+ All Categories
Home > Documents > Noel Leeming Maximise Your Prezzies Mailer

Noel Leeming Maximise Your Prezzies Mailer

Date post: 06-Apr-2016
Category:
Upload: noel-leeming
View: 248 times
Download: 10 times
Share this document with a friend
Description:
Noel Leeming 3rd December Mailer
Popular Tags:
32
3 rd December - 9 th December Product and credit offers begin Wednesday 3rd December 2014 and end Tuesday 9th December 2014, or while stocks last. See pages 2 and 3 for terms & conditions. FCBNOE5501 Carrera 1:20 Scale Red Bull Buggy Model: CT201017 125585 2 See Pg 5 for details $ $ 69 69 99 99 HTC One M8 Smartphone - Gold Model: OPEN NETWORK PHONE 133068 35 See Pg 10 for details colour colour Philips AirFryer Model: HD9220/20 124973 11 Also available in lavender white in selected stores only. Props not included See Pg 25 for details $ $ 299 299 or weekly from $ 3 30 ¥ $ 899 or weekly from $ 8 13 ¥ each each get more Christmas for less maximise your prezzies While stocks last Baking Tray WORTH $ 49 99 bonus bonus ^ ^ $ $ WIN †† the ultimate the ultim be in to †† †† †† †† †† 30min free free ^ ^ device introduction $ $ 99 99 99 99 Learning Learning Games, 2 Protective Bumpers and Screen Protector includes includes ^ ^ Funtech 7” Kids Tablet Model: FTTAK001 132580 3 See Pg 13 for details full HD 100Hz HDMI X4 USB X2 full HD 100Hz HDMI X4 USB X2 Sony 60” Full High Definition SMART LED Model: KDL60W600B 134767 79 See Pg 20 for details Playstation 4 bonus bonus ^ ^ your 1 r ur week guide uid to xmas shopping Xbox One 500GB Ultimate Racing Bundle Model: XB1XMASBUN 134526 23 See Pg 2 for details $ $ 1999 1999 or weekly from $ 16 97 ¥ See pages 2&3 of the Gift Generator#3 insert $ $ 599 599 or weekly from $ 5 72 ¥
Transcript
Page 1: Noel Leeming Maximise Your Prezzies Mailer

3rd December - 9th December

Product and credit off ers begin Wednesday 3rd December 2014 and end Tuesday 9th December 2014, or while stocks last. See pages 2 and 3 for terms & conditions. FCBNOE5501

Carrera1:20 ScaleRed Bull BuggyModel: CT201017 125585

2 See Pg 5 for details

$$69699999

HTC One M8 Smartphone - GoldModel: OPEN NETWORK PHONE 133068 35 See Pg 10 for details

colourcolour

PhilipsAirFryerModel: HD9220/20 124973

11 Also available in lavender white in

selected stores only. Props not included

See Pg 25 for details

$$299299or weekly from $330¥

$899or weekly from $813¥

eacheach

get more Christmas for less maximiseyour prezzies

While stocks last

Baking Tray

WORTH $4999

bonusbonus^̂

$$WIN

††

the ultimatethe ultim

be in to ††††††††††††††††

30minfreefree^̂

deviceintroduction

$$99999999LearningLearning Games,

2 Protective Bumpers and

Screen Protector

includesincludes^̂

Funtech 7” Kids TabletModel: FTTAK001 132580 3 See Pg 13 for details

full HD 100Hz HDMI X4 USB X2full HD 100Hz HDMI X4 USB X2

Sony 60” Full High Definition SMART LEDModel: KDL60W600B 134767

79 See Pg 20 for details

Playstation 4

bonusbonus^̂

youry

1 rurweekguideguidto xmas shopping

Xbox One 500GB Ultimate Racing Bundle Model: XB1XMASBUN 134526

23 See Pg 2 for details

$$19991999or weekly from $1697¥

See pages 2&3 of the

Gift Generator#3 insert

$$599599or weekly from $572¥

Page 2: Noel Leeming Maximise Your Prezzies Mailer

Product and credit off ers begin Wednesday 3rd December 2014 and ends Tuesday 9th December 2014, or while stocks last. Personal shoppers only, trade not supplied. ¥Up to 48 Months to Pay Weekly Repayment Terms and Conditions: Weekly repayments are calculated on products over $250 over 48 months to approved purchasers. An establishment fee, monthly service fee, and interest apply. The weekly payments shown include optional protection insurance (chattels and payment protection). Credit is provided by Finance Now Limited. Normal lending conditions and credit criteria apply. See in store for details. Quadruple Fly Buys on LG Whiteware: **4x Fly Buys are not available in conjunction with any other Fly Buys promotional off er. 4x Fly Buys consists of 1 standard Point plus 3 Bonus Points for every $25 you spend at Noel Leeming. Fly Buys Points shown on LG whiteware products reflect quadruple Points. Fly Buys consist of 1 standard Point for every $25 you spend at Noel Leeming. Fly Buys shown reflect single points. ^Includes/Free/Bonus/½ Price item available only with purchase of associated product at advertised price. +Discount terms and conditions apply: Excludes combo/package deals. †Price Promise terms and conditions available in store and online. ++Prices shown reflect discount. #^Heat Pump off ers are valid for all enquiries recorded between 03/12/2014 and 09/12/2014 and where the sale is completed by 16/12/2014 or while stocks last. The standard back to back installation price is $850 incl GST back to back installation applies when outdoor compressor is less than 3 metres from indoor unit. Extra electrical or wiring maintenance charges may apply. Call 0800 44 44 88 to arrange for a specialist to visit your home. See instore for details. **Our Lowest Price Ever refers to the advertised price. Tech solutions Terms and conditions and exclusions apply. This

Xbox One500GB Ultimate Racing Bundle Model: XB1XMASBUN 134526

23

Xbox One

or weekly from $572^

$$599599or weekly from $572^

Xbox One500GB Hard-core Bundle Model: XB13GAMEBUN 134532

23

$$599599

Xbox One

or weekly from $354^

Xbox 360 500GB Holiday Bundle Model: XB360500GBBR 134786 13

$$329329SAVE $20

Xbox One Controller• Wireless controller. • AA batteries x2 Model: S2V-00004 123542 2

nownow $$69699999SAVE $40

Turtle BeachXO Four Xbox One Headset• Compatible with Xbox One and Mobile Gaming Model: XOFOUR 124630 6

nownow $$1169699999

Xbox OneMinecraft Model: 44Z-00005 134529

$$2424 9999

SAVE $20

Electronic ArtsUFC 2014 Model: EAXB12112538 128460 2 Also available in PS4 (128459)

nownow $$69699999

Xbox OneThe Crew Xbox One Model: THECREWXB1 128606

3 Also available in PS4 (128498)

$$8484 9999

Xbox OneGrand Theft Auto V Model: GTA5XB1 130811 3 Also available in PS4 (130809)

$$89899999

2

Gaming

Product and credit off ers begin Wednesday 3rd December 2014 and ends Tuesday 9th December 2014, or while stocks last. Personal shoppers only, trade not supplied. ¥Up to 48 Months to Pay Weekly Repayment Terms and Conditions: Weekly repayments are calculated on products over $250 over 48 months to approved purchasers. An establishment fee, monthly service fee, and interest apply. The weekly payments shown include optional protection insurance (chattels and payment protection). Credit is provided by Finance Now Limited. Normal lending conditions and credit criteria apply. See in store for details. Quadruple Fly Buys on LG Whiteware: **4x Fly Buys are not available in conjunction with any other Fly Buys promotional off er. 4x Fly Buys consists of 1 standard Point plus 3 Bonus Points for every $25 you spend at Noel Leeming. Fly Buys Points shown on LG whiteware products reflect quadruple Points. Fly Buys consist of 1 standard Point for every $25 you spend at Noel Leeming. Fly Buys shown reflect single points. ^Includes/Free/Bonus/½ Price item available only with purchase of associated product at advertised price. +Discount terms and conditions apply: Excludes combo/package deals. †Price Promise terms and conditions available in store and online. ++Prices shown reflect discount. #^Heat Pump off ers are valid for all enquiries recorded between 03/12/2014 and 09/12/2014 and where the sale is completed by 16/12/2014 or while stocks last. The standard back to back installation price is $850 incl GST back to back installation applies when outdoor compressor is less than 3 metres from indoor unit. Extra electrical or wiring maintenance charges may apply. Call 0800 44 44 88 to arrange for a specialist to visit your home. See instore for details. **Our Lowest Price Ever refers to the advertised price. Tech solutions Terms and conditions and exclusions apply. This

Page 3: Noel Leeming Maximise Your Prezzies Mailer

or weekly from $652^

PlayStation 4500GB Mega Game Bundle Model: PS4XMASBUN 134524

27

$$699699

PlaySSttattiiioonn 4444500GB M G BB ddl

or weekly from $612^

PlayStation 4500GB Ultimate Family Bundle Model: PS43GAMEBUNDLE 134533

25

$$649649

SAVE $50

Turtle BeachSTEALTH 500P Model: TBEARS500P 134484

7

Wireless DTS surround sound gaming headset for PS4 & PS3

nownow $$119999or weekly from $330^

PlayStation Vita Minecraft and Little Big Planet Marvel bundle Model: VITAMC&LBPMARVEL 134522 11

$$299299or weekly from $411^

PlayStation 3500GB Singstar bundle Model: PS3500GBSINGSTAR 134534 15

$$399399

PlayStation 4 & Xbox OneRUGBY 15 Model: RUGBY 15 PS4 133948 / 133949

3

$$89899999eacheach

Ubisoft Farcry 4 PlayStation 4 & Xbox One Model: FARCRY4PS4 130333 / 130335

3

$$8484 9999 eacheach

PlayStation 4 & Xbox OneAssassin’s Creed Unity Model: ASSUNITYPS4 129198 / 129199

3

$$8484 9999 eacheach

New PS3 Essential Games Model: 9248774 122846 / 122446

$$2424 9999eacheach

service is available at all Noel Leeming stores nationwide. Customers must complete the terms and conditions declaration prior to work commencing. Please contact your local store in regards to service areas. The Free diagnosis and quote services are only off ered in selected stores. There is an additional travel charge of $49 per 30KM outside of serviced areas. Prices are subject to change without notice. Courier charges may apply. Ask in store for full terms and conditions and service policy. Excludes all Noel Leeming Clearance Centres. Contact us on 0800 44 44 88 or visit www.noelleeming.co.nz

Page 4: Noel Leeming Maximise Your Prezzies Mailer

PlayStation 4Skylanders Trap TeamModel: TRAPTEAMPS4 129970 2 Available on PS4, PS3, Xbox One and Xbox 360

$$74749999eacheach

Disney InteractiveDisney 2.0 Marvel Super Heroes Xbox One Model: DISNEY2.0XB1 130931 3 Available on PS4, PS3, Xbox One and Xbox 360

$$99999999eacheach

Nintendo Super Smash Bro’s U Model: SSBROSU 128455 3

$$88999999

Disney Interactive 2.0 Characters Model: CAPTAINAMERICA 130936 / 134313 / 134320

Range may vary by store

eacheach$$11999999

Disney InteractiveDisney Infinity Toy Box Combo Pack Model: DISNEYTOYBOX PS4 134101 3 Available on PS4, PS3, Xbox One and Xbox 360

$$84849999eacheach

Nintendo 3DSPokemon Omega Model: OMEGARUBY 130164 / 130167 2

$$55999999eacheach

$$999999eacheach

SkylandersSWAP Force Characters

124705

125366

125636

SWAP Force Cha

125636

Skylanders Trap Team Traps Model: AIR ELEMENT 133640 / 133466 / 133471

Range may vary by store

$$77 9999eacheach

Nintendo 2DS Model: 125301 131336 / 131337 6 Colour options may vary by store

$$1174749999eacheach

ActivisionSkylanders SWAP Force Starter Kit Model: 84702AU 127369 2 Available on PS4, PS3, Xbox One and Xbox 360

$$55999999

Skylanders Trap Team Master Character Model: KRYPT KING 133472 / 133473 / 133474

Range may vary by store

$$11999999eacheach

4

Gaming and toys

48 months¥ to payon products $250* & overup to

An establishment fee, monthly service fee and interest apply. Normal lending conditions and credit criteria apply. See in store for details. Credit is provided by Finance Now Limited.

