Notch Pathway Blockade in Human Glioblastoma Stem Cells ... · Notch Pathway Blockade in...

Notch Pathway Blockade in Human Glioblastoma Stem Cells Defines Heterogeneity and Sensitivity to Neuronal Lineage

Commitment

by

Erick Ka Ming Ling

A thesis submitted in conformity with the requirements for the degree of Doctor of Philosophy

Laboratory Medicine and Pathobiology University of Toronto

© Copyright by Erick KM Ling 2012

ii

Notch Pathway Blockade in Glioblastoma Stem Cells Defines

Heterogeneity and Sensitivity to Neuronal Lineage Commitment

Erick Ka Ming Ling

Doctor of Philosophy

Laboratory Medicine and Pathobiology University of Toronto

2011

Glioblastoma is the commonest form of brain neoplasm and among the

most malignant forms of cancer. The identification of a subpopulation

of self-renewing and multipotent cancer stem cells within glioblastoma

has revealed a novel cellular target for the treatment of this disease. The

role of developmental cell signaling pathways in these cell populations

remains poorly understood. Herein, we examine the role of the Notch

signaling pathway in glioblastoma stem cells. In this thesis we have

demonstrated that the canonical Notch pathway is active in glioblastoma

stem cells and functions to inhibit neuronal lineage commitment in a

subset of patient derived glioblastoma stem cells in vitro. Gamma

secretase (γ-secretase) small molecule inhibitors or dominant-negative

co-activators inhibit glioblastoma stem cell proliferation and induce

neuronal lineage commitment in a fashion that synergizes with Wingless

pathway activation via GSK-3β blockade. Our data suggest that subsets

of patient samples show a Notch gene expression profile that predicts

their abilities to undergo neuronal lineage differentiation in response to

iii

γ-secretase small molecule inhibitors. Additionally, the data suggests

that Notch may perturb the relative fractions of cells undergoing

symmetric division, in favour of asymmetric division, limiting clonal

expansion from single cells. These data may have important implications

for treating human glioblastoma, and suggest that in addition to

inhibition of proliferation, influencing lineage choice of the tumor stem

cells may be a mechanism by which these tumors may be

pharmacologically inhibited.

iv

Acknowledgments

The work required to complete the text and figures contained within this thesis is, without a

doubt, the most difficult challenge I have ever undertaken. The completion of this document and

the growth of my character would not have been possible without the influence of so many

talented and patient individuals. Thank you Peter for giving me the privledge of tackling cancer

and teaching me how to be a man of science. Thank you Ian for being critical, teaching me to

accept criticism and making me better with it. Thank you Leanne, Ryan, Lilian, Phedias, Kevin,

Caroline and Renee for being part of my fondest and most cherished moments.

Mom and Emily, I could not have finished this without your unwavering love and support. For

my Father especially, this achievement is as much yours as it is mine. You have showed me the

importance of hard work and dedication. I love you all and will always aim to make you proud.

To my loving wife Nancy who has always stood by my side. We did it! It would have been

impossible to do this without you. When any challenge seems too difficult or when any barrier

seems insurmountable, you have been with me to help me through it. I really am the luckiest

man in the world.

Finally, for all those who are afflicted by cancer: you provided me with the motivation to chip at

this complex problem. I am honored to have the privledge of working with you and look

forward to the day when the solution is found.

Thank you.

v

LIST OF ABBREVIATIONS ABCG2 - ATP-binding cassette sub-family G member 2 AML – Acute Myeloid Leukemia Ach –Acetylcholine AD – Alzheimer’s disease AMP– Adenosine Monophosphate APC – Adenomatous Polyposis Coli APH-1 – Anterior Pharynx-defective 1 APP – Amyloid Precursor Protein ATRA – All trans retinoic acid Bax - Bcl2-Associated-X-Protein BDNF–Brain Derived Neurotrophic Factor bHLH – Basic Helix Loop Helix BIO - 6-bromoindirubin-3'-oxime BMP – Bone morphogenetic protein BSA – Bovine Serum Albumin BTE- Basic Transcription Element BTSC – Brain Tumor Stem Cell C – Carboxyl terminus CBF-1- C Promoter-binding factor 1 CD – Cluster of Differentiation CDK – Cyclin Dependent Kinase CNTF – Ciliary Neurotrophic Factor CNS – Central Nervous System CSL – CBF-1/Suppresor of Hairless/Lag-1 D - dextrorotatory DAPI – 4',6-diamidino-2-phenylindole DAPT - N-f-L-alanyl-2-phenyl]glycin e-1,1-dimethylethyl ester Dll – Delta Like DMEM – Dubelcco’s Modified Eagle Medium DMSO – Dimethyl Sulfoxide DNA – Deoxyribonucleic Acid DN-MAML – Dominant negative mastermind like dNTP – Deoxyribonucleotide triphosphate DRD2 – Dopamine receptor D2 e – embryonic day ECD – Extracellular Domain EC50 – Half maximal effective concentration EDTA – Ethylene diamine tetra-acetic acid ED50 – Half maximal effective dose EGF – Epidermal Growth Factor eGFP – enhanced Green Fluorescent Protein ER – Endoplasmic Reticulum ES – Embryonic Stem Cell FACS – Fluoresence activated cell sorting FAP – Familial Adenomatous Polyposis FBS – Fetal Bovine Serum

vi

FBW7 - F-box and WD repeat domain-containing 7 FGF (bFGF) – Basic fibroblast growth factor FITC – Fluorescein Isothiocyanate GABA – γ-aminobutyric acid GBM – Glioblastoma multiforme GFAP – Glial Fibrilary Acidic Protein Gli – Glioma associated oncogene zinc-finger protein G-NS – Glioblastoma Stem Cell GRIA1 – Glutamate receptor 1 γS – γ-Secretase γSI – γ-Secretase inhibitor GSK-3β – Glycogen synthase kinase 3 beta HD – Heterodimerization Domain HDAC – Histone Deacetylase HEPES – (4-(2-hydroxyethl)-1-1piperazineethansulfonic acid) Hh - Hedgehog HRP – Horseradish peroxidase HSC – hematopoietic stem cell HTS – High throughput screening INP – Intermediate Neural Precursors Jag – Jagged KLF - Krüppel-Like Family L - Levorotatory LIF – Leukemia inhibitory factor LDA – Limiting Dilution Analysis Mash1 - Human Achaete-Scute homologue 1 Ms - mouse MAML – Mastermind like MAPK – Mitogen-activated protein kinase MB - Medulloblastoma mRNA – Messenger Ribonucleic Acid MTT - 3-(4,5-Dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide N – Amine terminus NICD – Notch intracellular domain NGS – Normal goat serum NGF- Neuronal growth factor NLS – Nuclear Localization Signal NMDA – N-methyl-D-aspartic acid NOD-SCID - Non-obese diabetic severe combined immunodeficiency NS – Neural Stem NSAID – Non-steroidal anti-inflammatory drug NSC – Neural Stem Cell NSE – Neuron Specific Enolase P - Phosphate P53 – Tumor protein 53 PBS – Phosphate buffered saline PCR – Polymerase Chain Reaction PEN2 – Presenilin enhancer 2

vii

PEST – Proline-Glutamic Acid-Serine-Threonine domain PFA - Paraformaldehyde PI – Propidium Iodide PLO – Poly-L-ornithine PTEN - phosphatase and tensin homolog RAM – RBP-jK Associated Molecule Rb - Retinoblastoma RBP-jκ – Recombination signal-binding protein for immunoglobulin kappa-J region. RNA – Ribonucleic acid RT – Reverse Transcriptase RT-PCR – Reverse transcriptase polymerase chain reaction SDS-PAGE - sodium dodecyl sulfate polyacrylamide gel electrophoresis SGZ – Subgranular zone SVZ – Subventricular zone Sox - (sex determining region Y)-box T-ALL – T-lineage acute lymphoblastic leukemia TBST – Tris-Buffered Saline Tween-20 TLE1 – Transducin-Like Enhancer of Split 1 TH – Tyrosine Hydroxylase VZ – Ventricular zone WHO – World health organization Wnt – Wingless integration-1 WT – Wild Type

viii

Table of Contents

ACKNOWLEDGMENTS................................................................................................ IV

TABLE OF CONTENTS .............................................................................................. VIII

LIST OF TABLES......................................................................................................... XII

CHAPTER 1.....................................................................................................................1

1 INTRODUCTION ...........................................................................................1

1.1 Cancer ..................................................................................................................................................1 1.1.1 Brain Cancer ..........................................................................................................................................1 1.1.2 Cancer Biology ......................................................................................................................................1

1.2 Cell Signaling.......................................................................................................................................2 1.2.1 Notch Signaling Pathway ......................................................................................................................2 1.2.2 Non-canonical signaling and crosstalk ..................................................................................................7

1.3 Stem Cells and Cancer Stem Cells .....................................................................................................9 1.3.1 Normal neural stem and progenitor cells ...............................................................................................9 1.3.2 Notch Signaling in Stem Cells.............................................................................................................10

1.4 Cancer Stem Cells .............................................................................................................................11 1.4.1 Brain Tumor Stem Cells ......................................................................................................................14 1.4.2 Notch in cancer and cancer stem cells. ................................................................................................15 1.4.3 The Function of Notch Brain Cancer and Brain Cancer Stem Cells....................................................16

1.5 Specific Aims......................................................................................................................................17

CHAPTER 2...................................................................................................................19

2 USING NOTCH PATHWAY BLOCKADE TO DEFINE HUMAN GLIOMA STEM CELL HETEROGENEITY AND SENSITIVITY TO NEURONAL LINEAGE DIFFERENTIATION.......................................................................................................19

ix

2.1 Introduction.......................................................................................................................................19 2.1.1 Glioblastoma Multiforme ....................................................................................................................19 2.1.2 Rationale..............................................................................................................................................20

2.2 Results ................................................................................................................................................20 2.2.1 Primary Patient Glioma Express Notch Receptors and Ligands..........................................................20 2.2.2 Adherent Cancer Stem Cell Cultures are Highly Homogeneous and Express Primitive Stem Cell

Markers. ..............................................................................................................................................23 2.2.3 Tumor Precursor Lines Express Notch Receptors and Ligands...........................................................26 2.2.4 Notch receptors are activated in Glioma NS lines ...............................................................................28 2.2.5 Notch Pathway antagonism decreases cell proliferation......................................................................30 2.2.6 γ-Secretase inhibitor prevents activated Notch1 nuclear localization and inhibits the propagation of

canonical Notch signal transduction....................................................................................................35 2.2.7 Glioblastoma NS lines downregulate primitive markers in the absence of Notch signals...................42 2.2.8 Notch blockade promotes neuronal lineage differentiation .................................................................47 2.2.9 Neuron like cells are negative for neurotransmitter synthesis genes ...................................................53 2.2.10 Hierarchical clustering of signaling pathway genes reveals differential expression of Notch

components between tumor lines. .......................................................................................................56 2.2.11 Treatment of glioblastoma stem cells with γ-secretase inhibitor increases tumor latency...................60 2.2.12 Gene expression between Responsive and Non-responsive NS tumor lines. ......................................64 2.2.13 Activation of the wingless signaling pathway sensitizes glioblastoma stem cells to Notch blockade

induced differentiation. .......................................................................................................................67 2.2.14 Neuronal precursors treated with γSI and BIO are less proliferative...................................................71 2.2.15 Notch antagonist and Wnt agonists synergistically reduce in-vivo engraftment and tumor growth. ...75

2.3 Discussion...........................................................................................................................................80 2.3.1 The Notch-Hes Axis as a Therapeutic Target......................................................................................80 2.3.2 Modulating Canonical and Non-Canonical Elements of the Notch pathway ......................................82 2.3.3 Functional Synergism in BTSCs..........................................................................................................84 2.3.4 Clinical Implications............................................................................................................................88

Materials and Methods .............................................................................................................................................95 2.3.5 Primary Patient Samples......................................................................................................................95 2.3.6 Tissue Culture......................................................................................................................................95 2.3.7 Vectors and Transfection.....................................................................................................................96 2.3.8 Immunocytochemistry .........................................................................................................................96 2.3.9 Semi-Quantitative and Real Time PCR ...............................................................................................97 2.3.10 Flow Cytometry...................................................................................................................................97 2.3.11 Animals................................................................................................................................................98

x

2.3.12 Microarray Data and Analysis .............................................................................................................98

CHAPTER 3...................................................................................................................99

3 SYMMETRIC VERSUS ASYMMETRIC SELF RENEWAL IN CANCER STEM CELLS. ...............................................................................................................99

3.1 Introduction.......................................................................................................................................99

3.2 Results ..............................................................................................................................................102 3.2.1 Self-renewing BTSCs persist in γSI treated cultures. ........................................................................102 3.2.2 Notch blockade restrains stem cell self-renewal and simultaneously pushes lineage commitment...106

3.3 Discussion.........................................................................................................................................113 3.3.1 Replating Assay.................................................................................................................................118 3.3.2 Limiting Dilution Analysis ................................................................................................................118 3.3.3 Differentiation Protocol .....................................................................................................................118 3.3.4 Lineage Trees ....................................................................................................................................118

CHAPTER 4.................................................................................................................119

4 NOTCH1 RECEPTOR MUTATIONS IN BRAIN TUMOR STEM CELLS ..119

4.1 Introduction.....................................................................................................................................119

4.2 Results ..............................................................................................................................................120 4.2.1 Sequence analysis of the Notch1 heterodimerization and PEST domain in CNS tumors..................120

4.3 Discussion.........................................................................................................................................122

4.4 Materials and Methods ...................................................................................................................125 4.4.1 Genomic DNA extraction ..................................................................................................................125 4.4.2 Nested Polymerase Chain Reaction...................................................................................................125 4.4.3 Sequencing.........................................................................................................................................125

CHAPTER 5 GENERAL DISCUSSION.......................................................................126

5.1. Targeting Notch in Brain Cancers.................................................................................................126 5.1.1. Cancer Stem Cells are Controversial .................................................................................................126

xi

5.1.2. Cancer Stem Cells as a Therapeutic Target .......................................................................................127 5.2. Notch and the Cancer Niche ..............................................................................................................128 5.2.1. Insight from Neurodegenerative Disease Treatment .........................................................................130 5.2.2. Therapeutic Specificity ......................................................................................................................131 5.2.3. Forcing lineage choice as a treatment for cancer ...............................................................................132 5.2.4. Glioblastoma prevention....................................................................................................................133

5.3. Origins and mechanisms of brain tumors .....................................................................................134 5.3.1. A neural stem cell as the cancer stem cell .........................................................................................134 5.3.2. Symmetrical versus asymmetrical self-renewal in neural stem cells and cancer stem cells ..............135 5.3.3. Cancer as a caricature of development ..............................................................................................136

5.4. Future Direction ..............................................................................................................................139 5.4.1. How can we target non-neurogenic glioblastoma? ............................................................................139 5.4.2. Targeting Notch in CNS tumors ........................................................................................................140

REFERENCES ............................................................................................................141

xii

List of Tables Table 2-1 ....................................................................................................................................... 24

Table 2-2 ....................................................................................................................................... 66

Table 3-1 ..................................................................................................................................... 109

Table 4-1 ..................................................................................................................................... 124

List of Figures Figure 1-1........................................................................................................................................ 5

Figure 1-2........................................................................................................................................ 6

Figure 1-3........................................................................................................................................ 8

Figure 1-4...................................................................................................................................... 13

Figure 2-1...................................................................................................................................... 22

Figure 2-2...................................................................................................................................... 25

Figure 2-3...................................................................................................................................... 27

Figure 2-4...................................................................................................................................... 29

Figure 2-5...................................................................................................................................... 32

Figure 2-6...................................................................................................................................... 33

Figure 2-7...................................................................................................................................... 34

Figure 2-8...................................................................................................................................... 37

Figure 2-9...................................................................................................................................... 38

Figure 2-10.................................................................................................................................... 39

Figure 2-11.................................................................................................................................... 40

Figure 2-12.................................................................................................................................... 41

Figure 2-13.................................................................................................................................... 44

Figure 2-14.................................................................................................................................... 45

Figure 2-15.................................................................................................................................... 46

Figure 2-16.................................................................................................................................... 49

Figure 2-17.................................................................................................................................... 50

Figure 2-18.................................................................................................................................... 51

Figure 2-19.................................................................................................................................... 52

Figure 2-20.................................................................................................................................... 55

Figure 2-21.................................................................................................................................... 62

Figure 2-22.................................................................................................................................... 63

Figure 2-23.................................................................................................................................... 69

xiii

Figure 2-24.................................................................................................................................... 70

Figure 2-25.................................................................................................................................... 73

Figure 2-26.................................................................................................................................... 74

Figure 2-27.................................................................................................................................... 77

Figure 2-28.................................................................................................................................... 78

Figure 2-29.................................................................................................................................... 79

Figure 2-30.................................................................................................................................... 87

Figure 3-1.................................................................................................................................... 101

Figure 3-2.................................................................................................................................... 104

Figure 3-3.................................................................................................................................... 104

Figure 3-4.................................................................................................................................... 105

Figure 3-5.................................................................................................................................... 110

Figure 3-6.................................................................................................................................... 111

Figure 3-7.................................................................................................................................... 112

Figure 4-1.................................................................................................................................... 121

Figure 5-1.................................................................................................................................... 138

Supplemental Figure 1 .................................................................................................................. 90





Supplemental Figure 6 ................................................................................................................ 116

Supplemental Figure 7 ................................................................................................................ 117

1

Chapter 1

1 Introduction

1.1 Cancer

1.1.1 Brain Cancer

Cancer is one of the leading causes of mortality in North America and only second to accidents

in the death of children1. In Canada, over 40% of women and 45% of men will develop some

form of cancer in their lifetime with approximately 1 in 4 Canadians succumbing to this disease2.

Among the new cases of cancer reported in Canada in 2009, 1.5% of these were brain

neoplasms. Mortality from this disease represented 2.3% of all Canadian cancer deaths and

results in a dismal death to case ratio (0.67) which is exceeded by few other cancers. Malignant

brain tumors also have the highest death to case ratio in childhood cancers (0.30). Despite initial

responses to treatment, many of these tumors recur, leaving only few long term survivors3. In

particular, glioblastoma multiforme (GBM), the most common malignant primary brain tumor in

adults, has a 2 year survival of less than 10%. As well, histologically benign brain tumors of the

glial lineage can confer a poor prognosis in cases where growth occurs in surgically inaccessible

areas. In addition, it is well known that longer term survivors of this disease, particularly

children and young adults, often suffer from the adverse side effects of aggressive chemotherapy

and radiation. Our poor understanding of the cellular and molecular mechanisms governing this

cancer is one of the limiting factors in the development of new strategies to treat this disease.

1.1.2 Cancer Biology

Cell divisions are regulated by a chorus of cellular processes. Tumor suppressors such as P53

and Rb, function to prevent tumor cell division in part by inhibiting regulators of the cell cycle

and by integrating with the molecular controls regulating programmed cell death. Conversely,

oncogenes such as EGFR, facilitate cell cycle progression, migration and survival. Lesions

(point mutations, translocations, deletions, epigenetic alterations) in these genes can lead to a

state where cells acquire one or more of the classic oncogenic properties, such as: 1. Evading

apoptosis, 2. Self-sufficiency in growth signals, 3. Insensitivity to anti-growth signals, 4.

Sustained angiogenesis, 5. Limitless replicative potential, and finally, 6. Tissue invasion and

2

metastasis4. While these individual characteristics do not necessarily confer pathological

properties, the accumulation of loss-of-function mutations in tumor supressors5 and gain-of-

function mutations in oncogenes support the development of a full blown malignant neoplasm

which possesses all of the hallmarks of cancer enumerated above. The development of effective

therapies against all forms of cancer will hinge on the understanding, and ultimately control of,

cellular processes which regulate these characteristics.

1.2 Cell Signaling Many of the cell signaling pathways critical for normal organismal and tissue development are

now recognized as contributors to neoplastic transformation. Notch, Sonic Hedgehog and

Wingless pathways amongst others, all have fundamental functions in developmental patterning

and regulation of post-developmental homeostasis. These pathways are known to be active in

many cancers, such as those occurring in the brain, gastrointestinal, and lung6. Defining the role

of these pathways in growth and propagation of cancer will likely help identify new targets for

therapeutic interventions.

1.2.1 Notch Signaling Pathway

Over the past several decades the Notch signaling pathway has emerged as one of the most

important pathways implicated in development, stem cell biology and cancer. Due to the

diversity of actions, and complexity of signaling mechanisms, the exact role for Notch in many

biological processes remains incompletely understood. The study of a Drosophila melanogaster

mutant with Notched wings led Thomas Hunt Morgan in 1916 and subsequently D. F. Poulson in

1937, to identify insufficiency at the Notch locus as a cause of the improper wing development7.

Since then, it has been revealed that Notch is a key regular in all facets of Drosophila growth,

including (but not limited to) wing, eye, oocyte and neural development. Studies in

Caenorhabditis elegans and Drosophila have shown that Notch regulates cell fate decisions

through a process termed ‘lateral specification’8. In the developing Drosophila neuroblast,

signaling between adjacent neural progenitors with stochastic differences in cell surface Notch

receptor and ligand expression represses neuronal differentiation in the Notch activated cell and

inhibits adjacent cells from adopting the same fate9. In 1991, the first human Notch gene was

identified and, in the same study, linked to human cancer10. It is now clear that Notch signals are

highly conserved across many organisms and serve a diverse set of functions including

3

developmental patterning, stem-cell maintenance and differentiation, all of which are regulated

in a complicated context-dependent specificity.

In mammals, there are four Notch receptor homologues (Notch1-4)(Figure 1-1). The precursor

of each receptor is manufactured in the endoplasmic reticulum, exported to the golgi for

posttranslational modification by fringe glycosylases11 and further processed by furin like

proteases12. Notch receptors are then exported and assembled at the cell surface into a

heterodimeric transmembrane receptor that is maintained in a stabile conformation by Ca2+

ions13,14. In the absence of ligand the receptor assumes a conformationally inactive state

whereby the cleavage site in the heterodimerization domain is protected from activation. The

signaling cascade is initiated when the mature receptor comes into physical contact with one of

five canonical ligands (Jagged1, 2, Delta-like1, 3, 4) expressed on the cell surface of an adjacent

cell. Despite the large combination of potential ligand and receptor interactions, specificity is

dictated by glycosylation of the receptor11,15. Ligand-receptors interactions are mediated through

the extracellular EGF-like motifs in Notch and initiate internalization of ligand into the ligand-

presenting cell. Ligand internalization is thought to generate physical force which assists in

deforming the tertiary structure of the receptor, displacing extracellular Ca2+ ions13,16 and

unmasking receptor cleavage sites. At this point, TNF-α-converting-enzyme (TACE) cleaves

Notch at the newly exposed S2 cleavage site within the heterodimerization domain17. At the

intracellular face of the plasma membrane, γ-secretase cleaves the intracellular domain18.

