectively ................................................................................................ 76
Figure 3.11 Schematic diagram illustrating how NFIC and FoxA1 coordinate AR
transcriptional activity at distinct classes of ARBS. ......................................................... 78
Figure 3.12 NFIC regulate a substantial amount of FoxA1 regulated genes .................... 81
Figure 3.13 NFIC plays pioneering factor of AR at AR model genes instead of
FoxA1 ............................................................................................................................... 86
Figure 3.14 NFIC pioneers AR mediated transcription instead of FoxA1 at FoxA1
independent/occupied ARBS ............................................................................................ 91
xii
Figure 3.15 NFIC modulates chromatin accessibility to facilitate AR mediated
transcription instead of FoxA1 at FoxA1 independent/occupied ARBS .......................... 94
Figure 3.16 NFIC and FoxA1 collaborate at several FoxA1/NFIC co-pioneered
genes ................................................................................................................................. 99
Figure 3.17 NFIC and FoxA1 collaborate at additional FoxA1/NFIC co-pioneered
genes ............................................................................................................................... 104
Figure 3.18 Both NFIC and FoxA1 modulate chromatin accessibility and
contribute to pioneering AR mediated transcription at FoxA1/NFIC co-pioneered
regions ............................................................................................................................. 107
Figure 4.1 NFIC have no effect on H3K4me1/2 marks .................................................. 112
xiii
ABBREVIATIONS
AF Transactivation Function
Amp Ampicillin
AP-1 Activator Protein 1
AR Androgen receptor
ARBS Androgen receptor binding site
ARE Androgen response element
BPH Benign prostatic hyperplasia
BSA Bovine serum albumin
CARM1 Co-activator-associated arginine methyltransferase
C/EBP CCAAT/enhancer-binding protein
CCAT Control based ChIP-Seq Analysis Tool
CCND1 Cyclin D1
cDNA Complementary DNA
CD-FBS Charcoal-dextran treated FBS
ChIA-PET Chromatin Interaction Analysis-Paired End DiTag
ChIP Chromatin immunoprecipitation
ChIP-Seq ChIP-Sequencing
xiv
co-IP co-immunoprecipitation
cRNA Complementary RNA
CTCF CCCTC-binding factor
DBD DNA binding domain
DHT dihydrotestosterone
DMEM Dulbecco’s modified Eagle’s medium
DMSO Dimethyl sulfoxide
DNA Deoxyribonucleic acid
E2 17β-estradiol
EGF Epidermal growth factor
ER Estrogen receptor
ERBS ERα binding sites
ERE Estrogen response element
ETOH Ethanol
FAIRE Formaldehyde assisted isolation of regulatory elements
FBS Fetal bovine serum
FDR False discovery rate
FKH Forkhead
FoxA1BS FoxA1 binding sites
GAPDH Glyceraldehyde-3-phosphate dehydrogenase
GO Gene ontology
xv
GRO-Seq Global Nuclear Run-On and Sequencing
HAT Histone acetyltransferase
HDAC Histone deacetylase
HNF3α Hepatocyte nuclear factor 3α
JMJD JuMonJi domain-containing histone demethylase
LSD1 Lysine specific demethylase 1
MEME Multiple EM for Motif Elicitation
M-MLV RT Moloney Murine Leukemia Virus Reverse Transcriptase
NR Nuclear hormone receptor
NR3C4 Nuclear Receptor Subfamily 3, Group C, Member 4
Oct Octamer-binding transcription factor
PCR Polymerase chain reaction
PIC preinitiation complex
PKA Protein kinase A
PR Progesterone receptor
qPCR quantitative PCR
RNA Pol RNA polymerase
RNA-Seq RNA-Sequencing
SDS Sodium Dodecyl sulfate
SDS-PAGE SDS polyacrylamide gel
siRNA Short interfering RNA
xvi
SRC Steroid receptor co-activator
SWI/SNF Switching/sucrose non-fermenting
TSS Transcription start site
ii
PUBLICATION
Chng KR, Chang CW, Tan SK, Yang C, Hong SZ, Sng NY, Cheung E (2012) A
transcriptional repressor co-regulatory network governing androgen response in prostate
cancers. The EMBO journal 31: 2810-2823
1
CHAPTER 1 INTRODUCTION
1.1 Prostate development and prostate cancer
The prostate belongs to the male reproductive system and is an accessory gland
slightly larger than the size of a walnut. The prostate gland functions as secreting
prostatic fluid that usually constitutes more than half of the volume of the semen.
Prostate development is dependent upon the integration of steroid hormone
stimulations. A multitude of genes and signaling pathways has been shown to
regulate single or multiple steps prostate development, which includes epithelial
budding, the elongation of the duct, branching morphogenesis, and cellular
differentiation (Powers and Marker, 2013). Almost all prostatic acini developed
by outgrowths from the urethral epithelium and develop and grow into the
mesenchyme tissues in adjacent areas. The prostatic glandular epithelium
differentiates from the endodermal cells, while the associated mesenchyme of the
prostate differentiates into the dense stroma and the prostatic smooth muscle. In
the development of male reproductive systems, the prostate gland composed of
several glandular and non-glandular components are usually developed by the 9th
week of embryonic growth, formed by the condensation of mesenchyme, urethra
and Wolffian ducts.
2
The disorder of the prostate gland consists of Prostatitis, Benign prostatic
hyperplasia and finally leads to prostate cancer (Figure 1.1).
Prostatitis is defined as inflammation of the prostate gland. This sort of prostatic
disorder mainly comprises of four different forms, namesly acute prostatitis ,
chronic bacterial prostatitis, chronic non-bacterial prostatitis, and Category IV
prostatitis that is relatively uncommon in the general population, also classified as
a type of leukocytosis. Each type of prostatitis has different causes and outcomes.
Benign prostatic hyperplasia (BPH) happens when the prostate enlarges and
results in difficulty in urination. BPH often occurs in older men. The cause of
BPH is not well established, but potential factors that may contribute to BPH
include DHT. DHT is thought to play a potential role in the development in BPH,
by inducing cell growth in the prostate. Older men who stops producing DHT are
observed not to develop BPH(Isaacs and Coffey, 1989).
Prostate cancer is one of the most common types of cancers affecting aged men in
developed countries and has been considered the second leading cause of cancer
related death in US males. The most common form of prostate cancer is
adenocarcinoma. At the beginning cancer growth is only limited in the interior of
the prostate, and at certain stage the prostate cancer cells may progress to a more
advanced state, by metastasizing from the prostate and invade into other various
organs of the body, especially the bones and lymph nodes (Coffey and Pienta,
1987). The metastasized tumors are usually lethal.
3
Figure 1.1 H&E stain of micrograph showing prostate gland disorders
The H&E stain graph of prostatitis on the top panel and prostate adenocarcinoma on
the bottom panel (Isaacs and Coffey, 1989).
4
1.2 Androgen and Androgen receptor
Testosterone is a steroid hormone primarily derived from the testis. It plays key
physiological roles ranging from development of male reproductive tissues such
as prostate and epididymis (Desjardins, 1978; Cunha et al., 1987) to the
acquisition or promotion of the secondary male sexual characteristics during
puberty (Mooradian et al., 1987). Apart from the male-associated phenotypes,
androgens also regulate development or functions of other tissues and organs, for
instance, the bone and muscle tissues (Finkelstein et al., 1987), hair follicles on
the skin (Messenger, 1993), sebaceous gland (Deplewski and Rosenfield, 2000),
and adipose tissues (Schroeder et al., 2004).
The androgenic effect in a wide array of tissues is usually carried out by androgen
after it’s metabolized into 5-dihydrotestosterone (DHT) (Randall, 1994), which is
a more potent form of androgen. In the majority of androgen targeted tissues,
DHT binds to androgen receptor to form a regulatory complex to regulate target
genes, thus maintaining proper function of these vital organs (Liao and Fang,
1969). Androgen receptor plays a vital role both in the development of normal
prostate gland and prostate carcinoma, and is expressed throughout prostate
cancer progression and it remains expressed in many prostate tumors resistant to
androgen ablation therapy (Agoulnik and Weigel, 2008). Functional AR is
expressed through different stages of prostate carcinogenesis, including PIN and
early carcinoma, advanced carcinoma, and eventually in metastatic carcinoma.
Androgens are found to regulate the proliferation of epithelial cells, leading to the
5
adenocarcinoma, therefore androgens that modulate AR activity may result in
uncontrolled cell proliferation in the form of cancer.
1.3 AR structure and its mode of action in prostate cancer
The AR is also known as NR3C4 (nuclear receptor subfamily 3, group C, member
4). It is a nuclear transcription factor and is most closely related to the
progesterone receptor (Raudrant and Rabe, 2003). Androgen receptor carries out
its function as a DNA binding transcription factor by regulating gene expressions
(Mooradian et al., 1987).
The genomic structure of AR has been highly conserved throughout mammalian
evolution. The AR gene is located on the X-chromosome at position Xq11-12. It
spans around 90 kb and contains eight exons that code for nearly more than 900
amino acids within a 10.6 kb mRNA. Two isoforms of AR has been identified.
The less predominant isoform A is 87 kDa with its N-terminus truncated resulting
from in vitro proteolysis, while predominant isoform B is full length with 110
kDa mass (Wilson and McPhaul, 1994). Similar to many other steroid receptors,
the AR is modular in structure and consists of distinct functional domains known
as the amino-terminal domain transactivation domain (NTD), DNA binding
domain (DBD), carboxyl terminal ligand-binding domain (LBD) (Brinkmann et
al., 1989; Tsai and O'Malley, 1994). The DBD and LBD are connected by a hinge
region (Figure 1.2).
6
LBD, DBD and the N-terminal of the hinge segment are highly conserved during
evolution, while the NTD sequence is mostly variable. The NTD consists of
homopolymeric repeats including polyglutamine and polyglycine and contains the
major transactivation domain which is termed as activation function (AF)-1
responsible for transcriptional activity once it is bound by ligand. It also contains
activation function 5 (AF-5) that is responsible for the activity without ligand
binding. The LBD has specific motifs for ligand binding, as well as activation
function-2 (AF-2) domain responsible for agonist induced activity. AF-2 in AR
mainly binds preferably to N-terminal FXXFL motif but not FXXFL motifs that
are mostly found in many coactivators (He et al., 2002; He and Wilson, 2003).
Furthermore, the LBD contribute to not only the tethering to heat shock proteins
(HSPs), but also AR homo- and hetero-dimerization. The DBD consists of two
zinc-finger motifs. The DNA recognition specificity is determined by the first
zinc finger of the DBD, and the second zinc finger of DBD is mainly responsible
for the stabilization of the DNA and AR complex, as well as AR dimerization. In
addition, the DBD also mediates the nuclear localization of AR (Suzuki and Ito,
1999).
7
Figure 1.2 Schematic diagram featuring structural domains of the two
isoforms (AR-A and AR-B) of the human androgen receptor.
The numbers above the two structural isoforms indicates the number of amino
acid residues separating the domains starting from the N-terminus on the left to C-
terminus on the right. AR contains three functional domains, namely NTD (exon
A/B), DBD (exon C), and LBD (exon E to F). NTD and LBD are mainly
responsible for AR transcriptional activities, and LBD have additional functions
such as associating AR to HSPs and dimerization with DBD. DBD is required for
recognizing and binding AR to the ARE on chromatin. (Suzuki and Ito, 1999)
8
AR mode of action in mediating transcriptional regulation in prostate cancer in
highly ligand induced. In the absence of androgen stimulation, AR exists in the
cytoplasm as a complex with the HSPs as chaperones (Figure 1.3). Once bound
by ligand such as DHT converted from testosterone, AR undergoes
conformational change that triggers the subsequent dissociation of itself from
HSPs. This turns on the subsequent phosphorylation and homodimerization of AR,
leading to the translocation of dimerized AR into the nuleus where a serial of
events occurs. After AR moves into the nuleus, it recognizes and docks itself to
the canonical ARE (Chang et al., 1995; Gelmann, 2002; Harris et al., 2009). The
binding of AR to the ARE will subsequently facilitate the AR complex to recruit
other interacting proteins to mediate the downstream transcriptional regulation.
These recruited proteins include general transcriptional machinery such as RNA
PoII, chromatin remodeling complexes and transcriptional coactivators and
corepressors (Heinlein and Chang, 2004; Heemers and Tindall, 2007; Harris et al.,
2009).
9
Figure 1.3 AR mode of action in prostate cancer
After testosterone released from plasma proteins is converted to DHT by 5-
reductatse, AR becomes bound by DHT and HSP is dissociated caused by DHT
binding, leading to AR dimerization. The dimerized AR subsequently translocated
into the nucleus and binds to ARE, which facilitates recruitment of co-activators
and general transcription machinery, to regulate transcriptional activities (Chen et
al., 2008).
10
1.4 AR interacting proteins in AR mediated transcription
AR plays a central role in the transcriptional regulation in prostate cancer, but it
does not function alone. The androgen regulation in prostate cancer cell lines
often involves the formation of diverse AR transcriptional complexes, and this
regulatory network mainly consists of components of the general transcriptional
machinery, AR coactivators and corepressors, and specific transcription factors
(Shang et al., 2002; Heemers and Tindall, 2007).
AR may regulate its downstream transcription by regulating both transcriptional
initiation and elongation. General transcription factors to enhance AR
transcription involve the formation of preinitiation complex (PIC) to promote the
recruitment of RNA PoII to the AR target gene promoters. Besides the direct
contact of AR with general transcription factors, AR has been shown to interact
with RNA PoII directly by the subunit RPB2 (Lee et al., 2003).
Up to now a huge number of nuclear receptor coregulators of AR have been
identified. They can be broadly classified as AR coactivators and corepressors,
but they can also be classified based on the particular cellular activities they have
to regulate transcription. These cellular activities may include components of the
chromatin remodeling complex were shown to alter DNA topology and associated
with loss of canonical nucleosomal ladder. For instance, the switching / sucrose
nonfermenting (SWI/SNF) complex were shown to stimulate AR activity in an
ATP dependent manner (Marshall et al., 2003). Histone modifiers affect AR
transcriptional activity by modifying histone residues by acetylation, methylation,
phosphorylation, ubiquitination, and glycosylation. Such modifications would
11
result in changes of the net charge of the nucleosome and thereby changes in the
conformation of the histone. For example, histone acetylase (HAT) are commonly
asscociated with transcriptional activation while the histone deacetylase (HDAC)
recruitment render a more compact chromatin structure and transcriptional
repression (Xu and O'Malley, 2002). Histone methylation, however, can render
both transcriptional activation and repression depending on the position of the
histone residues modified. For instance, H3K4 methylation is associated with
active genes, while H3K9 and H3K27 methylation often indicate repressed state
of genes (Mellor, 2006). Histone demethylase such as lysine specific demethylase
1 (LSD1) and JMJ domain-containing family of histone demethylases (JMJD1A
and JMJD2C) have recently drew attention to their role in demethylating mono, di
and trimethylated H3K9, resulting in activation of AR dependent transcription
(Metzger et al., 2005; Yamane et al., 2006; Wissmann et al., 2007). And
Coactivator-associated arginine methyltransferase (CARM-1) is one of the well
studied histone methyltransferases (HMTs) to interact with SRC coactivators and
is classified as a secondary coactivator (Chen et al., 1999).