Page 5: Noel Leeming Maximise Your Prezzies Mailer

Toy 4 Channel Remote Control Quadcopter with Rollcage • Flying, running, climbing capabilities • Good for beginner with protective

cage • 2 speed settings

Model: GT4000 131755 3

now$$79799999

SAVE $10nownow

S

4444444444 CCCCCCCCChhhhaaaannnnnnnnnnnnnnnnnnneeellll RRRRReeeeemmmmmmmmmmmooooooooootttttttttttteeeeee

ToyRemote Control Toy Excavator Model: 905B 131544 1

$$3939.9999

EvolutionBubble Machine Model: SFL004 125132

$$2424 7777

iHeliRadio Controlled HelicopterModel: GT3405 112223 3

Large 50cm length

$$99999999

MaistoRadio Controlled Rock Crawler JuniorModel: ROCK CRAWLER JUNIOR 113979 2

Full 4WD power

$$69699999

Colour options may vary by store

ToyGlitter Lamp Model: SZGLL 132841

Changes colour

$$11999999

BeeForce24cm Remote Controlled HelicopterModel: M-V398 125467 1

Shoots Missiles

$$49499999

Carrera1:20 Scale Red Bull Buggy• Top speed 12km/h • Ready to race• Run time up to 20 minutesModel: CT201017 125585 2

$$69699999

ToyRemote Control 2 Channel Nano Car Model: GT4030 131759

Hang on your tree

$$11999999

ToyRechargeable Glider Plane with Gun Launcher Model: GT4020 131758 1

Perfectstockingstuff er

$$29299999

Toy

Toy1:32 Micro Stunt Buggy Model: YW253010-B, YW253020 133955

1 Available in orange or blue.

$$39399999

awesome toysawesome toysXmasXmasforfor

Page 6: Noel Leeming Maximise Your Prezzies Mailer

SAVE $10

Nokia Lumia 530Smartphone• 4” screen• 1.2GHz quad-core

processor • 5MP CameraModel: LUMIA530 132323

3 At this price this phone is set up to only

work with a Vodafone NZ SIM. To use

another network’s SIM, a $30 unlock fee

will apply. See vodafone.co.nz/unlock for

more information.

nownow $$89899999

M

3A

w

a

w

m

Comes witha free Prepay

$19

Sony Xperia E1 Smartphone• 4” Screen• 1.2GHz dual core

processor• 3MP CameraModel: XPERIA E1 133862

4 At this price this phone is set up to only

work with a Vodafone NZ SIM. To use

another network’s SIM, a $30 unlock fee

will apply. See vodafone.co.nz/unlock for

more information.

$$111199999

M

44A

w

a

w

m

Comes witha free Prepay

$19

Nokia Lumia 635Smartphone - Black• 4.5” screen • 1.2GHz

quad core processor• 5MP cameraModel: PH-N-635 132097

9

$$249249Comes with

a free Prepay

$19

or weekly from $371^

Samsung GALAXY S4 mini Smartphone - Black• 4.3” screen• 1.7 GHz dual core processor• 8MP cameraModel: PH-SAM-GS4M-B 124295 13

$$349349Comes with

a free Prepay

$19

VodafonePower to you

Prepay $29. Now with 1GBGet a free Prepay $29 with selected phones

VodafoneSmart 4 Turbo5MP Camera1.2GHz quad core processorMassive 4.5” screenAndroid 4.4 (Kit Kat)

VodafoneSmart 4 fun2MP camera1GHz dual core processorLarge 3.5” screenAndroid 4.4 (Kit Kat)

$4799

At this price this phone is set up to only work with a Vodafone NZ SIM

132204 132831

134755

$6999

VodafoneSmart 4 mini3.2MP camera1.3GHz dual core processorLarge 4” screenAndroid 4.3 (Jelly Bean)

Comes witha free Prepay

$29Comes with

a free Prepay

$29Comes with

a free Prepay

$29

1GBdata

Now withVodafone200

minsto std NZ and Oz

numbers

TXTUnlimited

to std NZ and Oz numbers

Freeweekendcalling

to Vodafone NZ mobiles

4GFast

in 4G areas with a capable device

Get ready for the festive season with the Vodafone family of handsets

$149991 2 5

At this price this phone is set up to only work with a Vodafone NZ SIM

$49

Stay close all summer with 5GB Free

$

Data lasts 6 months. Must be activated by 31/12/2015. Auto-renews if you have enough credit.

Vodem StickK4607z

1 3

lasts 6 months

Free 5GB

$79Vodafone WiFi hotspot R209z

6

VODAFONE: 4G not available everywhere and requires a 4G capable device. See vodafone.co.nz/4G. Included value off er valid until 15 Jan 2015. *Free mins and TXTs is Prepay $9 and are to standard NZ numbers. Prepay $9, $19 and $29 last 30 days and auto renews if you have credit. Included mins and TXTs are for personal use only. Free weekend calling is 7pm Friday to 7am Monday. Prepay terms apply see vodafone.co.nz/prepay. Fantastic Friday terms apply, not available to business customers and some deals only available with top up. See vodafone.co.nz/fantasticfridays for details. To use with other networks a $30 unlock fee applies. For HD to work, you and the person you are calling both need to have 3G coverage, HD voice compatible phone and be on the Vodafone network.2DEGREES: 2degrees terms and conditions: *Fair Use Policy applies. Handset off ers end 09/12/14 or while stocks last. Plan conditions & early termination charges apply. Standard NZ & Aus mins & texts only. NZ data usage only. Calls rounded up to the nearest minute. Handset price based on using your Plan Bonus. See 2degreesmobile.co.nz for full Fair Use Policy & conditions. Free NZ Text off er only if you redeem your code received with purchase of this phone before 09/12/14. 5000 standard NZ texts applied on every top up made on the Prepay SIM until 31/12/15. Texts valid 1 month. 1.5GB promotion ends 09/12/14. Promotion only available to 2degrees Prepay & Pay Monthly customers, excl Business. Visit 2degreesworld.co.nz/redeem to enter & for full conditions. Handset off ers while stocks last. Free Google Play Music trial redeemed on Android devices before 11.59pm, 31/01/2015 & is valid 90 days from redemption. 5000 standard NZ texts applied on every top up made on the Prepay SIM until 31/12/15. Texts valid 1 month.1.5GB promotion ends 1/02/2015. Visit 2degreesworld.co.nz/redeem for info how to redeem. For full conditions visit 2degreesmobile.co.nz. Google & Google Play are trademarks of Google Inc.SPARK: Spark terms and conditions: Value Pack Terms: Spark terms, conditions and charges apply. Value Pack valid for one month. See Spark.co.nz for more details. Spotify Terms: Data charges plus Spark and Spotify terms and conditions apply. See spark.co.nz/Spotify for more information. Wifi Terms: Available free on selected Spark value packs only. “For Life” means whilst the eligible pack or plan is made available and you continue to renew it. Socialiser available on packs and plans above $19 p/m and customers must opt in. Only available on smartphones with off icial Facebook and Twitter apps. Standard data charges apply after 1GB has been used up and to any click through links. Available to consumer customers

Mobiles & accessories

Page 7: Noel Leeming Maximise Your Prezzies Mailer

HuaweiAscend Y520 Smartphone• 4.5” screen• 5MP camera• 4GB internal memoryModel: HUAWEI Y520 134408

4

4.5” screen

SAVE $80nownow $$1111999999

or weekly from $1014^

• 1.9Ghz octa-core processor• 5.7” quad HD super

AMOLED screen• Android 4.4Model: NOTE 4 WHITE 133962

45

$$11114949handset onlyhandset only

$68VALUE

FREE MUSICAND 1.5GBNZ DATA

Only on a $39 or above Freedom Term plan

$46permonth

over 24 months

Samsung Galaxy Note 4 Smartphone$20 upfront

Lifeproof iPhone 6 Fre Case• Four-proof protection• Virtually invisible scratch defenseModel: 77-50357 133387 / 133386 / 133388 / 133389 / 133390 / 133391 3 Colour options may vary by store iPhone 6 not included

$$99999999eacheach

SAVE $20

Jabra Stealth Bluetooth Headset Black• Smartphone voice control

button for remote activation of Siri/Google Now

• Noise blackout dual microphone reduces background noise

Model: STEALTH 133603 3

nownow $$99999999

$$249249

$68VALUE

FREE MUSICAND 1.5GBNZ DATA

Huawei G730 Smartphone - Black• 5.5” screen• 1.3GHz quad-core

processor• 5MP cameraModel: HUAWEI G730 BLACK 128397

9

SAVE $10

Jabra Drive BluetoothHandsfree Speakerphone• Jabra bluetooth hansfree speakerphone transmits

music, podcasts and GPS directions• Connects to 2 Bluetooth devices at the same timeModel: DRIVE 118298 3

nownow $$79799999

$$899999

SamsungGALAXY Trend• 4” Screen• 1GHz Processor• 3MP CameraModel: GT-S7390 126506

3

SaSa

$68VALUE

FREE MUSICAND 1.5GBNZ DATA

Go to the ‘Play Music’ App on your Android phone to redeem.

$68VALUE

FREE MUSICAND 1.5GBNZ DATA

Give over 25 million songs this Christmas.Enjoy FREE Google Play Music and 512MB NZ Data each month for 3 months when you buy any Android smartphone.