Composed of the subunits nicastrin19,20, presenilin21,22,23, presenilin enhancer 2 (PEN2) 24, and

anterior pharynx-defective 1 (APH-1)24, and regulated by modifying proteins such as

TMP2125,26, γ-secretase cleaves the Notch receptor at the S3 cleavage site. The released Notch

intracellular domain (NICD) translocates into the nucleus where it binds to the Jκ recombination

signal-binding protein (RBP-Jκ/CBF-1/CSL) and recruits co-activators such as Mastermind-Like

(MAML)27. This transcriptional activation complex disrupts RBP-jκ complexes containing co-

repressors such as N-CoR28,29. The RBP-Kκ/co-activator complexes binds to promoter elements

and regulate transcription of target genes that include basic helix loop helix transcription factors

(bHLH), primarily Hes1, Hes5, and Hes related proteins (Hey and Herp)7. The bHLH

transcription factors, in turn, form dimeric and heterodimeric complexes which have the capacity

to function as either transcriptional activators or repressors30. The resulting effect of Notch

signaling is therefore highly context dependent and varies from tissue to tissue (Figure 1.2).

4

While the Notch signaling pathway was one of the first to be identified, it has yet to be fully

defined. The Delta and Serrate ligands have been studied for decades31, however, novel Notch

ligands such as weary (Wry) are still being discovered. Drosophila weary mutations contribute to

cardiomyopathy32. Additionally, longstanding components have been found to function through

previously underappreciated mechanisms. For example, negative regulation of receptor activity

can occur via cis-inhibition of Notch by Delta in development of Drosophila photoreceptors33,34.

In the murine brain, Epidermal growth factor-like domain 7 has been identified as a secreted

factor that binds to the ligand binding domain of Notch, antagonizing receptor function in neural

stem cells35. Even the long held views of receptor activation may require rethinking with the

recent discovery that Notch1 is capable of forming homodimers36. These findings underscore

how much remains to be discovered with respect to Notch signaling and its role in development.

5

Figure 1-1

Structure of the four known mammalian Notch receptors. All Notch receptors have an N-

terminal extracellular domain, which consists of multiple EGF repeats and three cysteine rich

Lin-12 repeat (LNR) domains37. These regions are responsible for direct ligand interaction and

function to shield cleavage sites from ligand-independent activation, respectively. Ligand

binding initiates proteolytic cleavage of the receptor at the heterodimerization domains (HD).

Subsequent downstream signaling is dependent on cytoplasmic domain sequences. Nuclear

localization sequences (NLS) are required for nuclear shuttling38, whereas the ankyrin (ANK)

domains mediate protein-protein interactions with various transcriptional co-activators39,40.

Importantly, RBP-jK binding occurs at the ‘RBP-jK associated module’ (RAM)41. Ultimately,

proline-glutamic acid-serine-threonine (PEST) rich sequences in the C-terminus are responsible

for activated receptor degradation42.

6

Figure 1-2

Schematic of the canonical Notch signaling pathway. Notch receptors are activated by direct

contact of ligands presented on the plasma membrane of adjacent cells. Pathway activation is

regulated at many levels including the ligand, receptor and nucleus. Receptor modulation

includes cis-delta-like 3 interactions, Numb degradation, γ-secretase regulators and others.

Ligands are regulated by a class of proteins call neuralized, which endocytose and ubiquitinate

ligands on the ligand presenting cell. Finally, proteins such as FBW7 assist in the turnover of

activated Notch. In the absence of receptor activation, target gene expression is suppressed by

co-repressors in the cell nucleus. Ligand binding unmasks target sites for TACE proteolysis

within the extracellular domain and γ-secretase proteolysis within the transmembrane domain.

The liberated intracellular domain translocates to the nucleus where it binds RBP-jK and MAML

to induce transcription of downstream basic helix-loop-helix transcription factors and other

target genes.

7

1.2.2 Non-canonical signaling and crosstalk

As a result of the decades of study and increasing technical sophistication of biochemical assays

to detect active Notch signaling, there is a growing appreciation for the idea that signaling

pathways link together to form networks with considerable power to integrate across multiple

membrane inputs. Defining these networks is a prerequisite for the rational development of

novel anti-cancer drugs. Interestingly, there is growing evidence to demonstrate crosstalk

between Wnt and Notch pathways and their integration within a common network in

development and oncogenesis. For example, β-catenin, a fundamental player of the canonical

Wnt pathway (Figure 1-3), is capable of binding to and stabilizing the activated domain of

Notch43. Curiously, the NICD co-activator MAML1 has recently been shown as a binding

partner and transcriptional co-activator of the β-catenin mediated TCF/LEF complex44. MAML

also binds to and regulates P53 signaling45, showing that some of the fundamental players in

Notch signaling are more involved with cell homeostasis than previously thought. Conversely,

some cell cycle regulators have been discovered to extensively modulate Notch. HIF-1α, a

global regulator of oxygen homeostasis, binds to and stabilizes the Notch intracellular domain in

C2C12 myogenic cell lines, suppressing differentiation and supporting an undifferentiated

state46. Further, HIF-1α may even upregulate components of γ-secretase, leading to activation of

the receptor in hypoxic environments47. In addition, non-bHLH targets of the RBP-jK activation

complex have been identified and are important to consider in neural stem cell biology. For

example, Notch can directly regulate expression of Brain Lipid Binding Protein (BLBP)48,

ABCG249 and Nestin50 genes. Clearly, direct crosstalk between signaling pathways and many of

the non-canonical downstream targets of Notch have important implications for disease and

development.

8

Figure 1-3

Schematic summary diagram of canonical Wingless signaling. A) In the absence of

activating ligands, β-catenin is bound and phosphorylated by the destruction complex which

includes GSK-3β, APC and Axin51. B) Binding of ligands to the frizzled receptor and LRP

induces a cascade of events, which promote association of Axin with LRP, thereby disrupting the

destruction complex. Subsequently, β-catenin accumulates in the cytoplasm, translocates to the

nucleus, and binds to TCF/LEF. Binding of TCF/LEF to β-catenin dismantles the transcriptional

repressor complex, nucleates assembly of a transcriptional activation complex and induces

transcription of downstream targets.

9

1.3 Stem Cells and Cancer Stem Cells

1.3.1 Normal neural stem and progenitor cells

Seminal experiments conducted by James Till and Ernest McCulloch in 1963 identified a

population of hematopoietic cells, which were capable of self-renewal, giving rise to spleen

colonies in irradiated mice52. These experiments identified hematopoietic stem cells as the blood

borne cellular element capable of reconstituting an immune compromised host. The discovery of

a stem cell compartment in blood led to similar discoveries in the gut53, skin54, mammary gland55

and other tissues56. Despite evidence to demonstrate the existence of a proliferative population

in brains of songbird canaries57, dogma persisted that the brain lacked regenerative potential. In

1992, Reynolds and Weiss cultured a population of cells from striata of 3 to 18 month old mice.

When grown at clonal densities with the mitogens, epidermal growth factor (EGF) and fibroblast

growth factor (FGF), non-adherent spheroid colonies grew, which contained cells positive for the

intermediate filament Nestin and negative for neuronal and glial markers. Additionally these

cells were found to be capable of self-renewal, generating clonally derived spheres possessing

the same primitive properties. Furthermore, neurosphere initiating cells were capable of multi-

lineage differentiation, with single cells differentiating into neuronal-specific enolase (NSE)

positive neurons or glial fibrillary acidic protein (GFAP) positive astrocytes58. This study

demonstrated the existence of neural stem cells in the brain. Since then, our understanding of

neuroanatomy revolving around NSCs has developed significantly. Postnatal neural stem cells

are situated in at least two regions of the brain: the subventricular zone (SVZ) of the lateral

ventricles and the subgranular layer of the dentate gyrus59. In the SVZ, elegant studies by

Doetsch, et al., demonstrated that a population of GFAP positive cells termed type-B astrocytes

are uniquely capable of regenerating migratory neuroblasts and immature precursors following

chemical ablation of cells lining the lateral ventricles60. In murine models, neural stem cells

have now been demonstrated to play an active role in postnatal olfactory development61,62 and

neuroprotective functions following brain trauma63,64,65,66 thus dispelling the long held dogma

that the brain is a postmitotic organ. Indeed, populations of proliferative cells, which contribute

to neurogenesis, have been identified in the adult human brain67. These cells may function in

memory formation68 and may even compose a human equivalent of the murine rostral migratory

stream69.

10

1.3.2 Notch Signaling in Stem Cells

Notch signaling is a key regulator of embryonic and postnatal central nervous system

development. Isolation of the Notch1 or Hes5 positive cell populations from the developing

mouse forebrain enriches for cells with a greater clonogenic ability, suggesting a role in neural

stem cells70,71. Consistent with these findings, knockout of pathway elements such as Notch1

and Notch2 result in widespread CNS cell death and embryonic lethality at E10, a period of rapid

neurological expansion72. Knockout mice deficient for RBP-jK or presenilin are incapable of

forming secondary or tertiary neurospheres in culture73 and neural stem cells isolated from Hes1-

/- and Hes5-/- double knockouts have similar self renewal impairments74. Conversely, over

expression of Notch175 or Notch376 in the murine brain induces radial glial phenotypes and

astroglial cell fate specification. Over expression of Notch2 inhibits differentiation in the

cerebellum by promoting proliferation of cerebellar granule neuron precursors77, and over

expression of Hes1 and Hes5 in the telencephalon maintains neural stem cells in an

undifferentiated state74. In the postnatal murine brain, RNA in-situ hybridization analysis of

Notch receptors and ligands reveals strong expression within the subventricular zones and

subgranular layers of the dentate gyrus78, regions known to harbor neural stem cells60, suggesting

that Notch signaling, in addition to its developmental roles may be required to regulate postnatal

NSCs. Indeed, it has been demonstrated that Notch regulates self renewal of murine neural stem

cells in post-natal animals putatively through Jagged1 signaling79. Mechanisms of NSC self

renewal are being developed as it is now understood that Notch may co-operate with other

signaling pathways such as EGFR80.

While Notch signals are required to promote self renewal and expansion of neural stem cells, it

also provides instructive signals for lineage cell fate decisions in neural precursors. Expression

of Notch receptors and ligands is critical for neuronal and astrocytic patterning in the E11.5 mid-

gestational telencephalon81. Regulation of cell fates occurs partly through Hes1 and Hes5, Notch

targets known to inhibit downstream pro-neural transcription factors, leading to a block in

neuronal lineage differentiation and promotion of glial lineage specification. Ectopic expression

of activated Notch in the postnatal murine forebrain result in expansion of the radial glial

putative stem cell compartment at the expense of differentiated neurons75. Conversely, blockade

of Notch signaling with pharmacologic inhibitors of γ-secretase induces neuronal lineage

differentiation in endothelial co-culture experiments82 and human fetal slice cultures83. Notch

11

also signals through the non-canonical ligand F3/Contactin, to promote oligodendrocytes

differentiation84,85,86. Interestingly, the discovery that Hes proteins are regulated in an oscillatory

mechanism, where adjacent neural precursors express varying levels of Notch targets genes yet

retain primitive characteristics87 demonstrates that many nuances regarding Notch in neural stem

cells have yet to be defined. Paradoxically, Notch signaling has also been shown to function in

terminally differentiated cells88,89. Notch signals are critical for maintenance of post-mitotic

neurons and are responsible for neuronal maturation and dendrite formation. Clearly, the Notch

pathway is a multifaceted signaling mechanism with important functions at all levels of the stem

cell hierarchy.

1.4 Cancer Stem Cells Central to the development of novel therapies is an understanding of how a disease state is

maintained. Some of the first reports to shed light upon heterogeneity of cancer were highly

unethical experiments conducted by Southam and Brunschwig in 1961. Through the dissociation

of human tumors and re-injection of cell suspensions sub-cutaneously into the same patients,

they observed that tumor formation occurred at a low frequency90. Further studies of murine

myeloma demonstrated that the efficiency of in-vivo spleenic colony formation was very low91.

While the idea that only a unique population of cells with tumorigenic potential was

postulated92,93, the stochastic hypothesis that most or all the cells in the tumor had equivalent,

albeit low, tumorigenic potential retained prominence for almost four decades (Figure 1-4).

The concept of cancer clones existing as a functional tumor hierarchy was firmly put forward in

the studies by Lapidot and Dick in 1994, and by Bonnet and Dick in 1997. In these studies on

acute mylogenous leukemia (AML), Lin-/CD34+/CD38- cells prospectively isolated from patient

samples were observed to possess the unique capability to recapitulate the disease in-vivo upon

transplantation into NOD/SCID mouse models94. This population of leukemic cells possessed

the capacity to replenish the entire repertoire of aberrant cell types found in the original patient

cancer; demonstrating the capability for hierarchical organization94. Furthermore, this work

provided evidence to support the idea that the leukemogenic event occurs in primitive

hematopoietic stem cells. Subsequent studies in a number of solid tumors have mirrored these

results. For example, a study by Al-Hajj, et al., characterized a population of CD44+/CD24-

cells isolated from patient breast cancers that were uniquely capable of forming tumors when

12

serially passaged in NOD/SCID mice. Secondary tumors reconstituted the phenotypically mixed

population of cells found within the original patients tumor95. The demonstration that both

hematopoietic and solid cancers are driven by unique and relatively rare populations has led to

characterization of cancer stem cells in many different cancer types. Thus far, cancer stem cells

(CSCs) have now been identified in prostate96, brain97,98, colon99,100, pancreas101, mesenchyme102,

skin103,104, ovaries105, head & neck106 and lung56 malignancies.

13

Figure 1-4

Stochastic and hierarchical models of cancer growth. A) The stochastic model of cancer

growth proposes that each cell within a malignancy has a small but equal capacity to give rise to

neoplasia in-vivo. B) In contrast, the cancer stem cell hypothesis suggests that not all cells

within a tumor are capable of propagating the malignancy. In this model, only a subpopulation

of cells has the ability to self-renew and give rise to the phenotypic heterogeneity found within

the cancer

14

1.4.1 Brain Tumor Stem Cells

Pathologists have long recognized on histologic analysis of primary samples of glioblastoma that

these tumors contained cells with a primitive appearance, often mixed with more differentiated

cells. With the discovery of culture conditions that show a capacity to maintain viable

proliferating populations of stem cells from the normal brain, Singh, et al., successfully cultured

a population of cells from human tumors (medulloblastoma and glioma) that formed clonally

derived tumorspheres. These Nestin positive sphere derived cells had the ability to self-renew

and could generate Nestin negative, β-III-tubulin (BIIIT) positive neurons and Nestin negative,

GFAP positive astrocytes upon serum induced differentiation107. Furthermore, these

characteristics were only found in primary brain tumor cells expressing the cell surface antigen

CD133. CD133 was previously identified as a marker used to enrich for spherogenic

populations from the human fetal brain, as well to also identify populations of normal human

hematopoietic stem cells. Importantly, only CD133+ human glioblastoma cells were capable of

tumor initiation in vivo,. Upon orthotopic injection of as few as 102 cells into the brains of

NOD-SCID mice, the CD133+ population was capable of engrafting and forming a tumor that

recapitulated the original patient phenotype. Conversely, the CD133- population was not

capable of generating spheres in-vitro and injection of several orders of magnitude more cells in-

vivo did not result in tumor formation97. The tumors that arose recapitulate the same phenotype

as the original patient’s tumor and were capable of regenerating disease upon serial

transplantation, demonstrating cardinal features of in-vivo self-renewal capability.

The existence of a cancer stem cell population in brain cancer and others, may explain why many

malignancies are difficult to treat. Since only small numbers of cancer stem cells are required to

propagate disease, removing the bulk of the malignant cells but sparing small numbers of CSCs

may leave small populations of cells capable of regrowing the tumor, leading to clinical relapse.

Perhaps the existence of CSCs may explain why many cancers recur despite aggressive

chemotherapy treatment. Anti-mitotic drugs such as 5-fluorouracil108 inhibit rapidly dividing

cells, and thus by virtue of their mechanism of action, target the large numbers of precursors

which are rapidly dividing but limited in self-renewal, thus sparing CSCs which retain unlimited

self-renewal but which may be more relatively quiescent. In addition to this passive resistance,

CSCs may possess a more active resistance to drugs. One of the hallmarks of stem cells is

expression of ATP-binding cassette (ABC) transporters. Hematopoetic stem cells express high

15

levels of the efflux pump ABCG2, which is down regulated in more mature blood cells109.

Indeed, this property has been utilized to prospectively isolate stem cells from bone marrow110,

muscle111 and other tissues based on the ability of pump-expressing cells to efflux fluorescent

dyes. The physiological function of these transporters, also known as multidrug resistance

genes, is to transport hydrophilic and hydrophobic compounds across the cell membrane as well

as playing important roles in blood-brain and blood-testis barriers112. However, expression of

transporters in CSCs has also been theorized to be the cause of significant drug resistance as

many common drugs are actively effluxed by these pumps. Indeed, elevated pump expression

has been detected in CSCs of brain113, breast114, lung114 and mesenchymal tumors102. Another

common strategy in targeting cancer is the use of radiation to induce DNA damage and cell death

in areas of cancer growth. Remarkably, cancer stem cells may also possess DNA damage repair

mechanisms that enable them to be particularly resilient to conventional radiation treatments115.

Thus, current strategies may only target bulk cells and spare the cancer stem cells which possess

long term self-renewal ability. Understanding molecular mechanisms and cellular requirements

that regulate cancer stem cells will be of critical importance for development of effective and

specific therapies.

1.4.2 Notch in cancer and cancer stem cells.

Considering the degree of resistance to traditional therapies, there has been a strong impetus to

identify molecular mechanisms critical to growth of cancer stem cells that may confer

vulnerability when targeted by anti-cancer treatments. One pathway that has been implicated in

multiple tumors and more recently in CSCs is the Notch pathway. Aberrant Notch signaling is

associated with a number of neoplasms116. In particular, Notch has a significant role in the

pathogenesis of T-cell acute lymphoblastic leukemia by virtue of genetic rearrangements and

mutations (T-ALL). First identified in 1991 by Ellisen, et al., a translocation on chromosomes 7

and 9 caused a breakpoint in an intron of the Notch1 gene resulting in fusion of the 3’ end of

Notch1 to the TCRβ locus10. This translocation resulted in expression of a constituatively

activated intracellular domain (ICD) fragment of Notch1. The contribution of Notch1 to the

pathogenesis of T-ALL was further demonstrated in 2004 when Weng, et al., showed that over

50% of T-ALL samples harboured mutations in the heterodimerization (HD) and/or PEST

domains of Notch1117. Point mutations found in the HD domain are thought to increase

sensitivity of the receptor to activation, while PEST domain mutations increase the half-life of

16

activated Notch. Ultimately, both mutations cause ectopic activation of Notch1 during T- versus

B-cell lineage choice of hematopoietic progenitors. Under normal circumstances, Notch1

inactivation supports development of B-cells at the expense of T-cells118,119 while activation of

the receptor supports the opposite120. Most T-ALL leukemic cells are arrested at the CD4+CD8+

double-positive stage of development and committed to the αβ lineage suggesting that ectopic

Notch1 pathway activation occurs during maturation of hematopoietic precursors112. The role of

Notch in this hematopoietic neoplasm is relatively well characterized, however, while Notch1

functions as an oncogene in the blood117,10 and brain121, it serves the opposite role, as a tumor

suppressor, in some forms of skin, lung and cervical cancers122,123,124. In addition to its direct

contribution to oncogenesis, Notch activation also regulates tumor angiogenesis125,126. From the

first report of Notch in T-ALL over 19 years ago, the Notch signaling pathway is now implicated

in development of many solid and hematopoietic cancers.

1.4.3 The Function of Notch Brain Cancer and Brain Cancer Stem Cells

Active Notch signaling has been implicated across all spectrums of central nervous system

neoplasms. Benign tumors of the choroid plexus can be initiated in mouse models by over

expression of Notch3 and human tumors have been found to possess elevated levels of

Notch2127. In medulloblastoma, the aggressive pediatric cerebellar tumor, the role of Notch is

more controversial. In some mouse models, active Notch signaling is required for the

development and/or propagation of spontaneous medulloblastoma within Patched heterozygous

mice128,129,130. Yet other models of murine medulloblastoma point to a Notch independent role.

Here, RBP-jκ knockout models did not prevent the generation of aggressive tumors in

mice131,132. Despite the controversy in model systems, Notch receptor activity has been identified

in human medulloblastoma with Notch2 possessing oncogenic properties in these cerebellar

tumors133. Within gliomas, a spectrum of tumors with glial characteristics, activated Notch1 was

detected in primary patient samples of oligoastrocytomas, anaplastic astrocytoma, glioblastoma

and serum derived glioblastoma cells lines121,134. Dysregulated expression of Notch1 through

disruption of the negative microRNA regulator miRNA-146a may lead to uncontrolled

signaling135. It is postulated that many of these cancers may signal through canonical Notch

ligands. Jagged1 signaling is active downstream of the developmental regulator inhibitor of

differentiation 4 (ID4)136 and knockdown of Dll1 was effective in preventing the growth of

serum derived cell lines121, all suggesting that these canonical binding partners are activated.

17

Considering the diverse and context dependent roles of Notch in normal tissue development and

homeostasis, the precise role for this signaling pathway in the pathogenesis of glioblastoma is far

from clear.

With the identification of tumor initiating cells, efforts to identify key signaling pathways have

intensified. In medulloblastoma, Fan and colleagues reported that proliferation of a serum

derived medulloblastoma stem cell lines can be reduced with γ-secretase inhibitors137, an effect

that is rescued by ectopic expression of Notch2-ICD. Interestingly, Notch1 antagonized the

oncogenic effects of activated Notch2 in these tumors, suggesting that Notch receptors have

discrete and unique functions.