1.5 Decoding AR cistromes in prostate cancer cells
Early studies on transcriptional regulation by AR were largely gene and site
specific, with limited number of candidates (Cleutjens et al., 1996). However, AR
signaling involves hundreds of targets genes and the regulation by AR appears to
have high differential expression kinetics as well based on time course expression
profiling (Tan et al., 2012). Therefore the development of techniques such as
12
Chromatin Immunoprecipitation coupled with microarray (ChIP-chip) and
Chromatin Immunoprecipitation coupled with massively parallel sequencing
(ChIP-seq) has provided much more comprehensive insights into the studies of
genome wide AR cistromes and transcriptional activities. By combining ChIP-on
chip data with gene expression profile, transcription factors such as FoxA1, Oct1
and GATA2 have been identified as AR collaborators that control androgen-
mediated transcription (Wang et al., 2007). For instance, FoxA1 is a well studied
pioneering factor of AR in prostate cancer (Gao et al., 2003), and its role in
defining distinct classes of AR binding programs has recently been discovered
(Sahu et al., 2011; Wang et al., 2011). The general model for the AR
transcriptional complex is illustrated in Figure 1.4. I would like to elaborate on
several well characterized AR collaborative factors in the following chapters.
13
Figure 1.4 Model of AR coregulatory network
Pioneering factors such as FoxA1 and GATA2 preoccupy chromatin to modulate
chromatin structures prior to hormone stimulation. Upon DHT stimulation, AR is
recruited to distal enhancers and further recruits a hierarchical assembly of co-
activator complexes including p160, Oct1, HATs and HMTs, general transcription
machinery, PoII to ARE to start downstream transcription.
14
1.6 Well Characterized AR collaborative factors
AR-mediated transcription is composed of a wide array of coordinated events,
such as chromatin stucture remodeling, epigenetic signature modifications,
chromosomal looping events and polymerase tracking (Wang et al., 2005). AR
collaborative factors regulate AR transcriptional activities with diverse functions
on AR and regulating its transcriptional output, therefore are often overexpressed
and contribute to carcinogenesis in prostate cancer (Heinlein and Chang, 2004).
1.6.1 FoxA1
FoxA1 is short for Forkhead box protein A1. It is also known as hepatocyte
nuclear factor 3-alpha (HNF-3α) and is encoded by FOXA1 gene. FoxA1 belongs
to the FKH family of DNA binding transcription factor and plays key roles in the
development of various organs including liver, pancreas, breast and prostate (Lee
et al., 2005). In the early years it was shown to be involved in the regulation of
several ER target genes such as TFF-1 (Beck et al., 1999) as well as interacting
with ERα. Later studies proved that FoxA1 is required for modulating chromatin
structure, thereby facilitating ERα recruitment to mediate ER transcriptional
activities and this is the first study to establish FoxA1 as a pioneering factor of
ERα (Carroll et al., 2005). Furthermore, FoxA1 was also implicated in prostate
cancer development and progression by interacting with AR and regulate AR
target genes (Gao et al., 2003), thus a lot of studies emerged to focus on its role in
AR mediated transcription (Jia et al., 2008; Lupien et al., 2008). FoxA1 has
recently been shown to possess a cell type-specific functions which primarily rely
15
on its differential recruitment to chromatin at enhancers, subsequently leads to
chromatin structure changes and functional interplay with lineage-specific
collaborative factors. The differential recruitment of FoxA1 in prostate and breast
cancer is defined by the distribution of mono- and dimethylated H3 lysine 4
residues. Therefore FoxA1 translates epigenetic signatures into changes in
chromatin states to establish cell type specific transcriptional programs.
Most recently, studies have investigated the genome wide redistribution of ARBS
after depleting FoxA1 in prostate cancer cell lines and discovered that FoxA1
defines three distinct classes of ARBS, which are lost, conserved or gained after
its depletion. The AR redistributed binding program is nicely correlated with
similar patterns in the redistribution of gene expression profiling (Sahu et al.,
2011; Wang et al., 2011) (Figure 1.5). These studies provided a more
comprehensive global picture on FoxA1 regulation in prostate cancer, that apart
from FoxA1 pioneered ARBS, there are also ARBS that is independent on FoxA1
regulation, and thereby eliciting needs for new studies to explore what other
pioneering factor might come into play to regulate the AR mediated transcription
in these particular ARBS.
16
Figure 1.5 Diagram showing the model for FoxA1 mediated reprogramming
of distinct classes of AR enhancers in the LNCaP prostate cancer cells.
In the lost AR binding program, FoxA1 faciliates AR recruitment to ARE in
relatively open chromatin regions. Nucleosome remodelling is not induced upon
AR binding to ARE in this class of enhancers. In the conserved AR program, AR
recruitment to ARE is independent of FoxA1, and the binding events induce
nucleosome remodelling. In the third type of program in which AR binding is
gained after FoxA1 depletion, FoxA1 inhibits AR binding, in spite of the presence
of strong AREs. In all the above three classes of AR binding programs, eRNAs
were produced or increased following AR binding to AREs (Wang et al., 2011).
17
1.6.2 GATA2 and Oct1
By integrating Chromatin Immunoprecipitation with tiled oligonucleotide
Microarrays, previous studies have identified transcription factors such as
GATA2 and Oct1 to be cooperating in mediating AR transcription. They were
shown to form a regulatory hierarchy with AR to regulate androgen dependent
gene expression and prostate cancer progression (Wang et al., 2007).
Even earlier studies have discovered that GATA family members have the ability
to open compact chromatin structures via zinc finger motifs (Boyes et al., 1998),
therefore it may also serve the role of pioneering factor that modulate chromatin
to facilitate AR binding. However, Oct1 is not required for AR recruitment to
PSA and TMPRSS2, indicating Oct1 functions downstream to GATA2 and
cooperate to work together with AR. Silencing GATA2 and Oct1 results in a
significant decrease in the androgen dependent cell proliferation.
A later study utilized ChIP-microarray technique to map ARBS and histone H3
acetylation loci in C4-2B prostate cancer cell line, and manage to find large
portion of ARBS to be marked by AcH3. From the analysis of the ARBS
sequence motifs, they also discovered FoxA1, GATA2 to be AR coregulators.
Adopting transient siRNA knockout experiments, they discovered that these
coregulators of AR have diverse effects on the expression level of several AR
target genes such as KLK2, KLK3, TMPRSS2 and FKBP5 (Jia et al., 2008).
18
1.6.3 NKX3.1
NKX belongs to a subfamily of Homeobox Genes which were shown to be
aberrantly expressed in cancers. Human NKX3-1 is largely confined within the
prostate gland (Bieberich et al., 1996). The implication fo NKX3-1 in prostate
cancer development was addressed in recent studies. NKX homeodomain has
been observed to be enriched in AR cistrome analysis. NKX3-1 is the first known
marker for prostate epithelial differentiation. Studies have shown that NKX3-1
collaborate with AR at several AR target prostate cancer model genes such as
PSA, TMPRSS2 and FKBP5, and it regulate AR in a feed forward manner (Tan et
al., 2012).
Functional analysis has shown that NKX3-1 collaborate with AR and pioneering
factor such as FoxA1 to promote prostate cancer survival.
1.6.4 ETS family of transcription factors
The ETS family comprises of several transcription factors containing highly
conserved ETS DNA binding domain (Karim et al., 1990) . The ETS family of
transcription factors plays important roles in regulating diverse cellular processes
such as cell proliferation, cell differentiation, angiogenesis and apoptosis (Sevilla et
al., 1999). ETS transcription factors could function both as coactivator or corepressor
depending on the cellular context (Sharrocks et al., 1997; Sharrocks, 2001) . The
function of this family of transcription factors in cancer was notably found to be
through gene fusion with another protein and in the context of prostate cancer,
various papers have reported the discovery of recurrent ETS fusion genes (Tomlins et
19
al., 2008). Among all gene fusions of ETS family members such as ETV1, ETV4 and
ETV5 occurring in prostate cancer, the most common type of occurring variant of
ETS gene fusion in prostate cancer is the TMPRSS2-ERG fusion gene (Kumar-Sinha
et al., 2008) . From AR ChIP-on ChIP studies in prostate cancer cell line, the ETS
motif was found to be enriched at AR-bound promoter regions, and members such as
ETV1 and ERG were subsequently found to be collaborative factors of AR (Massie et
al., 2007). Interestingly, while ETS-1 and ETV1 were found to be AR coactivators in
a feed forward manner (Shin et al., 2009), ERG, on the other hand, was recently
implicated to play the role of AR corepressor in androgen dependent transcriptions
(Sun et al., 2008).
Genome-wide cistrome studies of AR and ERG in VCaP prostate cancer cells have
shown that ERG suppresses androgen dependent transcription as well as epithelial
differentiation (Yu et al., 2010). A recent study has investigated further into the
mechanism of the transcriptional collaboration between AR and ERG in ERG
overexpressed prostate cancer cells (Chng et al., 2012). They assigned functional
roles of various corepressors such as ERG, HDACs and EZH2 in mediating
metastasis in a way that they cooperate in a coregulatory network centered by AR to
attain optimal androgen signaling for prostate cancer progression and development.
1.7 Pioneering factors as potential drug targets
Pioneer factors are an emerging class of transcription factors that contribute to the
cell-type-specific transcriptional programs and facilitate transcription factors
binding to enhancers by modulating chromatin accessibility (Zaret and Carroll,
2011; Jozwik and Carroll, 2012). Pioneering factors are usually prebound to
20
condensed chromatin in a hormone independent manner, and its modulation of the
chromatin accessibility via various molecular mechanisms, they are able to
facilitate recruitment of other transcription factors to turn on the subsequent
transcription. Recent studies on nuclear receptors have identified a variety of
pioneering factors in different classes of cell lines. Besides the role of FoxA1 as
pioneering factor of AR in prostate cancer, it has also been shown to pioneer the
Estrogen Receptor (ER) mediated transcription in breast cancer, by facilitating
ERα recruitment and modulating chromatin accessibility at the regulatory sites of
ERα target genes (Carroll et al., 2005; Lupien et al., 2008; Eeckhoute et al., 2009)
(Figure 1.6).
PBX1 has been shown to be a novel pioneering factor for the ER-mediated
transcriptional response that drives aggressive tumors in breast cancer. PBX1
translate specific epigenetic signatures into an open chromatin state that guides
the recruitment of ERα and its regulated transcriptional programs are highly
associated with poor prognosis in breast cancer patient (Magnani et al., 2011).
Ap2γ is another novel pioneering factor and it has recently been shown to play a
role in ERα recruitment and mediating long range chromatin interactions in
response to estrogen stimulation in breast cancer. It also has interplay with FoxA1
in mediating ER dependent transcription as well as long range chromatin
interactions (Tan et al., 2011).
Another pioneering factor GATA3 has been shown to act upstream of FoxA1 to
directly affect ER enhancer accessibility in breast cancer cells, and its depletion
21
resulted in a global redistribution of active histone marks such as H3K4me1 and
H3K27Ac (Theodorou et al., 2013).
Due to the importance of pioneer factors in mediating transcription in hormone
dependent cancer, they constitute attractive therapeutic drug targets for cancer
treatment. Examples such as FOXA1 is found to be play the role as pioneering
factor to both ERα mediated transcription and tumor growth in breast cancer and
AR mediated transcription and cancer progression in prostate cancer, therefore the
development of a specific inhibitor to FOXA1 would provide a useful clinical
utility for the treatment of ER+ hormone-resistant breast cancer and AR
dependent prostate cancer.
22
Figure 1.6 Cell type specific FoxA1 recruitment recognized by the lineage-
specific H3K4 methylation distributions
FoxA1 recruitment occurs in a cell-specific manner. The FoxA1 are directed to
bind to its respective response elements recognized by active enhancers marked
by lineage specific H3K4me1 and H3K4me2. In contrast, H3K9 methylation
marks silenced enhancer regions and those repressed loci are usually devoid of
FoxA1 binding. FoxA1 are found to bind and actively modulate the associated
chromatin to a more relaxed state, thereby facilitating lineage-specific
23
transcription factor such as ERα, AR or other collaborative factors recruitment to
the more exposed binding sites in response to hormone stimulation to establish
transcriptional competency (Eeckhoute et al., 2009).
24
1.8 NFI family of transcription factors
Our study utilized genomic approaches to identify and characterize novel
collaborative factor of AR. By adopting ChIP-seq technology (Schmidt et al.,
2009), we generated AR binding patterns across the genome in LNCaP prostate
cancer cells. Apart from the other well characterized AR cofactor motifs such as
Forkhead, ETS, NKX, GATA, another motif that is highly enriched motifs in the
AR cistrome belongs to the NFI family of DNA-binding proteins. This family of
transcription factors consists of four members, namely NFI-A, NFI-B, NFI-C and
NFI-X (Qian et al., 1995). They are known to function in both viral DNA
replication and in the regulation of gene expression (Gronostajski, 2000; Perez-
Casellas et al., 2009) (Figure 1.7).
NFI proteins have modular structures. The N-terminal domains of NFI proteins
mediate DNA binding and dimerzation, and the C-terminal domains usually
regulate transcriptional activation and/or repression (Mermod et al., 1989;
Bandyopadhyay and Gronostajski, 1994). NFI binding sites have been found in
many mammalian tissues, including brain, liver, lung and mammary gland,
pituitary, retina and various other tissues (Cereghini et al., 1987; Courtois et al.,
1990; Watson et al., 1991; Furlong et al., 1996; Bachurski et al., 1997; Bedford et
al., 1998). In most of these tissues, the function of NFI proteins has been indicated
to be important for gene expressions. The NFI family of transcription factors
usually binds as a either hetero- or homodimer with a preferred binding sequence
as a palindrome containing two half sites TTGGCANNTGCCAA on duplex DNA
(Gronostajski et al., 1985). NFI proteins are found to be either repressing or
25
activating gene expression in a gene specific manner (Furlong et al., 1996;
Johansson et al., 2003). It has been recently shown to be involved in long rang
regulation of gene expression by forming chromatin barrier that blocks the
propagation of heterochromatin structures (Esnault et al., 2009).
Studies also showed that the NFI proteins have dual role in hormone-mediated
transactivation of mouse mammary tumor virus (MMTV) promoter. NFI family
of transcription factors are found to play a role in both transcriptional activation
and nucleosome remodeling via the formation and maintenance of a preset
chromatin structure in the MMTV promoter region in mouse (Chikhirzhina et al.,
2008).
In situ hybridization assays in mouse indicated that the four NFI gene members
are expressed in a relatively unique but widely overlapping pattern during
embryogenesis, suggesting that it’s due to the differential expression of these
genes that lead to differential expression of the target proteins that regulate
development (Chaudhry et al., 1997).
NFI proteins also have implications in cancer from their role in the control of cell
growth. The aberrant fusion between the C-terminus of NFIB and HMGIC leads
to pleomorphic adenomas (Geurts et al., 1998). However, the overexpression of
NFIX has opposing role in cancer development by suppressing oncogenic
susceptibility in mink lung epithelial cells (Sun et al., 1998). The early findings of
the role of NFI proteins in DNA replication might be related to the influence of
the altered expression of NFI proteins on cell proliferation in cancer development.
The current models for investigating the role of the four members in cancer are
26
mainly systems that are depleted or overexpressing the specific isoforms of NFI
protein family members (Gronostajski, 2000).
27
Figure 1.7 Domains and alternative splicing of vertebrate NFI genes.
The top figure illustrates the general feature of NFI proteins and the below shows
the alternatively spliced products of the four NFI genes from vertebrates, NFIA,
NFIB, NFIC and NFIX. The chromosomal locations of each individual member
are indicated below the name of the member. NFI proteins are generally
composed of the N-terminal DNA-binding and dimerization domain and the C-
terminal regions including the proline-rich transactivation domain (Gronostajski,
2000).
28
1.9 NFIC CCAAT binding transcription factor
Based on the clinical transcriptome studies available in Oncomine database, we
narrowed down to NFIC which is overepressed in the metastatic prostate tumor
samples (Lapointe et al., 2004; Yu et al., 2004).