+ 3-layer reinforced protection

+ High impact polymer for shock absorption

+ Soft touch surface for secure grip

+ Compatible with +drive and +trip mounts

for Samsung GALAXY S5 for iPhone 5/5s/6

132469 / 132470 / 133084 / 133083 / 130659 / 130686 / 131359 / 131361

Colour options may vary by store Smartphone not included

from from $$49499999

eacheach

only and excludes legacy plans. Socialiser off er ends 3 February 2015. SKINNY: 3GB off er for new customers (1 per customer), who activate SIM & purchase a $16, $26 or $40 Combo & renew it for the following 2 renewal periods. Each 1GB Data is valid for 30 days. Phones set up to only work with a Skinny SIM. To use with another network’s SIM seeskinny.co.nz for unlock code, $30 fee may apply. Personal use in NZ only. See skinny.co.nz for terms and extra charges. Excludes Noel Leeming Clearance Centres. For more information contact us on 0800 44 44 88 or visit www.noelleeming.co.nz.

Mobile phone accessories

Page 8: Noel Leeming Maximise Your Prezzies Mailer

SWITCH ON AT SPARK.CO.NZ/SOCIALISER BEFORE 3 FEBRUARY 2015

“ For life” means for the life of the pack or plan above $19. Packs must be renewed monthly, and is available on official Facebook and Twitter apps only. See spark.co.nz/socialiser for full details. SP

A03

16

HuaweiAscend G630 Smartphone- Black• 5” screen• 1.2GHz quad core processor• 8MP cameraModel: G630 131234

6

Large 5” screen

$1159599999

Sony Xperia E1 Smartphone- White• 4” screen • 1.2GHz dual core

processor• 3MP cameraModel: 119203 129272

3

4GB internal memory $$89899999

FREE^ $29VALUE PACK*

AlcatelD1 Mobile Phone• 3.5” screen • 2MP camera• 1GHz dual-core processorModel: ALCATEL POP 133668 1 Set up to work on the Spark network only

$$44 9999

FREE^ $19VALUE SIM*

Huawei Ascend Y330 Smartphone- Black• 4” screen• 1.3GHz dual core

processor• 3MP CameraModel: Y330 BLACK 130632

2 Set up to work on the Spark network only

$$69699999FREE^ $19VALUE SIM*

SamsungGALAXY Trend PlusSmartphone• 4” screen• 1.2GHz cpu processor• 5MP cameraModel: GALAXY TREND PLUS 132985

3 Set up to work on the Spark network only

$$89899999

FREE^ $19VALUE SIM*

SamsungGALAXY Ace3 4G Smartphone - Black• 4” screen • 1.2GHz dual core processor• 5MP cameraModel: SAMSUNG- GALAXYACE3 126805 7

$$1199999999FREE^ $29VALUE SIM*

8

Mobile & audio

KERIKERI (Waipapa) • WHANGAREI - Cameron Street, Whangarei Supa • AUCKLAND - Albany Mega Centre, Auckland Clearance Centre, Botany Downs, Lincoln Centre - Lincoln Road, Hunters Plaza, Manukau Supa Centa, New Lynn, Newmarket, Papakura, Pukekohe Mega Centre, St Lukes Mega Centre, Sylvia Park, Silverdale, Wairau Park Mega Store, Westgate, Warkworth • THAMES • HAMILTON - Cnr Ward & Anglesea Street, Te Rapa • WAIKATO - Cambridge, Matamata, Morrinsville, Te Awamutu • TOKOROA • MT MAUNGANUI • TAURANGA • ROTORUA • TAUPO • GISBORNE • HASTINGS • NAPIER • PALMERSTON NORTH • LEVIN • NEW PLYMOUTH • HAWERA • MASTERTON • WANGANUI • WHAKATANE • WELLINGTON - Lyall Bay, Coastlands, Porirua, Lower Hutt, Tory Street Appliances, Tory Street Whiteware Clearance Centre (inside Tory Street Appliances), Tory Street Technology, Upper Hutt • NELSON - Appliances & Technology, Trafalgar St, Richmond • BLENHEIM • GREYMOUTH • CHRISTCHURCH - Rangiora, Riccarton, Shirley, Papanui, Moorhouse Ave, Northwood Supa Centa • ASHBURTON • TIMARU • OAMARU • QUEENSTOWN • DUNEDIN - Crawford Street, George Street • GORE • INVERCARGILL • Ph: 0800 44 44 88 www.noelleeming.co.nz As at 3rd December 2014

76 stores nationwide

Page 9: Noel Leeming Maximise Your Prezzies Mailer

SAVE $40

Marley Jammin Positive Vibration Rasta HeadphonesModel: EM-JH013-RA 114685

2

nownow $$5959999940% OFF

+ +

or weekly from $411^

Bose®SoundLink®On Ear BluetoothHeadphonesModel: 714675-0010 137230 / 137231

15

$$399399eacheach

Colour options may vary by store

SAVE $35

Yurbuds Ironman Inspire Pro - Red (Performance Fit) EarphonesModel: 10101 137055

1

nownow $$4444 999943% OFF

+ +

or weekly from $363^

Beats Solo 2 On Ear HeadphonesModel: SOLO2BLACK 137070 / 137071 / 137072 / 137073 / 137074 / 137075

13 Colour options may vary by store

$$339339eacheach

SAVE $10

Endeavour Street HeadphonesModel: EN910 119539

nownow $$1144 999940% OFF

+ +

SAVE $100

Philips FM Wireless Hi-Fi HeadphonesModel: SHC5100 112307

3

nownow $$9999999950%

OFF+ +

Give them a smartphone, not socks.

skinny.co.nz

Over 3 months, that’s 1GB each month.Just join Skinny on an eligible combo before 6 January 2015.

3GB FREE 3G + FREE SIM

3G + FREE SIM

3G + FREE SIM

3G + FREE SIM

Samsung Galaxy Ace 4 Lite• 1GHZ processor• 4" touch

screen display

• Intelligent 3MP camera

Skinny V795• Internet & social

media functions• 3.5" touch

screen display

• Up to 32GB expandable memory

Skinny V811• Android™ 4.4• Slim, smooth

design• 4" touch

screen display

• 2MP camera

HTC Desire 310• Android™ 4.2.2• HD touch

4.5" screen

• Ultra fast 1.3GHZ quad core processor

• 5MP camera

$7999

$3999 $6999

$16999

Set up to only work with a Skinny SIM.

134177 3

Set up to only work with a Skinny SIM.

134183 6

Set up to only work with a Skinny SIM.

134176 1

Set up to only work with a Skinny SIM.

134179 2

Page 10: Noel Leeming Maximise Your Prezzies Mailer

HuaweiAscend P7 Smartphone• 5” screen• 1.8Ghz quad-core processor• 13MP cameraModel: ASCEND P7 132069

19

8MP front facing camera. Perfect for selfies!

SAVE $100nownow $$499499

or weekly from $491^SAVE 100

or weekly from $813^

HTC One M8 Smartphone - Gold• 5” Screen • Qualcomm Snapdragon 801 processor• UltraPixel Camera with dual lens

Model: OPEN NETWORK PHONE 133068 35

$$899899eacheach

16GB internal memory

colourcolour

Motorola G 2nd Generation Smartphone - Black• 5” screen • 1.2GHz

quad-core processor• 8MP cameraModel: MOTO G 2ND GEN 132818 9

Massive 8GB internal memory

$$249249

M

or weekly from $314^

HTC Desire 510 Smartphone• 4.7” screen• 1.4GHz processor• 5MP cameraModel: HTC DESIRE 510 133048

11

$$279279

HT

or weekly from $491^

HTCDesire 816 Smartphone• 5.5” screen• 1.6MHz processor• 13MP cameraModel: HTC DESIRE 816 133049

19

$$499499

HT

Car ChargerModel: F8J002QEBLK

121770 / 121771 / 121772 / 121773 / 121774 / 121775 1 Colour options may vary by store

$$349999 each

Single Wall ChargerModel: F8J052AUBLK

124464 / 124465 / 124466 / 124467 / 124468 / 127742 1 Colour options may vary by store

Lightning CableModel: CNSLIGHT

131659 / 131661 / 131663 / 131664 1 Colour options may vary by store

$$339999 99 eacheach

from from

$$262699 99 eacheach

ee

Belkin MIXIT USB 2.1

Mobile accessories

Available to purchase in store and online

Cover Me Customised Phone Cases Model: COVERMECASE 130139 1

$$29299999eacheach

The best phone case is the one that you design yourself, and is a great xmas prezzie for family and friends! You customise the design from photos of your favourite pets, to family or that not to forget summer holiday!

Visit noelleeming.co.nz/coverme to purchase a case today.

MAKE YOUROWN CASE

10

Mobiles & GPS

like us on facebook for updates on the latest products, news & off erswww.facebook.com/noelleemingonline

Page 11: Noel Leeming Maximise Your Prezzies Mailer

Tom Tom GO 50 Navigational Unit• Tap & go • 3D city maps • Quick keyword search

Model: 1FC5.069.00 130214 9

5” screen$$229229

OOOOOOOOO 555555555555555555000000000000 NNNNNNNaaaaaavvvvvvvviiiiiiiggggggggggaaaaaaaaattttttttttiiiiiiiiiooooooooooooonnnnnnnnnnnnnaaaaaaaaaaallllllll UUUUUUUUUUUUUUUnnnnnnnnnnnnnnniiiiiiiiiitttttttty my mmmmapsapsapsaps •••• QuiQuiQuQuiQuQuiQuickck ck ck keykeyke worrwororoord sd seaarrearararararchchchchchcccch

0 130220211414 9

NavmanEZY250 Navigational Unit• 5” touchscreen • Bluetooth handsfree • Lifetime free maps built-inModel: EZY250 123546 5

$$1129299999

While stocks last

Tom TomVIA 280 LTM Navigational Unit• 5” touchscreen • Daily map updates with mapshare• NZ and Australian maps preloadedModel: VIA280LTM 123277 7

$$1189899999

Tom TomVIA225 LTM Navigational Unit• 5” touchscreen • Advanced lane guidance • Maps of NZ and AustraliaModel: VIA225LTM 123278 6

$$1159599999

NavmanMY600LMT Navigational Unit• Rapid map refresh - lifetime monthly map updates• New look chassis • Landmark guidance plusModel: MY600LMT 131346 7

$$1199999999

Page 12: Noel Leeming Maximise Your Prezzies Mailer

SamsungGalaxy Tab 3 7.0 Lite Wi-Fi Tablet• 1.2GHz dual core processor • 8GB SSD hard drive• 1GB RAM • 2MP rear camera onlyModel: SM-T110NDWANZC 128356 / 128355 / 128357

7

$$1199999999eacheach

Colour options may vary by store

30minfreefree^̂

deviceintroduction

Samsung Galaxy Tab S 10.5” 16GB WiFi Tablet• 1.9GHz quad core processor • 3GB RAM• 16GB memory • 10.5” 2560x1600(WQXGA) super

AMOLED screenModel: SM-T800NTSBUN 131463

29

nownow$$699699

SAVE $50or weekly from $652^

30minfreefree^̂

deviceintroduction

Bo-nusBonusBonus

Trend Micro Security & 32GB

Micro SD Card WORTH

$89

SAVE $50

Samsung Galaxy Tab S 8.4” 16GB WiFi Tablet• 1.9GHz quad core processor • 3GB RAM 16GB memory Model: SM-T700NTSABUN 131464