Several groups have demonstrated that in-vitro and in-vivo growth of glioblastoma derived

neurospheres can be blocked by administration of γ-secretase inhibitor (γSI) and this effect is

Notch specific138,139,140. In these studies, pharmacologic inhibitors attenuated the formation of

glioma derived neurospheres derived from established lines and low passage cultures.

Implantation of γSI impregnated beads along with glioblastoma stem cells lead to reduced tumor

formation in orthotopic models. Targeting Notch in stem cells may also be an effective

mechanism to sensitize BTSCs to current anti-neoplastic strategies. High rates of recurrence are

thought to be due, in part, to inherent radioresistance of cancer stem cells115. Blockade of Notch

signaling in glioma has been shown to reduce tumorigenicity by sensitizing cancer stem cells to

radiation therapy141,142. This preliminary body of knowledge has lead to a push to understand the

contribution of Notch to glioma stem cell self-renewal and differentiation.

Herein, we propose that cancer stem cells, which drive growth of human brain cancer, are

regulated by Notch signaling. Activation of the Notch receptor is required for self-renewal and

also functions to suppress differentiation of cancer stem cells. Notch pathway antagonism may

therefore be an effective strategy to treat brain tumors.

1.5 Specific Aims The objective of this thesis is to identify the function and significance of Notch signaling in

human brain tumor stem cells derived from glioblastoma. My objectives are summarized in the

chapters following.

18

Aim 1: Establish whether Notch components are expressed in glioblastoma. We will determine

whether pathway antagonism using genetic and pharmacologic blockade is a feasible strategy to

target the CSC. We will characterize the functional effect of Notch blockade in-vitro and in-

vivo.

Aim 2: Elucidate a cellular mechanism of Notch pathway mediated tumorigenesis.

19

Chapter 2

2 Using Notch Pathway Blockade to Define Human Glioma Stem Cell Heterogeneity and Sensitivity to Neuronal Lineage Differentiation.

2.1 Introduction

2.1.1 Glioblastoma Multiforme

Glioblastoma is the most frequent primary brain neoplasm and most malignant. Found mainly in

adults between the ages of 45-75 and localized most commonly in cerebral hemispheres, this

class of tumor accounts for 12-15% of all intracranial tumors. Histologically, this disease

presents as a poorly differentiated and highly mitotic entity. Prognosis is very poor, with mean

survival of 9.5 months for patients under 50 years of age with progressively worse prognosis for

older patients3. Treatment strategies involve surgical resection, radiation and chemotherapy.

Even with high doses of temozolomide, often described as one of the few successes in

glioblastoma treatment options, mean survival is only extended by 60 days143. Despite surgical

resection, recurrence is frequent and often in close proximity to the original tumor site144.

With considerable phenotypic heterogeneity, is it possible to use genetic profiling to identify

vulnerabilities? This approach has been useful for the treatment of some malignancies. For

instance approximately 30% of invasive ductal breast cancer exhibit over expression of ErbB2

(Her2)145, a discovery that has lead to use of humanized monoclonal antibodies against this

variant of cancer, which results in significantly increased 1-year survival in patients with this

disease146. Thus under the pretense of creating individualized therapies, there has been a great

effort to understand the genetics and susceptibility markers behind this disease. Great efforts

have been undertaken to genotype large cohorts of glioblastoma. A large screen of 91 bulk

tumor samples revealed that NF1, EGFRvIII and PI(3)K are recurring instigators in a large

proportion of tumors147. However, the identification of cancer stem cells in GBM suggests that

one must consider the role and genomic profile of these particular tumor cells to obtain a more

realistic picture of the molecular drivers of brain tumor growth.

20

Our laboratory has previously demonstrated that brain tumors are maintained by a rare

subpopulation of cancer cells, which retain stem-like properties, and we have also established

methods for their culture in vitro. Unlike the majority of cells isolated from primary tumors,

CSCs are uniquely capable of self-renewing in-vitro and in-vivo to give rise to tumors in murine

models, which recapitulate human disease97. Preliminary reports have suggested that many of

the signaling pathways which regulate normal neural stem cells, may have a similar function in

regulating the self renewal of cancer stem cells. Amongst these putative regulatory pathways,

the role of Notch signaling in CSCs remains an oft implicated player. Based on the knowledge

of the phenotypic diversity surrounding glioblastoma multiforme, we dissected the role of

signaling pathways in glioblastoma stem cells with the objective of elucidating novel targets for

chemotherapy.

2.1.2 Rationale

Developmental signaling pathways are known to play an important part in normal neural stem

cell maintenance and expansion148. Among these pathways, the Notch signaling pathway has

been shown to regulate neural stem cell self renewal73,149 as well as to regulate

gliogenesis150,151,152,76 and the morphology of mature neurons153,154. These apparently opposing

functions (or context dependency) are integrated with the finding that GFAP positive radial glial

stem cells are Notch positive155,75,83. Glioblastoma stem cells derived from patient tumors

possess self-renewal and proliferative properties similar to that of normal NSCs97,107,98.

Therefore, we will investigate whether Notch pathway mechanisms regulate similar roles in stem

and lineage characteristics of glioblastoma stem cells.

2.2 Results

2.2.1 Primary Patient Glioma Express Notch Receptors and Ligands

Studies have illustrated Notch receptor expression in bulk brain tumors121 and therefore we

initially validated Notch receptor and downstream pathway expression in our primary patient

samples. Semi-quantitative PCR of mRNA isolated from bulk primary patient tumors shows that

glioblastoma express Notch1, Notch2 and Notch3 receptors. Immunohistochemistry in paraffin

embedded primary patient tumor samples and scoring for nuclear localization show that all

21

tumors express nuclear Notch1 (15/15), 83% (26/31) express nuclear Hes1 protein and 87%

(27/31) express Hes5 protein (Figure 2-1).

22

Figure 2-1

Notch components are expressed in primary patient tissue. RNA was isolated from unsorted

primary tumor tissue. A) Patient 144 and Patient 179 express Notch1, Notch2, Notch3, Jagged1

and Hes1 by semi-quantitative RT-PCR. B,C,D) Representative immunohistochemistry from

Patient 309 illustrating nuclear localization (brown) of Notch1, Hes1 and Hes5 in paraffin

embedded bulk tumor tissues. Primary patient samples were 4% paraformaldehye fixed and

paraffin embedded. Localization of protein expression was resolved with peroxidase staining

and counterstained with hematoxylin.

23

2.2.2 Adherent Cancer Stem Cell Cultures are Highly Homogeneous and Express Primitive Stem Cell Markers.

Since we have identified Notch pathway component expression in at least a few bulk tumors, we

were then interested to study the pathway in more detail in the cell population, which drives

tumor growth. To obtain enriched populations of cancer stem cells from human glioblastoma,

we needed to turn to culture systems, particularly those that retain tumorigenic potential in vivo.

One of the potential methods to study this population is the neurosphere culture system. While

an important tool that has been used since the mid 1990’s, neurosphere culture have limitations.

Neurospheres culture conditions do not support the long term growth of tumor cells and tend to

lose replating activity after 5 passages, limiting their usefulness for many mechanistic studies. In

addition, due in part to the complex three-dimensional aspect of sphere colonies, more

differentiated cells are localized to the nutrient deficient and spatially restricted centre while

primitive stem-like cells are favored at the nutrient accessible and spatially unrestricted surface

of the colony156. Therefore spheres contain mixed cell populations and cannot be considered as

pure cancer stem cell cultures. To circumvent these technical limitations, we cultured freshly

dissociated glioblastoma samples on laminin/poly-L-ornithine coated surfaces. The cells, grown

in 2D culture, have a much higher degree of morphologic and phenotypic homogeneity, reduced

spontaneous cell death and a greater success rate forming cell lines in-vitro with long term

passage potential157. In contrast to neurosphere cultures, NS cultures contain few cells that

express markers of differentiation like β-III-Tubulin (βIIIT) and express high percentages of

primitive markers such as CD133, CD44, CD15130, Nestin and Sox2 (Table 2-1) (Figure 2-5).

GFAP is expressed at low levels, perhaps highlighting its role as both a neural stem cell marker

in addition to marking differentiated astrocytes60. The adherent culture system therefore is an

excellent tool to asses the genomic and functional differences that exist between normal neural

stem cells and glioblastoma stem cells. Indeed, while the NS system is permissive for

homogeneous stem cell cultures each line retains some unique characteristics such as cell

morphology, primitive marker expression signature and lineage marker expression upon

differentiation. Relative to human fetal neural stem cells, glioblastoma stem cells often have

abnormal nuclear morphology and exhibit varied cell morphologies ranging from bipolar

(G179NS) to flat (G144NS). Each glioblastoma NS line exhibits a unique profile in flow

cytometry reflecting diverse differences in cell size, granularity and surface marker expression

24

(Fig 2-5), (Table 2-1). Additionally, each line exhibits fundamentally unique characteristics

upon in-vitro differentiation (Supplementary Figure-1), rates of in-vivo tumorigenesis and

histologic appearance157.

Since we have a robust and versatile system to expand cancer stem cells, we can characterize

glioblastoma stem cells and identify factors that sensitize these cells to pharmacologic

intervention and other forms of treatments.

Stem Cell

Line

CD133(%) CD15(%) CD44(%)

HF240NS 98.1±1.6 13.6±4.8 94.0±10.8

G144NS 74.8±13.6 8.1±7.6 91.4±16.6

G179NS 65.4±18.4 57.0±21.9 90.8±12.8

GliNS1 94.7±2.9 82.1±22.5 n/a

Table 2-1

CD133/CD15/CD44 percentage cell populations in established NS lines. Glioma NS lines are

highly enriched for CD133 relative to neurosphere cultures. Mean expression of CD133 from

NS lines is 78.3±14.9%, a significant enrichment over 18.3±22.6% found in unmatched

neurospheres (n=3). Interestingly, other markers such as CD15 demonstrate marked variability,

underscoring the heterogeneity between tumors. n/a = not assayed.

25

Figure 2-2

Glioblastoma stem cell lines express stem cell markers and exhibit morphologic

heterogeneity. Nestin and Sox2, primitive markers commonly expressed in stem cells, are

expressed when cultured with EGF/FGF. Immunofluoresence staining of cells shows filamentous

cytoplasmic Nestin and nuclear Sox2. Quantitative FACS demonstrates the variability of CD133

and CD15 expression among cell lines. Scale bar 50μm

26

2.2.3 Tumor Precursor Lines Express Notch Receptors and Ligands

Since expression of Notch receptors and ligands in bulk tumor tissue may not be representative

of the primitive stem like population, we conducted RT-PCR to assay for receptor and ligand

mRNA expression. Expression by semi-quantitative PCR showed that both human fetal

(HF240NS, HF286NS, HF289NS) and tumor (GliNS1, G166NS, G179NS) lines express Notch1,

Notch2 and Notch3 receptors as well as the Jagged1 ligand. The downstream target Hes1 was

expressed in all lines. Interestingly, Hes5 was expressed in HF240NS, HF286NS, HF289NS,

and G179 but was detected in low abundance in GliNS1 and G166NS. We have demonstrated

that Notch components and downstream targets are expressed in glioblastoma NS lines

suggesting that the pathway is active and may have a role in regulating CSCs.

27

Figure 2-3

Semi-quantitative RT-PCR of Notch components in human fetal stem cell and glioblastoma

stem cell lines. All lines express Notch1, Notch2, Notch3, Hes1 and Jagged1. Hes5 is detected

in HF240NS, HF286NS, HF289NS and G179NS. Hes5 is expressed in low abundance in

GliNS1 and G166NS.

28

2.2.4 Notch receptors are activated in Glioma NS lines

We have shown that Notch 1-3 transcripts are expressed in human NS lines. To further delineate

the functional relevance of Notch expression in cancer stem cells, we probed receptor expression

by immunofluorescence staining of the various glioblastoma stem cell cultures. Of the four

mammalian Notch homologues, data from the literature has shown that Notch1 is critical in the

maintenance of murine NSCs. Hitoshi and colleagues demonstrated that Notch1-/- murine

forebrains were incapable of forming neurospheres and that forced expression of NICD1 was

sufficient to rescue NSC self-renewal73. Therefore, we looked for Notch1 receptor activation

and nuclear localization with immunofluorescence microscopy in HF240NS, G144NS and

G179NS lines. We first validated our antibodies with EDTA induced constitutive Notch

activation14 and also with ectopic expression of activated Notch138 (Figure 2-9) by looking for

nuclear localization of activated Notch1. Under proliferative conditions with EGF/FGF,

glioblastoma lines demonstrate a high percentage of activated Notch1 positive nuclei (Figure 2-

4). Scoring random fields of nuclei double positive for DAPI and NICD1, HF240NS was

89±7%, G144NS was 87±3% and G179NS was 91±8% positive. G144NS, which contains

multinucleated cells, demonstrated positive staining in all nuclei. NICD1 negative cells, a

minority in these stem cell cultures, were often morphologically indistinguishable from the

NICD1 positive cells and occured in low cell density and high cell density areas. Importantly, at

lower cell densities, cells would also express NICD despite appearing to lack contacts with

adjacent cells, indicating that expression was cell autonomous, at least in part, not dependent on

contact with neighbouring cells. Since immunocytochemistry is a snapshot of fixed and

permeabilized cells, these observations may suggest that NS cells are capable of cell autonomous

self Notch activation. Another possibility is that due to motility, these cells were activated by

transient contact with other cells before the fixation.

29

Figure 2-4

Nuclear localization of activated Notch1 in human fetal and glioblastoma stem cell lines.

Endogenous activated Notch1 can be detected in fixed cultures by immunofluorescence staining.

Consistent with the mechanism of Notch activation, the fluorescent signal is localized to the

nucleus. Scale bar 100μm.

30

2.2.5 Notch Pathway antagonism decreases cell proliferation.

We have shown that NS lines express mRNA of Notch components and show nuclear

localization of the activated Notch1 receptor. Since Notch has a fundamental role in murine self

renewal, we hypothesize that blockade of Notch signals will reduce glioblastoma stem cell self

renewal and cell proliferation. Utilizing a pharmacologic inhibitor of Notch, we challenged

glioblastoma stem cell lines with an effective γ-secretase inhibitor L-685,458. We previously

demonstrated that this compound is more effective than the γSI DAPT158 in reducing the sphere

forming ability of human fetal neurospheres (Supplementary Figure-2).

Culture of glioblastoma stem cell lines and a control human fetal neural stem cell line with γSI

induced dose dependent reductions in proliferation that could be monitored by the reduction of

tetrazolium (MTT) into insoluble formazan crystals by mitochondria in active cells. Averaged

together, NS lines exhibited a mean EC50 of 4.6±2.5μM which is over 9-fold lower than that of

the cell line U87 (EC50=40.6μM), a serum cultured glioma line documented to have growth

regulated independently of Notch signaling134 (Figure 2-5). Of five NS lines profiled (G144NS,

G179NS, GliNS1, G174NS, and G166NS); G174NS was the most sensitive line with an EC50 of

0.9μM. G179NS possessed the highest EC50 of 7.4μM.

Since mitochondrial metabolism may not always adequately reflect cell numbers in-vitro, we

utilized real-time microscopy to observe the effect of Notch inhibitor in real-time. Consistent

with MTT, GliNS1 treated with γSI underwent fewer cell divisions compared with control.

Using an Incucyte video microscope (Essen Bioscience), we measured the surface area of the

microscope field occupied by cells. Automated tracking software determined that glioblastoma

stem cells cultured with vehicle achieved 43% confluence in 16 days. These control cells were

highly motile and made contact with adjacent cells over the course of the observation period.

The high motility may explain the activity of Notch signaling among cells apparently lacking

ligand presenting partners. In contrast, cultures plated at an identical starting density in 6μM or

10μM γSI achieved 25% and 18% confluence respectively in the same period of time. GliNS1

treated with γSI adopted a dramatic change in cell morphology and motility. After 7 days in

culture, the cells became less motile and projected bipolar processes. After 14 days, the

morphologic changes in the cells were more dramatic, the cells aggregated into adherent

spheroid colonies and extended long filamentous processes that resembled the axons of mature

31

neurons (Figure 2-6). Thus, the presence of γ-secretase inhibitor definitively reduced cell

proliferation and induced morphologic cell changes resembling differentiation.

We have demonstrated the efficacy of pharmacologic inhibitors in modulating glioblastoma stem

cell proliferation and altering cell morphology. γ-secretase is responsible for processing several

cell surface receptor proteins. A few of the characterized targets are Notch, CD44159, ErbB4160

and Ryk161. To investigate the possibility that we were more strongly affecting other γ-secretase

dependent cell surface receptors, we used a more specific molecular targeting strategy to block

Notch signaling downstream of the γ-secretase stage of the pathway by inhibiting the RBP-jK

activation complex. Mastermind-like 1 (MAML) is a crucial co-activator in the binding

interaction between NICD and RBP-jK162,163. We used a dominant negative variant of this

protein (a generous gift from Dr. Jon Aster). As a pan-Notch inhibitor, Dominant Negative-

MAML (DN-MAML) binds activated Notch but is unable to assemble the transcriptional

activation unit with RBP-jK. GliNS1 transfected with DN-MAML-GFP and sorted for viable

GFP positive cells were cultured in NS conditions to probe the effect of DN-MAML on doubling

time and confluence. Tracking transfected cells by Incucyte over a period of 14 days showed a

proliferative impairment conferred by Notch blockade (Fig 2-7). GFP sorted vector control cells

approached 63% confluence whereas DN-MAML transfected cells reached 23% confluence in

the same 16 day observation period. Here, we have shown that pharmacologic antagonists of the

γ-secretase complex and downstream dominant-negative pathway specific inhibitors induce a

robust blockade of glioblastoma stem cell proliferation in vitro.

32

Figure 2-5

Dose response analysis of NS lines cultured for 7 days with γSI. A) Structure of L-685,458, a

potent γ-secretase inhibitor which acts as a transition state analogue in the catalytic region of the

holoenzyme. B) All cell lines demonstrate sensitivity to low doses of γSI in proliferation assays.

Average EC50 for all NS lines is 4.6±2.5μM. The EC50 for U87, a serum derived glioma line

that does not possess stem cell characteristics is 40.6μM.

33

Figure 2-6

γSI inhibits growth and alters cell morphology of GliNS1 A) GliNS1 was cultured for 18

days with 6μM γSI. Day 18 culture with 6μM γSI illustrates bipolar morphology and axon-like

processes. Scale Bar 200μm. B) Proliferation of cells is inferred from combined cell surface

area and expressed as a percentage of maximum confluence. 6μM γSI for days impairs growth

of GliNS1 by a factor of 0.58.

34

Figure 2-7

GliNS1 dominant-negative Mastermind-like1 Notch antagonism prevents cell proliferation.

Representative growth curve of DN-MAML-eGFP transiently transfected glioblastoma stem

cells that were machine sorted for GFP. DN-MAML transfected GliNS1 cells proliferate slower

compared to vector transfected eGFP sorted control. Note that the inflections in the curve at 240

and 320 hours are artifacts of growth media replenishment.

35

2.2.6 γ-Secretase inhibitor prevents activated Notch1 nuclear localization and inhibits the propagation of canonical Notch signal transduction.

Since the Notch pathway is active in glioblastoma stem cell cultures (G-NS lines) as

demonstrated by nuclear staining of activated Notch1, we blocked pathway activation by

targeting the γ-secretase complex critical for receptor activation, and demonstrated reduction in

cell proliferation and alteration in cell morphology. In proliferating conditions with EGF/FGF,

normal human fetal NS cell lines and glioblastoma NS lines exhibit punctuate nuclear

immunoflourescence staining pattern when using antibodies specific for activated Notch1. This

staining pattern may be indicative of transcriptionally active sub-nuclear bodies164.

To determine if the reduction in proliferation was due to specific effects on Notch signaling, we

conducted experiments using the inhibitors together with rescue of signaling with downstream

pathway activation. The number of cells that exhibit this activated Notch1 staining pattern was

reduced by 3-fold in HF240NS and G144NS cells cultured in the γSI L-685,458165 for 24hrs

(Figure 2-8AB) to 3 weeks (Figure 2-8CD). This reduction in numbers of positive nuclei is

restored under conditions which promote ligand independent activation, with transduction of the

cells with NICD1 (Figure 2-9). A third cell line, GliNS1, which demonstrates ubiquitous

activation of Notch1 in 95±7% of cells was reduced to 35±22% upon 12hr γSI treatment.

Transfection of NICD1 restored immunoreactivity in 100% of cell nuclei (Figure 2.9 and Figure

2.10).

Canonical Notch pathway components Hes1 and Hes5 were examined by quantitative PCR after

treatment with γSI. While all of the cell lines profiled demonstrated significant reductions in

Hes5 transcript expression after a 10 day exposure, only some of them demonstrated significant

reductions in Hes1 expression (Supplemental Figure-4). Hes1 was undetectable in G174NS, the

cell line most sensitive to γSI in proliferation assays and reduced by approximately 50% in

G166NS. However, Hes1 expression was not affected by antagonist in G179NS or HF240NS.

We examined downstream signaling more closely in GliNS1. Hes5 and Hes1 transcript

expression was robustly diminished more than 20-fold and 6-fold respectively when cultured

with a 24h exposure to γSI (Figure 2-12A). Further, the proneural downstream target of Hes

transcription factors, Ascl1 (Mash1), is increased 4.7-fold with γSI. This finding suggests that

36

the canonical Notch-Hes axis that functions to prevent neuronal differentiation is intact at least in

some glioblastoma stem cell cultures and may serve a role in maintaining a more proliferative

primitive stem cell state. Forced expression of NICD1 in GliNS1 induced a 5-fold increase in

Hes5. Surprisingly, ectopic NICD1 did not significantly increase Hes1 beyond exogenous

expression (Figure 2-12B). This data may suggest that transcription of Hes genes are regulated

independently of each other and that each gene may require a different repertoire of co-activators

that, in this context, may function as a limiting reagent for Hes1. It also suggests that Hes5 may

be the more critical Notch1 target in glioblastoma stem cell populations. Finally, Hes1 and Hes5

expression is protected by NICD1 when challenged by γSI. Hes1 and Hes5 expression is

unaffected by γSI when NICD1 is overexpressed, reinforcing observations that Hes genes are a

target of Notch downstream signaling.