Up till now there have been relatively limited studies of NFIC in prostate cancer,
and most studies on the biological functions of NFIC have been performed on nfic
knock out mice, which showed that NFIC played an essential role for odontogenic
cell proliferation and odontoblast differentiation during tooth root development
(Lee et al., 2009). Nfic-deficient mice exhibited normal molar crown formation
but aberrant odontoblast differentiation during root formation (Steele-Perkins et
al., 2003). Mice that lack NFIC develop abnormal roots and lose their teeth,
which shares similar symptoms to the radicular dentin dysplasia I in humans.
Studies found significant increases in the several mRNA expressions in NFIC
depleted cells, suggesting that NFIC might regulate odontoblast cell migration
and differentiation, and thus play a role in the root development (Kim et al., 2009).
One study on the transcriptional regulatory function of NFI proteins based on the
model of NFI-dependent mouse mammary tumor virus (MMTV) promoter
indicated that the expression of NFIC or NFIX, but not NFIA or NFIB proteins,
represses glucocorticoid induction of the MMTV promoter in HeLa cells. The
repressive regulatory functions by NFIC appears to be highly cell type specific
that such regulation is observed in HeLa and COS-1 cells but not 293 or JEG-3
cells (Chaudhry et al., 1999).
29
The role of NFIC in cancer development has limited implication up to date. A
study of ERα centric regulatory network in breast cancer suggest that NFIC
negatively regulates the cyclin D1 (CCND1) oncogene expression, therefore its
expression is negatively correlated with breast cancer proliferation (Eeckhoute et
al., 2006). However, the role of NFIC in the context of AR in prostate cancer has
not yet been established.
1.10 Aim of the study
In this study, we integrate molecular and computational approach to decode AR
and NFIC cistrome in prostate cancer cells. By combining ChIP-sequencing with
microarray gene expression profiling, we endeavor to find out the role of NFIC in
AR mediated transcriptional network. We established NFIC as a novel pioneering
factor of AR and functionally dissect its role as a pioneering factor in relation to
another pioneering factor, FoxA1, in mediating AR transcriptional regulations.
We found huge amount of AR and NFIC overlapping cistromes also converge
FoxA1 binding events, suggesting that FoxA1 comes into play with AR and NFIC
regulatory network. Lastly, we discovered that NFIC mediates AR transcriptional
regulation at distinct classes of ARBS defined by their dependency on FoxA1,
and at these sites NFIC and FoxA1 differentially modulates chromatin
accessibility, thereby potentiated the role of NFIC in the prostate cancer
development.
30
CHAPTER 2. MATERIALS AND METHODS
2.1 Reagents and antibodies
The hormone dihydrotestosterone (DHT) was purchased from Tokyo Chemical
Industry. The antibodies we used for ChIP-assay were purchased from the
following companies: anti-AR (sc-816 and sc-815x), anti-NFIC (sc-5567), normal
rabbit IgG (sc-2027), normal goat IgG (sc-75 2028) from Santa Cruz, and anti-
FoxA1 (ab5089) from Abcam.
The antibodies used for western blot analysis were shown as follows. Primary
antibodies used were: anti-AR (AR441) from Labvision, anti-NFIC (sc-5567)
from Santa Cruz; anti- FoxA1 (ab5089) and anti-βactin (ab3280-500) from
Abcam. Secondary antibodies used were: donkey anti-goat IgG HRP (sc-2033)
from Santa Cruz; ECL anti-rabbit IgG horseradish peroxidase (HRP) linked whole
antibody (NA934V) and ECL anti-mouse IgG HRP linked whole antibody (NA931V)
from Amersham.
2.2 Cell culture
LNCaP cells were purchased from American Type Culture Collection (ATCC).
LNCaP were maintained in RPMI Medium 1640 (RPMI) with 10% fetal bovine
31
serum (FBS), 1 mM sodium pyruvate, 100 units/ml penicillin and together with
30 μg/ml gentamycin. LNCaP cells were maintained in hormone deprived phenol
red free RPMI medium for at least 3 days followed by DHT or ethanol treatment.
2.3 Cryogenic preservation and recovery of cells
Early passages of LNCaP cells were trypsinized and spun down at 1,000 rpm for 3
mins to remove the trypsin. Cell pellet was resuspended in culture media which was
further supplemented with 45% FBS and 5% dimethyl sulfoxide (DMSO) (Sigma),
and then aliquoted into 2 ml Cryobank Vials (Thermo Scientific, Nunc). The vials
were placed into a pre-cooled isopropanol-filled container for slow freezing at -80˚C.
After freezing overnight, the vials were transferred to a liquid nitrogen tank for long
term storage. During recovery, the cells were thawed quickly at 37˚C and transferred
to T75 flask for culture. The medium was changed the next day to remove DMSO.
2.4 Western Blot Analysis
After LNCaP cells were stimulated with DHT for 2 hours, we use Triton X lysis
buffer (0.25% Triton X-100, 1mM EDTA, 10 mM TrisHCl, 150 mM NaCl) to
lyse the cell membrane. Total protein lysates were collected and protein
concentration was subsequently quantified using Pierce BCA Protein Assay kit
(Thermoscientific). Then we prepared 20 to 30 ug of protein lysates of each
sample and mixed them with 5x SDS loading buffer, followed by denaturing at
99˚C for 5 mins. After that, the protein lysates were resolved on 10% SDS
polyacrylamide gel (SDS-PAGE) and subsequently transferred onto the
32
nitrocellulose membrane (GE Healthcare). The transferred membrane was
blocked with 5% milk for 1 hr at room temperature before it was incubated with
corresponding primary antibodies and secondary antibodies at an optimized duration
and temperature. For signal detection, ECL plus Western Blotting Detection System
(Amersham) was sprayed onto the surface of the membrane and subsequently
incubated in dark for 5 minutes before the membrane was exposed to films.
2.5 RNA Isolation and Real-time Reverse Transcription reaction (RT-qPCR)
LNCaP cells were pretreated with ETOH or 10 nM DHT for 12 hrs, followed by
extraction of total cellular RNA using TRI® Reagent (Sigma). After precipitated
with 75% ETOH, chloroform was added to facilitate RNA isolation. The
extracted RNA was then purified using the Invitrogen PureLinkTM RNA Mini
Kit according to the manufacturer’s protocol. After measuring RNA quality and
concentration using Nanodrop, 1 μg RNA was obtained to undergo reverse
transcription using Oligo (dT) primer (Promega), dNTP Mix (Fermentas),
Moloney Murine Leukemia Virus Reverse Transcriptase (M-MLV RT) (Promega)
and M-MLV RT 5X Buffer (Promega). After cDNA are synthesized, real-time
qPCR was subsequently performed by adding the KAPA SYBR FAST qPCR kit.
CT values were analyzed with the ABI 7900HT Fast Real-Time PCR System to
obtain relative expression. The sequences for real-time qPCR primers of cDNA
are listed in Appendix I. The experiments were repeated at least three times to
obtain the gene expression profiles.
33
2.6 Chromatin Immunoprecipitation assays
LNCaP cells were treated with 100nM DHT or EtOH for 2 hours before the cells
were fixed with 1% formaldehyde (Sigma-Aldrich, Missouri). After cell pellets were
collected, they were subsequently lysed with SDS lysis buffer with cocktail
Proteinase Inhibitor and underwent sonication to shear the genomic DNA into lengths
of 500-1000 bp. From the sonicated samples, 30 uL was aliquoted and kept as input.
The rest of the sheared chromatin was then precleared with normal rabbit/goat IgG
(Santa Cruz Biotechnology, Santa Cruz) and sepharose beads A or A/G (Zymed, San
Francisco) for at least 2 hours in 4°C. It’s followed by incubation overnight for
complete immunoprecipitation after adding the specific antibodies and sepharose
beads. On the next day, the beads were washed with four rounds of washing buffers
to remove non-specific bindings. Then the protein bound DNA complex was
subjected to elution and subsequent reverse-crosslinking at 65°C overnight to
completely isolate DNA fragment with the protein complex. The DNA was then
purified with QIAquick spin PCR purification kit (Qiagen, California). Real-time
quantitative Polymerase Chain Reaction (q-PCR) was carried out by using the KAPA
SYBR FAST qPCR kit. Amplified DNA products were subsequently detected using
the ABI 7900HT Fast Real-Time PCR System. The relative binding profile was
determined by calculating the ratio of immunoprecipitated DNA over the input.
Real-time qPCR primer sequences for ChIP assays are listed in Supplementary
Table S. All ChIP experiments were performed at least three times.
34
2.7 Short interfering RNA (siRNA) studies
We transfected LNCaP cells with 100 nM siRNA against NFIC, AR, or FoxA1
purchased from Dharmacon or negative control siRNA from 1stBase via
Lipofectamine™ RNAiMAX Transfection Reagent (Invitrogen). Cells continued
to be incubated for 72 hr. After that, cells were treated with vehicle or 10 nM
DHT for another 12 hr followed by collected for ChIP, Real-time qPCR and
western blot analyses.
2.8 ChIP-Sequencing
After quantification using Pico-green ds DNA assay kit (Invitrogen) , 5ng of
immunoprecipitated DNA were obtained and used for ChIP-Seq library construction.
The ChIP-Seq DNA sample Prep Kit (Illumina) was utilized for library preparation
with some minor modifications. The ChIP DNA was made to undergo end-repair
followed by adapter ligation. Platinum Pfx DNA polymerase (Invitrogen) was then
used to amplify the ChIP-DNA. Electrophoresis of the amplified DNA products on a
2% agarose gel was subsequently performed. Detection of the amplified DNA
products was done by staining the gel with SYBR® Green I Nucleic Acid Gel Stain
(Invitrogen). DNA products of size 200-300bp were extracted by gel excision and
purified. Confirmation of the size and quality of the extracted purified ChIP DNA
was done using bioanalyzer prior sequencing on the Solexa platform. The sequencing
depth for each library was at least 10million tags. ChIP-Seq read tags were aligned to
the reference human genome (UCSC, hg18). The binding peaks were determined
with CCAT (Xu et al., 2010) normalized against input .
35
2.9 Co-immunoprecipitation (Co-IP)
LNCaP cells were maintained in full serum RPMI medium for the Co-IP
experiments. After cells were seeded for at least three days, they were
subsequently trypsinized and lysed to obtain whole cell lysate. This is followed by
pre-clearing process of the cell lysate with Protein A-Agarose beads (Roche
Applied Science) at 4°C for 4 h. Before the IP process, we collected an aliquot of
around 30 ul and kept it at -80°C as input for the final western blot analysis. After
pre-clearing, we add 5 mg of anti-NFI (H-300, sc-5567) to the supernatant and
incubated the mixture on the roller overnight at 4°C. The next morning we added
30ul Roche beads into the incubated mixture and continued incubation for another
1.5 h at 4°C. After that we washed the mixture with TBS for four times
consecutively. Finally, we removed supernatant and heated the beads at 99°C for
5 min followed by elution with SDS loading buffer for the subsequent western
blot analysis.
2.10 Microarray expression profiling
Total RNA was extracted and purified from LNCaP cells, under the NC and NFIC
depleted or FoxA1 depleted conditions. The cells were pre-treated with ETOH or
10 nM DHT for the 12 hours. Then the Invitrogen PureLinkTM RNA Mini Kit
was used according to the manufacturer’s protocol. RNA from three biological
replicates was then processed to cRNA using the Illumina® TotalPrepTM-96
RNA Amplification Kit (Ambion) according to the manufacturer’s instructions.
36
Subsequently direct hybridization assay was performed with the HumanRef-8 v2
Expression BeadChip Kit and scanning the chip array using the BeadArray
Reader (Illumina). The BeadStudio software was subsequently used to process the
image data and GeneSpring GX11 software was further implemented to analyze
the expression data.
2.11 Gene Ontology (GO) Analysis
GO was performed using the IPA (Ingenuity Pathway Analysis) online software
on NFIC depleted microarray. NFIC activated and repressed DHT responsive
genes were analyzed respectively. Threshold for DHT responsiveness is 1.3 fold
change and cut off for NFIC dependency is 1.2 fold change.
37
CHAPTER 3. RESULTS
3.1 NFIC as a novel AR collaborative factor
3.1.1 Identification of NFIC as a potential AR cofactor in LNCaP prostate
cancer cells
To gain insight into the AR coregulatory network in mediating androgen
dependent transcription in prostate cancer and to discover novel AR collaborators
in prostate cancer, we first performed AR ChIP-Seq in the androgen-dependent
prostate cancer cell line, LNCaP to obtain a genome wide map of AR binding
events (Tan et al., 2012). AR ChIP-seq was performed at 2 hour after DHT
treatment. We managed to obtain 18,117 AR peaks in the ETOH treated condition
and 75,296 peaks in DHT treated condition based on FDR 0.05.
Next we used our in house motif discovery algorithm called Center of
Distribution (CENDIST) to analyze the ARBS sequences. CENTDIST program is
designed based on an algorithm that scans across the genome wide binding sites
and rank motifs of transcription factors available in TRANSFAC database
according to the enrichment of center distribution around the binding events of the
ChIP-seq dataset (Zhang et al., 2011). By inputting obtained AR peaks into
CENDIST, we discovered significant enrichment of several transcription factor
family motifs including Forkhead, ETS, and NKX as previously reported (Figure
1A). In addition, we also found NFI motif among the top ten most highly enriched
38
motifs derived from this analysis, indicating members of NFI family of
transcription factors might play a potential role in the AR mediated transcription.
After examining the Oncomine database that deposit cancer transcriptome studies,
we found that NFIC, one of the NFI family of transcription factors, to be over-
expressed in metastatic prostate carcinoma with respect to normal prostate tumor
in several clinical prostate tumor transcriptome studies (Lapointe et al., 2004; Yu
et al., 2004). This indicates that NFIC might play a role in prostate cancer
progression, especially in more advanced prostate cancer types (Figure 3.1).
39
A
B
40
Figure 3.1 NFI motifs are highly enriched in AR binding peaks
(A) CentDist motif enrichment analysis of the top co-occupying transcription
factor family motifs from AR ChIP-seq peaks under the condition of DHT
stimulation. The motif of families of transcription factors are ranked based on the
score of the distribution of the top member within the transcription factor family
respectively. (B) Boxplot comparing the transcript expression level of NFIC in
prostate adenocarcinoma and metastasis prostate tumor samples based on clinical
studies available in the Oncomine database of transcriptomes (Yu et al. study).
The differential gene expression data is centered on the median of expression
levels and plotted in a log2 scale.
41
3.1.2 Generation of NFIC binding cistromes in LNCaP prostate cancer cell line
We next examined the potential role of NFIC as an AR collaborative factor. By
performing NFIC ChIP-qPCR on known binding sites associated with AR model
target genes such as KLK3, KLK2, and TMPRSS2, we observed NFIC and AR
are co-localized at these loci. Based on these findings we would like to expand the
scope for the NFIC binding events across the genome by performing genome
wide ChIP sequencing of NFIC in LNCaP prostate cancer cell line under the same
2 hours hormone stimulation condition as AR ChIP-seq. Adopting FDR less than
0.05 in the in-house CCAT peak calling algorithm (Xu et al., 2010), we identified
89,377 and 82,645 NFIC binding sites in LNCaP cells prior to and after DHT
treatment, respectively. De novo motif analysis of NFIC binding sites was
subsequently performed and it revealed an enriched binding motif that is highly
similar to the NFI motif in the TRANSFAC database (Figure 3.2).
42
(A)
(B)
43
Figure 3.2 Generation of NFIC ChIP-seq library in LNCaP cells
(A) ChIP-qPCR of AR and NFIC binding profile at the PSA enhancer, KLK2
enhancer and promoter regions, and two ARBS around TMPRSS2. The data
represents the mean ± SEM of at least 3 independent assays. (B) Logos showing
the canonical ARE available from the Transfac database in the top panel and
derived via MEME algorithm in the bottom panel.