21

nownow $$549549BB oonnuuss^̂

Trend Micro

Security & 16GB Micro SD Card

WORTH $59

or weekly from $531^

30minfreefree^̂

deviceintroduction

Bo-nus

BB oonnuuss^̂

16GB microSD card

WORTH$2999

or weekly from $387^

Samsung Galaxy Tab 48.0 WiFi 16GB White Tablet• 1.2GHz Quad Core Processor• 1.5GB RAM • 16GB SSD Hard Drive• 3MP Rear Camera and 1.3MP Front CameraModel: SM-T330NZWBUN 131320 14

$$36936930minfreefree^̂

deviceintroduction Bo-

nusBonusBonus ^̂

16GB Micro SD Card

WORTH $2999

or weekly from $491^

Samsung Galaxy Tab 4 10.1 WiFi 16GB White Tablet • 1.2GHz quad core processor• 1.5GB RAM • 16GB SSD hard drive• 3MP rear camera and 1.3MP front cameraModel: SM-T530NZWBUN 131321 19

$$49949930minfreefree^̂

deviceintroduction

or weekly from $853^

Samsung GalaxyNote Pro 12.2” 32GB Tablet - Black• 1.9GHz + 1.3GHz Quad Core

Processor • 3GB RAM • 32GB Hard drive• 12.2” Display (2560x1600) WQXGA LCDModel: SM-P9000ZBUN 134248 37 Limited stock

$$949949BonusBonus 32GB Micro

SD Card & Trend Micro Security

WORTH $89

30minfreefree^̂

deviceintroduction

12

Portable devices

We’ll match any competitor’s price† plus give you

Go to tabtradeup.co.nz for more details. *Terms and conditions apply.

Get up to $250 cash back* when you trade in your old device.

Page 13: Noel Leeming Maximise Your Prezzies Mailer

Nextbook8” Windows 8 Tablet• 1.8GHz quad core processor • 1GB RAM • 16GB hard drive• Windows 8.1 with BingModel: M890BCP 133282

9

In-cludes

IncludesIncludes ^̂

1 Year Subscription to MS Office

365

$$24924930minfreefree^̂

deviceintroduction

Funtech 7” Kids Tablet• 1.0GHz dual core processor • 512MB RAM • 4GB hard drive • Android 4.4

Model: FTTAK001 132580 3

With parental management of access & playtime

$$99999999

IncludeIncludess^̂

Learning Games, 2 Protective

Bumpers and Screen

Protector

30minfreefree^̂

deviceintroduction

Nextbook7” Tablet• 1.0GHz dual core

processor • 1GB RAM• 8GB hard drive• Android 4.4Model: M7100KLD 131633

3

$$99999999

front & rear camera

Touchscreen30minfreefree^̂

deviceintroduction

Bo-nusbonusbonus

16GB Micro SD Card

HP 7 Plus 7” Tablet• 1.0GHz ARM

Cortex A7 quad core processor

• 1GB RAM • 8GB hard drive Model: HP7PLUSSDCARD

133905 5

$$1149499999

30minfreefree^̂

deviceintroduction

SmarTab 7” 3-in-One Tablet• Quad core processor • 8GB internal memory• 1GB RAM • Front and rear camerasModel: SMARTTABS7 132473 7

$$1199999999

70+includeincludess^̂

70+ Apps & Books from Disney

& Marvel

30minfreefree^̂

deviceintroduction

In-cludesiinncclluuddeess^̂

1 Year MS Office 365 Subscription

or weekly from $403^

Nextbook10” Windows 2n1 Tablet• 1.8GHz quad core processor • 1GB RAM• 32GB hard drive • Windows 8.1 with BingModel: M1012BCP 132973 15

$$38938930minfreefree^̂

deviceintroduction or weekly from $491^

MicrosoftSurface 2 32GB Tablet• 1.7GHz NVIDIA Tegra 4 processor • 2GB RAM • 32GB Hard drive • 10.6” Touchscreen displayModel: SURFACE232GBBUN 134364 19

$$499499Hard Sleeve & 16GB Micro

SD Card WORTH

$79

bonusbonus^̂

30minfreefree^̂

deviceintroduction

Kindle Paperwhite(Sponsored Version) eReader• 6” Paperwhite display• Up to 8 weeks battery • WiFi • Holds 1,100 booksModel: KINDLEPAPERWHITE 131230 / 134774

7

$$119999999930minfreefree^̂

deviceintroduction

When you buy a new device there’s no better way to discover the possibilities of what it can do than with a session in our Open Learning centre.

Open Learning is only available at the following stores: Albany, Queen Street, Wairau Park, Sylvia Park, Manukau, Te Rapa, Tauranga, Lower Hutt, Dunedin, Napier, Palmerston North and Nelson

maximise your device with a

FREEFREE^ 30 Minute 30 Minute one-on-one one-on-one introduction to your deviceintroduction to your deviceCall us to book a session today on 0800 555 989 or for more information visit noelleeming.co.nz/openlearning.

amazing deals on tabletsamazing deals on tablets

Page 14: Noel Leeming Maximise Your Prezzies Mailer

Great deals on printers & computer software

HDMI

Webcam

Touchscreen

HDMI

WebcamWW

TouchscreenTT

or weekly from $491^

HP 11.6” Silver Touchscreen Netbook Off ice• 1.0GHz AMD A4-1250 dual core processor • 4GB RAM• 320GB Hard drive • Integrated graphicsModel: 11-E102AUBUN 131857

19

$$499499

Bo-nusbonusbonus

MS Office 365 WORTH

$9999

includes delivery, installation & setup

$$598598oror

HDMI

DVD Writer

Bluetooth

HD Webcam

HDMI

DVD Writer

Bluetooth

HD WebcamWW

or weekly from $572^

Acer 15.6” Notebook Bundle• 1.83GHz Intel Celeron N2930 quad core processor • 4GB RAM• 1TB Hard drive • Intel HD Graphics with 64MB dedicatedModel: ES1-511-006BU 134261

23

$$599599Bo-

nusbonbonuu ss^̂

Bag, Mouse & Speakers

worth $109includes delivery,

installation & setup

$$698698oror

HDMI

Bluetooth

HD Webcam

HDMI

Bluetooth

HD Webcam

Bo-nus

bonubonuss^̂

Bag & MS Mouse

WORTH$79

or weekly from $451^

Toshiba 15.6” Notebook Bundle• 2.16GHz Intel celeron N2830 dual core processor • 2GB RAM • 500GB Hard drive • Intel HD graphicsModel: C50-B03EBUN 134262 17

$$449449 HDMI

DVD Writer

Bluetooth

Webcam

HDMI

DVD Writer

Bluetooth

Webcam

bonubonuss^̂

Trend Micro Security and Bag

WORTHWORTH $12999

HP 15.6” Silver Notebook• 1.7GHz Intel i3-4010U dual core • processor • 4GB RAM • 500GB hard drive • Internal graphicsModel: 15-R016TUB 134785 27

or weekly from $652^

$$699699DVD Writer

HD Webcam

DVD Writer

HD Webcam

Acer 19.5” All-In-One Desktop• 2.0GHz Intel celeron J1900 quad core processor• 4GB RAM • 500GB hard drive • Intel HD graphicsModel: ZC-606-002 131635 27

or weekly from $636^

$$679679

SAVE $20

CanonPixma MG2460 Multifunction Printer• 4800 x 1200 DPI print resolution• 4x6 Photos in 44 secondsModel: MG2460 124522 1

nownow $$33999999

HP Envy 4504 e-All-in-One Printer• Print, scan, copy & photo printing• Print resolution 4800 x 1200 dpiModel: HP4504 131945 2

$5999999$$$

HP Off icejet 6830 Premium e-All-in-One Printer• Print, scan, copy, fax, web • Print resolution up to 4800 x 1200 dpiModel: 6830 131944 5

$$1122999999

$7999**visit www.hp.co.nz/cashback for details.

Ends 24/12/14

WITH $50 CASHBACK, VIA REDEMPTION**

$$1199999999$9999

**visit www.brother.co.nz for details. Ends 24/12/14

WITH $100 CASHBACK VIA REDEMPTION**

BrotherMultifunction A3 Printer• Print, copy, scan, fax • Up to 20/22

ipm print speed • Duplex printingModel: MFCJ4620DW 133572 7

14

Computer essentials

48 months¥ to payon products $250* & overup to

An establishment fee, monthly service fee and interest apply. Normal lending conditions and credit criteria apply. See in store for details. Credit is provided by Finance Now Limited.

Page 15: Noel Leeming Maximise Your Prezzies Mailer

Get more with Offi ce 365.

*Offer available on Offi ce 365 University, Personal or Home one year subscription purchased 1/11/14 – 31/03/15. Redeem by 15/04/15. For full terms and conditions visit microsoft.co.nz/offi ceprezzy

Receive a $25 Prezzy Card when you buy Offi ce 365.*

120984/109923

128769/128937

120983/109916

or weekly from $1054^

Acer 15.6” Touchscreen Notebook• 1.7GHz Intel i5-4210U dual core processor • 4GB RAM• 1TB hard drive • Intel HD graphics with 128MB dedicatedModel: E5-571P-004BUN 134263

47

$$11119999

HDMI

DVD Writer

HD Webcam

Acer 15 6” Toouchscreeen NNootteebboookk

$$12981298ororBo-

nusBonusBonus Solution Bundle

WORTH $308

includes delivery, installation & setup

or weekly from $12 95^

HP 23”Touchscreen All-in-One Desktop• 3.1GHz Intel i3-4160T dual core processor • 8GB RAM • 1TB hard drive • 1GB GeForce 710M graphics

Model: 23-P104ABUN 134264 59

$$11499499

DVD Writer

HD Webcam

Touchscreen

PPP 22333”””””ouuchhssccrreeeenn AAAllllll iiiinnnn OOOOOOnnnneeeee DDDDDDeeeesskkkkktttttooooopppppp

includes delivery, installation & setup

$$15981598oror

Bo-nusBonusBonus

Solution Bundle WORTH

$462

HDMI

DVD Writer

Bluetooth

Webcam

HDMI

DVD Writer

Bluetooth

Webcam

or weekly from $732^

HP 15.6” Notebook• 1.7GHz Intel i5-4210U dual core processor• 8GB RAM • 750GB hard drive• Intel HD graphicsModel: 15-R003TU 134784 31 Limited stock

$$799799BonusBonus

MS Office 365

WORTH $9999

Toshiba 15.6” White Notebook• 1.8GHz AMD A4-6210 quad core processor• 4GB RAM • 500GB hard drive• AMD Radeon R3 graphicsModel: L50D-B01CHDD 132933 31

HDMI

DVD Writer

Bluetooth

HD Webcam

Bo-nusBonusBonus

1TB Portable Hard Drive

or weekly from $732^

$$799799

ASUS 15.6” Notebook• 1.7GHz Intel i5-4210U dual core processor• 8GB RAM • 750GB hard drive• 1GB NVIDIA Geforce 820 graphicsModel: F552LDV-SX966BUN 134265 45

HDMI

DVD Writer

Webcam

or weekly from $1014^

$$11114949BonusBonus

1TB HDD, Office 365 & Trend Security

WORTH $328

$5999**Visit www.summerpromo.trendmicro.co.nz.