We have demonstrated immunofluorescence localization of activated Notch in glioblastoma stem

cells, but immunoflorescence staining is difficult to quantify. Therefore, we also conducted

analysis by western blot. Using two different antibodies specific for the activated Notch1, we

demonstrate that signaling is abrogated in a dose dependent manner (G166NS). Consistent with

PCR analysis, Hes1 protein persisted in the presence of γSI (Figure 2-11). At the time of this

study, reliable antibodies for Hes5 are not available and therefore we are not able to quantify

Hes5 protein levels by Western.

We continued to recognize that pharmacologic antagonists can have off target effects. To

address this issue, GliNS1 was transiently transfected for DN-MAML-GFP and sorted for GFP+

cells two days post transfection. GFP positive cells had a significant 3-fold reduction in Hes1

and a 6-fold reduction in Hes5 by RT-PCR. There was a concurrent 2-fold increase in Ascl1

expression though this observation did not achieve statistical significance (Figure 2-12C).

Reduced Hes1 and Hes5 transcript expression was observed in all NS lines assayed with Hes5

being more sensitive to pathway blockade (Supplemental Figure 3).

The evidence that we have presented herein suggests that Hes signaling downstream of Notch1 is

active in glioblastoma stem cells. Furthermore, we have presented data to show that Hes5 is a

more specific indicator of Notch1 signaling in cultured glioblastoma stem cells. Hes5

demonstrates greater upregulation upon Notch1 activation and is more sensitive to Notch

blockade compared to Hes1.

37

Figure 2-8

γSI treated cells have a reduction in nuclear activated Notch1. A) G144NS cultured with γSI

for 24hrs (n=3) demonstrates B) over 4-fold reduction in nuclear localization. C) HF240NS

(n=2) cultured with 10μM γSI for 3weeks demonstrate D) over 5-fold reduction in nuclear

localization. Scale bar 50μm. *t-test, P<0.005.

*

*

38

Figure 2-9

Activated Notch1 nuclear localization can be blocked with γSI and rescued with NICD1 in

G144NS glioblastoma line. A&B) γSI robustly blocks intracellular processing and nuclear

localization of Notch1 in the tumor line G144NS after 24hrs of treatment. This is rescued with

ectopic NICD expression. Scale bar 100μm. C) Activated Notch1 is not detected despite

constitutive ligand independent activation with Ca2+ chelators. Scale bar 20μm. *t-test,

P<0.005.

* *

39

Figure 2-10

Activated Notch1 can be blocked with γSI and rescued with NICD. Immunofluorescence

staining of GliNS1 illustrates punctuate nuclear staining with vehicle treatment in 95±7% of

cells. γSI treatment reduces this pattern of staining to 35±22%. NICD1 over expression protects

NICD1 nuclear localization from pharmacologic blockade. Scale bar 100μm. *t-test, P<0.05.

*

40

Figure 2-11

Quantitative Western blot of Activated Notch1 in Glioma lines. A) Notch1 activation is

potently diminished at low concentrations of γSI in G166NS. B) Activated Notch1 protein can

be detected with two different antibodies when cultured in NS media containing EGF/FGF.

Blockade of Notch1 with 6μM γSI for 3 weeks in G166NS can be detected with Val1744

specific antibody and 8925. Despite γSI treatment, Hes1 protein persists.

A

B

41

Figure 2-12

Downstream targets of activated Notch signaling are interrupted with Notch antagonism.

Quantitative RT-PCR conducted in GliNS1 glioblastoma line. A) Transcription of target

helix-loop-helix transcription factors are downregulated upon pharmacologic blockade. B)

Blockade can be circumvented by expression of activated Notch1. C) DN-MAML

downregulates Hes1 and Hes5 targets. * t-test, P<0.05

42

2.2.7 Glioblastoma NS lines downregulate primitive markers in the absence of Notch signals.

We have demonstrated that γSI treated glioblastoma stem cell lines are less proliferative and

have reduced Hes5 expression. Of these treated lines, morphological changes with γSI Notch

blockade were most pronounced in GliNS1. Upon treatment with γSI, this line is characterized

by bipolar morphology and extension of cellular processes. We hypothesized that these cells

were no longer showing stem-like properties and were acquiring differentiated characteristics.

We examined expression of Sox2 and Nestin, markers of neural precursor cells, in four NS lines

treated with vehicle or 6μM γSI for 3 weeks (HF240NS, GliNS1, G166NS, G174NS). We

observed in all of the lines a reduction in nuclear Sox2 and cytoplasmic Nestin filaments by

immunostaining (Figure 2-13).

To demonstrate that these observations were specifically due to blockade of Notch, NICD1

stably transfected GliNS1 (GliNS1-NICD1) was treated with 6μM γSI in culture for 14 days.

GliNS1-Vector vehicle control treated cells are uniformly 99% Nestin/Sox2 double positive.

Upon γSI administration to GliNS1-Vector transduced cells, the Nestin and Sox2 double positive

cell population was abolished (0±1% double positive). Of all the vector transduced cells, 4±4%

were Nestin positive only, 18±18% of these cells were Sox2 positive only and the vast majority

(76±15%) was double negative for both stem cell markers. GliNS1-NICD1 vehicle control

treated cells showed Sox2 and Nestin colocalization in all cells (100±0%). In contrast to vector

controls, enforced NICD1 expression maintained coexpression of both Sox2 and Nestin in γSI

treated GliNS1 cells. 56±6% of cells examined were doubly positive for both primitive markers

demonstrating a rescue of a more primitive stem cell phenotype population (Figure 2-14).

Quantitative western blot of γSI cultures demonstrates that NICD1 protects Nestin expression in

GliNS1 cells. Thus, the existence of the stem like population in the GliNS1 glioblastoma cells

appears to be dependent in part on Notch1 signaling activity.

Rapid cell proliferation is often seen as a hallmark of cancer. To determine whether cell

proliferation was regulated by Notch, we examined whether NICD1 was capable of rendering

glioblastoma stem cells insensitive to the proliferative deficit caused by γSI. Proliferation of

G411NS was diminished to 53±12% of vehicle controls when treated with 7.5μM γSI for 5 days.

The same cells transfected with NICD1 were insensitive to the effects of γSI (99±11% of vehicle

43

control) (Figure 2-15). We have demonstrated that Notch blockade causes glioblastoma stem

cells to loose stem cell marker expression. In normal neural stem cells and embryonic

development, Notch signals are known to be instructive for glial differentiation at the expense of

neurons7,166,82,81. We postulated that changes in cellular morphology following γSI treatment

may be secondary to neuronal lineage differentiation in response to diminished precursor signals.

44

Figure 2-13

Nestin and Sox2 protein expression is reduced upon Notch blockade. A) GliNS1, B)

HF240NS, C)G166NS, D)G174NS lines have a robust decrease in Nestin and Sox2 protein

expression by immunocytochemistry when treated with 6μM γSI. Scale bar 100μm.

45

Figure 2-14

Nestin and Sox2 expression in GliNS1 can be rescued with NICD1. A) Representative image

of GliNS1 pcDNA or NICD transfected cultured for 18 days with 6μM γSI. Nestin and Sox2

expression is retained in GliNS1-NICD1 upon γSI treatment. Scale bar 100μm. B)

Quantification of Nestin and Sox2 by cellular localization. C) Quantitative Western blot of

GliNS1 stably transfected with NICD and treated with γSI.

46

Figure 2-15

NICD1 protects cell proliferation from γSI. MTT proliferation assay of G411NS

supplemented with 7.5μM γSI for 5 days. Proliferation of cells is protected by NICD1. Error

bars ± SEM. * p<0.05, t-test.

*

47

2.2.8 Notch blockade promotes neuronal lineage differentiation

To determine whether glioblastoma stem cells are differentiating because of Notch signaling

blockade, we studied the expression of astrocytic (GFAP) and neuronal lineage (β-III-tubulin)

markers of differentiation in a human fetal NS line and 9 glioblastoma stem cell lines after 2

weeks of treatment in 5μM γSI compared to vehicle controls. At the end of the culture period,

cells were examined for marker expression by immunofluoresence. We quantified expression of

lineage markers by sampling random fields and scoring cells as β-IIIT positive, GFAP positive

or both. Under vehicle control conditions with EGF/FGF, GFAP positive cells are detected in

9/10 stem cell lines. GFAP is protein that marks dual populations: labeling stem cells and also

identifying differentiated astrocytes. In 4/10 cell lines, β-IIIT positive cells can be detected as a

minority population in vehicle treated cultures. The G-NS line with the most numerous cells

acquiring spontaneous neural marker expression is 377NS with 26±13% of cells positive with β-

IIIT. The relatively low expression of neuronal markers in most G-NS lines demonstrates that

EGF and FGF culture conditions maintain a primitive cell phenotype. Supplementing γSI to

EGF/FGF growth conditions, the majority (7/10) of cell lines downregulated GFAP after two

weeks. 5 of 10 lines demonstrated an increase in β-III-tubulin immunoreactivity compared to

vehicle treated cells (HF240NS, G144NS, GliNS1, G377NS)(Figure 2.17). In the remaining

50%, β-IIIT expression was not affected (G166NS, G179NS, G174NS, G361NS, G362NS)

(Figure 2.16). In this group of ‘non-neurogenic’ cells, 3/5 lines downregulated GFAP suggesting

that Notch blockade has functional consequencecs on either the GFAP positive primitive cell or

impacts the astroglial cell fate choice. Very rarely were cells double positive for neuronal and

glial markers in any line. Since Notch is known to be a pro-glial and anti-neuronal stimulus

during developmental, we have demonstrated that some glioblastoma stem cells maintain a

responsiveness to Notch signals that recapitulates neural development.

Since GliNS1 is well characterized157 and demonstrates the highest induction of neuronal lineage

differentiation in response to γSI, this line was chosen for further study. To test our hypothesis

that Notch signaling regulates cell fate decisions in brain tumor stem cells, we transduced

GliNS1 glioblastoma stem cells with NICD1 (or empty vector) and grew the cells in stem cell

conditions with γSI. Consistent with previous results, vector transfected GliNS1 exposed to γSI

increased the numbers of cells showing β-III-tubulin expression by 9-fold (8.5±9.5% vs

48

73.1±7.6%) compared to vehicle treatment and GFAP expressing cells were reduced (10±7% vs

0±0%). Forced expression of NICD1 in vehicle treated GliNS1 cells induced a 5-fold increase in

numbers of GFAP positive cells (10±7% vs 56±22%). Ectopic expression of NICD1 in γSI

treated cells increased the numbers of GFAP (27±7% vs 0±0%) cells and suppressed β-IIIT

(28±13% vs 68±1%) expression compared to vector transfected γSI treated cells, demonstrating

that activated Notch is contributes to the maintenance of a primitive GFAP positive phenotype in

GliNS1 (Figure 2-18). Since transfected cells may be heterogenous with respect to copy number

and transgene expression, some cells may remain sensitive to Notch inhibition.

We then demonstrated that the neuronal lineage commitment was specific to Notch signaling

using DN-MAML. We transfected glioblastoma lines with DN-MAML-GFP and tracked cell

fate for a period of 3 weeks. G144NS and GliNS1, two lines that were observed to exhibit

neuronal differentiation with γSI, were transiently transfected. Cells that maintained DN-

MAML-GFP expression over the observation period acquired neuronal lineage markers and

never expressed GFAP. To contrast these observations, a cell line that did not acquire neuronal

markers with γSI (G166NS), was not positive for neuronal markers in DN-MAML-GFP cells

(Figure 2-19). We have demonstrated that patterns of neuronal marker expression between

different NS lines can be recapitulated with DN-MAML expression, but not all patient derived

glioblastoma stem cell cultures show this ability to generate β-III-Tubulin+ cells with Notch

signaling blockade.

Ultimately, we have demonstrated that blockade of Notch, both at the receptor cleavage and

downstream transcriptional activation is effective in reducing GFAP expression in most (7/10)

cell lines and significantly increases β-III-tubulin expression in 50% (5/10) of cell lines. Herein,

we will refer to HF240NS, GliNS1, G144NS, G377NS and G362NS as ‘neurogenic’ reflecting

the propensity to express neuronal lineage markers in response to Notch antagonism. We will

refer to G166NS, G179NS, G174NS, G361NS and G364NS as ‘non-neurogenic’ to reflect their

resistance to neuronal lineage differentiation in the absence of Notch pathway activation.

Differences between tumor responses to Notch blockade raise the question of whether we are

inducing more mature neuronal differentiation. Further, can the genetic factors which

distinguish neurogenic versus non-neurogenic properties be identified and what are the

functional implications of this observation?

49

Figure 2-16

50% of stem cell lines do not express markers of neuronal lineage differentiation with

pharmacologic Notch blockade. Cell lines were cultured for 2 weeks with 5μM γSI. Cells

were scored as GFAP+, β-IIIT+, or double positive by sampling random fields and visually

localizing marker expression. Scale bar 100μm.

50

Figure 2-17

50% of stem cell lines express markers of neuronal lineage differentiation with

pharmacologic Notch blockade. Cell lines were cultured for 2 weeks with 5μM γSI. Cells

were scored as GFAP+, β-IIIT+, or double positive by sampling random fields and visually

localizing marker expression. Scale bar 100μm.

51

Figure 2-18

NICD1 blocks glial marker expression induced by γSI Notch blockade in GliNS1. i) GliNS1

cells have low basal expression of GFAP and β-IIIT lineage markers. ii) γSI induces neuronal

lineage marker expression in vector transduced cells. iii) NICD1 expression in vehicle treated

cultures upregulates GFAP expression. iv) NICD1 transfected cells treated with γSI express both

GFAP and β-IIIT markers. Quantification by random field cell counting shows that NICD1

renders GliNS1 cells less sensitive to the neurogenic effect of γSI. Scale bar 100μm. Error bars

± SEM.

52

Figure 2-19

DN-MAML Notch blockade induces β-IIIT expression in neurogenic NS lines. GliNS1 and

G144NS neurogenic stem cell lines co-express neuronal lineage markers when transfected with

DN-MAML for 21 days. DN-MAML-GFP GliNS1 do not express glial markers. White

arrowheads are indicative of DN-MAML/β-IIIT double positive cells. G166NS non-neurogenic

line, does not co-express neuronal markers in DN-MAML positive cells. Scale bar 50μm.

53

2.2.9 Neuron like cells are negative for neurotransmitter synthesis genes

Functional neurons can be defined as cells expressing neuronal lineage markers167,

neurotransmitters & neurotransmitter receptors168 and displaying electrophysiological

properties169. We speculated that in-vitro blockade of Notch signals induces functional neuronal

lineage differentiation in neoplastic cells. Since β-III-tubulin is a primitive marker of early

differentiated neurons, we investigated whether Notch blockade can induce the expression of the

mature neurotransmitter receptors, that identify more mature neuronal subtypes, upon neuronal

differentiation170. Using GliNS1, the NS line with the greatest increase in β-III-tubulin positive

cells induced by γSI, we profiled the expression of receptors from the muscarinic, cholinergic,

dopaminergic, glutamatergic and GABA receptor subclasses. After a two week exposure to 6μM

GSI, none of the receptors we profiled were increased in their expression. On the contrary, many

of the neurotransmitter receptors (6/8) across several different classes had significantly

diminished mRNA expression (M3, CHRNA9, GARB2, Gria1, Gria4). The change in gene

expression was most pronounced in CHRNA9 and Gria1 with an undetectable and 10-fold

reduction respectively in gene expression compared to controls. For two receptors, DRD2 and

Gria2, gene expression was unchanged (Figure 2-20). It is possible that the “differentiated”

glioblastoma stem cells reflect additional neurotransmitter subclasses that we did not analyse.

We also did not exhaustively test for other markers that are associated with differentiated

neurons. Another critical point is that a full differentiation may not be possible in neoplastic

cells, which have many genetic and epigenetic alterations affecting cell behavior.

The results presented here show that neurotransmitter receptors are not expressed in γSI treated

cultures. Berninger et al, demonstrated that murine neurospheres differentiated into neurons with

growth factor withdrawal and BDNF administration acquired a default GABAergic neuron fate

in standard differentiation conditions that was reinforced with expression of Mash1171. How is it

then, that our cells do not express these markers? In our experiments, we have differentiated

cancer stem cells with γSI over the course of 7-21 days. In the experiments conducted by

Berninger and colleagues, they demonstrated that murine neural stem cells only demonstrate

functional GABAergic activity in periods between 21-28 days. Murine NS lines are able to

differentiate in 7-12 days172 versus 21-28 days required for human NS line differentiation173.

Therefore, considering that murine models often demonstrate faster growth and differentiation

54

kinetics, it may be possible that human models of neuronal differentiation may also require

longer periods of maturation.

55

Figure 2-20

GliNS1 neurogenic line downregulates neurotransmitter receptors upon Notch blockade.

A panel of neurotransmitter receptors was examined in neurogenic GliNS1 to evaluate neuronal

differentiation. Neurotransmitter receptors are predominantly downregulated when cultured with

γSI for 14days. Quantitative RT-PCR normalized to β-Actin. Error bars ± SEM. t-test,

**P<0.0001, * P<0.05.

56

2.2.10 Hierarchical clustering of signaling pathway genes reveals differential expression of Notch components between tumor lines.

We have shown 44% (4/9) of glioblastoma stem cell lines in EGF/FGF respond to Notch

blockade by upregulating β-III-tubulin protein expression and 56% (5/9) downregulate GFAP

expression without upregulating of β-III-tubulin under the same conditions. Since Notch is

known to regulate lineage choice in neural stem cells, we examined whether patterns of Notch

pathway expression in populations of glioblastoma stem cells may predict the propensity for a

particular line to undergo neuronal lineage differentiation and thus reveal clinically relevant

glioblastoma subtypes. We conducted an analysis of pathway expression data from human fetal

NS lines, glioblastoma NS lines and human adult non-neoplastic cortical resections. Compiling

a list of known stemness genes, canonical and non-canonical Notch pathway elements, we

conducted complete linkage hierarchical clustering analysis using the program Cluster174.

Dendrogram and heat-map plots (Figure 2-21) demonstrate that signaling pathway components

expressed in nine adherent precursor cultures contrast greatly with non-neoplastic adult human

cortex (Figure 2-6BC). Human cortical samples originate from resections of fully differentiated

tissues. Canonical Notch pathway components often associated with stemness (Notch1 and

Hes1) were decreased relative that of NS lines. Cortical samples expressed Notch components

associated with terminal differentiation such as Jagged2 and negative regulators of Notch

signaling such as Numb and Numblike. The expression of Jagged2 in human cerebral cortex and

not precursor cultures is consistent with murine studies showing that the expression of this ligand

is restricted to more differentiated areas of the brain78. To contrast cortical samples, normal and

glioblastoma stem cell lines have high relative expression of Notch2, Hes1 and Jagged1; genes

associated with stemness. Numb and deltex1, known negative regulators of Notch175,176,177 are

relatively under expressed in both normal and glioblastoma NS lines compared to cortical

samples. Notch4, Jagged2, MAML2-3 and HeyL were enriched in cortical samples and indeed,

these components are not known to have defined functions in normal or cancer stem cells.

Interestingly, hierarchical clustering identifies two distinct sub-groups within NS lines. The first

cluster includes all the human fetal lines (HF240NS, HF289NS and HF286NS), GliNS1, GliNS2,

and G144NS. This group includes the class of cell lines which we have previously defined as

‘neurogenic’ based upon the ability to express β-IIIT without Notch signals. The second cluster

included three glioblastoma lines and consisted of G166NS, G179NS and G174NS. This group

57

consisted of cells, which we have previously defined as non-neurogenic based on the inability to

express β-IIIT. To distinguish the genes that differentiated these two groups, inspection of the

heat-map reveals a cluster of genes that were exclusive to neurogenic lines. Notch1, Ascl1

(MASH1) and Dll3 are all highly expressed in neurogenic lines compared to cortical samples and

non-neurogenic lines. Consistent with the transcriptome analysis, Ascl1 expression by real-time

PCR was highest in GliNS1 with over 24-fold expression compared to G179NS, the NS line that

expressed the least amount of Ascl1 (Supplementary Figure-5). One Notch target gene, Hey2,

was exclusive to neurogenic tumors only and was relatively under expressed in HF240NS

despite clustering with the other neurogenic lines. Interestingly, β-IIIT (TUBB3) mRNA is

highly expressed in neurogenic lines. The relative abundance of this transcript but lack of

protein expression with EGF/FGF could indicate that neurogenic lines are primed to differentiate

in the appropriate conditions.

We have demonstrated that Notch component gene expression in-vitro can classify glioblastoma

stem cell lines into two distinct groups. Furthermore, this classification recapitulates the

functional classification based on lineage outcome upon Notch antagonism. Therefore, evidence

presented here strongly supports the hypothesis that lineage potential of glioblastoma stem cell

lines can be predicted via analysis of gene expression. Furthermore, these data raise an

important potential therapeutic question. Can we identify a subset of patient derived populations

of glioblastoma stem cells that may show the potential to differentiate in response to

manipulation of Notch signaling?

58

Non-Neurogenic

Non-Neurogenic

59

Figure 2-21

Hierarchical complete linkage clustering data of Notch pathway genes from 9 NS lines and

5 samples of non-neoplastic human cortex. A) Differences in gene expression between

neurogenic and non-neurogenic NS lines. B) Notch pathway genes, which are elevated in NS

lines relative to human cortex. C) Notch pathway genes, which are decreased in NS lines

relative to human cortex. Red and Green represent expression data higher and lower compared

to the median respectively. Black is median expression.

60

2.2.11 Treatment of glioblastoma stem cells with γ-secretase inhibitor increases tumor latency.

We demonstrated that neuronal lineage differentiation of glioblastoma stem cell lines in-vitro can

be predicted based upon Notch pathway gene expression. To determine whether these neuron-

like cells possess reduced in-vivo self renewal or engraftment, we ex-vivo treated GliNS1

glioblastoma stem cells with 10μm γSI or vehicle for a period of 17 days and orthotopically

injected treated cells into forebrains of NOD/SCID mice (Figure 2-23A). Single cell suspensions

of 100,000 live cells, inspected for viability by trypan blue exclusion, robustly formed tumors in

vehicle control treated mice at a median survival of 90 days. Mice injected with ex-vivo treated

γSI cells still developed tumors but had a significantly (P=0.029, Logrank test) improved median

survival of 115 days, demonstrating that γSI treated cells have increased tumor latency (Figure 2-

23B).