44
3.1.3 NFIC cistromes overlap with AR binding events
We observed that NFIC shares huge proportion of overlapping binding events
between DHT and ethanol treated conditions, which in turn also overlaps
considerably with ARBS (Figure 3.3 A and B).
The previous ChIP-qPCR of AR and NFIC recruitment on several AR model
genes can further be visualized on the USCS genome browser from the binding
peaks of the AR and NFIC ChIP-seq datasets. The co-localization of AR and
NFIC at PSA enhancer, KLK2 enhancer and promoter, and two sites associated
with TMPRSS2 can be observed (Figure 3.3 E).
We also investigated the genomic distribution of AR and NFIC binding events.
Most of our AR binding sites are located distances away from the transcriptional
start sites (TSS), while the NFIC binding events occurs both at distal and
proximal regions relative to the TSS. Interestingly, the AR and NFIC co-localized
binding sites exhibits similar patterns to most of the AR binding sites, that
majority of these binding events are found far away from the TSS (Figure 3.3 D).
This suggested that the collaboration between NFIC and AR most probably
occurs at enhancers of the genes to modulate downstream transcription.
To investigate whether NFIC interact with AR endogenously in LNCaP prostate
cancer cells, Co-immunoprecipitation experiment was subsequently performed.
Cell lysates were incubated with NFIC antibody and we pulled down the potential
protein complexes using specifically designed beads. After western blot analysis
45
using AR antibody, we managed to observe a weak interaction between AR and
NFIC, as compared to the intensity after negative control IgG pull down. This
provided support that NFIC not only co-localize with AR, but also physically
interact with AR, possibly by forming a transcriptional complex (Figure 3.3 C).
However, the Co-IP experiments need to be optimized to obtain a better
visualization of the endogenous protein-protein interactions between AR and
NFIC.
46
(A)
(B)
(C)
58743
66092
16553
AR DHT
NFIC DHT
AR/NFIC overlapping
47
(D)
(E)
48
Figure 3.3 AR and NFIC are co-localized in LNCaP cells
(A) Venn diagram illustrating the overlap between AR binding peaks under DHT
treatment and NFIC ChIP-seq peaks in both ETOH and DHT treated conditions.
(B) Percentage of AR unique, NFIC unique and AR/NFIC shared binding events.
(C) Co-immunoprecipitation experiments showing the interaction between AR
and NFIC. (D) Genome-wide distribution of AR and NFIC binding sites with
respect to the transcription start sites (TSSs) of RefSeq genes. (E) UCSC Genome
browser (Hg18) featuring representative androgen dependent AR model genes,
KLK3 (top left panel), KLK2 (top right panel) and TMPRSS2 (bottom panel), co-
occupied by AR and NFIC. The binding tag intensities are indicated on the right
y-axes.
49
3.1.4 NFIC mediates AR transcriptional activity
To confirm the effect that NFIC had on AR-mediated transcription is at least, in
part, attributed to NFIC binding on the cis-regulatory elements, we cloned the two
AR binding sites (C7, C8), that were shown to recruit NFIC in vivo on androgen
stimulation (Figure 3.4) respectively into a luciferase reporter plasmid. The
predicted AR and NFIC binding motif of each of the AR binding site was then
distorted via mutagenesis separately prior to performing reporter assays.
Androgen-induced reporter activities of both binding sites were decreased when
the AR or NFIC binding motifs were abolished (Figure 3.4), pointing to the
importance of NFIC occupancy in androgenic transcriptional response.
50
Figure 3.4 Ligand dependent response at ARBS requires AR and NFIC
The top panel is the schematic diagram illustrating the reporter constructs used in the
transient transfection analysis. The Bottom panel shows the reporter assay after
LNCaP cells were transfected with reporter constructs. Prior to transfection, LNCaP
cells were treated with or without DHT for 24 hrs. C7 and C8 ARBS full mutated
ARE and NFIC motifs were cloned into pGL4-TATA and assessed for their
luciferase reporter activity. Empty vector pGL4-TATA was integrated as a negative
control. All results represent the average of 3 independent experiments ± SEM.
51
3.2 Characterization and Validation of NFIC as pioneering factor to AR
3.2.1 NFIC binding events at ARBS are independent of androgen stimulation
We moved on to globally analyze the NFIC binding events. To validate the NFIC
ChIP-seq datasets, we randomly selected 5 high tag intensity, 5 medium tag
intensity and 10 low tag intensity NFIC binding sites. The ChIP-qPCR validation
of these binding events shows the NFIC recruitment happens to be independent of
DHT treatment for all 20 binding sites tested (Figure 3.5 A).
The genome wide binding profile of AR and NFIC showed that AR binding is
minimal prior to DHT treatment in both AR unique and AR and NFIC co-
localized regions, while the occupancy of NFIC at both NFIC unique and AR and
NFIC overlapping regions is comparable before and after androgen stimulation.
This indicates the binding of NFIC to its binding sites is independent of androgen
stimulation. The scatter plot showing the distribution of the tag intensity of each
NFIC binding sites available in either ETOH or DHT treated ChIP-seq library
exhibits a high correlation between the two datasets. This provided additional
evidence that NFIC binding events are indeed ligand independent (Figure 3.5 B
and C).
Together with the substantial overlap between AR and NFIC binding events after
androgen stimulation, our data suggested that NFIC might play a role as a pioneer
factor of AR that first binds to ARBS prior to DHT treatment and subsequently
enhances the transcriptional competency of AR. One of the most well studied
52
pioneer factors to AR in prostate cancer cells is FoxA1, which remodels the
chromatin accessibility rendering it competent for other transcription factor
binding (Lupien et al., 2008; Magnani et al., 2011). Hence it would be intriguing
to explore whether NFIC also possesses the ability of pioneering the
transcriptional activity of AR in the context of prostate cancer.
53
(A)
54
(B)
(C)
55
Figure 3.5 NFIC genome wide recruitment is ligand independent
(A) ChIP-qPCR of NFIC occupancy at the 5 high tag intensity binding sites, 5
medium intensity binding sites and 10 low intensity binding sites randomly
picked from the NFIC ChIP-seq dataset. The data represents the mean ± SEM of
at least 3 independent assays. (B) Comparison between average tag densities of
binding sites after peak calling using CCAT in both ethanol and DHT treated
NFIC ChIP-seq binding maps that also have ARBS. (C) Scatter plot showing the
tag intensity of NFIC binding events in both DHT-treated and ETOH-treated
datasets.
56
3.2.2 NFIC and AR do not regulate each other
To investigate the role of NFIC as pioneering factor to AR, we adopted transient
siRNA knockdown approach to transfect into the LNCaP cells to examine the
subsequent effect of NFIC depletion on AR recruitment and androgen dependent
gene expressions. It would be important to find out whether there’s a mutual
regulation between AR and NFIC in the first place. After knocking down AR and
NFIC respectively, we observed that the depletion of NFIC has no appreciable
effect on AR expression both in mRNA level and protein level, indicating AR is
not a direct target of NFIC. On the other hand, NFIC expression was unaffected
by AR knockdown or DHT stimulation, confirming that NFIC is not an AR-
regulated gene (Fig 3.6).
57
(A) (B)
(C)
58
Figure 3.6 NFIC and AR do not regulate each other
(A and B) Effect of NFIC silencing on AR mRNA expression level. Starved
LNCaP cells were transfected with either negative control siRNA or siRNA
agains NFIC, followed by DHT or ETOH treatment for 6 hours. Total RNA was
then isolated and quantified using real-time RT-qPCR with the primers of AR,
NFIC and GAPDH genes. Subequently all mRNA expressions were normalized
against GAPDH expression levels. The data presented are relative expression to
GAPDH ± SEM of at least 3 independent experiments. (C) Western blot showing
the protein levels of AR and NFIC as well as loading control β-actin after
transfected with siRNA against NFIC and AR respectively.
59
3.2.3 NFIC mediate AR dependent transcription
Next, we sought to determine the requirement for NFIC in AR mediated
transcriptional response. AR and NFIC were observed to be co-localized at
several AR target genes such as PSA, KLK2, and TMPRSS2. NFIC depletion
resulted in a significant reduction of the expression of these AR model target
genes (Figure 3.7 A) as well as the AR recruitment to its binding sites associated
with these genes (Figure 3.7 B), suggesting that NFIC acts upstream of AR
recruitment, thereby promoting AR signaling. Above results provide support that
NFIC plays a role as an AR collaborative factor in regulating AR target gene
expression
To obtain more candidate genes regulated by NFIC for further analysis, we
performed genome wide microarray gene expression analysis under the condition
of NFIC depletion on LNCaP cells with or without DHT treatment (Fig 3.7 C).
Our analysis revealed 1868 DHT responsive genes by adopting 1.3 fold change
cut-off in comparison of the expression profile prior and after DHT treatment.
Interestingly, the depletion of NFIC affected the expression of a significant
number of DHT-induced (402) and DHT-repressed genes (158), indicating that
NFIC plays the role of either a transcriptional coactivator or corepressor to
mediate AR-mediated transcription. The expression profiling array also provides a
candidate pool of NFIC target genes in the context of androgen regulation. Taken
together, our results potentiated the role of NFIC as a pioneer factor of AR that
acts upstream and subsequently mediates AR transcriptional regulation.
60
To further analyze the genome wide microarray profiling data after NFIC
silencing, we use IPA gene ontology to investigate the cellular pathways and
processes involved in NFIC regulation of AR dependent transcription. NFIC
activated and repressed gene sets were both analyzed by IPA. Cancer related
cellular process involved in NFIC regulation include cellular movement, cell
death, cell proliferation and cell development. This further proves that NFIC plays
a role in androgen mediated prostate cancer growth and development (Figure 3.7
D).
61
(A)
(B)
62
(C)
(D)
63
Figure 3.7 NFIC regulates AR dependent genes
(A) Effect of NFIC silencing on PSA, TMPRSS2, KLK2 mRNA expression
levels. LNCaP cells were maintained in hormone depleted medium followed by
transfection with either control negative control siRNA or siRNA targeting
against NFIC prior to stimulation with or without 10 nM of DHT for 12 hr. Total
RNA was isolated and amplified with real-time RT-qPCR primers for PSA,
TMPRSS2 and KLK2. mRNA expression levels were normalized against
GAPDH. (B) ChIP-qPCR of AR occupancy after NFIC silencing at the PSA,
KLK2, and TMPRSS2. (C) Microarray gene expression profiling was performed
on LNCaP cells transfected with control or NFIC siRNA and stimulated with
ETOH as vehicle or DHT for 12 hours. The heatmap represents all DHT-
regulated genes and fold change in expression is indicated below. All results
represent the average of 3 independent experiments ±S.E.M. (D). Gene Ontology
using IPA showing cellular process involved via the regulation of the NFIC
activated and repressed genes.
64
3.3 FoxA1 form co-regulatory complex with NFIC in Mediating AR
Transcriptional Regulation
So as to reveal a more comprehensive mechanism of the AR and NFIC regulatory
network, we decided to investigate additional potential players. To achieve this,
we analyzed NFIC cistrome that also contains ARBS via CENTDIST motif
analysis program to discover motifs that are also centered around AR and NFIC.
As expected, both NFI and ARE motifs were highly ranked at these binding sites,
and interestingly, the second highly enriched motif revealed by CENDIST is
Forkhead motif (Figure 3.8 A). This indicates that NFIC and AR might form a
transcriptional regulatory network with factors that belong to the Forkhead family.
Since the role of FoxA1 as a pioneering factor to mediate AR gene transcription
has been recently studied and reported (Lupien et al., 2008; Serandour et al.,
2011), we would like to investigate the potential role of FoxA1 in the AR and
NFIC regulatory network.
Collaborations between multiple pioneer factors to mediate the transcriptional
competency of regulatory elements have been reported. For instance, FoxA1 has
been shown to cooperate with AP- occupied by
both factors there is a functional interplay between AP-2γ and FoxA1 to mediate
ER transcription and long range interaction(Tan et al., 2011).To study the
potential interplay among AR, NFIC and FoxA1, we utilized the FoxA1 ChIP-Seq
dataset in LNCaP cells from the previous study by our group (Tan et al., 2012).
Integrating the DHT stimulated AR, NFIC and FoxA1 ChIP-Seq datasets, we
65
discovered a huge proportion of AR and NFIC overlapping binding sites that are
also bound by FoxA1 (Figure 3.8 B).
66
Table 1 Summary of the unique tag counts and total number of peaks called
using FDR 0.05 for each ChIP-seq library
Library ID
Description
Sequencing Depth
No. of peaks called
SCS800
AR ETOH
17,413,241
18,117
SCS801 AR DHT 13,252,823 75,296
CHL005 NFIC ETOH 918,0715 89377
CHL006 NFIC DHT 994,3604 82645
CHL001 FOXA1 ETOH 13,462,620 79,975
CHL002 FOXA1 DHT 8,677,867 61,309
67
(A)
(B)
68
(C)
69
Figure 3.8 FoxA1 is a potential interplayer of AR/NFIC network
(A) CentDist output of the top co- occurring transcription factor family motifs
from DHT stimulated AR and NFIC overlapping ChIP-seq peaks. (B) Venn
diagram illustrating the overlap between DHT stimulated AR, NFIC and FoxA1
ChIP-seq peaks. (C) Screenshots of AR, NFIC and FoxA1 ChIP-seq peaks
around the KLK3, KLK2 and TMPRSS2.
70
In agreement with previous studies, by examining the heatmap of genome wide
FoxA1 binding profile, similar to the binding profile of NFIC, the pattern of
FoxA1 binding is generally independent of androgen stimulation in our study, and
the majority of AR and NFIC co-localized sites also contain substantial amount of
FoxA1 occupancy (Figure 3.9A). Furthermore, by comparing the tag intensity
distribution of FoxA1 binding peaks on AR unique, NFIC unique and AR/NFIC
overlapping regions, we found that FoxA1 binding events are more enriched at
AR and NFIC co-localized regions than AR and NFIC uniquely occupied regions
(Figure 3.9B). All these results suggested that FoxA1 possibly forms a
transcriptional network with AR and NFIC.
71
(A)
(B)
72
Figure 3.9 FoxA1 binding is highly enriched in AR/NFIC overlapping regions
(A) Heatmap of AR (red), NFIC (green) and FoxA1 (purple). ChIP-seq tag
intensity sorted according to NFIC (DHT) tag intensity (top-bottom: highest to
lowest) and centered on AR (DHT) peaks in a 2 kb window. 1-3: Groups of
common or unique NFIC binding sites identified, namely (1) AR unique; (2)
NFIC unique; (3) AR/NFIC overlapping
73
Before depleting FoxA1 for the subsequent analysis, we also noted that silencing
FoxA1 or NFIC did not affect the expression of the other; neither did it have any
appreciable effect on AR protein level (Figure 3.10A). Then based on the
available genome wide ChIP-seq datasets of AR, NFIC and FoxA1, we randomly
selected ARBS co-localized with FoxA1 only, as well as ARBS that are co-
occupied uniquely by NFIC, and examined the AR recruitment at these sites after
introducing siRNA against NFIC and FoxA1 respectively. Not surprisingly, AR
recruitment was regulated by FoxA1 at ARBS void of NFIC occupancy, while
NFIC regulated AR recruitment at sites bound by only NFIC itself (Figure 3.10B).