Ends 24/12/14

WITH $20 CASHBACK, VIA REDEMPTION**

Trend MicroMaximum SecurityModel: TREND15MS4U 132912

3

$$79799999SAVE $30

Norton 360 2.0Model: 21327320 129163

3

Multiple Device Protection

nownow $$99999999

23%223%OFF

++

Page 16: Noel Leeming Maximise Your Prezzies Mailer

Essential accessories

or weekly from $572^

iPad Air 16GBWiFi Space GreyModel: MD785X/B 126510

23

$$599599

or weekly from $395^

iPad Mini 16GBWi-Fi WhiteModel: MD531X/A 119722

15

$$379379

or weekly from $692^iPad Air 2 Wi-Fi 16GB - GoldModel: MH0W2X/A 134060 29

$$749749eacheach

fromfrom

At just 6.1 millimetres, the thinnest iPad ever is also the most capable. It has a re-engineered 9.7-

inch Retina display, the revolutionary Touch ID fingerprint sensor, a powerful A8X chip with 64-bit

architecture, a new iSight camera, an improved FaceTime HD camera, faster wireless, iOS 8, iCloud

and up to 10 hours of battery life.1 It also comes with great apps for productivity and creativity.

And there are many more apps available in the App Store.

1 Battery life varies by use and configuration. See www.apple.com/batteries for more information.

iPad Air 2

Get the iPad you want, at a price you’ll love

Wacom Intuos Small Pen and Touch TabletModel: CTH-480/S0-CX 124782 7

$$1179799999

SAVE $20

Logitech Z506 Surround Sound SpeakersModel: 980-000433 106253 3

nownow $$99999999

SAVE $10

LogitechM557 Bluetooth MouseModel: 910-003960 127642 / 127644 2 Colour options may vary by store

Perfect forMacbooks

nownow $$59599999 eacheach

Apple iPad Air Smart CoverModel: MGTM2FE/A 133999 / 134008 / 134016 / 134019 / 134028

2 Colour options may vary by store iPad not included

$$59599999 eacheach

16

iPad & accessories

we’ve gotxmas

sortedgift gift card card

We’ll deliver & install

your new technology

0800 555 989Click & collect

noelleeming.co.nz We’ll show you how

to use your device

0800 555 989to suit

flexible

your budget

finance options

Page 17: Noel Leeming Maximise Your Prezzies Mailer

Access your media & documents from your Smartphone or Tablet

3TBModel: WDBCTL0030HWT-AESN 126338

10

4TBModel: WDBCTL0030HWT-AESN 126339

13

$$269269or weekly from $306^

$$349349or weekly from $371^

$$1199999999

WD Personal Cloud Storage

2TBModel: WDBCTL0020HWT-AESN 126337

7

16GBModel: LJDS50-16GABANZ113095 / 142155 / 142156 / 142159

32GBModel: LJDS50-32GABANZ113098

$$11119999

$$11999999Colour options may vary by store

Colour options may vary by store

eacheach

eacheach

Lexar JumpDrive S50 16GB USB Flashdrive

AOC 23.6” Full HD LED Monitor• 23.6” LED • Full HD 1920 x 1080 • HDMI, DVI, VGAModel: E2450SWH 113689

7

$$1199999999

SAVE $60

NetgearD6200 Wireless AC Dual Band Modem Router with GigabitModel: D6200-100AUS 123240

9

nownow $$229229

2TB Model: WDBFJK0020HBK-AESN 127216

5 $$1139399999

3TB Model: WDBFJK0030HBK-AESN 127219

7

4TB Model: WDBFJK0040HBK-AESN 127220

9

$$1791799999

$$249249

WDMy Book USB 3 Desktop Hard Drive

MicrosoftSculpt Comfort DesktopModel: L3V-00027 127579

3

$$79799999

SAVE $70

BelkinN600DB Wireless-N Modem RouterModel: F9J1102AU 113617

6

nownow $$1159599999

30% OFF

+ +

LogitechWireless Desktop MK220Model: 920-003235 130439 1

$$29299999

SAVE $20

LogitechC270 HD WebcamModel: 960-000584 107122

1

nownow $$49499999

28% OFF

+ +

SAVE $20

N300Model: N300 130312

3

Boost your signal with a range extender

nownow $$79799999

SAVE $25

N600 Dual BandModel: F9K1122AU 124922

3

nownow $$9494 9999

BelkinWireless Range Extender

122

20% OFF

+ +

SAVE $1516GBModel: SDSDQUA-016G-UQ46A 117314

nownow $$2424 9999

SAVE $30

SAVE $30

32GB Model: SDSDQU-032G-UQ46A 117407

1

64GB Model: SDSDQUA-064G-UQ46A 117019

3

nownow $$49499999

nownow $$99999999

SandiskUltra Micro SD Card with Adapter

76 stores nationwide

Page 18: Noel Leeming Maximise Your Prezzies Mailer

00xx Zoom Zoom

1010xx Zoom Zoom

2020xx Zoom Zoom

4040xx Zoom Zoom

6565xx Zoom Zoom

Display all of your favourite photos

nownow$$389389eacheach

Fujifilm S9200 Ultra Zoom Camera Model: S9200 129335 15

16.2 Megapixel

Sensor

50x Optical Zoom

3” LCD TFT Screen

10 Advanced

Filters

or weekly from $403¥

Only at Noel Leeming

Sony DSCH300 Cyber-shot Black CameraModel: DSCH300 134068 11

SAVE $100

20.1 Megapixels

35x Optical Zoom

3.0” LCD Screen

DSLR-like body & EVF provide

steady shot when zooming

nownow $$299299or weekly from $330^3 ^

SAVE $60

Nikon Coolpix P600 Super Zoom Includes 8GB SD CardModel: P600 RED 8GB SD CARD 129029 / 129026 23 Colour options may vary by store

nownow $$589589eacheach

16 Megapixels

60x Optical Zoom

3.0” Vari-angle

LCD Screen

1080P Full HD Video up to

60 FPS

or weekly from $564^

Thomson7” Wooden Style Digital Photo Frame• 7 inch TFT LCD Screen• Panel Resolution: 480x234 (16:9)• Supports SD, MMC, MS Memory cardModel: DPF1707W 132811 2

$$59599999

Bo-nusbb oonnuuss^̂

16GB SD Card

WORTH$3499

130630

CanonSX170 Super Zoom CameraModel: SX170ISR 126315 9

16 Megapixel

Sensor

16x Optical Zoom

3” LCD Screen

32x Zoom Plus

colourcolour $$249249

$629**Visit canon.co.nz for details. Offer ends 10th January 2015

WITH $50 CASHBACK VIA REDEMPTION**

or weekly from $636^

Canon SX60 Ultra Zoom Camera with Wi-FiModel: SX60HS 133582 27

$$679679

16.1 Megapixel

Sensor

65x Optical Zoom

21mm ultra wide angle lens

Optical image stabiliser

Worlds biggest optical zoom camera

JCMatthew8” Ultra Slim Digital Photo Frame• Ultra slim Design, only 6mm• 800 x 600 Resolution• Built-in Light-Sensor , auto detect the ambient

brightness and adjust the panel brightness accordingly.

Model: PF8082E 119868 3

$$89899999

Bo-nusbb oonnuuss^̂

16GB SD Card

WORTH$3499

130630

JCMatthew 12” Classic Black Wood Digital Photo Frame• 12” LCD Screen• 800 x 600 Screen Resolution• SD, MMC, MS, XD, and CF Card SlotsModel: DPF1210AAN 119899 7

$$1179799999

Bo-nusbb oonnuuss^̂

16GB SD Card

WORTH$3499

130630

bonus^̂Outdoor Extreme Bluetooth Speaker

WORTH $179with any of the below super / ultra zoom cameras134068 / 126315 / 129335 /

133582 / 129029 / 129026

BlueSpeaker

WORT$179with abelo/ ulca13

1

• Splashproof • Built in lantern• Charge your phone

zoom in closer than ever before

18

Cameras

Did you know we have our own life prints photo lab?Visit our website www.noelleeming.co.nz/stores to see which of our stores have a photo lab or you can order prints online at www.lifeprints.noelleeming.co.nz

aaa

Page 19: Noel Leeming Maximise Your Prezzies Mailer

Perfect for Summer

Capture the perfect picture with these DSLRs

$$39399090

$$39399090

Hero 4 Rechargeable Battery Model: AHDBT-401 133918

1

Handlebar Seatpost MountModel: GOPRO HANDLEBAR 129627

1

Headstrap + QuickClip Model: HEADSTRAP+QUICKCLIP 129632

1

Suction Cup Mount XModel: GP SUCTION CUP MOUNT 129628

2

Chest Mount Harness “Chesty” Model: GOPRO CHEST MOUNT 129626 2

$$738738or weekly from $683¥

Hero4 Black Action Camera Model: CHDHX-401 133666 29

$$585585or weekly from $560¥

$229Hero4 Silver Action Camera Model: CHDHY-401 133697 23

HeMod

1

$$$$$$$$$$$$$$$$$

M

1

$$44449999

GoPro Action Cameras

Hero4 silver

Go Pros not included

SP Gadgets 39”Telescopic Pole With Remote SlotModel: 53021 131160

3Remote not included

Top GoPro AccessoriesA wide range of accessories available in store

Hero Action Camera + Bonus Bag of Mounts Model: CHDHA-301&AGBAG-001 133698 9

SAVE $100nownow $$55449999

SAVE $30nownow $$89899999

SAVE $10nownow $$59599999

Canon Ixus 145 Waterproof BundleModel: IXUS145 BLACK BUNDLE 131840 / 131841

5 Colour options may vary by store

$$1139399999

Canon Ixus 145

Black camera

1x Dicapac WP-One

camera case

1x Seagull mini tripod

1x Sandisk 8GB SD card

eacheach

B

or weekly from $490^

Canon EOS1200D with 18-55mm Lens KitModel: EOS1200D EFS 1855MM 129176 19

$$498498

18 Megapixel

Sensor

18-55mm Lens

3 Frames per second

shooting speed

9 point AF with

cross-type at centre

Kit

Nikon Coolpix S32 Everyday Tough CameraModel: COOLPIX S32 TOUGH 129164 / 129166 7 Colour options may vary by store

13.2 Megapixel

Sensor

3x Nikkor Lens

10m Waterproof, 1.5m Shock

proof

-10 Celcius Freeze &

Dustproof

oolpix S32

$$1189899999eacheach

or weekly from $893^

Canon EOS600D Triple Lens KitModel: EOS600D+EF50MM F1.8 117952 39

$$99999918.0

Megapixel CMOS Sensor

18-55mm IS,55-250mm IS and 50mm

Lenses

3.0” vari-angle TFT

screen

FullHD movie recording

(1080 x 1920)