G166NS, a non-neurogenic line that does not acquire neuronal markers, was treated ex-vivo to

determine whether these cell lines are responsive in-vivo in the same manner as the neurogenic

lines. After the ex-vivo treatment and in-vivo orthotopic injection, G166NS vehicle treated

injected mice had a median survival of 172 days, consistent with differential survival from

different patient derived glioblastoma stem cell lines. Mice that were injected with γSI treated

cells had a median survival of 215 days. These survival curves are not statistically significant

(P=0.34, Logrank Test) (Figure 2.25). Taken together these results indicate that neurogenic lines

treated with Notch inhibitors have reduced tumorigenicity or engraftment in-vivo whereas non-

neurogenic lines are not significantly affected, although the numbers in these experiments were

small.

To elucidate the molecular and cellular differences in the tumors that arise in vehicle and γSI

treated cells, we fixed and paraffin embedded the xenografted brain samples for analysis by

immunohistochemistry. Gross examination of the NOD/SCID brains after sacrifice did not

reveal significant phenotypic differences between vehicle and γSI treated tumors. Large frank

tumors of approximately equal size in both cohorts were found intracranially, possessed invasive

properties, and local areas of necrosis consistent with human glioblastoma. In-vivo BrdU labeling

of GliNS1 showed proliferative cells throughout the tumor with no apparent differences between

vehicle and ex-vivo γSI treated cells. Tumors arising from treated and untreated NS lines

61

harbored foci of GFAP and Nestin positive cells. Some regions within the tumor arising from

γSI treated cells expressed β-IIIT, suggesting that a prior Notch blockade can specify lineage

commitment in the developing tumor. As not all the cells in the ex-vivo treated culture

differentiate into β-IIIT positive cells, we suspect that tumors may arise from the non

differentiated glioblastoma cells in the treated culture, or alternatively, that the differentiation is

lost without continued Notch blockade in-vivo. The formation of tumors demonstrates that cells

treated with Notch inhibitors maintain in-vivo self renewal and therefore ex-vivo Notch blockade

alone is insufficient to completely suppress tumorigenicity.

62

Figure 2-21

GliNS1 ex-vivo treated with γSI and transplanted orthotopically. A) Cells were treated ex-

vivo for two weeks and transplanted orthotopically utilizing a sterotactic apparatus. B) Tumor

free survival of mice injected with 100,000 γSI treated cells was longer than mice injected with

100,000 Vehicle treated cells. Mean survival 115 days versus 90 days, p<0.026, Logrank Test.

C) Both vehicle and γSI treated cells are proliferative by BrdU incorporation and express glial

markers throughout the tumor. Tumors arising from γSI treated cells possess tracts of βIIIT

positive cells indicating lineage specification in the absence of continuous Notch blockade.

63

Figure 2-22

G166NS ex-vivo treated with γSI and transplanted orthotopically form tumors in-vivo.

Median survival of vehicle control is 172 days versus 215 days for γSI treated. Logrank Test,

P>0.05.

64

2.2.12 Gene expression between Responsive and Non-responsive NS tumor lines.

We have demonstrated that gene expression of Notch pathway and downstream components in

glioblastoma stem cells correlates with sensitivity to γSI induced neuronal differentiation. Since

there may be genes outside of the Notch pathway that confer γSI sensitive properties in

neurogenic lines, we compared gene expression of neurogenic versus non-neurogenic lines to

evaluate which genes, Notch inclusive, may contribute to neuronal lineage commitment in

glioblastoma. We conducted an unbiased principle component analysis of global gene expression

between the neurogenic group (GliNS1, HF240NS and G144NS) and non-neurogenic group

(G166NS, G179NS and G174NS). Using the data analysis program Partek, we identified genes

that were differentially expressed between the two groups. The analysis returned 1255 probe-

sets representing 879 unique genes with significant (p<0.05) differences between the two groups.

Amongst the most significant hits (Table 2-2), several are relevant to neuronal lineage

commitment and survival. Some are genes relating to mature neuronal phenotypes such as

NMDA receptor regulated-1 like (NARG1L). Expression of Glutamate Receptors (Grik4, Gria3,

Gria4) and γ-Aminobutyric Acid A-receptor α-5 (GABRA5), may explain why some lines are

predisposed to neuronal differentiation as expression of neurotransmitter receptors may prime

cells for neuronal differentiation. Ascl1, a gene studied in our original clustering analysis

(Figure 2-22), is highly elevated in neurogenic lines, as is β-III-tubulin and Sox4, a transcription

factor which is required for the survival of sympathetic neurons in the CNS178. Interestingly,

adenomatous polyposis coli (APC), a fundamental component of the Wnt signaling pathway is

highly expressed in neurogenic lines. This multidomain protein has a critical function in the

regulation of intracellular β-catenin and antagonizes the Wnt signaling pathway179. Our lab

(Brandon et al., unpublished data) and others180,161, 181,182 have demonstrated that activation of the

Wnt pathway is instructive for neuronal lineage differentiation in normal neural stem cells.

Therefore, global analysis of gene expression identifies neural lineage transcripts in neurogenic

lines that show a capacity to differentiate in response to Notch signaling blockade, but may

suggest other potential differentiation strategies.

65

Gene TitleGene

Symbolp-value(GSI Response)

F(GSI Response

)Transcribed locus --- 1.83E-09 574.575RNA binding motif protein 47 RBM47 9.28E-09 398.066periplakin PPL 3.47E-08 294.867secreted protein, acidic, cysteine-rich (osteonectin) SPARC 3.56E-08 293.088asparagine-linked glycosylation 2 homolog (S. cerevisiae, alpha-1,3-mannosyltran ALG2 6.88E-08 252.083sterile alpha motif domain containing 9-like SAMD9L 8.65E-08 239.17cytochrome b-561 CYB561 9.34E-08 234.997sterile alpha motif domain containing 9-like SAMD9L 1.05E-07 228.714cytochrome b-561 CYB561 1.17E-07 223.117M-phase phosphoprotein 8 MPHOSPH 1.61E-07 207.161NMDA receptor regulated 1-like NARG1L 2.96E-07 180.051NMDA receptor regulated 1-like NARG1L 7.97E-07 142.853glutamate-cysteine ligase, modifier subunit GCLM 3.63E-07 171.674glutamate-cysteine ligase, modifier subunit GCLM 7.21E-07 146.244SRY (sex determining region Y)-box 4 SOX4 7.66E-07 144.164tripartite motif-containing 38 TRIM38 8.89E-07 139.206SRY (sex determining region Y)-box 4 SOX4 6.79E-06 85.6508SRY (sex determining region Y)-box 4 SOX4 1.14E-05 75.5225SRY (sex determining region Y)-box 4 SOX4 1.71E-05 68.2453achaete-scute complex homolog 1 (Drosophila) ASCL1 3.09E-05 58.8635SRY (sex determining region Y)-box 4 SOX4 6.25E-05 49.1503achaete-scute complex homolog 1 (Drosophila) ASCL1 1.14E-04 42.0053bone morphogenetic protein 7 (osteogenic protein 1) BMP7 3.48E-04 31.0058vascular endothelial growth factor A VEGFA 3.50E-04 30.9578vascular endothelial growth factor A VEGFA 5.67E-04 26.9947adenomatous polyposis coli APC 1.39E-03 20.6991glutamate receptor, ionotrophic, AMPA 4 GRIA4 1.83E-03 18.9726neural cell adhesion molecule 1 NCAM1 1.96E-03 18.5867hairy/enhancer-of-split related with YRPW motif 2 HEY2 2.19E-03 17.9276NDRG family member 2 NDRG2 2.38E-03 17.4549NDRG family member 2 NDRG2 2.39E-03 17.4373glutamate receptor, ionotrophic, AMPA 4 GRIA4 3.68E-03 15.1217Notch homolog 1, translocation-associated (Drosophila) NOTCH1 4.20E-03 14.4563SRY (sex determining region Y)-box 4 SOX4 4.56E-03 14.0572CD44 molecule (Indian blood group) CD44 5.04E-03 13.577tubulin, beta 3 TUBB3 5.97E-03 12.7863adenomatous polyposis coli APC 6.13E-03 12.6638homeobox D10 HOXD10 6.22E-03 12.6011tubulin, beta 3 TUBB3 6.32E-03 12.5253adenomatous polyposis coli APC 6.61E-03 12.3268gamma-aminobutyric acid (GABA) A receptor, alpha 5 GABRA5 6.72E-03 12.2545tubulin, beta 2A TUBB2A 6.98E-03 12.0847transcription factor 3 (E2A immunoglobulin enhancer binding factors E12/E47) TCF3 8.28E-03 11.3453deltex 3 homolog (Drosophila) DTX3 8.30E-03 11.3367glutamate receptor, ionotropic, kainate 4 GRIK4 1.10E-02 10.1941glutamate receptor, ionotrophic, AMPA 3 GRIA3 1.14E-02 10.0244glutamate receptor, ionotrophic, AMPA 3 GRIA3 1.82E-02 8.28999solute carrier family 1 (glutamate/neutral amino acid transporter), member 4 SLC1A4 2.40E-02 7.34763SRY (sex determining region Y)-box 2 SOX2 2.40E-02 7.34339solute carrier family 1 (glutamate/neutral amino acid transporter), member 4 SLC1A4 2.51E-02 7.19198solute carrier family 1 (glutamate/neutral amino acid transporter), member 4 SLC1A4 3.68E-02 5.99641Notch homolog 2 (Drosophila) NOTCH2 2.20E-02 7.63262

F(γSI Response)

66

Table 2-2

List of top 53 probe sets most significantly elevated in neurogenic NS lines compared to

non-neurogenic NS lines. Principal component gene analysis between neurogenic and non-

neurogenic cell lines reveals 879 genes that are significantly upregulated in neurogenic lines.

Genes are organized in order of significance.

67

2.2.13 Activation of the wingless signaling pathway sensitizes glioblastoma stem cells to Notch blockade induced differentiation.

Notch signaling is known to regulate CNS development and neuronal differentiation in concert

with other pathways72. Some of these interactions are postulated to function in a regulatory

manner outside of a developmental context. Therefore, inhibiting Notch signaling combined

with activation of other developmental pathways in glioblastoma stem cells may induce a

synergistic response that may render CSC’s more sensitive to differentiation and inhibit self-

renewal. Notch and Wnt have collectively been implicated in the progression of intestinal

adenomas183, colon cancer184 and may crosstalk directly at several points in the signaling

pathway44,43. Existing reports have suggested LiCl inhibition of GSK3β may inhibit cancer stem

cell self-renewal in sphere assays185. Activation of the wingless pathway by administration of

exogenous Wnt ligands or pharmacologic inhibition of negative regulators (Brandon, Dirks et al,

unpublished data) has been shown to induce a neuronal lineage phenotype with upregulation of

downstream Wnt targets. Therefore, we postulated that blockade of Notch in concert with the

activation of Wnt may synergistically inhibit in-vivo growth of glioblastoma stem cells compared

to modulation of either pathway alone. We constitutively activated canonical Wnt signaling

using 6-bromoindirubin-3'-oxime (BIO)186, a potent inhibitor of GSK-3β. GSK-3β is a kinase

which phosphorylates activated β-catenin in the absence of pathway activation to facilitate

recognition by ubiquitin ligases and targeting by the proteosome51 (Figure 1-3).

Using BIO and γSI, we conducted a two-dimensional dose response analysis and assayed GliNS1

for neuronal (β-IIIT) or glial (GFAP) differentiation (Fig 2-26). After one week in culture, we

observed that γSI induced a dose dependent (0-10μM) bipolar morphology and β-IIIT expression

with a corresponding decrease of GFAP expression. Similar dose dependent (0-1μM)

observations were observed with BIO treatment. Combinations of γSI and BIO induced

significant morphologic changes and increased β-III-tubulin expression beyond levels of

individual treatments. 1μM γSI and 1μM BIO had the largest qualitative induction of neuronal

morphology and marker expression with a concurrent repression of astrocytic marker expression.

Therefore, we utilized these concentrations for further characterization of NS lines.

To examine whether synergistic treatment would promote neurogenesis in non-neurogenic lines,

we treated G166NS with a combination of γSI and BIO. The individual compounds and

68

combination treatment were effective in reducing GFAP protein expression but did not increase

expression of neuronal markers upon 1μM BIO and/or 1μM γSI treatment (Figure 2-27). This

demonstrates that despite synergistic activation of Wingless and inactivation of Notch, non-

neurogenic lines remain resistant to neuronal lineage differentiation.

69

Figure 2-23

γSI and BIO synergistically induce neuronal lineage differentiation in GliNS1. GliNS1 was cultured for 7 days with doses of γSI, BIO or a combination of the two compounds. Immunocytochemistry was conducted to visualize protein expression of neuronal and glial marker expression. Scale bar 100μm.

70

Figure 2-24

Non-neurogenic line remains neuronal marker negative with Wnt activation and Notch

blockade. G166NS cultured for one week with 1μM BIO and/or 1μM GSI downregulate

astrocytic markers but do not upregulate neuronal lineage markers. Scale bar 100μm.

71

2.2.14 Neuronal precursors treated with γSI and BIO are less proliferative.

Since neuronal lineage marker expression is prevalent in neurogenic lines treated with

combinations of γSI and BIO, we hypothesized that using dual pathway modulation to force

cancer stem cells into a growth restricted neuronal lineage may be a more viable strategy to treat

glioblastomas in patients. We therefore treated GliNS1 with 1μM γSI and/or 1μM BIO for 1-2

weeks and pulsed with BrdU 24hrs immediately prior to analysis to monitor cells progressing

through S phase. At one week, 46±21% of all cells in BIO/γSI combination treatment expressed

β-III-Tubulin. This was significantly greater than that of individual 1μM GSI (10±5%) and 1μM

BIO (22±10%) treatments alone. A low percentage of vehicle treated cells were β-III-T positive

(5±2%), reflecting the low levels of spontaneous differentiation inherent to the assay (Figure 2-

28). Continued treatment for two weeks increased neuronal marker expression, growth of

bipolar processes and a reduction of numbers of GFAP positive cells (Figure 2-29). 52±25% of

all cells expressed neuronal marker expression in combination treatment versus 1μM GSI

(7±6%), 1μM BIO (14±2%) and vehicle treatment (2±1%). The effect of the combination

treatment is greater than the sum of the individual compounds, suggesting that Notch signaling

inhibition, together with activation of Wnt signaling, synergistically promotes neuronal lineage

differentiation.

The level of BrdU incorporation in cells positive for neuronal markers is much lower than that of

marker negative cells. At one week of γSI/BIO combination treatment, 63±14% of all β-IIIT

positive cells are BrdU negative. At 2 weeks of treatment, 86±4% of β-III-Tubulin positive cells

are BrdU negative and only 7±2% of total cells were double positive. Thus neuronal precursors

expressing neuronal markers have significantly impaired ability to proliferate, which becomes

more pronounced with prolonged Notch/Wnt blockade. This supports the notion that cells with

committed neuronal character are more limited in proliferative potential.

Additionally, we examined expression of glial markers and BrdU incorporation with γSI and/or

BIO. At one week, most of the GFAP positive cells are also BrdU positive, suggesting that cells

at this stage are proliferating glial precursors. This population of cells is unaffected by 1μM γSI

or 1μM BIO but is dramatically reduced to 0±1% when treated with a combination of the two

compounds. At two weeks, individual treatments of γSI and BIO effectively reduce the small

72

percentage (5±1%) of doubly positive GFAP/BrdU cells found in vehicle treated controls to

levels similar to that of combination treatment (Figure 2-29). Thus, combining the two drugs

synergistically diminishes the time required to force neuronal lineage differentiation.

Taken together we conclude that neuronal lineage differentiation may contribute to a

proliferative disadvantage found in neurogenic cell lines. An anti-proliferative effect of

Notch/Wnt modulators is observed in neurogenic lines is likely due to a growth restriction

imposed by cell type to and not due to non-specific toxicity, the proliferative disadvantage

conferred to non-neurogenic cell lines is less well understood. While there is a possibility that

the non-neurogenic lines are restricted due to non-specific toxicity, it is more likely that Notch

antagonists inhibit the proliferation of the glioblastoma stem cells but cannot also engage them in

differentiation as they are hypothesized to have a molecular defect in differentiation.

73

Figure 2-25

Cells possessing neuronal characteristics are less proliferative. GliNS1 cultured with 1μM

γSI, 1μM BIO or both for 1 or 2 weeks and pulsed with BrdU for 24hrs prior to fixation and

immunofluorescence stain. Quantification was conducted by nuclear localization.

74

Figure 2-26

BrdU positive glial precursors are reduced by combined γSI and BIO treatment. GliNS1

glioblastoma line was cultured with 1μM γSI or 1μM BIO and pulsed with BrdU for 24hrs. A)

At one week, most GFAP positive cells are BrdU positive and are eliminated with treated with

γSI and BIO. B) GFAP positive cells are reduced after two weeks of treatment.

A

B

75

2.2.15 Notch antagonist and Wnt agonists synergistically reduce in-vivo engraftment and tumor growth.

We demonstrated that Notch and Wnt blockade synergistically induce neuronal lineage

differentiation, associated with lineage specific reduction in proliferation, therefore we tested

whether these cells have impaired engraftment or proliferation in-vivo. GliNS1 was treated ex-

vivo with vehicle, 1μM γSI, 1μM BIO or a combination of the two drugs for 1 week. We then

orthotopically injected viable cells into the brains of NOD/SCID mice. The median survival of

mice injected with vehicle treated cells in this experiment was 74 days, consistent with previous.

Treatment of cells with 1μM GSI had no difference in survival, as animal survived a median 68

days. Since we previously demonstrated an improvement in host survival when the cells were

treated with 10μm γSI, this data illustrates that a threshold concentration is required to abrogate

tumorigenicity. 1μM BIO treated GliNS cells engrafted had a median survival to 116 days. In

contrast, combination treatment with 1μM BIO and 1μM GSI synergistically and substantially

improved median survival to 182 days (P<0.05, Logrank Test), an improvement of over 2-fold

compared to vehicle treated cells (Figure 2-30A).

While GFAP marker expression is diminished, non-neurogenic lines do not acquire markers of

neuronal lineage commitment with synergistic Notch and Wnt modulation (Figure 2-27).

Nevertheless, we questioned whether synergistic treatment was sufficient to block in-vivo

engraftment and growth a representative glioblastoma cell line from this class of tumors.

G166NS vehicle treated cells injected into NOD/SCID mice had a median survival of 97 days.

1μM γSI and 1μM BIO alone treated cells had a median survival of 66.5 and 89 days

respectively. Treatment of cells with both compounds and orthotopic injection resulted in a

significant (P<0.05, Logrank Test) 1.3-fold increase in median survival to 127 days (Figure 2-

30B).

Comparison of frank tumors in H&E stained paraffin embedded sections shows large intracranial

tumors with brain invasion. Immunostaining of GliNS1-vehicle tumors showed GFAP and β-

III-Tubulin positive cells demonstrating at least some spontaneous differentiation in-situ,

potentially in response to the endogenous neurogenic and gliogenic factors that exist in the brain

milieu. Some GFAP and β-III-tubulin staining was observed in GliNS1-BIO and GliNS1-γSI

cohorts. Interestingly, and importantly, tumors arising from GliNS1-BIO-γSI combination

76

treatment possessed large areas of β-III-tubulin staining suggesting persistent neuronal

differentiation after engraftment. We hypothesize that the more synergistic differentiation may

have lead to the increased survival of the dual modified cells. In addition, G166NS was also

stained for markers of differentiation. Consistent with results observed in-vitro, tumors arising

from these cells possessed very little β-III-tubulin immunoreactivity regardless of ex-vivo Notch

or Wnt modulation. Thus, the biases in lineage fates resulting from pathway modulation in-vitro

with dual pathway modification are preserved in-vivo in the absence of continued pharmacologic

modulation. Dual modification may more firmly lock cells into a differentiated sate that is

maintained cell autonomously after engraftment.

We have shown that a Notch antagonist and a Wnt agonist synergistically improve survival by

delaying tumor growth from both neurogenic and non-neurogenic glioblastoma groups. The

synergistic effect of γSI and BIO is greater in neurogenic tumors (2-fold) compared to non-

neurogenic tumors (1.3-fold), we hypothesize that this reflects the more limited proliferative

potential of glioblastoma cells that are directed into the neural lineage.

77

Figure 2-27

Notch antagonists and Wnt agonists synergistically improve survival of mice injected with

ex-vivo treated cell lines. A) GliNS1 neurogenic line cultured ex-vivo with 1μM γSI and/or

1μM BIO for 1 week. Combination treatment significantly improves survival. Asymptomatic

animals were sacrificed after 270 days. p<0.05, Logrank Test. B) γSI and BIO synergistically

improve survival with G166NS. P<0.05, Logrank Test.

*

*

78

Figure 2-28

GliNS1 glioblastoma NS lines treated ex-vivo with γSI, BIO or combination. Treatment of

tumor lines ex-vivo increases host survival. Examining the expression of lineage markers by

immunofluoresence shows an increase in neuronal marker expression in combined BIO+γSI

treated cells. Star marks the site of the frank tumor.

79

Figure 2-29

G166NS glioblastoma NS line treated ex-vivo with γSI, BIO or combination. Treatment of

tumor lines ex-vivo increases host survival but does not affect gross morphology of tumors.

Non-neurogenic lines do not express neuronal lineage markers with γSI and BIO combination

treatment. Star marks the site of the frank tumor.

80

2.3 Discussion Glioblastomas are a highly malignant and phenotypically diverse class of tumors demonstrating

remarkable heterogeneity from patient to patient. Despite a growing appreciation for the

complex genomic and molecular variability encapsulating this disease, there have been very few

successful clinical treatments. Insight from cancer breakthroughs, such as the use of Imatinib for

CML187,188 and Trastuzumab in breast cancer189,190, illustrated that inhibition of the key tumor

pathway drivers can significantly improve the outcome of patients. In this study, we antagonized

the Notch signaling pathway, inducing neuronal lineage commitment and reducing

tumorigenicity of a cancer initiating population. Furthermore, based upon expression of Notch

and downstream components, we have identified patterns of gene expression in glioblastoma

stem cells that identify subsets of glioblastoma that are more sensitive to neuronal lineage

commitment. These findings provide potential valuable insight in identifying novel

differentiation strategies for glioblastoma stem cells based on analysis of molecular and pathway

specific predictors of differentiation.