FAIRE-qPCR was subsequently performed to investigate the role of NFIC and
FoxA1 on modeling chromatin openness in different classes of ARBS that could
contribute to AR recruitment and subsequent transcription. Under normal
conditions a relatively high FAIRE signal detected by qPCR suggests that the
chromatin state at specific loci is relatively open in state. From the FAIRE qPCR
results, it has been revealed that at NFIC unique ARBS, FAIRE signal is
compromised upon NFIC depletion, but not after FoxA1 knockdown, while for
FoxA1 unique ARBS it is FoxA1 that modulates chromatin state instead of NFIC
(Figure 3.10 C&D).
74
(A)
(B)
75
(C)
(D)
76
Figure 3.10 NFIC and FoxA1 pioneer AR recruitment at NFIC unique and
FoxA1 unique ARBS respectively
(A) Western blot showing the effect of NFIC, FoxA1 silencing on AR, NFIC and
FoxA1 as well as loading control β-actin protein levels. (B) ChIP-qPCR of AR
occupancy after FoxA1 silencing at the PSA, KLK2, and TMPRSS2. (C)
Heatmap showing the AR ChIP-qPCR experiment after NFIC or FoxA1 silencing
on randomly selected NFIC unique ARBS and FoxA1 unique ARBS. The
intensity of the relative enrichment of % input is indicated below. All relative
enrichments of individual ARBS have been normalized against NC ETOH treated
condition. All ChIP qPCR experiments were repeated three times. (C) Box plot
showing the FAIRE qPCR experiments after NFIC or FoxA1 silencing on NFIC
unique ARBS. All relative FAIRE signal enrichments have been normalized
against NC ETOH treated condition. (D) Box plot showing the FAIRE qPCR
experiments after NFIC or FoxA1 silencing on FoxA1 unique ARBS. All relative
FAIRE signal enrichments have been normalized against NC ETOH treated
condition. All FAIRE qPCR experiments were repeated at least three times.
77
It is not to our surprise to find out patterns of NFIC and FoxA1 functioning as
pioneering factor to AR respectively at those ARBS not co-occupied by both
factors. Previous studies have indicated the role of FoxA1 to modulate chromatin
accessibility and direct AR recruitment to respective ARBS it preoccupies
(Eeckhoute et al., 2009). It is interesting to discover the role of NFIC as
pioneering factor to AR, acting in a similar manner to FoxA1 at ARBS occupied
by AR and NFIC only. This suggests NFIC could function independently as a
pioneering factor to AR and gives rise to questions about what the mechanism is
like at FoxA1 and NFIC co-bound regions.
We summarize our above results so far, that these results indicate that NFIC and
FoxA1 function as pioneering factor to facilitate AR recruitment to NFIC and
FoxA1 uniquely occupied ARBS respectively in an independent manner. And
whether there is collaboration between NFIC and FoxA1 in mediating AR
dependent transcription at ARBS shared by both pioneering factors remains to be
investigated.
78
(A)
(B)
Figure 3.11 Schematic diagram illustrating how NFIC and FoxA1 coordinate
AR transcriptional activity at distinct classes of ARBS.
(A) At NFIC unique ARBS, NFIC plays the role of AR pioneering factor and
facilitate the AR recruitment. (B) At FoxA1 unique ARBS, FoxA1 plays the role
of AR pioneering factor and facilitate the AR recruitment.
79
3.4 NFIC has multiple mechanisms in distinct ARBS defined by FoxA1
3.4.1 FoxA1 regulated a large number of genes also regulated by NFIC
To obtain a global view of the coregulatory functions of NFIC and FoxA1 on AR
transcription, we next performed genome wide microarray expression profiling in
LNCaP cell line after depleting FoxA1. FoxA1 depletion was performed in
accordance to NFIC knockdown conditions. Cells were transfected with negative
control siRNA as well as siRNA against FoxA1 for 72 hours, followed by
treatment with or without DHT for 12 hours after the total RNA have been
collected.
We adopted 1.3 fold changes for the DHT responsiveness and 1.3 fold changes as
threshold for FoxA1 dependency. As a result, we observed a striking difference
between the expression patterns of FoxA1 regulated genes before and after FoxA1
depletion.
Comparing the NFIC regulated genes with the FoxA1 regulated genes, we found
that around 42% of NFIC regulated genes are also regulated by FoxA1 and the
rest 58% of genes are regulated by NFIC without interference by FoxA1.
Therefore these datasets provided candidates for the subsequent analysis of the
role of NFIC in regulating AR transcription in the presence of the absence of
FoxA1 regulation.
80
(A)
(B)
81
Figure 3.12 NFIC regulate a substantial amount of FoxA1 regulated genes
(A) Microarray gene expression profiling was performed on LNCaP cells
transfected with control or FoxA1 siRNA and stimulated with ETOH as vehicle or
DHT for 12 hours. The heatmap represents all DHT-regulated genes and fold
change in expression is indicated below. All results represent the average of 3
independent experiments ±S.E.M. (B) Vann Diagram showing the overlap
between NFIC regulated genes and FoxA1 regulated genes obtained from
knockdown microarray expression profiling of NFIC and FoxA1.
82
3.4.1 NFIC plays the role of pioneering factor instead of FoxA1 at FoxA1
independent ARBS
Next we sought to explore the regulatory roles of NFIC and FoxA1 on NFIC and
FoxA1 co-localized ARBS. From the expression microarray and the ChIP-Seq
datasets of AR, NFIC and FoxA1, we selected several androgen responsive and
NFIC regulated genes associated with ARBS occupied by both NFIC and FoxA1.
By performing the expression microarray after FoxA1 depletion under similar
condition to NFIC knockdown microarray, we compared the gene list to the NFIC
regulated gene sets , and found out that some of the NFIC regulated genes are also
regulated by FoxA1, while another substantial group of NFIC regulated genes are
independent on FoxA1 depletion.
Based on this, we further classified the ARBS associated with these genes into
FoxA1 independent and pioneered regions. And this is consistent with recent
studies that revealed distinct AR binding programs defined by FoxA1 in LNCaP
prostate cancer cell line. FoxA1 depletion elicits extensive redistribution of AR
binding events and this is correlated with changes in androgen-dependent gene
expressions (Sahu et al., 2011; Wang et al., 2011).
Although AR, NFIC and FoxA1 co-occupy around a few well characterized AR
model genes such as PSA, KLK2 and TMPRSS2 (Figure 4A), none require
FoxA1 for gene activation (Figure 4B), but were found to be regulated by NFIC
(Figure 2D). Additionally, depletion of FoxA1 did not affect AR recruitment to
ARBS associated with these genes (Figure 4C), suggesting NFIC plays a more
83
important role as pioneering factor to AR at these AR model gene associated
ARBS. Although they were occupied by FoxA1 as well, FoxA1 does not appear
to play any regulatory role. Next we carried out knock down of NFIC or FoxA1
and checked the subsequent binding of either factor, but both seem not to be
required for the recruitment of the other (Figure 4D and 4E), suggesting NFIC and
FoxA1 do not have mutual dependency at these ARBS despite their co-occupancy.
84
(A)
(B)
85
(C)
(D)
86
Figure 3.13 NFIC plays pioneering factor of AR at AR model genes instead of
FoxA1
(A) Effect of FoxA1 silencing on PSA, TMPRSS2, KLK2 expression levels.
LNCaP cells were maintained in hormone depleted medium followed by
transfection with either control negative control siRNA or siRNA targeting
against FoxA1 prior to stimulation with or without 10 nM of DHT for 12 hr. Total
RNA was isolated and amplified with real-time RT-qPCR primers for PSA,
TMPRSS2 and KLK2. mRNA expression levels were normalized against
GAPDH. (B) ChIP-qPCR of AR occupancy after FoxA1 silencing at the PSA,
KLK2, and TMPRSS2. (C) ChIP-qPCR of FoxA1 occupancy after NFIC
silencing at the PSA, KLK2, and TMPRSS2. (D) ChIP-qPCR of NFIC occupancy
after FoxA1 silencing at the PSA, KLK2, and TMPRSS2. All results represent the
mean ± SEM of at least 3 independent assays.
87
To provide support to our hypothesis on the mechanism of NFIC in mediating AR
transcription alone at FoxA1 independent loci, additional FoxA1 independent
ARBS have been revealed from gene expression profiling and ChIP assay
validation, namely, AADAT, MBOAT2, NDRG1, SGK3 and SEC24D. As can be
observed from Figure 3.14, these genes were all NFIC regulated genes but
independent of FoxA1 regulation with patterns pretty similar to the few AR model
genes. Depletion of neither NFIC nor FoxA1 affected the occupancy of one
another on these loci, indicating NFIC is pioneering factor of AR where FoxA1
binds to chromatin without contributing to the activation of AR transcriptional
programs.
88
(A)
(B)
89
(C)
(D)
90
(E)
(F)
91
Figure 3.14 NFIC pioneers AR mediated transcription instead of FoxA1 at
FoxA1 independent/occupied ARBS
(A) Effect of NFIC silencing on AADAT, MBOAT2, NDRG1, SGK3, and
SEC24D mRNA expression levels. LNCaP cells were maintained in hormone
depleted medium followed by transfection with either control negative control
siRNA or siRNA targeting against NFIC prior to stimulation with or without 10
nM of DHT for 12 hr. Total RNA was isolated and amplified with real-time RT-
qPCR primers for AADAT, MBOAT2, NDRG1, SGK3, and SEC24D. mRNA
expression levels were normalized against GAPDH. (B) Effect of FoxA1
silencing on AADAT, MBOAT2, NDRG1, SGK3, SEC24D expression levels. (C)
ChIP-qPCR of AR occupancy after NFIC silencing at the AADAT, MBOAT2,
NDRG1, SGK3, and SEC24D. (D) ChIP-qPCR of AR occupancy after FoxA1
silencing at the AADAT, MBOAT2, NDRG1, SGK3, and SEC24D. (E) ChIP-
qPCR of FoxA1 occupancy after NFIC silencing at the AADAT, MBOAT2,
NDRG1, SGK3, and SEC24D. (F) ChIP-qPCR of NFIC occupancy after FoxA1
silencing at the AADAT, MBOAT2, NDRG1, SGK3, and SEC24D. All results
represent the mean ± SEM of at least 3 independent assays.
92
In order to find out the role of NFIC and FoxA1 in modulating chromatin
accessibility at FoxA1 independent co-occupied ARBS, FAIRE qPCR
experiments were subsequently performed after silencing of NFIC and FoxA1
respectively. FAIRE qPCR provided further evidence for the effect of both factors
to AR recruitment and transcription, that NFIC plays a more important role than
FoxA1 for opening the chromatin structures at FoxA1 independent/NFIC
pioneered ARBS (Figure 6A).
Above results suggest that the co-presence of several transcription factors does
not necessarily indicate all are functioning in transcriptional regulation. AR
transcription is mainly mediated by key regulators including NFIC in the context
of FoxA1 independent ARBS. The schematic diagram depicting the mechanism
of NFIC and FoxA1 in mediating AR transcription at FoxA1 independent ARBS
is shown in Figure 3.15, that FoxA1 and NFIC are both present and co-occupy the
chromatin prior to DHT stimulation. However, FoxA1 only binds to chromatin as
a redundant factor without contributing to the remodeling of chromatin state.
NFIC instead modulates chromatin accessibility that subsequently facilitates AR
recruitment to the ARBS after DHT stimulation, and enhances AR dependent
gene transcription such as PSA, KLK2, SGK3, MBOAT2, AADAT and so on.
93
(A)
(B)
94
Figure 3.15 NFIC modulates chromatin accessibility to facilitate AR
mediated transcription instead of FoxA1 at FoxA1 independent/occupied
ARBS
(A) Box plot showing the FAIRE qPCR experiments after NFIC or FoxA1
silencing on FoxA1 occupied/independent ARBS. All FAIRE signal enrichments
are normalized against NC ETOH treated conditions. (B) Schematic diagram
illustrating how NFIC and FoxA1 coordinate AR transcriptional activity at
NFIC/FoxA1 overlapping ARBS where AR recruitment and gene regulation is
independent of FoxA1, it is NFIC that plays the role of AR pioneering factor.
95
3.4.2 NFIC collaborate with FoxA1 to contribute to AR transcription at FoxA1
pioneered ARBS
Besides the set of genes regulated by NFIC alone without interference by FoxA1,
we also would like to examine the mechanism of NFIC and FoxA1 coregulation
at NFIC and FoxA1 co-pioneered regions. Since microarray analysis of NFIC
regulated gene set and FoxA1 regulated gene set suggest 42% of NFIC regulated
genes are also regulated by FoxA1, and there’s a striking enrichment of Forkhead
motif in the NFIC and AR binding peaks, we propose there’s a collaborative
mechanism of NFIC and FoxA1 in regulating a subset of AR target genes.
Genes such as SASH1, LRIG1, AFF3, SLC2A12, PNMA1, SEPP1 and DEGS1
are found to be FoxA1 and NFIC co-pioneered genes selected from the gene
expression profiling dataset and ChIP validation. The cis-regulatory elements of
these genes were found to be co-localized by AR, NFIC and FoxA1 and co-
regulated by NFIC and FoxA1. By knocking down NFIC and FoxA1 respectively,
we are able to observe a drop in expression of these genes to different extents
(Figure 5A, 5B). In accordance to the expression profiling of these gene
candidates, we subsequently performed AR ChIP under the condition of NFIC
and FoxA1 depletion respectively. And it has been found that recruitment of AR
is reduced after depleting either NFIC or FoxA1 (Figure 5C, 5D).
Interestingly, the mutual dependency between NFIC and FoxA1 for the
recruitment of each other exhibits distinct patterns for different genes. Based on
the mutual knockdown ChIP, genes such as SASH1, AFF3, SLC2A12 and
96
PNMA1 shows that FoxA1 depletion resulted in a significant decrease of NFIC
occupancy, while knocking down NFIC did not affect the binding of FoxA1,
indicating at these loci FoxA1 acts upstream of NFIC and is required for NFIC to
bind to chromatin, and both collaborate as AR pioneering factor (Figure 5E and
5F). However, NFIC and FoxA1 did not show mutual dependency near LRIG1,
SEPP1 and DEGS1 (Figure 5F), and it’s likely that both factors function
independently and both contribute to pioneering AR transcription.
97
(A)
(B)
98
(C)
(D)
(E)
99
Figure 3.16 NFIC and FoxA1 collaborate at several FoxA1/NFIC co-
pioneered genes
(A) Effect of NFIC silencing on SASH1, LRIG1, AFF3, SLC2A12, PNMA1,
SEPP1, and DEGS1 mRNA expression levels. LNCaP cells were maintained in
hormone depleted medium followed by transfection with either control negative
control siRNA or siRNA targeting against NFIC prior to stimulation with or
without 10 nM of DHT for 12 hr. Total RNA was isolated and amplified with
real-time RT-qPCR primers for SASH1, LRIG1, AFF3, SLC2A12, PNMA1,
SEPP1, and DEGS1. mRNA expression levels were normalized against GAPDH.
(B) Effect of FoxA1 silencing on SASH1, LRIG1, AFF3, SLC2A12, PNMA1,
SEPP1, and DEGS1 expression levels. (C) ChIP-qPCR of AR occupancy after
NFIC and FoxA1 silencing at the SASH1, LRIG1, AFF3, SLC2A12, PNMA1,
SEPP1, and DEGS1. (D) ChIP-qPCR of FoxA1 occupancy after NFIC silencing
at the SASH1, LRIG1, AFF3, SLC2A12, PNMA1, SEPP1, and DEGS1. (E)
ChIP-qPCR of NFIC occupancy after FoxA1 silencing at the SASH1, LRIG1,
AFF3, SLC2A12, PNMA1, SEPP1, and DEGS1. All results represent the mean ±
SEM of at least 3 independent assays.