Super value kit

Fujifilm XP70 Action Camera BundleModel: XP70 BUNDLE 133443 / 133450 8 Colour options may vary by store

$$221199eacheach

16 Megapixels

5x Optical Zoom

2.7” LCD Monitor

28mm Wide Angle Lens

on dl

$1598**Visit canon.co.nz for details. Offer ends 10th January 2015

WITH $100 CASHBACK VIA REDEMPTION**

or weekly from $1455^

Canon EOS70D with EFS18-135mm IS STM LensModel: 70DSK 124423

67

$$1166998820.2 Megapixel

Sensor

EFS18-135mm IS Lens

3” Vari-Angle Clearview

II LCD Capacitive

Touchscreen

DiGiC 5 Processor

Our Our Lowest Price Lowest Price ever nationwideever nationwide****

Page 20: Noel Leeming Maximise Your Prezzies Mailer

Big savings on TV & audio essentials

or weekly from $2179^ or weekly from $3305^

60”Model: KDL60W850B

134762

103

70”Model: KDL70W850B

134765

159

Sony Full High Definition 3D SMART LED

$$25992599 $$37993799

full HD smart Wi-Fi built in 3D

Bo-nusbonusbonus

Playstation 4

full HD smart Wi-Fi built in Wi-Fi SubCompatiblefull HD smart Wi-Fi built in Wi-Fi SubCompatible

or weekly from $547^

Sony32” Full High Definition SMART LEDModel: KDL32W700B 128526 22

$$569569

full HD 100Hz HDMI X4 USB X2full HD 100Hz HDMI X4 USB X2

or weekly from $1697^

Sony60” Full High Definition SMART LEDModel: KDL60W600B 134767 79

$$11999999

Playstation 4

bonusbonus^̂

ultra HD 100Hz smart Wi-Fi built in

or weekly from $3305^

Sony 65” Ultra High Definition 3D SMART LEDModel: KD65X8500B 132166 187

$$44994499

ULTRAHIGH

DEFINITION

Playstation 4

bonusbonus^̂

SAVE $20

Sony Blu-Ray PlayerModel: BDPS1200 135703 4

nownow $$1109099999

21% OFF

+ +

SAVE $150

Sony 2.1 Channel Sound BarModel: HTCT370 130420 21

nownow $$549549or weekly from $531^

Sony Hi-Fi SystemModel: SHAKE77 132094 43

$$1099

Buy an HTM77, SHAKE77 or SHAKE99 between 28/10/14 and 24/12/14 and receive a bonus Coleman NXT300 barbecue in store at time of purchase. While stocks last.

SAVE $310

Philips Fidelio E5 Wireless Surround On Demand SpeakersModel: E5 132165 35

nownow $$889889or weekly from $805^

Playstation 4bonusbonus ^̂

Playstation 4with purchase of a 2014 model Sony TV 55” or over.Terms and conditions apply. See in store for details.

20

TV & audio

accepted here. Valid until 10th January 2015A C

USTOME

R3368 4

576 23

99 054

3

A CUSTOMER

3368 4576 2399 0543

A CUSTOMER

3368 4576

2399 0543

Page 21: Noel Leeming Maximise Your Prezzies Mailer

ultra HD 100Hz smart cinema 3Dultra HD 100Hz smart cinema 3D

LG 55” Curved Ultra High Definition 3D SMART LED

ULTRAHIGH

DEFINITION

55” Model: 55UC970T 133030

171

65” Model: 65UC970T 132992

171or weekly from $3546^or weekly from $2501^

$$29992999 $$42994299

LG42” Full High Definition SMART LEDModel: 42LB5820 129396

35

$$899899or weekly from $813¥

full HD 50Hz smart Wi-Fi built in

LG55” Full High Definition SMART LEDModel: 55LB5820 129400

67

$$16991699or weekly from $1456¥

full HD 50Hz smart Wi-Fi built in

LG65” Ultra High Definition Smart LEDModel: 65UB930T 133138 159

$$39993999or weekly from $3305¥

ultra HD 200Hz smart USB input

Selected stores only. Customer orders available

LGBlu-Ray & DVD Player• DivX• USB content playback• HDMI outModel: BP240 142024

3

$$99999999

LGMini 330 watts mini system• Mini 330 watts • DJ Turntable• AM/FM tunerModel: OM5540 132092

13

26%OFF

++

nownow$$329329SAVE $120

or weekly from $354¥

LG3D Blu-Ray Player Home Theatre SystemModel: BH7540TW 174793

29

$$749749or weekly from $692¥

Philips Sound Bar Bluetooth Detachable Wireless Rear SpeakersModel: HTL9100 174776

35

nownow$$879879

SAVE $220or weekly from $797¥

*See in store for details

Purchase selected LG 4K Ultra HD

& OLED TVs and receive a

LG Google Nexus 5 Smartphone

*Via Redemption

bonusbonus^̂

Page 22: Noel Leeming Maximise Your Prezzies Mailer

full HD dual tunersSatellite & Terrestrial 50Hz smartfull HD dual tunersSatellite & Terrestrial 50Hz smart

Samsung32” Full High Definition SMART LEDModel: UA32H5500 129672

25

$$649649or weekly from $6 12^

Panasonic Full High Definition 3D SMART LED

HD 100Hz smart 3DHD 100Hz smart 3D

42” Model: TH-42AS700Z 129910

39 Store stock only or weekly from $891^

$$99799750” Model: TH-50AS700Z

129917 57 or weekly from $1255^

$$1449144955” Model: TH-55AS700Z

129918 71 or weekly from $1536^

$$1799179960” Model: TH-60AS700Z

129919 93 Store stock only or weekly from $1974^

$$23442344

full HD dual tunersSatellite & Terrestrial 100Hz smartfull HD dual tunersSatellite & Terrestrial 100Hz smart

or weekly from $1858^

Samsung55” Full High Definition 3D SMART LEDModel: UA55H6400 129681

87

$$22119999

or weekly from $314^

DishTVMyFreeview High Definition RecorderModel: T1050 112614

11

Works with terrestrial antenna

$$279279

or weekly from $371^

DishTVMyFreeview Satellite RecorderModel: S7090PVR 111505

13

Works with satellite dish

$$349349

or weekly from $5716^

Samsung 65” Curved Ultra High Definition 3D SMART LEDModel: UA65HU9000WXRD 129585 279

$$69996999

ultra HD curved edge LED 100Hz micro dimming

Ultimate

ULTRAHIGH

DEFINITION

Bo-nusBB oonnuuss^̂

Samsung Galaxy S5

4444444MMMM

33SS

555555MMMMM

1111111111

555555M

11

666666MMM

1

SSS

‘Tis the season to be jolly and this Christmas Panasonic is giving 50 lucky shoppers the chanceto win a 50” TH-50A400Z TV. Conditions apply. See in store for details.

WIN THIS

Panasonic BLUE XMAS

PanasonicBLUE XMAS

pan

asonic.co.nz/promotions. Terms & Condition

s ap

ply

.

Starter Table Top TV Service from $149*Television delivery, installation and configuration• Assemble your equipment

• Install and connect to existing power and antenna sockets

• Configure your television with functionality test and auto-tune

• Full overview and basic training on the features, functionality including: wireless, Internet

options apps, software available, updates , and media

• Connect up to three existing devices, e.g. Sky, FreeView, Blu-Ray, basic home theatre

connection

Our Tech Solutions mobile technicians make setting up your new TV & Home Theatre hassle free. They can deliver, install and show you how to get the most out of your new technology.

get the most out of your technology with our installation, delivery and setup service

Visit us in store or call us on 0800 555 989. See https://www.noelleeming.co.nz/techsolutions for details on other packages.

FROM $149 up to 1.5 Hour Service* Additional services are available by quotation upon request.

Any additional work required after 1.5 hours may be subject to additional charges.

22

Buy prezzies with your

Page 23: Noel Leeming Maximise Your Prezzies Mailer

or weekly from $306^

Logitech UE Boom• Full, Balanced Sound - Dual

performance drivers pump out clear mids and vibrant highs.

• Deep Bass - Dual passive radiators bring deep low frequencies.

Model: UEBOOMALLBLACKS 172877 / 132825 / 172888 / 132829 / 136917 / 172843 / 136915 / 172844

10 Colour options may vary by store

eacheach$$269269

Sony Mini Muteki System• 500W RMS of power • Wireless music playback

via Bluetooth and one-touch listening via NFC

Model: GTKX1BT 172865 17

$$449449or weekly from $451¥

SAVE $100

Wharfedale Wireless Speaker System• Indoor/outdoor, by the BBQ

or the pool • BluetoothModel: TANDEM 134230

11

nownow $$299299or weekly from $330^

or weekly from $395^

Panasonic Micro System• 120 Watt• Pure brillant sound 3 way speaker systemModel: SC-PMX5DBGNS 116666 15

$$379379

iPhone not included

SAVE $30

Sony Iphone/IPOD dock• Compatible with iPhone 5• FM/AM Digital Tuner • Mega Bass / Mega

Xpand Sound System (3.5W + 3.5W)Model: ICFDS15IPNB 172789

5

nownow $$1129299999

18% OFF

+ +

SAVE $70

Blaupunkt High PowerPortable System - Bluetooth• High power portable audio system• Rechargable battery operated or AC powerModel: BPE1008BT 172852 13

nownow $$329329or weekly from $354^

SAVE $30

SonyAlarm Clock with Time Projection• Time Projection• Station Pre-sets

(direct pre-set buttons)Model: ICFC1PJ 132030

3

nownow $$89899999

MarleyGet TogetherBluetooth Speaker• Bluetooth A2DP stereo system• 5 Hour Lithium-ion battery built inModel: EM-JA006-MI 172873 9

$$249249

or weekly from $411^

BravenPortable Rugged Bluetooth Speaker• 20 hours music playback • BluetoothModel: B855BG 133455 15

$$399399or weekly from $330^

BravenPortable Bluetooth Speaker• IPX7 waterproof exterior• Shockproof rubber exteriorModel: BRVXBBB 133453 11

$$299299

BravenBRV-1 Bluetooth Speaker - Black/Cyan• IPX7 waterproof • 12 hour music playbackModel: BRV1BCB 133816 6

$$1169699999

Page 24: Noel Leeming Maximise Your Prezzies Mailer

George Foreman Infinity Chopper• Unique chopping and

blending blades• Two 1.2 litre stackable

bowls • 350 watt motorModel: 21510AU 133115

2 Props not included

$699999

GeorBraun 3 in 1 Mixer, Processor and Blender• 950 watt output power• Variable speed control with

auto pulse• Stainless steel mixing bowlModel: KM3050WH 131198

27

SAVE $100nownow $$699699

or weekly from $652^6 ^

$2649**Offer ends 24th December 2014.