2.3.1 The Notch-Hes Axis as a Therapeutic Target

Our lab recently demonstrated that primary patient glioblastoma samples can be expanded in

serum free conditions on a laminin coated surface as an adherent monolayer157, a technique

which greatly facilitates molecular characterization and functional analysis. We manipulated the

Notch pathway using pharmacologic and genetic strategies with the goal of elucidating the

components required to maintain stemness. Our study of downstream Notch targets showed that

we could relieve repression of downstream proneural transcription factors using pharmacologic

antagonists of γ-secretase. Of the multiple downstream targets, our data show that one of the key

factors in regulating lineage fate in CSCs is Hes5 and not Hes1. Hes5 expression is diminished

in all lines upon treatment with γSI (5/5), demonstrating an exquisite sensitivity to Notch

receptor activity. In contrast, Hes1 is much less responsive with only 60% (3/5) of lines

significantly downregulating Hes1 after γSI treatment. Further, Hes5 is more sensitive to ectopic

Notch activation with NICD1 expression than Hes1. The current understanding of bHLH factors

is not completely understood and remains controversial. Of the multitude of Hes transcription

factors, Hes1 and Hes5 have traditionally been viewed as the major downstream targets of Notch

in murine and human neural stem cells74,191. Owing to partial functional redundancy in the

81

context of murine cortical development191, the precise roles for Hes1 and Hes5 has been unclear.

The prevailing paradigm has been that the Notch-Hes1 axis is critical in neurosphere self renewal

whereas Hes5 is a dispensible component82,192. In contrast, a seminal study illustrated that ES

cells and ES sphere colonies derived from RBP-jK-/- mice fail to express Hes5 transcripts but

retain Hes1 expression73 indicating a Notch independent regulatory mechanism. Furthermore,

Notch1-/- and RBP-jK-/- E9.0 murine embryos retain expression of Hes1 and Hes3, but not

Hes5193. Taken together, these studies suggest that Hes5, and not Hes1, is directly regulated by

Notch. In support of this, there evidence that some canonical Notch targets are regulated

independently of the NICD/RBP-jK activation complex. In a study conducted with serum cell

lines, hedgehog signaling can directly regulate Hes1 independent of Notch receptor activation in

C3H/10T1/2 mesodermal and MNS70 neural cells129. In the context of murine postnatal retinal

progenitor cells, activation of hedgehog signaling is a stronger stimulus than activated Notch for

Hes1 expression and occurs independently of RBP-jK194. This suggests that Hes1 may not be an

exclusive Notch target as previously thought. Our study has demonstrated that Hes5 is more

sensitive than Hes1 to Notch blockade and over expression. Therefore, in the cancer stem cell,

Hes5 appears to be regulated by Notch directly whereas Hes1 may be regulated by alternate

pathways and/or Notch. Obviously further deliniation of the relative importance of Hes1 and

Hes5 in glioblastoma stem cells requires further functional analysis of these cells with additional

gain and loss of function experiments.

The persistance of Hes1 expression despite Notch blockade reveals a fascinating possibility into

the potential mechanism of glioblastoma disease recurrence. A seminal study reported that Hes1

maintains the reversibility of cellular quiescence in human fibroblasts and rhabdomyosarcoma by

blocking the effect of Cyclin Dependent Kinase inhibitor p21Cip1 and inducing expression of

TLE1195. In a developmental context, this protective function would intuitively prevent stem and

progenitor cells from undergoing premature quiescence, ensuring that developmental and

homeostatic programs are retained. Likewise, maintenance of Hes1 expression in cancers would

confer a significant survival advantage. Inducing cellular quiescence and terminal differentiation

in cancer is a highly sought after goal for the purposes of treating disease. Our observation that

glioblastoma NS lines retain Notch-independent Hes1 expression illustrates how a normal

protective mechanism may be co-opted by aberrant cancer programming. Indeed, we have

observed that glioblastoma stem cells can be differentiated into less proliferative (potentially

82

more quiescent) neuronal cells in-vitro, yet retain the capacity to generate tumors upon in-vivo

orthotopic transplantation when isolated from the effects of γSI. This could reflect a state of

reversible quiescence or reversible differentiation of glioblastoma stem cells, and could have

important implications for guiding anti-Notch directed therapies (or differentiation therapy

strategies in general) and suggests that maximal therapeutic benefit of these types of therapies

may require active maintenance of differentiation signals to the cancer stem cells. Small

molecule inhibitors196 and anti-Notch receptor antibodies197 are just some pharmacologics that

are currently being developed and tested. However, it may be crucial to also target the pathways

which crosstalk with Hes1 in order to minimize the likelihood of disease recurrence. We have

shown that the wingless pathway is a candidate pathway for combinatorial modulation.

Recently, Schreck et al., demonstrated that Hes1 negatively regulates hedgehog by directly

binding the Gli1 gene in a glioblastoma neurosphere model. Interestingly, blockade of Notch

with γSI resulted in a corresponding increase in Gli1 activity as a result of diminished Hes1

expression198. The result was a compensatory upregulation of Shh activity and was postulated to

protect cancer cells from death. From this preliminary study, combining Notch and Shh

inhibitors was more effective at reducing cell proliferation than individual inhibitors. Ultimately,

simultaneous targeting of multiple signaling pathways implicated in tumorigenesis is likely to be

more efficacious in a clinical setting.

2.3.2 Modulating Canonical and Non-Canonical Elements of the Notch pathway

In our study we compared canonical and non-canonical pathway gene expression in glioblastoma

stem cell lines, fetal NS lines and cerebral cortex. We discovered that Notch2, Hes1 and

Jagged1 expression is relatively increased in normal or tumor stem cells compared to human

cortex. Intriguingly, we uncovered patterns of gene expression which may be predictive of the

differentiation potential for glioblastoma stem cells. Glioblastomas that acquire neuronal

phenotypes in response to Notch blockade have patterns of gene expression similar to human

fetal neural stem cell lines. Importantly, this sensitive group of gliomas can be distinguished

from insensitive gliomas by high relative expression of Ascl1 and Dll3. Ascl1, a transcription

factor whose expression is repressed by the Notch target Hes1/Hes5199,115, is crucial for

reprogramming fibroblasts to functional neurons200 and is critical in neuronal differentiation and

patterning200. Paradoxically, we have shown that Ascl1 is expressed in some EGF/FGF cultured

83

NS lines, conditions which promote self-renewal and inhibit differentiation. Rectifying this

apparent contradiction, Castro et al., recently reported that Ascl1 has direct functions in all stages

of neurogenesis. In addition to regulating genes associated with Notch signaling, cell fate

specification, neuronal differentiation and neurite morphogenesis, Ascl1 was found to control

genes regulating cell proliferation201. The authors show that Ascl1 can bind the promoters of up

to 603 genes responsible of reactivating cell cycle. Transfection of dominant negative-Ascl1 into

neural stem cells resulted in impaired S-phase progression. Interestingly, the authors discovered

that the Ascl1 promoter binding sequence (GTGGGAC) very closely matched that of the

CBF1/NICD co-activator sequence (GTGGGAA). They proposed a model whereby Ascl1

functions to co-activate cell cycle progression genes when Notch is active, but is displaced by

CBF1/co-repressor complex when Notch is inactive. Therefore, in our neurogenic lines,

CBF1/NICD and Ascl1 may function together to promote cell cycle progression/self-renewal

when Notch is active. Notch blockade therefore promotes the transcription of genes relating to

neuronal lineage commitment and maturation.

We wondered whether other transcription factors downstream of Notch contributed to the

prevalence of neurons and relative paucity of astrocytes upon Notch blockade. In our principal

component analysis of neurogenic versus non-neurogenic NS lines, we identified high expression

of Sox4 in neurogenic lines relative to human cortex and non-neurogenic lines. There is

evidence to support the role of this Sry-related HMG-box gene in neuronal commitment and

CNS development. In mouse models of development, over expression of Sox4 under the GFAP

promoter supports normal differentiation of neurons, but induces massive cerebellar defects due

to the developmental failure of Bergman glia202. In this mouse model, apoptosis occurred

extensively in astrocytes. Expression of Sox4 in neurogenic glioblastoma stem cell lines may

conceivably diminish the population of astrocytes when exposed to the neurogenic environment

of γSI treatments. Thus, considering the importance of this transcription factor in a

developmental context, it may serve an important function in neuronal lineage programming in

cancer stem cells, and would likely benefit from further detailed study.

In this study, we directly modulated the activity of Notch receptors using pharmacologic

inhibitors. While our study was being conducted, other groups have demonstrated that the

activity of Notch signaling can be modulated by affecting genes responsible for receptor

transcription and post-translational processing. Ying and colleagues demonstrated that the

84

retinoic acid induced differentiation of glioblastoma neurospheres was dependant on expression

of Krüppel-Like Family 9 (KLF9) transcription factor. KLF9 exerts negative regulatory effect

by direct binding to basic transcription element (BTE) sequences found in the Notch1 promoter.

Underexpressed in glioblastoma intiating cells, ectopic expression induces differentiation and

was sufficient to reduce tumorigenicity in mouse transplant models203. Identifying novel

pharmacologic and genetic mechanisms to perturb Notch signaling will of great importance for

efficiently and terminally antagonizing pathway activity in cancer cells.

2.3.3 Functional Synergism in BTSCs.

To determine whether Notch targeted therapies could be effective in patients we conducted a

proof of concept study using ex-vivo orthotopic models. Mice transplanted with γSI-induced

differentiated neurogenic lines significantly improved survival over transplants with untreated

cells. Non-neurogenic tumor lines treated the same way did not demonstrate an improvement in

host survival, but we acknowledge that numbers of animals tested and numbers of cell lines

tested are small to make the most concrete conclusions. Additionally, we activated the wingless

pathway using pharmacologic inhibitors of GSK-3β in conjunction with Notch blockade and

induced robust neuronal lineage differentiation in neurogenic lines. This combination improved

tumor-free survival of mice transplanted with neurogenic tumor cells. Remarkably, despite the

lack of neuronal differentiation, BIO and γSI combination treatment of non-neurogenic

glioblastoma lines was also effective in significantly prolonging the survival of mice in

orthotopic transplant. It may be possible that BIO and γSI promote the development of a

neuronal marker negative ‘tumor transient amplifying cell’. In the study conducted by Dieter

and colleagues, they demonstrated that colon cancer initiating cells could be subdivided into

three fractions: long term tumor initating cells, transient amplifying cells, and delayed

contributing cells. Of these fractions, transient amplifying tumor cells were only capable of

forming tumors in primary animals. Furthermore, transient amplifying tumor cells were much

less likely to metastasize within the murine host204. In our study, we demonstrated that mice

injected with BIO and γSI treated cells had improved survival compared to injections with

untreated or single treated cells. However, did not test the serial propagation ability of these

tumors. Furthermore, since CNS tumors do not metastasize to distant sites outside the CNS, we

are unable to assess the migratory abilities of putative glioblastoma transient amplifying cells in-

85

vivo. Ultimately, combination treatment may diminish tumorigenicity of non-neurogenic lines

by promoting a transient amplifying cell fate possessing limited self-renewal capabilities.

We demonstrated Wnt pathway activation synergizes with Notch inhibition to activate neuronal

genes and upregulate markers of lineage commitment. How do our results fit into the currently

established mechanisms of crosstalk? Evidence from the literature illustrates both direct and

indirect interactions between the two pathways. Indirectly, some elements of the Notch pathway

are targets of downstream activated Wnt signaling. For instance, the Jagged1 promoter is a

known target of the canonical β-catenin activation complex205,184. Katoh and Katoh

demonstrated that β-catenin can activate Notch signaling by upregulating transcription of

Jagged1. Direct protein-protein interactions can occur between Wnt-Notch and may modulate

activity of both pathways. Activated β-catenin can bind to the intracellular domain of activated

Notch and functions to prolong the half-life of NICD in-vitro206,43. In murine e14.5 neural stem

cell models, β-catenin together with NICD1, participates in the activation of Hes genes to

suppress neuronal differentiation206. Confusingly, studies also demonstrate that negative

regulators of Wnt can potentiate Notch signaling. Paradoxically, the kinase responsible for

marking β-catenin for degradation, GSK-3β, also has the ability to directly phosphorylate

Notch1207 and Notch2208, promoting nuclear localization and activation of downstream Hes

targets. Our data show that blocking GSK-3β in BTSCs can be a potent differentiating signal

and may support a model that GSK-3β is a phosphorylase that potentiates nuclear localization of

activated Notch (Figure 2-30). This context suggests that β-catenin is not required to regulate

proliferation. Also, induction of differentiation via BIO/γSI synergy may be independent of

activated β-catenin protein. To test this hypothesis, experiments confirming the physical

interaction between NICD and GSK-3β, and experiments demonstrating the effect of β-catenin

over expression in G-NS cells are required. The recipricol activity of these pathways is not

without precedent, as this putative model may have implications in memory consolidation in

Wistar rats. Conboy and colleagues demonstrated that Notch signaling in the adult rat

hippocampus was downregulated 12 hours following a passive avoidance training stimulus

consisting of a delinated area of a cage which administered an electric shock209. If the Notch

receptor was activated ectopically in-vivo after the animals completed the training period, the rats

failed to condition to the shock stimulus. Interestingly, diminished Notch activity was associated

with increased Wnt activity measured by GSK-3β phosphorylation and accumulation of

86

activated-β-catenin. The authors hypothesized that in order for proper learned conditioning to

occur, downregulation of Notch was required to allow for neuronal differentiation and neurite

outgrowth. Thus, while learning and memory are poorly understood processes, the findings in

this thesis indicate that physiological mechanisms governing memory may be conserved in

glioblastoma stem cells. Ultimately, our data support the hypothesis that the functional synergy

observed with BIO and γSI is due to recipricol Notch and Wnt pathway activation.

Herein, we have implicated a role for Wnt pathway by identifying upregulation of APC in

neurogenic tumors. We showed that activation of Wnt signaling and simultaneous blockade of

Notch promotes glioblastoma stem cell differentiation. The Wnt pathway is known to contribute

to a number of congenital cancer syndromes, most notably Familial Adenomatous Polyposis

(FAP). Inheritance of germline inactivating mutations within the APC gene induces growth of

numerous (hundreds to thousands) colorectal tumors manifesting as polyps in the second or third

decade of life210. This condition requires aggressive surgical treatment. FAP can also contribute

to a spectrum of CNS tumors. Referred to as Turcot’s Syndrome, these patients were found to

commonly develop medulloblastoma and, less frequently, glioblastoma. While this clinical

condition appears to contradict our findings that Wnt activation may diminish tumor growth, a

study that characterized glioblastoma of Turcot’s Syndrome revealed atypical molecular features

including more defects in mismatch repair and markedly improved outcome compared to

classical glioblastoma211. We did not conduct a full genotype analysis on all the glioblastoma

stem cell lines in this study and therefore FAP carrier status is unknown. While tumor response

to Wnt activation was variable, all of the lines studied showed diminished proliferation

suggesting that Wnt activation was not a proliferative simulus. Whether BIO treatment has the

same effect on CNS tumors of FAP origin is yet to be studied. Thus, synergistic inhibition of

Notch and activation of Wnt will be a useful strategy in some, but maybe not all brain tumors.

87

Figure 2-30

Putative Mechanism of Notch-Wnt Synergy. GSK-3β antagonists combined with γSI induces

neuronal lineage differentiation in neurogenic BTSCs. This interaction could putatively occur

through a positive feedback mechanism where GSK-3β interacts with the activated domain of

Notch.

88

2.3.4 Clinical Implications

The identification of the factors which distinguish neurogenic and non-neurogenic tumors in this

study may be clinically useful for identifying patients which may respond to therapies directed

against the Notch signaling pathway. Philips et al212, demonstrated that bulk tumors could be

grouped into three subclasses: proneural, proliferative and mesenchymal with markers from the

Akt and Notch pathway distinguishing Mesenchymal and Proneural groups respectively. The

proneural class included gliomas ranging from Grade II to Grade IV and tended to consist of

patients younger in age compared to the proliferative and mesenchymal groups (~40 y/o vs ~50

y/o). Verhaak and The Cancer Genome Atlas Research Network213 uncovered similar findings

with respect to glioblastoma subtypes. In their study, molecular genetic classification identified

four distinct glasses of glioma: classical, proneural, neural and mesenchymal. Of the proneural

class, they identified Notch, Ascl1 and Sox genes being highly expressed compared to other bulk

glioma. Our work has demonstrated that cancer stem cells can be prospectively organized based

upon a genetic signature and that the two groups possess functional differences in signaling

pathway dependency that can be exploited with γSI.

Interestingly, Verhaak et al. showed that there were significant differences between clinical

subtypes and response to aggressive chemotherapy regimens. Patients with Grade IV glioma can

be treated with ‘standard’ chemotherapy or ‘aggressive’ chemotherapy. Aggressive strategies

comprise of multiple rounds of high dose chemotherapy plus concurrent radiotherapy and have

been shown to improve gross patient survival. However, when grouped according to the genetic

profile of their glioma, patients with proneural GBMs do not possess any improvement in

mortality when compared to traditional chemo/radiotherapy regimens. Therefore, our work may

suggest a treatment modality in this subclass of GBMs. γSI’s may be a strategy to improve the

survival of patients with the proneural class of glioblastoma.

Therapeutically, functional synergy could minimize adverse drug reactions. Indeed, γSI at high

doses has been documented to induce severe gastric toxicity, the effects of which may be

mitigated by some combinations of adjuvant therapy with the corticosteroid dexamethasone214.

Similarly, while BIO has not yet been approved for the use in human patients, Wnt activation

through Lithium Chloride (LiCl) is an approved clinical treatment for neurological/psychiatric

disorders and thus effectively passes the blood brain barrier and functions in the CNS215. Lower

89

doses of combined drugs which have the same effect as high doses would be effective at

minimizing cost, reducing toxic burden, maximizing therapeutic value and ultimately preserving

patient compliance.

Historically, this differentiation therapy has been successfully applied in the treatment acute

promyelocytic leukemia (APL). All-trans retinoic acid (ATRA) administered to patients with

APL induced differentiation to mature granulocytes and effected a complete remission in a high

percentage of patients216. There is evidence in-vitro to demonstrate that this approach may be

viable in human glioma217. Furthermore, novel methods of targeting the Notch axis have been or

are currently under development. Perhaps like herceptin218, a developing strategy is the use of

antagonistic monoclonal antibodies specific for individual Notch receptors197,197.

Understandably, there is concern that targeting a signaling pathway integral to normal stem cell

homeostasis may cause undesirable side effects. Studies in rats have shown that administration

of γSI via intracranial osmotic pumps improves the performance of test subjects in water maze

challenges219, perhaps reflecting increases in functional neurogenesis as a result of Notch

blockade. However, extrapolation to human subjects should be done with caution as long term

memory or cognitive deficit in these laboratory animals have not been explored. Further, NSCs

are known to mobilize to sites of brain injury and ischemic damage. It is unknown how

plasticity and CNS repair would cope in an environment a depleted of a neural stem cell pool220.

Therefore, uncertainty regarding effects on memory and impaired response to brain ischemia

must be considered in a clinical setting.

Our findings have clear clinical implications. We have prospectively identified characteristics

which predict responsiveness to Notch antagonists. Further development and characterization of

the hits revealed in this study may lead to clinical applications where patient glioma samples

may be screened for Notch1, Ascl1 or Sox4 expression in advance of prescribing a

chemotherapeutic regimen. Information gleaned from patient screens may thus lead to the use of

γ-secretase inhibitors and Wnt agonists to induce neuronal lineage differentiation in susceptible

glioma.

90

Supplemental Figure 1

Growth factor withdrawal of NS lines induces multipotent differentiation..

A) HF240NS human fetal neural stem cells, B) GliNS1 glioblastoma line, C) G144NS

glioblastoma line, D) G166NS glioblastoma line, E) G174NS glioblastoma line, F) G179NS

glioblastoma line. Two-stage growth factor ithdrawal protocol administered over a period of 14-

21 days. Green channel is GFAP. Red channel is β-IIIT. Scale bar 50μm.

91


Dose response analysis of the γ-secretase inhibitor L-685,458 and DAPT in human fetal

neurosphere forming assay. Human fetal 6787 was plated at a clonal density of 2000 cells per

well with EGF/FGF and cultured for one week with either vehicle, L-685,458 or DAPT.

Neurospheres were scored based on a minimum 50um diameter.

Neu

rosp

here

s/W

ell

92


DN-MAML Notch antagonism reduces expression of downstream Notch targets. G144NS,

a neurogenic group NS line is responsive to DN-MAML Notch blockade. G174NS, a non-

neurogenic NS line is also responsive to DN-MAML Notch blockade. Both lines transiently

transfected and assayed for gene expression 3 days post transfection. *P<0.05

93


Downstream bHLH expression in Glioma NS lines and Human Fetal NS after 6uM γSI

treatment. A)HF240NS, B)G166NS, C) G179NS, and D) G174NS treated with 6μM γSI for 10

days have significantly reduced Hes5 expression. Hes1 is not significantly down regulated in A)

HF240NS or C)G179NS lines with pharmacologic Notch blockade. * P<0.05

94


Ascl1 transcripts are differentially expressed between NS lines.

Quantitative reverse-transcriptase PCR analysis of Ascl1 transcripts from NS lines cultured in

EGF/FGF. GliNS1 and G144NS neurogenic NS lines express higher levels of Ascl1 transcript

relative to G166NS and G179NS non-neurogenic lines.

95

Materials and Methods

2.3.5 Primary Patient Samples.

Samples were obtained with approval from ethics committee and appropriate patient consent.

Incoming tumor tissue was partitioned for immunohistochemistry, tissue culture and frozen for

archival purposes. Tumor tissue for primary neurosphere culture was mechanically dissociated

and enzymatically digested with 1.33mg/ml trypsin (Sigma), 0.67mg/ml hyaluronidase (Sigma)

and 0.1 mg/ml kynurenic acid (Sigma). The enzyme mix/cell suspension was quenched with

0.7mg/ml ovalbumin and filtered through a 70μm cell strainer to remove debris. Red blood cells

were eliminated from culture by 30-45min density centrifugation with Lympholyte Mammal

(Cederlane). Resulting cell suspension was plated in appropriate cell culture media or frozen for

archival purposes in a 10% DMSO/PBS solution. Primary patient tissue processed form

immunohistochemistry was immediately fixed with 4% paraformaldehyde for

immunohistochemistry. Tissue frozen for archival purposes was snap frozen using liquid

nitrogen and stored in an anonymized database to preserve patient confidentiality.