100
Similar patterns can be observed on additional FoxA1/NFIC dependent ARBS
such as LPAR3, PEX10, CORO2A, DNM1L and THRAP3. These additional
candidates are also selected from the genome wide microarray gene expression
profiling of FoxA1 and NFIC respectively. Among these candidates, LPAR3 has
been reported as pioneered by FoxA1 in previous studies (Wang et al., 2011).
Expression of these genes are regulated by both NFIC and FoxA1, and the
decrease in mRNA expression after silencing either factor is correlated to a
compromise in the AR recruitment after either factor is knocked-down in the
ChIP q-PCR experiments. Mutual knockdown ChIP also shows distinct patterns
in these set of candidates and further classifies them into two subtypes. PEX10,
LPAR3 and CORO2A shows a consistent decrease in NFIC recruitment after
FoxA1 silencing, suggest FoxA1 act upstream of NFIC at this class of ARBS,
while this pattern is not observed at DNM1L and THRAP3. Silencing NFIC,
however, has no appreciable effect on FoxA1 recruitment, suggesting FoxA1
selectively act as AR pioneering factor upstream of NFIC regulation, and both
collaborate to mediate AR dependent gene transcription.
101
(A)
(B)
102
(C)
(D)
103
(E)
(F)
104
Figure 3.17 NFIC and FoxA1 collaborate at additional FoxA1/NFIC co-
pioneered genes
(A) Effect of NFIC silencing on LPAR3, PEX10, CORO2A, DNM1L and
THRAP3 mRNA expression levels. LNCaP cells were maintained in hormone
depleted medium followed by transfection with either control negative control
siRNA or siRNA targeting against NFIC prior to stimulation with or without 10
nM of DHT for 12 hr. Total RNA was isolated and amplified with real-time RT-
qPCR primers for LPAR3, PEX10, CORO2A, DNM1L and THRAP3. mRNA
expression levels were normalized against GAPDH. (B) Effect of FoxA1
silencing on LPAR3, PEX10, CORO2A, DNM1L and THRAP3 expression levels.
(C) ChIP-qPCR of AR occupancy after NFIC silencing at the LPAR3, PEX10,
CORO2A, DNM1L and THRAP3. (D) ChIP-qPCR of AR occupancy after
FoxA1 silencing at the LPAR3, PEX10, CORO2A, DNM1L and THRAP3. (E)
ChIP-qPCR of FoxA1 occupancy after NFIC silencing at the LPAR3, PEX10,
CORO2A, DNM1L and THRAP3. (F) ChIP-qPCR of NFIC occupancy after
FoxA1 silencing at the LPAR3, PEX10, CORO2A, DNM1L and THRAP3. All
results represent the mean ± SEM of at least 3 independent assays.
105
We would like to examine whether both FoxA1 and NFIC contribute to the
remodeling of chromatin accessibility as well and subsequently performed FAIRE
experiments. As expected, FAIRE qPCR results suggest that both NFIC and
FoxA1 contribute to modulating chromatin accessibility at FoxA1/NFIC
pioneered ARBS (Figure 6A). Above results indicated a hierarchy of the AR
transcriptional regulation by NFIC and FoxA1, found at the NFIC and FoxA1 co-
pioneered ARBS.
The schematic diagram illustrating the role of NFIC and FoxA1 at NFIC/FoxA1
co-pioneered regions are shown in Figure 3.18. Both NFIC and FoxA1 contribute
to the modulation of chromatin accessibility in this type of ARBS. The chromatin
remodeling function of NFIC and FoxA1 facilitates subsequent AR recruitment
after DHT stimulation, therefore promotes the NFIC/FoxA1 co-pioneered genes
such as PEX10, LPAR3, AFF3, SASH1, PNMA1 and so on.
Taken together, the interplay between NFIC and FoxA1 has multiple mechanisms
and exhibits distinct patterns at different classes of ARBS.
106
(A)
(B)
107
Figure 3.18 Both NFIC and FoxA1 modulate chromatin accessibility and
contribute to pioneering AR mediated transcription at FoxA1/NFIC co-
pioneered regions
(A) Box plot showing the FAIRE qPCR experiments after NFIC or FoxA1
silencing on FoxA1 occupied/dependent ARBS. All FAIRE signal enrichments
are normalized against NC ETOH treated conditions. (B) Schematic diagram
illustrating how NFIC and FoxA1 coordinate AR transcriptional activity at
NFIC/FoxA1 overlapping ARBS where AR recruitment and gene regulation is co-
pioneered by NFIC and FoxA1, there is selective collaboration between NFIC and
FoxA1 to mediate AR dependent transcription at these ARBS.
108
DISCUSSION
AR has been shown to play a critical role in prostate development and
carcinogenesis, and it functions in both androgen-dependent and hormone-
refractory prostate cancer (Takayama et al., 2007; Wang et al., 2007). AR-
mediated transcription in prostate cancer involves the recruitment of the AR
together with general transcriptional machinery, collaborative factors,
coactivators, and corepressors in coordinated temporal and spatial fashion (Beato
and Sanchez-Pacheco, 1996; Heinlein and Chang, 2002; Heemers and Tindall,
2007; Chng et al., 2012). By analyzing the AR occupied region sequences
coupled with gene expression profiling, previous studies have identified a
network of AR transcriptional collaborative factors such as FoxA1, CEBPβ, Oct1
and GATA2 (Wang et al., 2007; Jia et al., 2008). Pioneering factors is an
emerging class of collaborative factors that are able to modulate condensed
chromatin to render the binding of additional transcription factors (Jozwik and
Carroll, 2012). Their role in hormone-dependent cancers has been implicated
recently. For instance, AP2γ and PBX1 mediate ER transcription in ER-positive
breast cancer (Magnani et al., 2011; Tan et al., 2011), and FoxA1 defines distinct
classes of AR binding programs in AR-positive prostate cancer (Sahu et al., 2011;
Wang et al., 2011).
109
In our study, chromatin immunoprecipitation coupled to massively parallel
sequencing (ChIP-Seq) allowed us to identify the genome-wide AR binding
cistromes in LNCaP prostate cancer cell line. And by combining molecular,
genomic, and bioinformatic approaches, we have identified NFIC as a novel
collaborative factor in the androgen signaling pathway that is critical for the AR
mediated gene transcription.
We showed that NFIC is globally recruited across the genome prior to androgen
stimulation and mediates AR binding to the cis-regulatory elements that drive
transcription of AR target genes, such as PSA, KLK2, and TMPRSS2.
Interestingly, the expressions of these AR model target genes have been shown to
be independent of FoxA1 regulation based on FoxA1 knockdown studies (Jia et
al., 2008; Sahu et al., 2011). Silencing FoxA1 in LNCaP prostate cancer cells
results in differentiating AR binding programs into distinct classes based on
subsequent AR occupancy and expression profiles, and FoxA1 was found to
function distinctively at these ARBS (Sahu et al., 2011; Wang et al., 2011). Those
well known AR target genes, such as PSA, KLK2 and TMPRSS2, happen to be
occupied by FoxA1, but neither their expression nor the recruitment of AR to sites
associated with these genes are affected by FoxA1 depletion. In such cases, AR
recruitment and chromatin structure might have been modulated by factors other
than FoxA1, and our study suggested that NFIC might be one of the regulators at
these FoxA1 independent ARBS.
Hence it intrigued us to examine the role of NFIC at the distinct ARBS
defined by FoxA1. Surprisingly, we found that NFIC has distinct roles in
110
regulating the AR transcriptional regulation at different classes of ARBS
classified by FoxA1 occupancy and functions. Our observation can be divided
into the following classes.
(1).For NFIC unique ARBS that are void of FoxA1 occupancy, NFIC serves as
the pioneering factor to facilitate AR recruitment at these ARBS. (2).For FoxA1
unique ARBS not occupied by NFIC, it is FoxA1 that plays the role as AR
pioneering factor to guide the binding of AR. (3). For NFIC and FoxA1 co-
occupied regions, these ARBS can be further divided into FoxA1 dependent and
independent sites. For FoxA1 independent regions, FoxA1 are found to occupy
the ARBS but does not contribute to AR transcriptional regulation, and it is NFIC
that plays the role of AR pioneering factor. At this class of ARBS, NFIC
facilitates the recruitment of AR, mediates downstream target gene expression
and contributes to the chromatin accessibility. While for FoxA1 dependent
regions, we found NFIC selectively collaborates with FoxA1, possibly by forming
a pioneering complex and both contributes to AR recruitment and subsequent
regulation of AR target genes, as well as modulating chromatin openness. In this
category, however, there are sites that exhibit no dependency between NFIC and
FoxA1 on each other, possibly suggesting both factors can also function as AR
pioneering factor independently at certain ARBS.
Studies on pioneering factors have also investigated various histone marks that
are possibly modulated by these factors in order to render better chromatin
accessibility. For instance, Forkhead and GATA family members have been
implicated to be able to open compacted chromatin by disrupting histone bindings
111
(Cirillo et al., 2002). FoxA1 has been predominantly found in H3K4me2 rich and
H3K9me2 poor regions in prostate cancer cells, and it is able to modulate
H3k4me2 in a genome wide manner and facilitate AR recruitment after androgen
stimulation (Sahu et al., 2011). Another pioneering factor GATA3 has been
shown to directly affect ER enhancer accessibility in breast cancer cells, and its
depletion resulted in a global redistribution of active histone marks such as
H3K4me1 and H3K27Ac (Theodorou et al., 2013). However, from the site
specific histone mark ChIP assays, we did not observe a significant change in
H3K4me1/me2 after depleting NFIC (Figure 4.1), although the chromatin
accessibility determined by FAIRE assays shows NFIC has certain impact. This
might be due to the possibility that NFIC modulates chromatin accessibility via
other histone marks at these ARBS.
Collectively, our data suggests that NFIC is one essential component of AR
transcriptional complex, and mediates the recruitment of AR and the transcription
of AR target genes in prostate cancer.
112
(A)
(B)
Figure 4.1 NFIC have no effect on H3K4me1/2 marks
(A) Boxplot showing the recruitment of H3K4me1 at 15 ARBS. Individual ChIP
assays have been repeated at least three times. (B) Boxplot showing the
recruitment of H3K4me2 at 15 ARBS. Individual ChIP assays have been repeated
at least three times.
113
CONCLUSION, FUTURE DIRECTIONS AND PERSPECTIVES
In the current study based on AR, NFIC ChIP-seq, we have identified a novel AR
cofactor belonging to the NFI family of transcription factors. From the genomic
analysis of the binding profile of NFIC, we further established NFIC as a novel
pioneering factor of AR that preoccupy the chromatin prior to DHT treatment and
facilities chromatin remodeling. Based on molecular characterization, we
demonstrated that NFIC is required for AR recruitment and the regulation of AR
target gene transcription. Motif analysis of the AR and NFIC co-occupied regions
reveals that FoxA1 might come into play in the NFIC and AR regulatory network.
From the expression profiling datasets, we selected genes differentially regulated
by FoxA1 and NFIC, and functionally dissect the role of NFIC as a pioneering
factor in relation to another pioneering factor, FoxA1, in mediating AR
transcriptional regulations. We discovered that NFIC mediates AR transcriptional
regulation at distinct classes of ARBS defined by their dependency on FoxA1,
and at these sites NFIC and FoxA1 differentially modulates chromatin
accessibility, thereby potentiated the role of NFIC in the prostate cancer
development.
In order to obtain a more comprehensive of picture of the pioneering factor role of
NFIC in mediating AR transcription, generating a genome wide AR ChIP-seq
library under the condition of NFIC depletion would provide important
114
information. However, due to the technical difficulty such as knockdown
efficiency happens to be the major challenge in this study. In future study of the
current project, it would be important to use a more efficient siRNA against NFIC
without disturbing AR expression levels to generate the genome wide binding
profile of AR, thus provide evidence for NFIC pioneering regulations globally.
Based on the oncomine database that deposit available clinical transcriptome
studies, we found that NFIC is overexpressed in many advanced prostate
carcinoma tissues relative to primary site (Lapointe et al., 2004; Yu et al., 2004).
This suggests that NFIC might play a role in the prostate cancer progressions. Our
current cell model LNCaP is an androgen responsive human prostate
adenocarcinoma cell line derived from the left supraclavicular lymph node
metastasis. It has been well characterized and chosen to be cell model for AR
positive prostate cancer studies based on its androgen responsiveness. However,
in terms of invasiveness, LNCaP is not very aggressive as observed in many
invasion assays, therefore to fully understand the role of NFIC in the progression
of the more advanced prostate cancer, characterization of other more invasive cell
lines might provide deeper insight.
Studies on pioneering factors of AR in the context of prostate cancer have
provided insight into the genome wide redistribution of the AR binding programs
after FoxA1 depletion (Sahu et al., 2011; Wang et al., 2011). They also left gaps
of knowledge for future studies to fill. For example, those ARBS independent of
FoxA1 regulation include several well characterized AR model genes such as
PSA, KLK2 and TMPRSS2, which are frequently implicated in the AR dependent
115
prostate cancer studies. If these model genes are not regulated by FoxA1, what
factor might contribute to the pioneering of AR regulation of these genes? Our
current study has partially filled this gap of knowledge by providing an
interplayer NFIC that pioneers the transcription of several FoxA1 independent
genes at ARBS co-occupied by NFIC and FoxA1. Since previous studies in
pioneering factors have assigned certain roles of epigenetic modulation to several
pioneer factors, our study also investigated the potential histone marks that might
be modulated by NFIC to facilitate chromatin remodeling at those ARBS it
pioneers, but so far we have not established a detailed epigenetic mechanism
regulated by NFIC. More histone marks such as other active histone methylation
and acetylation could be analyzed to understand how NFIC contributes to the AR
transcriptional regulation in the epigenetic point of view. It would also be
interesting to investigate the role of FoxA1 at those ARBS it occupies without
contributing to the regulation of the target gene.
Taken together, our studies established NFIC as a novel pioneering factor to
regulate AR transcription and dissected the multiple mechanisms of NFIC to co-
regulate AR transcription with FoxA1 at ARBS either dependent or independent
on FoxA1 regulation. We are currently investigating the functional role of NFIC
in regulating prostate cancer progession, and hopefully would provide deeper
insight and evidence for NFIC to be considered a potential attractive candidate as
a therapeutic target to treat prostate cancer.
116
BIBLIOGRAPHY
Agoulnik, I. U. and N. L. Weigel (2008). "Androgen receptor coactivators and
prostate cancer." Adv Exp Med Biol 617: 245-255.
Bachurski, C. J., S. E. Kelly, et al. (1997). "Nuclear factor I family members
regulate the transcription of surfactant protein-C." J Biol Chem 272(52):
32759-32766.
Bandyopadhyay, S. and R. M. Gronostajski (1994). "Identification of a conserved
oxidation-sensitive cysteine residue in the NFI family of DNA-binding
proteins." J Biol Chem 269(47): 29949-29955.
Beato, M. and A. Sanchez-Pacheco (1996). "Interaction of steroid hormone
receptors with the transcription initiation complex." Endocr Rev 17(6):
587-609.
Beck, S., P. Sommer, et al. (1999). "Hepatocyte nuclear factor 3 (winged helix
domain) activates trefoil factor gene TFF1 through a binding motif
adjacent to the TATAA box." DNA Cell Biol 18(2): 157-164.
Bedford, F. K., D. Julius, et al. (1998). "Neuronal expression of the 5HT3
serotonin receptor gene requires nuclear factor 1 complexes." J Neurosci
18(16): 6186-6194.
Bieberich, C. J., K. Fujita, et al. (1996). "Prostate-specific and androgen-
dependent expression of a novel homeobox gene." J Biol Chem 271(50):
31779-31782.
Boyes, J., P. Byfield, et al. (1998). "Regulation of activity of the transcription
factor GATA-1 by acetylation." Nature 396(6711): 594-598.