See in-store for details

WITH $250 CASHBACK VIA REDEMPTION**

or weekly from $2420^

DelonghiPrimadonna Fully Automatic Machine• Patented auto cappuccino system: personalising

and memorising your coff ee has never been easier• Dedicated chocolate jug and thermal milk jug• Colour displayModel: ESAM6900 117645 115 Props not included Selected stores only. Customer orders available

$$28992899

Bo-nusbonubonuss^̂

Coffee Grinds

Bin WORTH

$70

Breville Cafe Venezia Espresso Machine• Italian made 15 bar pump • Thermocoil heating

system • Advanced dual wall crema systemModel: BES250BSS 102801 7

$$1199999999

99257

1

2

NespressoInissiaModel: EN80BAE 128272 / 128214

10

2

3

3

Nespresso U MilkModel: BEC300MW 122978/123924

13

Nespresso Lattissima ProModel: EN750MB 128279

35

Colour options may vary by store

$$899899or weekly from $813¥

$$349349or weekly from $371¥

Props not included

$$269269or weekly from $306¥

$799**Offer ends 11th January 2015.

See in-store for details

WITH $100 CASHBACK

VIA REDEMPTION**

$194**Offer ends 11th January 2015.

See in-store for details

WITH $75 CASHBACK

VIA REDEMPTION**

$274**Offer ends 11th January 2015.

See in-store for details

WITH $75 CASHBACK VIA REDEMPTION**

Nespresso

Cashback

Off erOff er$75 – $100 cashback

on Nespresso75 – $1 ssoon Nespres

Via redemption. See in store

for terms & conditions. Off er

ends 11th January 2015

1

SAVE $80

KenwoodPatissier Mixer Teal• 600 watts • All metal body for long term

durability • 4 litre brushed stainless steel bowl with large handle

Model: MX323 124196 15 Also available in red

nownow $$379379or weekly from $395^

or weekly from $330^

BrevilleScraper Mixer Cherry• Scraper beater• Planetary mixing actionModel: BEM410CHE 111466 11

$$299299Bo-

nusBBoonnuuss^̂

Second Bowl

WORTH $79.99

124741

iinncclluuddee ss^̂

1 x 1.5L glass jug&& 1 x 600ml

personalpersonal bottle

George ForemanMix & Go Pro• 800 watts• Advanced fusion

blade technology• 3 speed settings

plus pulseModel: 21820AU 133116

3 Props not included

$$99999999

24

Small appliances

Need a gift and a card? Donegift gift card card

Page 25: Noel Leeming Maximise Your Prezzies Mailer

Icona Vintage

4 Slice ToasterModel: CTVO4003BK 184798 / 184797

5 Colour options may vary by store

$$1491499999 eacheach

$$1129299999 eacheachKettleModel: KBOV2001BK 154884 / 154883

5 Colour options may vary by store

or weekly from $330^

PhilipsAirFryer• Rapid air technology for healthier frying and less smell• Great tasting fries with up to 80% less fat• With Airfryer you can fry, grill, roast and even bake

Model: HD9220/20 124973 11 Also available in lavender white in selected stores only.

$$299299Bo-nusBBoonnuuss^̂

Baking Tray

WORTH $4999

Props not included

While stocks last132034

Props not included

KambrookFlutter Butter Popcorn Maker• 1200 watt for fast, hot air

popping action• Transparent cover with

popping chute• Non slip feetModel: KPC10 106048

1

$$39399999

Yonanas Healthy Dessert Maker• Makes healthy dessert from 100% fruit • Perfect

for those with food allergies or intolerancesModel: SILVER/BLACK 123429 3 Props not included

Fat free, dairy free & guilt free

$$79799999

SAVE $80

BrevilleBanquet Pan• Large 38cm frypan with glass lid • Extra deep

non stick 78mm pan • Variable temperature control with 10 settings from simmer to sear

Model: BEF200GRY 49769

3 Props not included

nownow $$79799999

50% OFF

+ +

George ForemanRemovable Plate Grilling Machine• Removable plates• George tough pro non stick coatingModel: GRP1080AU 133128 3 Props not included

$$99999999

newrelease

BB oonnuuss^̂

Heston Blumenthal Cookbook

WORTH $85 SAVE $200

Breville Benchtop Oven• Bakes, roasts, grills, toasts and reheats with ease• Auto eject rack - for easy removal of hot dishes• 9 LCD pre-set functionsModel: BOV800BSS 102013 11

nownow $$299299or weekly from $330^

40%OFF

++

134253

$179**Offer ends 4th January 2015.

See in-store for details

WITH $100 CASHBACK VIA REDEMPTION**

or weekly from $314^

$$279279

Brother Mechanical Sewing Machine• Easy to load top loading bobbin• Free arm convertible sewing surfaceModel: GS2510 155471

11

Page 26: Noel Leeming Maximise Your Prezzies Mailer

or weekly from $330^

ElectroluxLithium 18V Ergorapido Limited Edition• Lithium ion technology and longer run time• Convenient 2 in 1 cleaningModel: APOPI1 132102

11

$$299299

OPI Nail Polish WORTH

$2999

IncludeIncludess^̂

DysonAnimal Pro Ball Barrel Vacuum• The only vacuum with no maintenance of filters,

no bags to buy, & no loss of suction • Powerful complete clean around the homeModel: DC54 ANIMAL PRO 128307

37

SAVE $150

nownow $$949949or weekly from $853^

S 508 ^

SAVE $30

Electrolux Lithium 14.4V Rapido Tungsten Metallic• Lithium ion technology • Soft, felt covered

non-scratch wheelsModel: ZB6114 130674 4

nownow $$111199999920%

OFF++

SAVE $30

BissellLittle Green Portable Deep Cleaner• Deals with accidents and spills as they happen• The thorough, eff ective and convenient deep

cleaner for tasks large and smallModel: BS30K4F 103797 7

nownow $$1199999999

Bo-nus

bonusbonus ^̂

Formula WORTH

$1999

SAVE $50

NilfiskMeteor Bagless Vacuum• 2200 watt motor• HEPA 12 filtrationModel: METEOR DELUXE 111333

11

nownow $$299299or weekly from $330^

or weekly from $475^

MieleClassic Family All-Rounder• No more bending

with +/- foot switches• AirClean sealed

filtration systemModel: S8310 131318

19

$$479479SAVE $50

DysonCordless Stick Vacuum• Sucks up as much dust as a

corded vacuum cleaner• Powered by Dyson digital

motor v6Model: DC59 126537

21

nownow $$549549or weekly from $531^

DysonAllergy Ball Barrel Vacuum• The only vacuum with no maintenance of filters,

no bags to buy, & no loss of suction• Ideal for people with asthma or allergies Model: DC54 ALLERGY 128300 33

$$849849or weekly from $772^

26

Small appliances

Shop the way you want

noelleeming.co.nz0800 44 44 88 76 stores nationwideDelivered to your dooror pick up in store

Page 27: Noel Leeming Maximise Your Prezzies Mailer

BraunCruZer6 Beard & Head• Beard comb• Hair comb• Travel PouchModel: CZ6BEARD 119433

2

SAVE $30

nownow $$69699999

30%OFF

++

PhilipsRechargeable Shaver• 35 shaving minutes, 1 hour charge• Corded and cordless• Flex & float adjusts to face and

neck curvesModel: HQ6996 191055

2

SAVE $80

nownow $$59599999

57%OFF

++

$15999**Offer ends 31st December 2014.

See in-store for details

WITH $20 CASHBACK VIA REDEMPTION**

Philips Sonicare AirFloss• Simple one button use• Guidance tip for easy

placementModel: HX8111/02 118733

7

$$1179799999

RemingtonBlow Dry in a Box• Salon professional

2300 watt AC motor• Tourmaline technologyModel: AC3501AU 133117

2

• M

$$699999

newrelease

WahlLithium Ion Beard & Stubble Trimmer• Made in USA• Lithium ion batteryModel: WA9860-1312 134086

3

$99999999

newrelease

VS SassoonEvoke Ceramic Hair Straightener• Slimline professional straightener• LED controlled heat from 130C to 230CModel: VSLE288A 133788 3

$$99999999

Sassoon

SAVE $50

VS SassoonAllure Designer Gift Set• 2000W powerful salon dryer• Includes a luxury overnight bag and salon brushModel: VS012BMA 128395 1

nownow $$49499999

50%OFF

++

SAVE $100RemingtonPower Series Titanium Plus Rotary• Japanese titanium

coated blades• Pivot & flex technology• 21 low profile cutters per

headModel: PR1261AU 191077

3

nownow $$99999999

50%OFF

++

SAVE $50

RemingtonPerfect Curls 2-1• 19mm & 32mm curlers in one unit• Ceramic technologyModel: CI63E1AU 132551 1

nownow $$49499999

50%OFF

++

SAVE $25

RemingtonAero 2000• 2000 watt dryer• 6 switch combination,

3 heat & 2 speed• Cool shotModel: D3190AU 133171

nownow $$2424 9999

50%OFF

++

SAVE $40

VS SassoonMetro Expert Hair & Beard Clipper• 2 cutting guides for hair,

32 lengths (from 3 - 18 mm and from 21 - 36 mm, in 1 mm steps)

Model: VS709A 119488 1

now $$39399999

VMB•

M

nn

50%OFF

++

great deals on all shavers, groomers, hair dryers, stylers & moregreat deals on all shavers, groomers, hair dryers, stylers & more

all Braun shavers

to

Page 28: Noel Leeming Maximise Your Prezzies Mailer

Summer cooling is easy with Mitsubishi Electric Wi-Fi Controlyou can control and monitor these air conditioners from absolutely anywhere via your smartphone, tablet or online account*

AddAddAdd Wi-Fi Con-

troller for $299

or weekly from $1375^Mitsubishi ElectricClassic GE Series Heat Pump• 3.5 kW cooling / 4.0 kW heating• 19 dB(A) indoor, 48 dB(A) outdoor• NZ quietest heat pump / air conditionerModel: MSZ-GE35VAD-A1PKG 131203

63

$$11599599

Dyson Air Multiplier Tower Fan• Powerful airflow now

60% quieter • Awarded the Quiet MarkModel: 301218-01 132380 / 132379

29Selected stores only. Customer orders available in store or online

Colour options may vary by store

or weekly from $692^

$$749749 eacheachor weekly from $692^

$$749749

Powerful airflow Now up to 75% quieter

Dyson Air Multiplier Pedestal Fan• Powerful airflow now

35% quieter• Awarded the Quiet MarkModel: 301232-01 132381

29Selected stores only. Customer orders available in store or online

or weekly from $515^

$$529529 eacheach

Dyson 30cm Air Multiplier Table Fan• Powerful airflow now

75% quieter• Awarded the Quiet MarkModel: 301985-01 132378 / 132375 / 132376

21Colour options may vary by store

Stadler Form40cm Charly Floor Fan• 3 speed levels• 4 tilt positions • Made exlusively of metalModel: SF-CHARLY-FL 132278

9 Selected stores only. Customer orders available in store or online

Designed in Switzerland

$$249249

SAVE $15

Goldair40cm Pedestal Fan• 3 speed settings• Tiltable head• OscillatingModel: GCPF105 124593