2.3.6 Tissue Culture

Neurospheres were cultured in serum free conditions with 20ng/ml EGF and 20ng/ml FGF as

previously described97. 50% of the growth media was exchanged every 3-4 days. Neurospheres

were passaged with Accutase (Sigma) when the average diameter of neurospheres exceeded

350μm. Neurosphere limiting dilution assays (LDA) were seeded at an initial density of 20

cells/μl (2000 cells/well) with stepwise 50% dilution down to 0.04 cells/μl (4 cells/well) and

monitored for a period of 7-21 days. The percentage of wells without neurospheres was scored

and plotted against initial seeding density221. The 0.37 intercept was scored as the clonogenic

frequency to reflect the zero term of the poisson equation and density at which there is an

average of only one colony forming cell per well222.

Adherent NS culture172 was conducted on Primeria (Nunc) tissue culture plasticware coated with

0.01% Poly-L-Ornithine (Sigma) and 10ug/ml Laminin (Sigma). Neurocult media (Stem Cells

Technologies) was supplemented with 10ng/μl EGF, 10ng/μl FGF, N2 and B27. Cells were

passaged by enzymatic digestion with Accutase.

96

Glial and neuronal lineage differentiation was induced by a three week growth factor withdrawal.

The media for the first 7 days of differentiation was supplemented with 5ng/ml FGF, N2, B27

and no EGF. Subsequently, the Neurocult media was exchanged with a 1:1 mixture of

Neurobasal:Neurocult, B27 and ¼ N2.

Compounds were added to the culture as necessary with the appropriate vehicle controls. γSI L-

685,458 (EMD) and 6-bromo-3-[(3E)-1,3-dihydro-3-(hydroxyimino)-2H-indol-2-ylidene]-1,3-

dihydro-(3Z)-2H-indol-2-one (EMD) were added to the culture and monitored for proliferation

or morphological changes.

Proliferation assays were conducted with Thiazolyl Blue Tetrazolium Bromide (MTT, Sigma).

A final concentration of 500μg/ml was added to the tissue culture and monitored for the

formation of insoluble purple formazan crystals which were solubilised with 10% SDS/0.1M

HCl and quantified using a spectrophotometer at 575nm.

Live imaging and tracking of cells conducted using Icucyte Cell Tracking Systems (Essen

Biosciences) in standard tissue culture conditions (37ºC) and normoxic environment.

2.3.7 Vectors and Transfection

Notch1 intracellular domain was cloned into the pcDNA3.1 Vector from the Val1744 residue to

the end of the protein. Dominan-negative Mastermind contruct was a generous gift from Dr.

John Aster and is contained within a MigR1 plasmind. Transfections were conducted with

Nucleofector Device (Lonza) according to manufacturer’s protocols.

2.3.8 Immunocytochemistry

Cells cultured as adherent NS were grown on coated coverslips and fixed with methanol or 4%

paraformaldahyde (PFA). Coverslips were permeabilized with 0.1% TritonX100 and blocked

with 5% NGS. Antibodies against activated Notch1 (1:250, abcam8925), Nestin (1:1000,

Ab5922), GFAP (1:500, DAKO), β-III-tubulin (1:500, MAB1637) and Sox2 (1:500, MAB2018),

GFP (1:250, Roche, Cat 11814460001), Hes1 (1:500, A generous gift from Tetsuo Sudo), Hes5

(1:500, AB5708), BrdU (1:250, OBT0030) were used. Appropriate fluorescent-conjugated

secondary antibodies were used at a concentration of 1:500 with copious washing with PBS

between staining phases. Cells were counterstained with 1:1000 DAPI and mounted with

97

fluorescent mounting medium (DAKO). Imaging was conducted with a Leica microscope.

Matched exposures were used to compare images between treatments of the same cell line.

Manual scoring was conducted on randomly selected fields using ImageJ (V1.42q) to mark cells

counted. Cells were scored as ‘positive’ if staining corresponding to filamentous proteins were

localized as discrete fibres in the cytoplasm and ‘negative’ if fibres were not clearly visible.

Cells were scored as ‘positive’ if staining for corresponding nuclear transcription factors were

localized to the nucleus and ‘negative’ if no staining was visually observed.

BrdU incorporation was assayed following a 24hr pulse with 10μM BrdU. Cells were fixed with

4% PFA and denatured with 2M HCl for 20min at room temperature. Following neutralization

with 0.1M Sodium Borate pH 8.5, the coverslips were washed with copious amounts of PBS.

Cells were permeabilized with 0.2% TritonX100 and blocked with 5% BSA. Staining as above.

2.3.9 Semi-Quantitative and Real Time PCR

mRNA from primary patient tumor samples was isolated by Trizol extraction. mRNA from cells

was isolated according to the protocol using RNeasy (Qiagen), treated with DNase (Qiagen) and

quantified using a Nanodrop spectrophotometer. Reverse Transcriptase PCR was conducted

using oligo-dT and Reverse Transcriptor (Roche) according to protocol.

Real-time qPCR was conducted with a Bio-Rad PTC200 and Chromo4-α unit. Sybr Green

mastermix was obtained from Bio-Rad. Primers for Notch1223 F-

GAACCAATACAACCCTCTGC R-AGCTCATCATCTGGGACAGG, Hes1 F-

GAAGGCGGACATTCTGGAAA R-GTTCATGCACTCGCTGAAGC, Hes5224 F-

CGCATCAACAGCAGCATAGAG R- TGGAAGTGGTAAAGCAGCTTC, Sox4 F-

GTGGTACAGGGGCAGTCAGT R- ACACCATCACGATTCCGATT, Hey1 F-

GCTGGTACCCAGTGCTTTTGAG R- TGCAGGATCTCGGCTTTTTCT, Ascl1 F-

TCCCCCAACTACTCCAACGAC R-CCCTCCCAAGCGCACTG and B-Actin225 F-

CATCACCATTGGCAATGAGC R- CGATCCACACGGAGTACTTG.

2.3.10 Flow Cytometry

Cells were resuspended in flow cytometery buffer without EDTA and stained with CD133-APC

(Mylteni Biotech), CD15-FITC, CD44PE for 30min-1hr at 4°C. Cells were spun down, washed

with buffer and counter stained with propidium iodide. Quantitative flow cytometry was

98

conducted using the BD FACScalibur or BD FACscan. Cell sorting was conducted with BD

FACS Aria.

2.3.11 Animals

Orthotopic injections of cells suspended in PBS were conducted with stereotactic head frames

into female NOD/SCID mice. Animals were anesthetized with ketamine/xylazine and supplied

with the analgesic Anafen. A hole in the skull is bored with a needle to facilitate injection. The

co-ordinates originate at the bregma are 1mm anterior, 1mm right and 2mm deep. Injections of

2-3μl are conducted over the course of 30min: 10min injection, 10min to permit diffusion and

10min withdrawal of the needle. The hole in the skull is subsequently filled with bone wax and

the head sutured. Animals were cared for by laboratory animal services, assessed by unbiased

laboratory staff when animals demonstrated significant disease progression and were sacrificed

when recommended.

2.3.12 Microarray Data and Analysis

RNA hybridization, Affymetrix U133 Plus array and data normalization was conducted by Ian

Clarke. Data analysis and statistical analysis was conducted using Partek® software, version 6.3

Copyright © 2008. Complete linkage clustering analysis was conducted with Cluster and

Treeview (Version 1.60)174.

Data analysis, t-tests and Logrank tests were performed using GraphPad Prism version 4.00 for

Windows, GraphPad Software, San Diego California USA.

99

Chapter 3

3 Symmetric Versus Asymmetric Self renewal in Cancer Stem Cells.

3.1 Introduction Self renewal is a property whereby a stem cell undergoes a cell division where at least one of the

daughter cells retains properties identical to the parent cell. Generation of two identical progeny

in a self-renewal event is termed symmetric self-renewal (expansion) whereas generation of one

daughter stem cell and one daughter progenitor or differentiated cell is termed asymmetric self

renewal (maintenance). Thus, symmetric expansion is a process critical for rapid generation of

cell numbers during development and response to injury or tissue repair. Asymmetric self-

renewal is also a process that is tightly regulated during development and is required for proper

developmental patterning. Alternatively, a stem cell is also capable of dividing such that both

daughter cells lose stem cell properties (extinction) becoming progenitors or differentiated cells

lacking long term self-renewal (Figure 3-1). In cancer, one hypothesis of neoplastic growth is

that cancer stem cells arise from normal stem cells where self-renewal has been programmed to

symmetric expansion from asymmetric maintenance. Recently, Lathia and colleagues have

indeed demonstrated that glioblastoma stem cells are generated primarily through symmetric

self-renewal events226. Therefore, identifying the factors that modulate symmetric versus

asymmetric self-renewal is a highly sought goal in cancer prevention and treatment.

Much of our understanding of factors that regulate self-renewal originate from studies of

Drosophila neuroblasts and external sensory organs, a system which is permissive for

characterization due to clear distinctions between stem cells and differentiated cells. In this

system, cell fate decisions are determined by the spatial location of cells relative to the epithelia

and are dictated by apical and basal polarity of the cell. The polarity is marked by three distinct

protein complexes which are asymmetrically segregated into daughter cells. The first complex

Discs Large is composed of Scribble (Scrib), discs large (dlg) and lethal giant larvae (lgl). The

second complex Bazooka is composed of bazooka (baz), Drosophila atypical protein kinase C

(DaPKC) and Drosophila homologue of Partitioning Defective Protein 6 (DmPAR-6). Finally,

the Crumbs group is composed of crumbs(crb) and stardust (sdt)227. These protein complexes

100

function to regulate downstream determinants of cell fate. One of these determinants, Numb, is a

negative regulator of Notch signaling and a direct target of lgl228. Numb is hypothesized to

regulate Notch signaling by recruiting E3 ubiquitin ligases229, promoting Notch receptor

trafficking230 and lysosomal degradation231,175. The absence of Notch signaling in these daughter

cells is thought to induce PIIb cell fate which further divides into a Drosophila neuron and

sheath cell232. Interestingly, many of the components of the Drosophila polarity complexes have

mammalian counterparts, suggesting similar mechanisms of action in higher organisms.

Many components from the Drosophila polarity protein complexes have homologues in

mammalian cells, including mouse and human. Among these proteins, Drosophila Numb has

been discovered to have at least four homologues in mammals. In the murine central nervous

system, the mouse Numb homologue (m-numb) is expressed in neural precursor areas in the

developing and postnatal brain233. Another homologue, Numblike (nbl) was found to have

highest expression in postmitotic neurons234 and functions to antagonize Notch signaling.

Further, there is evidence which shows that Notch receptor signaling is absolutely required for

murine neural stem cell expansion. Notch1-/-, Presenilin1-/- and RBP-jK-/- neural stem cells are

all incapable of forming neurospheres73. Correspondingly, the opposite effect also holds true as

transient activation of Notch receptors in-vivo induces rapid neural stem cell expansion235. Thus,

it is clear that Notch plays an important role in regulating neural stem cell self-renewal.

Despite the understanding of Notch mediated self-renewal in Drosophila and murine models, the

role of Notch in glioblastoma stem cell self-renewal remains poorly understood. Preliminary

reports have demonstrated that persistent γ-secretase inhibition is sufficient to induce apoptosis

and reduce tumorigenicity of glioma neurospheres139 and the data we have presented in Chapter

2 has shown that we can differentiate and prevent CSC engraftment and tumorigenesis.

However, the consequences of Notch inhibition on symmetric versus asymmetric cancer stem

cell self-renewal remains poorly understood. Is Notch required for symmetric expansion and

asymmetric maintenance of CSCs or is it expendable in one of these cell fate choices? Is it

feasible to induce extinction in a population of cancer stem cells by targeting Notch? Herein, we

will attempt to elucidate the role of Notch in CSC self-renewal.

101

Figure 3-1

Self-renewal in stem cells. A stem cell (pink) can undergo three distinct cell fate choices. A)

Two daughter cells are identical in symmetric stem cell self-renewal and causes expansion of the

stem cell pool. B) One daughter cell and one progenitor/differentiated cell progeny (yellow) are

the result of asymmetric stem cell self-renewal and results in stem cell maintenance. C) Stem

cell extinction occurs when a stem cell differentiates to two daughter cells with no self-renewal

ability.

102

3.2 Results

3.2.1 Self-renewing BTSCs persist in γSI treated cultures.

We have demonstrated that Notch antagonism induces neuronal lineage differentiation of neural

stem cells and subsets BTSCs. Interestingly, despite a highly differentiated appearance in-vitro

we found that Notch antagonist treated BTSCs were still capable of forming tumors in-vivo,

albeit with an increased latency. Since disease recurrence is a common facet of glioblastoma, we

hypothesize that a cancer stem cell population may persist in culture despite pharmacological

treatment. If true, a culture of neuronally differentiated BTSCs may demonstrate cardinal stem

cell properties when exposed to a milieu free of inhibitor. To test this hypothesis, we treated

neurogenic NS lines with Notch antagonists and replated the cultures into standard stem-cell

conditions to observe repopulating capabilities. NS lines cultured in 10μM γSI/EGF/FGF for 3

weeks to induce robust neuronal lineage marker expression were passaged in accordance with

standard protocols and replated into proliferative conditions with EGF/FGF without Notch

antagonists. MTT proliferation curves of HF240NS closely mirrored those of control cultures

and at 3 weeks were restored to 95% of control cultures. Similarly, the growth dynamics of

antagonist treated G144NS was also similar to vehicle treated cultures. 3 weeks after replating,

this glioblastoma line demonstrated levels of MTT proliferation that were 83% of control

cultures. The restoration of cell proliferation in the absence of γSI suggests that the proliferative

impairment caused by Notch antagonism is not a permanent effect on all stem cells in the culture

and illustrates a remarkable expansion upon inhibitor withdrawal (Figure 3-2).

We have shown that proliferation can be rapidly restored in the absence of Notch inhibition.

However, the mechanism of proliferation is unclear. Does proliferation occur due to reactivation

of self-renewal in a pool of quiescent stem cells or does it occur due to a rapid burst of

proliferation from progenitors seeded into a new medium? To ascertain whether cells

undergoing transient Notch inhibition cells retain self-renewal, we utilized the limiting dilution

assay, allowing us to determine the number of colony forming cells within a population221,222.

G144NS treated for three weeks with γSI was dissociated and plated into LDA without inhibitor.

The clonogenic frequency of vehicle treated cells was 15.2±8.4 cells/well whereas the γSI treated

cells was 44.9±22.7. While clonogenic frequency is diminished by approximately three-fold, the

observation lacks statistical significance. Nevertheless, these experiments demonstrate that

103

glioblastoma lines treated with Notch antagonists retain self-renewal ability despite prior

expression of differentiated markers in bulk culture, suggesting survival of a clonogenic

population in the absence of Notch (Figure 3-3).

To investigate whether cells that regain self-renewal and proliferation are bona-fide cells with

full stem like properties, we conducted a differentiation assay of cells exposed to γSI and shown

to express differentiated markers in culture. GliNS1, a glioblastoma which demonstrates robust

neuronal differentiation when cultured with γSI for 3 weeks, was examined for multipotentiality

after a recovery period in EGF/FGF. The cells were enzymatically dissociated and plated into

EGF/FGF conditions without γSI to examine whether multi-lineage differentiation is biased

towards a particular lineage or impaired altogether. Surprisingly, GliNS1 treated with γSI for 3

weeks, replated into EGF/FGF without inhibitor and differentiated according to standard

differentiation protocols were capable of both glial and neuronal differentiation (Figure 3-4).

Therefore, despite the acquisition of neuronal lineage markers and reduced proliferation in the

absence of Notch signals, glioblastoma stem cells are still capable of self renewal, proliferation

and multipotentiality when exposed to favorable conditions which promote Notch receptors re-

activation.

104

Figure 3-2

Glioma Stem Cells and Fetal Neural Stem Cells previously treated with Notch inhibitors

proliferate in absence of antagonist. A) HF240NS and B) G144NS neurogenic lines were

dissociated and replated into fresh media with EGF/FGF after culture for 3weeks with γSI. Both

cell lines reacquire proliferative potential when assayed by MTT.

Number of Cells per well

0 100 200 300 400

Per

cent

age

of w

ells

with

out s

pher

es

1

10

100

37% intercept

Vehicle

10uM GSI

Figure 3-3

Limiting dilution assay of γSI treated G144NS cells plated into EGF/FGF without inhibitor

show retention of self-renewal. G144NS glioblastoma retains clonogenic potential despite

treatment with γSI indicating the retention of a self-renewing population in-vitro. Clonogenic

frequency of Vehicle (●) 15.2±8.4 cells/well. γSI treated cells (○) was 44.9±22.7 cells/well.

105

Figure 3-4

Glioma stem cells revert to a multipotent state with removal of γSI. GliNS1 was cultured for

2 weeks in 6μM γSI to induce robust neuronal marker expression. Viable cells determined by

trypan blue exclusion were passaged into fresh media with EGF/FGF without γSI and cultured

for 3 weeks. A loss of neuronal marker expression and the reacquisition of GFAP expression

were noted. These cells were passaged into differentiating conditions for 3 weeks and it was

noted that these cells were fully multipotent. Scale bars 100μm.

106

3.2.2 Notch blockade restrains stem cell self-renewal and simultaneously pushes lineage commitment.

We have observed that despite appearing to be highly differentiated, cancer stem cells retain

multipotentiality and self-renewal in-vitro, and are able to form tumors in-vivo. How is it

possible that a cell population with such a dramatic shift in lineage fate can retain such a robust

stem-like character? These findings may be explained by the observation that while a large

proportion of cells in-vitro are growth restricted and express neuronal markers, a minority are

marker negative and remain proliferative (Chapter 2). Therefore, while quiescent, a population

of cancer stem cells survives and retains stem like properties despite Notch blockade. One

hypothesis is that γSI blocks clonal expansion by shifting symmetric division to asymmetric

division, thereby producing quiescent stem cells and differentiated progeny (Figure 3-6C). In

this scenario, the outcome of a mitotic event is one neuronal precursor daughter cell that is

positive for markers of differentiation, limited in growth potential and susceptible to apoptosis.

The other daughter cell retains self-renewal and multipotentiality such that, when it is passaged

into permissive conditions, it expands to repopulate the cell line in-vitro and in-vivo. To date,

there has been little evidence to support the role of Notch in regulating symmetric/asymmetric

self-renewal transition in glioblastoma stem cells.

Alternatively, another explanation is that there is stochasticity with regard to the sensitivity of

each cell to Notch blockade. With this model, each cell may possess unequal Notch receptor

expression and/or dependence. Therefore, for any given cell line, while the EC50 in L-685,458

may be ~4μM for the cell line as a whole, the actual dose required to inhibit proliferation for

each cell in culture may range from <1μM to >10μM, and therefore, in the experiments that have

been presented, a small but significant population of stem cells will resist differentiation, retain

proliferation and repopulate the culture in-vitro and in-vivo (Figure 3-6B). Finally, another

model is that cells in culture may evolve resistance to the selective pressure of γSI236,237,238. This

would predict that all cell lines have a small possibility to evolve spontaneous resistance to γSI.

Stem cells evolving this resistance would retain self renewal and proliferation despite the

presence of a differentiating stimulus. This could theoretically occur via upregulation of non-

canonical signaling pathways such as c-Jun N-terminal protein kinase (JNK)239 or hedgehog129

modulating downstream Notch components.

107

Testing our hypothesis necessitated the lineage tracking of cells in-vitro in order to score the

relative frequencies of self-renewal events and cell fates. We collaborated with Dr. Eric Jervis &

colleagues240 who developed novel technologies to track cell growth in confined and easily

observable microenvironments. This in-vitro system employs a tissue culture surface seeded

with inert polymer beads of a defined and customizable diameter. Overlaid is an optically clear

coverslip that creates a ‘gap chamber’ between the glass and culture surface. This gap chamber

therefore limits cell growth to a two dimensional plane (Figure 3-5). Growth in a single plane

greatly facilitates video cell tracking and is amenable to standard culture conditions and

pharmacologic manipulations. Furthermore, this system is permissive for cell to cell interactions

and is thus a more faithful representation of a physiologic environment, a distinct advantage over

most isolated single cell tracking modalities. Tracking cells allows the creation of lineage trees

documenting the growth, divisions and cell fate of the glioblastoma stem cell line GliNS1

cultured with and without Notch inhibitors. We cultured GliNS1 glioblastoma stem cells for 7

days in 5μM GSI while recording cell divisions, apoptotic events and changes in cellular

morphology.

Cell divisions were classified based on the fate of daughter cells. Symmetric events were

classified as cell divisions where the two daughter cells retain compact primitive morphologies

and ability to further divide, regardless of subsequent cell fate of second generation cells.

Conversely, asymmetric events were defined as divisions where one daughter cell retained

mitotic potential, whereas the other daughter underwent apoptosis, acquired neuronal

morphology or failed to proliferate (quiescence). Neurons were defined as cells lacking

mobility, acquiring neuronal markers and showing elongated neuronal morphology.

Symmetrical events where all the daughter cells undergo apoptosis are not considered

symmetrical self renewal, but are scored as symmetrical apoptosis.

Lineage trees from control GliNS1 were remarkably symmetrical. Of 39 cells tracked over 7

days, there were 147 mitotic events occurred with an average generation time of 40.9±18.2 hours

resulting in 188 daughter cell observations. Of these divisions, 127 (86%) were classified as

symmetric. While we are currently unable to immunostain for apoptotic markers in this assay

system, cells undergoing programmed cell death exhibited distinctive membrane blebbing, lack

of motility and an undefined nucleus. Spontaneous apoptosis was an infrequent occurrence with

only 14 cells (7.4%) undergoing apoptosis during the observation period. Of these apoptotic

108

cells, 3 pairs underwent apoptosis shortly after dividing. In contrast to these findings, γSI treated

GliNS1 tracked for the same amount of time was observed to have fewer mitotic events. 90 cells

at the start of the observation period underwent a total of 102 mitotitc divisions with an average

generation time of 49.7±21.4 hours giving rise to 198 cells. Of these divisions, there was a

relative decrease in symmetric events, 57 (56%), and an increased proportion of asymmetric

events. 10.8% of cell divisions were asymmetric in vehicle cultured cells versus 30% of

divisions in γSI treated cells. Of the asymmetric events recorded in γSI cultures, 60% of these

asymmetric events (18/30) were biased towards one daughter cell undergoing apoptosis, 33%

(10/30) consisting of one daughter cell acquiring neuronal lineage morphology and finally 6.6%

(2/30) having one daughter cell becoming quiescent after dividing. (Table 3-1) (Figure 3-7).