Brinkmann, A. O., P. W. Faber, et al. (1989). "The human androgen receptor:
domain structure, genomic organization and regulation of expression." J
Steroid Biochem 34(1-6): 307-310.
117
Carroll, J. S., X. S. Liu, et al. (2005). "Chromosome-wide mapping of estrogen
receptor binding reveals long-range regulation requiring the forkhead
protein FoxA1." Cell 122(1): 33-43.
Cereghini, S., M. Raymondjean, et al. (1987). "Factors involved in control of
tissue-specific expression of albumin gene." Cell 50(4): 627-638.
Chang, C., A. Saltzman, et al. (1995). "Androgen receptor: an overview." Crit
Rev Eukaryot Gene Expr 5(2): 97-125.
Chaudhry, A. Z., G. E. Lyons, et al. (1997). "Expression patterns of the four
nuclear factor I genes during mouse embryogenesis indicate a potential
role in development." Dev Dyn 208(3): 313-325.
Chaudhry, A. Z., A. D. Vitullo, et al. (1999). "Nuclear factor I-mediated
repression of the mouse mammary tumor virus promoter is abrogated by
the coactivators p300/CBP and SRC-1." J Biol Chem 274(11): 7072-7081.
Chen, D., H. Ma, et al. (1999). "Regulation of transcription by a protein
methyltransferase." Science 284(5423): 2174-2177.
Chikhirzhina, G. I., R. I. Al'-Shekhadat, et al. (2008). "[Transcription factors of
the nuclear factor 1 (NF1) family. Role in chromatin remodelation]." Mol
Biol (Mosk) 42(3): 388-404.
Chng, K. R., C. W. Chang, et al. (2012). "A transcriptional repressor co-
regulatory network governing androgen response in prostate cancers."
EMBO J 31(12): 2810-2823.
Cirillo, L. A., F. R. Lin, et al. (2002). "Opening of compacted chromatin by early
developmental transcription factors HNF3 (FoxA) and GATA-4." Mol
Cell 9(2): 279-289.
Cleutjens, K. B., C. C. van Eekelen, et al. (1996). "Two androgen response
regions cooperate in steroid hormone regulated activity of the prostate-
specific antigen promoter." J Biol Chem 271(11): 6379-6388.
Coffey, D. S. and K. J. Pienta (1987). "New concepts in studying the control of
normal and cancer growth of the prostate." Prog Clin Biol Res 239: 1-73.
Courtois, S. J., D. A. Lafontaine, et al. (1990). "Nuclear factor-I and activator
protein-2 bind in a mutually exclusive way to overlapping promoter
118
sequences and trans-activate the human growth hormone gene." Nucleic
Acids Res 18(1): 57-64.
Cunha, G. R., A. A. Donjacour, et al. (1987). "The endocrinology and
developmental biology of the prostate." Endocr Rev 8(3): 338-362.
Deplewski, D. and R. L. Rosenfield (2000). "Role of hormones in pilosebaceous
unit development." Endocr Rev 21(4): 363-392.
Desjardins, C. (1978). "Endocrine regulation of reproductive development and
function in the male." J Anim Sci 47 Suppl 2: 56-79.
Eeckhoute, J., J. S. Carroll, et al. (2006). "A cell-type-specific transcriptional
network required for estrogen regulation of cyclin D1 and cell cycle
progression in breast cancer." Genes Dev 20(18): 2513-2526.
Eeckhoute, J., M. Lupien, et al. (2009). "Cell-type selective chromatin remodeling
defines the active subset of FOXA1-bound enhancers." Genome Res 19(3):
372-380.
Esnault, G., S. Majocchi, et al. (2009). "Transcription factor CTF1 acts as a
chromatin domain boundary that shields human telomeric genes from
silencing." Mol Cell Biol 29(9): 2409-2418.
Finkelstein, J. S., A. Klibanski, et al. (1987). "Osteoporosis in men with
idiopathic hypogonadotropic hypogonadism." Ann Intern Med 106(3):
354-361.
Furlong, E. E., T. Rein, et al. (1996). "YY1 and NF1 both activate the human p53
promoter by alternatively binding to a composite element, and YY1 and
E1A cooperate to amplify p53 promoter activity." Mol Cell Biol 16(10):
5933-5945.
Gao, N., J. Zhang, et al. (2003). "The role of hepatocyte nuclear factor-3 alpha
(Forkhead Box A1) and androgen receptor in transcriptional regulation of
prostatic genes." Mol Endocrinol 17(8): 1484-1507.
Gelmann, E. P. (2002). "Molecular biology of the androgen receptor." J Clin
Oncol 20(13): 3001-3015.
Geurts, J. M., E. F. Schoenmakers, et al. (1998). "Identification of NFIB as
recurrent translocation partner gene of HMGIC in pleomorphic
adenomas." Oncogene 16(7): 865-872.
119
Gronostajski, R. M. (2000). "Roles of the NFI/CTF gene family in transcription
and development." Gene 249(1-2): 31-45.
Gronostajski, R. M., S. Adhya, et al. (1985). "Site-specific DNA binding of
nuclear factor I: analyses of cellular binding sites." Mol Cell Biol 5(5):
964-971.
Harris, W. P., E. A. Mostaghel, et al. (2009). "Androgen deprivation therapy:
progress in understanding mechanisms of resistance and optimizing
androgen depletion." Nat Clin Pract Urol 6(2): 76-85.
He, B., J. T. Minges, et al. (2002). "The FXXLF motif mediates androgen
receptor-specific interactions with coregulators." J Biol Chem 277(12):
10226-10235.
He, B. and E. M. Wilson (2003). "Electrostatic modulation in steroid receptor
recruitment of LXXLL and FXXLF motifs." Mol Cell Biol 23(6): 2135-
2150.
Heemers, H. V. and D. J. Tindall (2007). "Androgen receptor (AR) coregulators:
a diversity of functions converging on and regulating the AR
transcriptional complex." Endocr Rev 28(7): 778-808.
Heinlein, C. A. and C. Chang (2002). "Androgen receptor (AR) coregulators: an
overview." Endocr Rev 23(2): 175-200.
Heinlein, C. A. and C. Chang (2004). "Androgen receptor in prostate cancer."
Endocr Rev 25(2): 276-308.
Isaacs, J. T. and D. S. Coffey (1989). "Etiology and disease process of benign
prostatic hyperplasia." Prostate Suppl 2: 33-50.
Jia, L., B. P. Berman, et al. (2008). "Genomic androgen receptor-occupied regions
with different functions, defined by histone acetylation, coregulators and
transcriptional capacity." PLoS One 3(11): e3645.
Johansson, E. M., M. Kannius-Janson, et al. (2003). "The p53 tumor suppressor
gene is regulated in vivo by nuclear factor 1-C2 in the mouse mammary
gland during pregnancy." Oncogene 22(38): 6061-6070.
Jozwik, K. M. and J. S. Carroll (2012). "Pioneer factors in hormone-dependent
cancers." Nat Rev Cancer 12(6): 381-385.
120
Karim, F. D., L. D. Urness, et al. (1990). "The ETS-domain: a new DNA-binding
motif that recognizes a purine-rich core DNA sequence." Genes Dev 4(9):
1451-1453.
Kim, M. Y., J. Reyna, et al. (2009). "Role of the transcription factor NFIC in
odontoblast gene expression." J Calif Dent Assoc 37(12): 875-881.
Kumar-Sinha, C., S. A. Tomlins, et al. (2008). "Recurrent gene fusions in prostate
cancer." Nat Rev Cancer 8(7): 497-511.
Lapointe, J., C. Li, et al. (2004). "Gene expression profiling identifies clinically
relevant subtypes of prostate cancer." Proc Natl Acad Sci U S A 101(3):
811-816.
Lee, C. S., J. R. Friedman, et al. (2005). "The initiation of liver development is
dependent on Foxa transcription factors." Nature 435(7044): 944-947.
Lee, D. K., M. Li, et al. (2003). "The second largest subunit of RNA polymerase
II interacts with and enhances transactivation of androgen receptor."
Biochem Biophys Res Commun 302(1): 162-169.
Lee, D. S., J. T. Park, et al. (2009). "Nuclear factor I-C is essential for
odontogenic cell proliferation and odontoblast differentiation during tooth
root development." J Biol Chem 284(25): 17293-17303.
Liao, S. and S. Fang (1969). "Receptor-proteims for androgens and the mode of
action of androgens on gene transcription in ventral prostate." Vitam
Horm 27: 17-90.
Lupien, M., J. Eeckhoute, et al. (2008). "FoxA1 translates epigenetic signatures
into enhancer-driven lineage-specific transcription." Cell 132(6): 958-970.
Magnani, L., E. B. Ballantyne, et al. (2011). "PBX1 genomic pioneer function
drives ERalpha signaling underlying progression in breast cancer." PLoS
Genet 7(11): e1002368.
Magnani, L., J. Eeckhoute, et al. (2011). "Pioneer factors: directing transcriptional
regulators within the chromatin environment." Trends Genet 27(11): 465-
474.
Marshall, T. W., K. A. Link, et al. (2003). "Differential requirement of SWI/SNF
for androgen receptor activity." J Biol Chem 278(33): 30605-30613.
121
Massie, C. E., B. Adryan, et al. (2007). "New androgen receptor genomic targets
show an interaction with the ETS1 transcription factor." EMBO Rep 8(9):
871-878.
Mellor, J. (2006). "Dynamic nucleosomes and gene transcription." Trends Genet
22(6): 320-329.
Mermod, N., E. A. O'Neill, et al. (1989). "The proline-rich transcriptional
activator of CTF/NF-I is distinct from the replication and DNA binding
domain." Cell 58(4): 741-753.
Messenger, A. G. (1993). "The control of hair growth: an overview." J Invest
Dermatol 101(1 Suppl): 4S-9S.
Metzger, E., M. Wissmann, et al. (2005). "LSD1 demethylates repressive histone
marks to promote androgen-receptor-dependent transcription." Nature
437(7057): 436-439.
Mooradian, A. D., J. E. Morley, et al. (1987). "Biological actions of androgens."
Endocr Rev 8(1): 1-28.
Perez-Casellas, L. A., X. Wang, et al. (2009). "Nuclear factor I transcription
factors regulate IGF binding protein 5 gene transcription in human
osteoblasts." Biochim Biophys Acta 1789(2): 78-87.
Powers, G. L. and P. C. Marker (2013). "Recent advances in prostate
development and links to prostatic diseases." Wiley Interdiscip Rev Syst
Biol Med 5(2): 243-256.
Qian, F., U. Kruse, et al. (1995). "Chromosomal localization of the four genes
(NFIA, B, C, and X) for the human transcription factor nuclear factor I by
FISH." Genomics 28(1): 66-73.
Randall, V. A. (1994). "Role of 5 alpha-reductase in health and disease."
Baillieres Clin Endocrinol Metab 8(2): 405-431.
Raudrant, D. and T. Rabe (2003). "Progestogens with antiandrogenic properties."
Drugs 63(5): 463-492.
Sahu, B., M. Laakso, et al. (2011). "Dual role of FoxA1 in androgen receptor
binding to chromatin, androgen signalling and prostate cancer." EMBO J
30(19): 3962-3976.
122
Schmidt, D., M. D. Wilson, et al. (2009). "ChIP-seq: using high-throughput
sequencing to discover protein-DNA interactions." Methods 48(3): 240-
248.
Schroeder, E. T., L. Zheng, et al. (2004). "Effects of androgen therapy on adipose
tissue and metabolism in older men." J Clin Endocrinol Metab 89(10):
4863-4872.
Serandour, A. A., S. Avner, et al. (2011). "Epigenetic switch involved in
activation of pioneer factor FOXA1-dependent enhancers." Genome Res
21(4): 555-565.
Sevilla, L., C. Aperlo, et al. (1999). "The Ets2 transcription factor inhibits
apoptosis induced by colony-stimulating factor 1 deprivation of
macrophages through a Bcl-xL-dependent mechanism." Mol Cell Biol
19(4): 2624-2634.
Shang, Y., M. Myers, et al. (2002). "Formation of the androgen receptor
transcription complex." Mol Cell 9(3): 601-610.
Sharrocks, A. D. (2001). "The ETS-domain transcription factor family." Nat Rev
Mol Cell Biol 2(11): 827-837.
Sharrocks, A. D., A. L. Brown, et al. (1997). "The ETS-domain transcription
factor family." Int J Biochem Cell Biol 29(12): 1371-1387.
Shin, S., T. D. Kim, et al. (2009). "Induction of prostatic intraepithelial neoplasia
and modulation of androgen receptor by ETS variant 1/ETS-related
protein 81." Cancer Res 69(20): 8102-8110.
Steele-Perkins, G., K. G. Butz, et al. (2003). "Essential role for NFI-C/CTF
transcription-replication factor in tooth root development." Mol Cell Biol
23(3): 1075-1084.
Sun, C., A. Dobi, et al. (2008). "TMPRSS2-ERG fusion, a common genomic
alteration in prostate cancer activates C-MYC and abrogates prostate
epithelial differentiation." Oncogene 27(40): 5348-5353.
Sun, P., P. Dong, et al. (1998). "p53-independent role of MDM2 in TGF-beta1
resistance." Science 282(5397): 2270-2272.
Suzuki, H. and H. Ito (1999). "Role of androgen receptor in prostate cancer."
Asian J Androl 1(3): 81-85.
123
Takayama, K., K. Kaneshiro, et al. (2007). "Identification of novel androgen
response genes in prostate cancer cells by coupling chromatin
immunoprecipitation and genomic microarray analysis." Oncogene 26(30):
4453-4463.
Tan, P. Y., C. W. Chang, et al. (2012). "Integration of regulatory networks by
NKX3-1 promotes androgen-dependent prostate cancer survival." Mol
Cell Biol 32(2): 399-414.
Tan, S. K., Z. H. Lin, et al. (2011). "AP-2gamma regulates oestrogen receptor-
mediated long-range chromatin interaction and gene transcription."
EMBO J 30(13): 2569-2581.
Theodorou, V., R. Stark, et al. (2013). "GATA3 acts upstream of FOXA1 in
mediating ESR1 binding by shaping enhancer accessibility." Genome Res
23(1): 12-22.
Tomlins, S. A., B. Laxman, et al. (2008). "Role of the TMPRSS2-ERG gene
fusion in prostate cancer." Neoplasia 10(2): 177-188.
Tsai, M. J. and B. W. O'Malley (1994). "Molecular mechanisms of action of
steroid/thyroid receptor superfamily members." Annu Rev Biochem 63:
451-486.
Wang, D., I. Garcia-Bassets, et al. (2011). "Reprogramming transcription by
distinct classes of enhancers functionally defined by eRNA." Nature
474(7351): 390-394.
Wang, Q., J. S. Carroll, et al. (2005). "Spatial and temporal recruitment of
androgen receptor and its coactivators involves chromosomal looping and
polymerase tracking." Mol Cell 19(5): 631-642.
Wang, Q., W. Li, et al. (2007). "A hierarchical network of transcription factors
governs androgen receptor-dependent prostate cancer growth." Mol Cell
27(3): 380-392.
Watson, C. J., K. E. Gordon, et al. (1991). "Interaction of DNA-binding proteins
with a milk protein gene promoter in vitro: identification of a mammary
gland-specific factor." Nucleic Acids Res 19(23): 6603-6610.
Wilson, C. M. and M. J. McPhaul (1994). "A and B forms of the androgen
receptor are present in human genital skin fibroblasts." Proc Natl Acad Sci
U S A 91(4): 1234-1238.
124
Wissmann, M., N. Yin, et al. (2007). "Cooperative demethylation by JMJD2C and
LSD1 promotes androgen receptor-dependent gene expression." Nat Cell
Biol 9(3): 347-353.