1 Selected stores only. Customer orders available in store or online

Adjustable height

nownow $$3434 9999

30%OFF

++

Goldair PlatinumSlim Turbo Tower Fan• 3 fan speeds and 3 mode

settings • 90 degree oscillationModel: GCTF700 132273 7 Selected stores only. Customer orders

available in store or onine

8 hour timer & remote control

$$1199999999

Goldair10cm Personal Box Fan • 15 watt • 1 speedModel: GCPDF10B 132269 / 132270 / 132271

Colour options may vary by store

$$11999999 eacheach

Black

Indigo

Pink

Goldair Desk Fan

23cm • 2 speed settingsModel: GCDF121 124589 1

$$34349999

30cm • 3 speed settings Model: GCDF131 124590 1

$$39399999

40cm • 3 speed settings Model: GCDF141 124591 1

$$49499999

Selected stores only. Customer orders available in store or online

Model shown

AddAddAdd Wi-Fi Controller

for $299 • 2.5kW Cooling / 3.2kW Heating capacityModel: MSZ-GE25VAD-A1PKG 12465 51

or weekly from $12 15^

$$11393999####

Mitsubishi ElectricClassic GE Series Air Conditioner• Whisper Quiet operation• Wi-Fi Compatible

or weekly from $1375^

$$11595999####

• 3.5 kW cooling / 4.0 kW heatingModel: MSZ-GE35VAD-A1PKG 131203 63

*Wi-Fi Controller and installation are an additional cost. To enable Wi-Fi Air Conditioner Control requires a Mitsubishi Electric Wi-Fi Controller, compatible WPA2-AES capable router with WPS and active Internet connection. For a list of compatible Air Conditioner models and for full system requirements please see http://www.mitsubishi-electric.co.nz/wifi/

## unit price only

## unit price only

28

Cooling & whiteware

We’re the only appliance store with

Page 29: Noel Leeming Maximise Your Prezzies Mailer

PanasonicMidsize Inverter Microwave• 1100 watts • Inverter turbo defrost

Model: NN-ST641WQPQ 181801 7

SAVE $70nownow $$1179799999

28% OFF

+ +

H 310 x W 525 x D 388mm

or weekly from $572^

Simpson5.5kg Top Load Washer• 11 wash programs • 850rpm spin speed

Model: SWT5542 128508 23 H 1025 x W 575 x D 625mm

$$599599

$$749749

H 992 x W 590 x D 606mm

LG6.5kg Top Load Washer• 6 motion direct drive motor• Turbo Drum for improved washing actionModel: WT-H6506 120817

or weekly from $692^

hi ti

or weekly from $1134^

$$11299299

H 850 x W 600 x D 665mm

Electrolux8kg Front Load Washer• 12 wash programs• JetsystemModel: EWF12832 122698

51

or weekly from $813^

$$899899

H 1020-1050 x W 600 x D 600mm

Fisher & Paykel7kg WashSmart Top Load Washer• SmartDrive System adapts to suit every load• Auto water level sensingModel: WA70T60GW1 112525 35

or weekly from $1134^

$$11299299

H 850 x W 600 x D 590mm

Fisher & Paykel7.5kg WashSmart Front Load Washer• Vortex wash• Whisper quietModel: WH7560P1 124605

51

or weekly from $1199^

Westinghouse60cm Wall Oven• 80 litre gross capacity (66 litre usuable)• 8 cooking functionsModel: POR668S 112453 55

$$11379379

H 595 x W 595 x D 566mm

SAVE $400

Elba by F&P90cm Freestanding Oven• 100 litre gross capacity • 5 cooking functionsModel: OR90SCBGFX2 84987 75

nownow $$11899899or weekly from $1617^

H 900-925 x W 897 x D 600mm

Page 30: Noel Leeming Maximise Your Prezzies Mailer

Selected stores only. Customer orders available

Delonghi Dual Zone 46 Bottle Wine Cabinet• Adjustable door hinge for reversing door• Triple glazed,UV tinted tempered glass door

Model: DEWC46D 102906 47

Wine chiller

H 865 x W 595 x D 575mm

$$11119999or weekly from $1054^10 ^

or weekly from $813^

LG345 Litre Fridge Freezer• Moist balance crisper• Inverter compressor technologyModel: GN-345HWL 129791

H 1711 x W 608 x D 707mm

$$899899

SAVE $150nownow $$299299

H 865 x W 500 x D 550mm

Haier113 Litre Bar Fridge• 16 litre built-in freezer• Reversible doorModel: HBF130WH 12588

11

or weekly from $330^SAVE 150

33% OFF

+ +

SAVE $30nownow $$349349

H 840 x W 500 x D 560mm

Tuscany85 Litre Bar Freezer• Reversible door• 3 freezer binsModel: T85BF 100204

13

or weekly from $371^

23% OFF

+ +

SAVE $150nownow $$499499

H 845 x W 550 x D 570mm

Westinghouse120 Litre Bar Fridge• Spillsafe glass shelves• Full-width iceboxModel: WIM1200SC 101064

19

or weekly from $491^

$$699

H 1577 x W 555 x D 636mm

Mitsubishi Electric260 Litre Fridge Freezer• Tempered glass shelves• Sliding chilled caseModel: MR-260G-W-A 133915

27

or weekly from $652^

Mits

SAVE $200nownow $$699699

H 1595 x W 525 x D 570mm

Fisher & Paykel246 Litre Fridge Freezer• Adaptive defrost• Adjustable, easy to

clean glass shelvesModel: E240BRWW 38627

27

or weekly from $652^

$$799799

H 1545 x W 555 x D 637mm

Samsung255 Litre Fridge Freezer• Digital inverter

compressor for greater reliability

• Frost freeModel: SR255MLS 121264

31

or weekly from $732^

30

Whiteware

Fees apply. For details visit www.noelleeming.co.nz/delivery

Ask us about our delivery, installation & removal service on any whiteware purchase

Page 31: Noel Leeming Maximise Your Prezzies Mailer

Terms and conditions apply. See instore for details and visit

fisherpaykel.co.nz/neatmeat

$300 BONUS PREMIUM

MEATS WITH YOUR NEW

FRIDGEFisher & Paykel519 Litre French Door Fridge Freezer• Concealed hinge - high quality,

flat, stainless steel doors• Temperature sensorsModel: RF522ADUSX4 123558

107 Selected stores only. Customer orders available

H 1715 x W 790 x D 730mm

$$26992699or weekly from $2260^

BONUS PREMIUM MEAT

SELECTIONRRP $300*

or weekly from $893^

$$999999

H 1602 x W 640 x D 709mm

Westinghouse370 Litre Fridge Freezer• Chill stream air curtain• Telescopic freezer binsModel: WBM3700WB 40918

39

We

or weekly from $1134^

$1299299

H 1678 x W 600 x D 656mm

Mitsubishi375 Litre Multi-Drawer Fridge Freezer• Surround cooling system• Humidity drawer for fresher

fruit and vegetablesModel: MR-C375C-ST 107339

51

or weekly from $1375^

Matching freezer also available for $1499

$$11599599

H 1425 x W 635 x D 715mm

Fisher & Paykel373 Litre Vertical Fridge• Designed to match E308• Humidity control lid for fruit

and vege binModel: E373RWW 4119

63

$$11999999

H 1789 x W 912 x D 700mm

Samsung583 Litre Side-By-Side Fridge Freezer• Twin cooling system• Ez clean steelModel: SRS583NLS 125529

79

or weekly from $1697^

Selected stores only. Customer orders available

$$11999999

H 1789 x W 912 x D 700mm

Samsung583 Litre Side-By-Side Fridge Freezer• Twin cooling system• Ez clean steelModel: SRS583NLS 125529

79

or weekly from $1697^

Selected stores only. Customer orders available

or weekly from $1858^

$$22119999

H 1760 x W 894 x D 620mm

LG 567 Litre Side-By-Side Fridge Freezer• Non-plumbed ice

and water with tall dispenser

• Express freezingModel: GC-L197DPNL 125972

SAVE $235nownow $$899899

H 855 x W 1055 x D 745mm

Haier 384 Litre Chest Freezer• Easy lift counterweight lid with

recessed grip • Interior lightModel: HCF384 123081 35

or weekly from $813^

Selected stores only. Customer orders available

rr

20% OFF

+ +

Page 32: Noel Leeming Maximise Your Prezzies Mailer

Jabra Sport Pulse Wireless Earbuds• Bluetooth with NFC• Integrated heart rate monitor• Jabra SportLife app included

(Android and iOS)Model: SPORT PULSE 133591

9

Perfect for New Year’s resolutions

SAVE $70nownow $$249249Bo-

nusBonuBonuss^̂

3x Powerade

500ml MountainBlast

SonySRSX5 Bluetooth Speaker + MDRZX750BN Headphones• Speaker: Bluetooth with NFC• 20 Watts output • 2.1 channel

Model: SRSX5+MDRZX750BN 172883 11

Wireless audio super deal!

BBoonnuuss^̂

Noise Cancelling Bluetooth

Headphones WORTH

$279

or weekly from $330^

$$299299

or weekly from $371^

Tom TomRunner Cardio Sportwatch• Sports watch • Train in your optimal heart rate

zone • Track your real-time distance, time, pace and calories

Model: 1RA0.001.02 130117 / 129795 / 129726 13

$$334499 eacheach

Colour options may vary by store

Jabra Solemate Mini Bluetooth Speaker• Bluetooth with NFC • Up to 8 hours playback• 2 front facing speakersModel: 094166 133093 / 133096 4 Colour options may vary by store

SAVE $35nownow $$111144 9999 eacheach

23% OFF

++

Fitbit Flex Wireless Activity + Sleep Wristband Black• Wireless activity and sleep

wristband • Tracks steps, distance, calories burned and monitor yours sleep

• Sync your stats to your computer or smartphone

Model: FB401BK 123462

5

$$1149499999

Sony4GB Waterproof Walkman Model: NWZW273SB 129553 / 130464 / 130465 / 134192

4 Colour options may vary by store

SAVE $10nownow $$1109099999 eacheach

Tom TomNike+ Sportwatch with Sensor Red• Sport watch • Tracks your time, distance, pace

or speed and calories burned• Reminds you to run and stores your run historyModel: TOMTOMNIKEWATCHRED 122865 5

Includes Nike+ Sensor for increase accuracy

$$1129299999

Sony 4GB B Series MP3 Walkman (Black)• FM Recording • Bass Boost • Quick ChargeModel: NWZB183FB 130464 2

SAVE $6nownow $$5353 9999

perfect giftsperfect gifts for those for those on the goon the go

Energise your day with Charge – a high-performance activity wristband that displays real-time fitness stats and caller ID to help you step up your routine.

• Tracks steps, distance, calories burned, floors climbed & active minutes.

• Displays stats, time & caller ID.

• Sleep monitoring & silent alarm.

• Water resistant. $17995 www.fitbit.com

shop the way you want

76 stores nationwide

0800 44 44 88 noelleeming.co.nz

Delivered to your dooror pick up in store


Recommended