Xu, H., L. Handoko, et al. (2010). "A signal-noise model for significance analysis
of ChIP-seq with negative control." Bioinformatics 26(9): 1199-1204.
Xu, J. and B. W. O'Malley (2002). "Molecular mechanisms and cellular biology
of the steroid receptor coactivator (SRC) family in steroid receptor
function." Rev Endocr Metab Disord 3(3): 185-192.
Yamane, K., C. Toumazou, et al. (2006). "JHDM2A, a JmjC-containing H3K9
demethylase, facilitates transcription activation by androgen receptor."
Cell 125(3): 483-495.
Yu, J., R. S. Mani, et al. (2010). "An integrated network of androgen receptor,
polycomb, and TMPRSS2-ERG gene fusions in prostate cancer
progression." Cancer Cell 17(5): 443-454.
Yu, Y. P., D. Landsittel, et al. (2004). "Gene expression alterations in prostate
cancer predicting tumor aggression and preceding development of
malignancy." J Clin Oncol 22(14): 2790-2799.
Zaret, K. S. and J. S. Carroll (2011). "Pioneer transcription factors: establishing
competence for gene expression." Genes Dev 25(21): 2227-2241.
Zhang, Z., C. W. Chang, et al. (2011). "CENTDIST: discovery of co-associated
factors by motif distribution." Nucleic Acids Res 39(Web Server issue):
W391-399.
125
APPENDIX I
List of ChIP real-time quantitative PCR primers
NFIC_H1_F TGCTGCCAGCCAGTATGCT
NFIC_H1_R GTTGGCCTCTGTACCTGATTCTG
NFIC_H2_F TGCGGCCAGTGTCAACAA
NFIC_H2_R GGTAATCGGGCTATGGTAATGC
NFIC_H3_F ATGGCCATCCTGCGAAAC
NFIC_H3_R TCTGTGGCAATAACTGTCAGTATCG
NFIC_H4_F TGGAGCAGTCCAGGACATTG
NFIC_H4_R GAGGTCAGCGCCACAGTTG
NFIC_H5_F CTGGGTGTCAAGTTCATGTGTGT
NFIC_H5_R GCACAGCCTGGCTTGCA
NFIC_M1_F TCCTTGAGGGAAAGAACACACA
NFIC_M1_R CAGCACACTGGCTGCCAAT
NFIC_M2_F AAGGACAAACAGAACTGGACACAA
NFIC_M2_R GCTAGTAATTCCCAGACAGAAAACAA
NFIC_M3_F TTGAGGGACCTGCCTGGAT
NFIC_M3_R CTGCCCCACCCTCAACAG
NFIC_M4_F CAAGTTTAAACCAAAACCAGAAATATCTAC
NFIC_M4_R CCTCTTAAAAATAAACAGATGAGCATGT
NFIC_M5_F GAAGGATTAAAGGGTACATTATGTGAAAT
NFIC_M5_R CCCAGCCTCTACTTGACTTGTAAAA
NFIC_L1_F CCCACTGAACTGTGAGCTCTGT
NFIC_L1_R TGGGCACTCACGATTTAATAATAAAC
NFIC_L2_F TCCTCTGTGCCTTGCCTATACA
NFIC_L2_R AACTGGGCTCAATTCCAAACA
NFIC_L3_F GAGGGAACATGGGTTATACAAGCT
126
NFIC_L3_R AGCCAAGACCCAAGCAATCTT
NFIC_L4_F AGAGCCAGAGAAGTGACAAGGAA
NFIC_L4_R CCACTGTGCTTGGCTGAGTTC
NFIC_L5_F TCAGTCACCTCCCTCCAACAC
NFIC_L5_R GGCAGAACTAGTGATGTGCAGAA
NFIC_L6_F TGGTAGAGGTGGGATTGAAACC
NFIC_L6_R GAAGGAAGAGACAGCACAGTATGC
NFIC_L7_F CCCTGTGTGTGACCTCGATTG
NFIC_L7_R TTTTTGTAAGTGGGCTGTCCAA
NFIC_L8_F GATCCACCACAGCACAGGAA
NFIC_L8_R CCTTGCTGCTCCCAGTCATT
NFIC_L9_F ACAAGTAACTACTCCCTTGAAAATCAGA
NFIC_L9_R GCAAGCACCACAGGAATGAA
NFIC_L10_F TCGACCTACATGTGGCTGAATG
NFIC_L10_R CTCAACATGCAGCAGTCAGATG
AR/NFIC_1_F GCACCTGCTGCGCAATC
AR/NFIC_1_R TCGCTGGAGGCCCACAT
AR/NFIC_2_F GGGAGCACAAGCAGAGCTTCT
AR/NFIC_2_R GGGTGTTCTTAGGAGCTGGAAA
AR/NFIC_3_F GCTCCCTGTCTTCTCCCAGTCT
AR/NFIC_3_R AAGGACTCGAGCAGGGAGATT
AR/NFIC_4_F CTGGAGCTTGCACAATCGAA
AR/NFIC_4_R TGCCAAGGAGACAGCACCTA
AR/NFIC_5_F TGCTGCCAGCCAGTATGCT
AR/NFIC_5_R GTTGGCCTCTGTACCTGATTCTG
AR/NFIC_6_F CGCCACGGCCTAATCCT
AR/NFIC_6_R AAGGGAGAGGTCGGTTTATATAATCTC
AR/NFIC_7_F CAGGGATGCACGTTGATCAG
AR/NFIC_7_R GAGAGGCAGCTGCAAACTTGA
AR/NFIC_8_F GCTCCCTGTCTTCTCCCAGTCT
AR/NFIC_8_R AAGGACTCGAGCAGGGAGATT
127
AR/NFIC_9_F TGGAGCAGTCCAGGACATTG
AR/NFIC_9_R GAGGTCAGCGCCACAGTTG
AR/NFIC_10_F GCTCAGTCTGTCCCCAGTAGAAA
AR/NFIC_10_R CCAAGCTGGCGACTGCTT
AR/FOXA1_1_F TCTTGTGTATGTGAGTGCAGCATAG
AR/FOXA1_1_R GTCCAGTACCAAAATGTAAAGCTTCTT
AR/FOXA1_2_F TGGCAAGTATGGAAGCCTTTATC
AR/FOXA1_2_R CCGGTTCCCTGTTGAATTACA
AR/FOXA1_3_F ACAATGCCAAGTGTTGGTGA
AR/FOXA1_3_R TGGTGGGTGGATTATACCTCA
AR/FOXA1_4_F TTCCCTTCCTTTCTTTTCAAGATACT
AR/FOXA1_4_R GCTGCTTACATTTGGATTATAACTGTTG
AR/FOXA1_5_F CAGCAAAAGAAACTATCAACAGAGTGA
AR/FOXA1_5_R TGCATTGTTTGCAAATAGCTTCTAC
AR/FOXA1_6_F GCTCTCTGGGAGTTAGGTACTGTCA
AR/FOXA1_6_R GCAGGGATTTGGTCTAGTTTATTCA
AR/FOXA1_7_F GCCACTGTACCTTGGAGAGG
AR/FOXA1_7_R AGGAAGGCCATCTGGATTTT
AR/FOXA1_8_F TGC CAC CTT GTG TAT TTT TTG ATA C
AR/FOXA1_8_R TCA CGC CAC TGT GTA CAA TAC ATA GT
AR/FOXA1_9_F GTG TTA AGA GCT CTC ACA ATA CAA GGA
AR/FOXA1_9_R AAT GTC CCC ATT AAA CCA ATA AGG
AR/FOXA1_10_F GGG AAG AGA TTA GTG TTT TGA GAT GTT
AR/FOXA1_10_R GCA AAA GCA CTG GTA ATC TCA GTA AA
PSA enh_F TGGGACAACTTGCAAACCTG
PSA enh_R CCAGAGTAGGTCTGTTTTCAA
KLK2 enh_F GTTGAAAGCAGACCTACTCTGGA
KLK2 enh_R CTGGACCATCTTTTCAAGCAT
KLK2 prom_F GGGAATGCCTCCAGACTGAT
KLK2 prom_R CTTGCCCTGTTGGCACCTA
TMPRSS2_1_F CAAATGGCCACCTGGTGAA
128
TMPRSS2_1_R TTAAAGGGTACGGCAGGTACTCA
TMPRSS2_2_F GGCCCCATCTCCCAATATTG
TMPRSS2_2_R TCCCCCTAAAAGCATGTGTTG
PEX10_ChIP_F CACACAAAAAATTCTCATCATGTCACT
PEX10_ChIP_R CAGGTGGGCAGCCATTG
LPAR3_ChIP_F CTTGTTTGCTTGGCAATTCTAGTTAG
LPAR3_ChIP_R GCCAAAGGCCCCATGAA
DNM1L_chip_F CCAGGCTGGCATGATCTCA
DNM1L_chip_R GGCAGGAGAATCACTTAGAACACA
CORO2A_chip_F TTGATCAACAGTGGCAATCACA
CORO2A_chip_R AGGAGCAAAGCAAGCTGAAGA
THRAP3_chip_F GAAGAGCCTCCACTGGGAATG
THRAP3_chip_R ACCTTAAACTCTCCCCCAATTACA
AADAT_ChIP_F TGCACTGTAACTCAGCGAAAGG
AADAT_ChIP_R GCAGTGTGGTGCTGCTGAAC
MBOAT2_ChIP_F CCAGTGATGCACTTAGGATTATCAA
MBOAT2_ChIP_R GATGCCAGTGTAAACAAACCTAATGT
NDRG1_ChIP_F TGTTCTGCCTCATAACTGTTGTTTAA
NDRG1_ChIP_R GGTCTCAGAGCCAGTAAGCTGACT
SGK3_ChIP_F CACCGGGTGTGCCTTCTG
SGK3_ChIP_R GGGTGGTGGCTTGTCTTACAG
SEC24D_chip_F TCTCTTCCAGCACACTCTAAGCA
SEC24D_chip_R CCCCAATGCCAGTTTCATG
SASH1_chip_F CCGTTACCTTGGCCATGTCTA
SASH1_chip_R TCCCTCGCAGACAACGATCT
LRIG1_chip_F ATTCAGGTGGAGACTGGATAAAAAA
LRIG1_chip_R CCTGGCGGAGGCTGTTT
AFF3_chip_F CCAGCTGTTATTTACACTGCCTACA
AFF3_chip_R TGAACCCTTCAGCCTTTTGTG
SLC2A12_chip_F CCCACCCACTTGTGCTTGA
SLC2A12_chip_R CCAGAGGAGACCCAAACATTG
129
PNMA1_chip_F AAAATCTATCCGCGTTATCAGTAATCT
PNMA1_chip_R GGCCTGGCTCACAGGAAGT
FBXO28_chip_F GGGCAATAAAAAGGTACATGCTACA
FBXO28_chip_R GTTTCTGGCTTCTTTCATTTAGCATA
SEPP1_chip_F CCATTGTCTGCCTGTGGAACT
SEPP1_chip_R TGCTCACGGACCCAGGAA
DEGS1_chip_F GGGCTCCCGGAATTTGTC
DEGS1_chip_R GGCAGGGAACAATGTGTGATT
control_F CCTGGAGGGCTTGGAGATG
control_R GATCCTACGGCTGGCTGTGA
130
APPENDIX II
List of cDNA real-time quantitative PCR primers
AR_cDNA_F GTGTCACTATGGAGCTCTCACATGT
AR_cDNA_R GTTTCCCTTCAGCGGCTCTT
NFIC_cDNA_F GGACATGGAAGGAGGCATCTC
NFIC_cDNA_R GGGCTGTTGAATGGTGACTTG
PSA_cDNA_F TGTGTGCTGGACGCTGGA
PSA_cDNA_R CACTGCCCCATGACGTGAT
TMPRSS2_cDNA_F GGACAGTGTGCACCTCAAAGAC
TMPRSS2_cDNA_R TCCCACGAGGAAGGTCCC
KLK2_cDNA_F CTGTGTCAGCATGTGGGACCT
KLK2_cDNA_R CCATGATGTGATACCTTGAAGCA
PEX10_cDNA_F GGTTGAGCTGCTCTCAGATGTG
PEX10_cDNA_R AGGGTCTGGTAGCCTGCAAGT
LPAR3_cDNA_F CTCATGGCCTTCCTCATCAT
LPAR3_cDNA_R TACCACAAACGCCCCTAAGA
DNM1L_cDNA_F ATCCACTTGGTGGCCTTAACA
DNM1L_cDNA_R GGACGAGGACCAGTAGCATTTC
CORO2A_cDNA_F GAATGCCCCCCACCAAA
CORO2A_cDNA_R CTCCTGTTGCCGGTAGAACATC
THRAP3_cDNA_F TGTCCGGATGGACTCTTTTGAT
THRAP3_cDNA_R CTTGCGTTCCTGAGCCAATAA
AADAT_cDNA_F GAGAAACGGGCTGACATATTGAG
AADAT_cDNA_R CCACCAGCCAAGGAGATCAT
MBOAT2_cDNA_F CTGATTTTTCAGGCCCAATGA
MBOAT2_cDNA_R CATGAATTTCGCAAGCCAAA
NDRG1_cDNA_F CGGCATGAACCACAAAACC
131
NDRG1_cDNA_R TGATCTCCTGCATGTCCTCGTA
SGK3_cDNA_F GCTGGGCTGACCTTGTACAAA
SGK3_cDNA_R TCTGGTCCAGCCACATTAGGA
SEC24D_cDNA_F ACTGAAGACCATGCTGGAAAAAA
SEC24D_cDNA_R CACTCGAATTGCAGACGTCTCT
SASH1_cDNA_F CGCATGGCGATTCCAAGT
SASH1_cDNA_R CGAAATGCACCCAGGAGAGA
AFF3_cDNA_F CGGAGACCTCACGAAAGCA
AFF3_cDNA_R TCTGCGGCCGTGACTTGT
SLC2A12_cDNA_F TTTTTGAAATGGCTGTCCTTAGC
SLC2A12_cDNA_R CCAGGGCATTGGTCCTAGAC
PNMA1_cDNA_F CCACCCTTCTGCAGCTTTAGTG
PNMA1_cDNA_R GACCCCACAGGGACAAGAAA
FBXO28_cDNA_F CCCAAGGAGAGAGTCAGAAAGGA
FBXO28_cDNA_R TCTCAACACACGATAAATCTCATCAA
SEPP1_cDNA_F TGCTCTCTCACGACTCTCAAAGA
SEPP1_cDNA_R GCGATGGAGTTTCAACTGTTTTATC
DEGS1_cDNA_F CGGGAGATCCTGGCAAAGTA
DEGS1_cDNA_R CCAACTGGGTGAGAACCATCA
GAPDH_cDNA_F GGCCTCCAAGGAGTAAGACC
GAPDH_cDNA_R AGGGGAGATTCAGTGTGGTG
132
APPENDIX III
List of siRNA sense sequences
siNC 1st BASE Pte Ltd
sense 5'-rUrUrC rUrCrC rGrArA rCrGrU rGrUrC rArCrG rUTT-3'
antisense 5'-rArCrG rUrGrA rCrArC rGrUrU rCrGrG rArGrA rATT-3'
siNFIC Dharmacon ON-TARGETplus SMARTpool siRNA NM_005597
sense 5'-GGAGCAAGCGGCACAAAUC-3'
sense 5'-GAACAGGACCCAACUUCUC-3'
sense 5'-AGACAGAGAUGGACAAGUC-3'
sense 5'-GCUCAAAGAUCUUGUCUCG-3'
siFoxA1 Dharmacon
sense 5'-GAGAGAAAAAAUCAACAGC-3'
antisense 5'-GCUGUUGAUUUUUUCUCUC-3'.