Via live cell tracking, we clearly demonstrated that blockade of Notch signaling in GliNS1

changes the outcome of mitotic events. This technique is advantageous since it can provide cell

fate information on cells which did not divide. In control cultures, 16/39 cells (41%) did not

divide during the 7-day observation period. Of these cells, 10% (4 of 39 seeded cells) acquired

neuronal characteristics, 23% (9 of 39 seeded cells) were quiescent and 7.6% (3 of 39 seeded

cells) underwent spontaneous apoptosis. In contrast, γSI treated cells were less likely to

experience a mitotic event with 55 cells (61% of total) failing to divide during the observed

period. 11% of these (11 of 90 seeded cells) adopted a neuronal morphology and 34% (31 of 90

seeded cells) underwent spontaneous apoptosis. Interestingly, this tracking system reveals that

while the number of quiescent cells increases with Notch blockade, the proportion of quiescent

cells that differentiate into neurons in this time period does not change appreciably (10%

neuronal cells in vehicle vs. 12% neuronal cells in γSI). These findings suggest that the majority

of neurons observed in culture are daughter cells of a self-renewal event.

We have used a novel cell tracking system to elucidate cell fate decisions of GliNS1 in the

absence of Notch pathway activation. In the 7 day observation period, we have noted that there

are an increased proportion of cells that undergo apoptosis, both before and after mitotic events.

We have observed an approximate three fold increase in asymmetric self renewal and a 1.5 fold

decrease in symmetric self renewal upon Notch blockade. Taken together, these results

demonstrate that expansion of the glioblastoma stem cell population can be blocked with Notch

pathway inhibition.

109

Table 3-1

Summary observation of cell divisions and apoptotic events from GliNS1 lineage tracking.

Cells were tracked over a period of 7 days with vehicle or 5 μM γSI. Total cells are defined as

the number of cells tracked at the end of the observation period. Quiescent cells are defined as

tracked cells which do not undergo a mitotic division during the observation period. Generation

time and percentage asymmetric events are increased upon γSI treatment. Bold number indicate

number of observations.

Vehicle 5μM γSI

Starting number of cells 39 90

Total Cells Tracked at end of observation period

188 198

147 102

127 (86%) 57 (55%)

16 (10%) 30 (29%)

3 (2%) 12 (11%)

Total Divisions

-Symmetric Events

-Asymmetric Events

-Symmetric Apoptosis

-Undefined 1 (1%) 3 (3%)

16 (41%) 55 (61%)

9 (21% of Quiescent) 13 (14% of Quiescent)

4 (10% of Quiescent) 11 (12% of Quiescent)

Total Quiescent Cells

-No Change

-Quiescent Neuronal

-Quiescent to Apoptosis 3 (8% of Quiescent) 31 ( 34% of Quiescent)

Total Apoptosis 14 (7%) 56 (28%)

Total Neurons 7 (4%) 22 (11%)

Average Generation Time 40.9±18.2 hours 49.7±21.4 hours

110

Figure 3-5

Diagram of monolayer cell culture in a confined 3D microenvironment. A) Standard culture

conditions are permissive for cell migration in all 3-dimensions, an aspect which makes cell

tracking difficult due to overlap of cells during videographic filming from above. B) A confined

microenvironment is created with polymer beads of a defined diameter and a culture slide. This

creates a gap under the coverslip which restricts movement of cells in 2-dimensions and greatly

facilitates live cell tracking.

111

Figure 3-6

Stochastic differentiation or asymmetric self-renewal as a result of Notch antagonism. A)

Cancer stem cells cultured in EGF/FGF have unlimited symmetric self-renewal in culture. B)

Stochasticity or evolutionary resistance upon Notch antagonism may allow a small population of

cancer stem cells to retain symmetric-self renewal. The other cells differentiate following a

neuronal lineage and eventually undergo apoptosis or fail to grow after passage. C)

Alternatively, asymmetric self-renewal may occur in all cells in culture.

112

Figure 3-7

Cell division and lineage tracking of GliNS1 glioblastoma stem cells. Representative lineage

trees illustrating GliNS1 cultured in EGF/FGF and tracked over one week. A) Representative

lineage tree of 2 cells cultured in vehicle. B) Representative lineage trees of 3 cells cultured in

5μM γSI. ○=Lost track, ►=Moved out of frame, X=Apoptosis, | =neuronal morphology

113

3.3 Discussion Despite differentiation into BrdU negative, β-IIIT positive neuronal cells in-vitro, glioblastoma

stem cells treated with Notch inhibitors retain a capacity for colony formation in-vitro and brain

tumor formation in-vivo. In-vitro, following γSI withdrawal, these cells are proliferative, colony

forming and possess multilineage capabilities when exposed to favorable conditions. In-vivo,

γSI treated cells formed tumors in orthotopic transplant models, albeit at a longer latency

compared to controls. This suggests that a tumorigenic cancer stem cell population can persist

despite Notch signalling inhibition, possibly from a shift from symmetric to asymmetric self-

renewal. By tracking cell divisions of single glioblastoma stem cells in a 2-D chamber, we

discovered that γSI indeed increased the proportion of cells undergoing asymmetric self-renewal.

In the majority of these asymmetric events, one of the daughter cells underwent apoptosis or

differentiated while the other remained unchanged. We are also able to observe the fate of cells

which do not undergo a cell division. This fraction, which we defined as quiescent, is increased

in the population treated with γSI. This is consistent with the observations made in Chapter 2,

where we demonstrated reduced proliferation with Notch blockade. Furthermore, the fraction of

quiescent cells undergoing apoptosis is elevated. 34% of all quiescent cells eventually die,

representing the majority (55%) of all observed apopotic events. Examining the bulk culture, we

found that over a quarter of all cells ultimately undergo controlled death. Thus, the decrease in

proliferation that we observe with γSI is due to a variety of factors. First, we can see that

without Notch signaling, cells are less likely to divide and are more likely to be quiescent.

Second, of the cells that do divide, there is a shift towards asymmetric self-renewal and even an

increase in double extinction of daughter cells. Finally, cell cycle time is lengthened by almost 9

hours (a factor of 1.2) in treated cells.

We questioned the mechanism of cell culture recovery and tumor formation after the removal of

Notch inhibitors and devised cell tracking experiments to help us elucidate the origins of

recovery. What is remarkable about cancer stem cells treated with Notch inhibitors is that some

cells demonstrate extensive self-renewal capability and flexibility to shift between symmetric

and asymmetric self-renewal. These observations raise intriguing questions regarding the

determinants of self-renewal and the potential of any given cell in culture. For instance, consider

the single cell that is tracked on the extreme right of supplemental figure 5. While there is an

increase in neuronal lineage differentiation and apoptosis, the lineage tree is punctuated with

114

many symmetric events interspersed with asymmetric events. It could be hypothesized that this

clone, if exposed to permissive conditions would be highly tumorigenic. Ultimately, the models

of cell fate decisions outlined in Figure 3-6 likely represent an oversimplification and these

processes require more detailed study. The data presented in this chapter illustrates the

complexity in fate choice and demonstrates that self-renewal in the absence of Notch is a

composite of all the possibilities outlined prior.

The lineage trees provided in this chapter provide functional insight at the single cell level. An

intriguing question that arises is how can one cell avoid terminal differentiation without Notch

activation? In an elegant study, Sang and colleagues showed that Hes1 expression is capable of

protecting serum starved fibroblasts from irreversible senescence and that sustained expression

of this bHLH transcription factor was sufficient to maintain reversible quiescence195. They

showed that terminal myogenic differentiation occurred when Hes1 signaling was blocked with

dominant-negative Hes1 constructs and γSI. Ultimately, they provided evidence to show that

Hes1 binds with and activates Transducing-Like Enhancer of Split 1 (TLE1), which functions as

a co-repressor that recruits Histone Deacetylases (HDAC). In Chapter 2, we have shown that

Hes1 is less sensitive to γSI blockade than Hes5 and that Hes1 expression persists in many NS

lines despite pharmacologic and DN-MAML blockade. Thus we theorize that the persistence of

low levels of Hes1 expression in glioblastoma stem cells is an adaptation, which functions as a

protective mechanism and allows for cell cycle re-entry and the prevention of irreversible

quiescence. Sang et al also showed that Hes1 expression was sufficient to prevent premature

senescence as a result of oncogene activation and that rhabdomyosarcomas express high levels of

the protein. Considering the effect on preventing senescence, it should be of no surprise that

Hes1 plays such an important role in tumorigenesis. Intriguingly however, their observation may

suggest that a tumorigenic lesion could begin in a cell population already expressing Hes1.

We observed an approximate four-fold increase in apoptotic glioblastoma cells in γSI treated

cultures compared to vehicle. Interestingly, evidence in the literature suggests that decision to

undergo apoptosis may be directly regulated by Notch. In a study conducted by Lakshmi and

colleagues, they provided evidence to show that the activated NICD interacts directly with

mitochondrial proteins to suppress the apoptotic cascade241. In a pathway independent of RBP-

jK, they showed that activation of NICD by Jagged1 allows it to bind directly to mitochondrial

surface proteins and leads to inactivation of the proapoptotic Bcl2-Associated-X-Protein (Bax).

115

Intriguingly, beyond canonical mechanisms of receptor activation, the entire canonical

downstream axis was found to be dispensable for the antiapoptotic function. Therefore, the

increases in cell death observed in cell tracking videos are consistent with the mechanism of

Notch mediated proliferation and anti-apoptotic protective effects.

Finally, an important alternative hypothesis that we have not ruled out is that cells expressing

lineage markers may be capable of ‘de-differentiation’: losing lineage marker expression and re-

acquiring stem cell properties upon reactivation of Notch signaling. To explore this possibility,

we would sort γSI treated cells positive for lineage markers and negative for stem cell markers,

and see whether this population is capable of expanding in-vitro or forming tumors in-vivo. The

process of ‘de-differentiation’ is a controversial occurance. With the advent of iPS technology, it

has been proven that some mature cell phenotypes can revert back to a pluri/multipotent cell

state with careful manipulation of defined transcription factors70. However, whether a similar

process can occur in differentiated cancer cells has not been proven.

The data presented in this thesis have identified one of the molecular switches responsible for

regulating symmetric to asymmetric self renewal in glioblastoma stem cells. Ultimately, with

knowledge of key molecular mechanisms controlling tumor growth, we have contributed to the

understanding of glioblastoma growth and disease recurrence. We are optimistic that the

findings presented in this thesis may have implications for the treatment and cure of

glioblastoma.

116


Notch antagonism induces asymmetric cell divisions in a glioblastoma stem cells. First

replicate. GliNS1 was cultured for 7 days with vehicle or 5μM γSI. An increase in asymmetric

cell divisions, apoptosis and neuronal morphology was noted. ○=Lost track, ►=Moved out of

frame, X=Apoptosis, | neuronal morphology. Horizontal line indicates point of γSI addition.

117


Notch antagonism induces asymmetric cell divisions in a glioblastoma stem cellse. Second

replicate. GliNS1 was cultured for 7 days with vehicle or 5μM γSI. An increase in asymmetric

cell divisions, apoptosis and neuronal morphology was noted. ○=Lost track, ►=Moved out of

frame, X=Apoptosis, | neuronal morphology. Horizontal line indicates timepoint of γSI addition.

118

Materials and Methods

3.3.1 Replating Assay

Cells were cultured in EGF/FGF and γSI for a period of 2 week to induce neuronal lineage

differentiation. After this period, cells were dissociated with Accutase (Sigma) and viable cells

replated into a 96 well plate at a concentration of 2000 cells/well without γSI. Cell proliferation

was measured with MTT as previously described (Chapter 2).

3.3.2 Limiting Dilution Analysis

Cells were cultured according to standard tissue culture protocol in 96 well plates. A starting

concentration of 2000 cells per well was plated in the left-most column and two-step dilutions

conducted down to a single cell per well. After one week in culture, the percentage of wells

without colonies (F0) was plotted against the initial number of cells per well (x). The number of

cells required to form one colony in every well is determined by the 0.37 intercept (F0=e-x) which

is frequency of clonogenic stem cells in the whole population from the Poisson distribution242.

3.3.3 Differentiation Protocol

Cells are cultured on a glass coverslip according to standard culture conditions. Growth factor

withdrawal induced differentiation was induced over a period of 3 weeks. In the first week of

differentiation, the cell are cultured in Neurocult media with the concentration of FGF reduced to

5 ng/ml, N2 growth supplement and 1xB27 growth supplement. Growth factors are further

reduced in the second week of differentiation to a 1:1 mix of Neurocult:Neurobasal media, ¼ N2

and 1xB27.

3.3.4 Lineage Trees

Cells were tracked in real-time as previously described240. Briefly, a cell chamber was created

by overlaying a glass cover-slip over a culture surface populated with polymer beads 7μm in

diameter. Cells cultured under this 7μm gap were then imaged every 6min using a tissue culture

camera. Media exchanges were conducted twice a week and supplemented with the γSI L-

685,458 at a concentration of 5μM or with the equivalent volume of DMSO as a vehicle control.

119

Chapter 4

4 Notch1 Receptor Mutations in Brain Tumor Stem Cells

4.1 Introduction The hypothesis that mutations within proto-oncogenes contributed toward neoplastic

transformation was first demonstrated in 1976 by seminal work by Stehlein et al243, where

normal chicken cells were found to contain sequences related to the src gene identified in avian

sarcoma viruses. Since then, mutations within proto-oncogenes are now understood to be a

major mechanism of transformation. Mutations in the Notch proto-oncogene resulting in

malfunctioning protein and contributing to neoplastic transformation has been described in

hematopoietic neoplasms. Notably, t(7;9)(q34;q34.3) translocations involving the TCR-β gene

and Notch1 gene were discovered to have a major role in T-ALL10. Mechanistically, this

translocation results in a fusion protein that deletes the extracellular domain of Notch1 resulting

in a constitutively active intracellular domain244,245.

Subsequent studies have determined that point mutations within the heterodimerization domains

and intracellular PEST sequences of the Notch1 gene are present in over 50% of all T-ALL

patients117. These mutations function by enhancing NICD cleavage and/or preventing

degradation of the activated receptor. Mutations within the heterodimerization (HD) domain

result in reduced membrane heterodimer stability and result in ligand-independent γ-secretase

processing of the receptor246. Combined with mutations in the PEST domain, the activated

receptor experiences a dramatic increase in half life, leading to precocious activation of

downstream Notch targets. Recently, mutations in Notch1 have also been identified in chronic

lymphocytic leukemia.

With the understanding of the lesion in the Notch pathway, scientists have been able to infer the

role of Notch in hematopoietic lineage decisions and have enabled a greater understanding of the

cell of origin in these cancers. In addition to this, γSI treatment for Notch mutation based T-

ALL is closer to becoming a viable treatment option. Combining γSI treatment and

dexamethasone, already in use to treat T-ALL, has led to promising results in-vitro and in-vivo

suggesting that γSI may be a viable patient treatment214. Therefore, identifying Notch mutations

in other cancers highly desired. To date, the contribution of Notch receptor mutations in other

120

diseases and cancer has been unclear. Some reports have demonstrated that some ependymomas,

CNS tumors arising in the ependyma lining the ventricles, harbor mutations in Notch1247.

However, other common malignancies fail to demonstrate mutations. No mutations have been

discovered in cervical cancers248. Therefore, the identification of Notch mutations in brain

tumors may represent a novel mechanism in the initiation and propagation of this disease and

highlight the Notch pathway as a target for drug therapy in CNS malignancies.

4.2 Results

4.2.1 Sequence analysis of the Notch1 heterodimerization and PEST domain in CNS tumors.

We have utilized primer sequences identical to those used by Weng et al, to profile the

heterodimerization and PEST domains of CNS tumors. This region of the receptor was profiled

exclusively of our screen as it had been revealed that this region harbored mutations in the

majority of Notch1 mutation positive T-ALL samples (43.7%)117. We examined genomic DNA

from archived tumor tissue isolated from 10 medulloblastoma, 38 GBM and 4 ependymoma

samples (Table 4-1). Our screen of genomic DNA from 38 GBM tissue samples revealed two

tumors (5.2%) that harbored mutations in the HD domain. In both of these tumors there was a

heterozygous guanine to an adenine missense mutation at position 4831 of the Notch1 sequence

inducing an alanine to a threonine mutation at amino acid position 1612. This novel mutation

has not been previously reported in the literature as a contributor to T-ALL, nor is it a reported

single nucleotide polymorphism (SNP). No other mutations were found in other tumor types.

121

Figure 4-1

5% of glioblastomas harbour mutations in the Notch1 receptor. A) Heterozygous mutations

were identified at position 4813 in the genomic sequence. B) The mutation corresponds to

amino acid position 1612 which corresponds to a highly conserved region of the

heterodimerization domain. C) This missense mutation mutates the first nucleotide of an alanine

codon resulting in a threonine codon.

122

4.3 Discussion In this study we have found two heterozygous mutations located in the HD domain in 3.8%

(2/52) of tumors. The absence of pervasive activating Notch1 mutations highlights an interesting

paradigm in tumor initiation and growth. Studies conducted in the past have indicated that

ectopic NICD is sufficient to transform immortalized cell lines244,249 and is required to maintain

the phenotype of Ras-transformed cell lines250. Therefore, one could expect any mutation that

extends the half-life or supports the precocious activation of the NICD would be common in

many tumors that feature activated Notch. While the presence of Notch mutations is not

widespread, there may be an explanation to the lower than expected observed frequency of

mutations. Cancer growth can be dependent on both a tumor derived and/or an exogenous

vascular niche251 to provide nutritional support, metabolic waste management and oxygen

requirements. Perhaps there is an evolutionary pressure to avoid constitutive Notch activation

which would otherwise limit or deny the repertoire of supporting cell fates. Indeed, the

subventricular zone niche is composed of transient amplifying cells which are the progeny of the

bona-fide Type-B stem cell252. The generation of these supporting cells would depend on the

ability of the stem cell to downregulate Notch signaling in daughter cells, a function that would

most certainly be impaired if Notch signaling is constituitively active. The ability of a neural

stem cell or cancer stem cell to cell autonomously generate a supporting niche is a significant

evolutionary advantage, and thus mutations which select against this ability may be unfavorable

in malignancies driven by cancer stem cells. This requirement for de-novo niche generation may

also explain the prevalence of Notch mutations in some hematopoietic cancers versus solid

cancers. Cancer stem cells in some hematopoietic malignancies are capable of usurping normal

bone marrow niches and disrupting the behavior of normal hematopoietic progenitor cells253.

Thus, leukemic stem cells are not pressured to retain the full repertoire of diverse cell fates

required to generate a supporting environment. This hypothesis is consistent with our previous

findings as we have demonstrated that not all of the cells in our relatively homogenous NS

cultures possess nuclear localization of activated Notch, suggesting the differential regulation of

Notch activation within cells in the tumor. Whether these Notch negative cells have a supporting

function in NS lines is yet to be determined. Taken together, our data demonstrate that a fraction

of brain tumors harbor Notch1 mutations. However, we do not rule out the possibility that

alternative mechanisms of aberrant Notch signaling supports brain tumor initiation and growth.

123

Activating Notch mutations are commonly found in T-ALL and now known to be a significant

contributor to the mechanism of leukemia initiation. Paradoxically, a recent discovery has also

implicated inactivating Notch mutations in the perpetuation of chronic myelomonocytic

leukemia (CMML). What was discovered was that mutations within Nicastrin, APH1, MAML1

or Notch2 functioned to disrupt downstream Hes1 signaling and lead to leukemia generation in

5/42 patients254. Thus, this study demonstrates that Notch signals exist in a fine balance in

hematopoietic development. Excess signaling can push hematopoietic stem cells to the T-

lymphocyte cell fate and T-ALL, whereas insufficient signaling can promote

granulocyte/monocyte progenitors leading to CMML. In our study, we have demonstrated that

5% of glioma (38 malignant glioma and 4 ependymoma) harbour activating Notch mutations.

Considering the model of Notch in leukemia, we would expect to discover mutations in glioma

since Notch activation plays a role in glial development. In contrast, Notch normally suppresses

neuronal cell fate. In our study, none of the 10 medulloblastoma samples were found to have

Notch mutations. Since Notch is responsible for glial specification, future studies in our lab will

focus on the identification of mutations in neuronal tumors. Identification of inactivating Notch

mutations in receptors or γ-secretase components in medulloblastoma would be an insightful

discovery and would help explain the mechanism of neuronal tumor development.

124

DomainTumor Type HD PEST

GBM1 A1612T NoneGBM2 A1612T NoneGBM3 None NoneGBM4 None NoneGBM5 None NoneGBM6 None NoneGBM7 None NoneGBM8 None NoneGBM9 None NoneGBM10 None NoneGBM11 None NoneGBM12 None NoneGBM13 None N/AGBM14 None N/AGBM15 None N/AGBM16 None N/AGBM17 None N/AGBM18 None N/AGBM19 None N/AGBM20 None N/AGBM21 None N/AGBM22 None N/AGBM23 None N/AGBM24 None N/AGBM25 None N/AGBM26 None N/AGBM27 None N/AGBM28 None N/AGBM29 None N/AGBM30 None N/AGBM31 None N/AGBM32 None N/A

DomainTumor Type HD PEST

Medullo1 None NoneMedullo2 None NoneMedullo3 None NoneMedullo4 None NoneMedullo5 None NoneMedullo6 None NoneMedullo7 None NoneMedullo8 None NoneMedullo9 None NoneMedullo10 None NoneMedullo11 N/A NoneMedullo12 N/A NoneMedullo13 N/A NoneMedullo14 N/A NoneMedullo15 N/A NoneMedullo16 N/A NoneMedullo17 N/A NoneMedullo18 N/A NoneEpendymoma1 None N/AEpendymoma2 None N/AEpendymoma3 None N/AEpendymoma4 None N/A

Table 4-1

Summary table of brain tumors profiled for mutations in Notch1. Genomic DNA from three

subtypes of brain cancer was profiled for mutations in the HD and PEST regions of Notch1.

125

4.4 Materials and Methods

4.4.1 Genomic DNA extraction

Patient samples were obtained with proper ethics approval and informed consent. Tissue was

immediately snap frozen in liquid nitrogen for archival purposes. Genomic DNA from primary

tumor tissue was isolated by Trizol (Sigma) extraction according to protocols.

4.4.2 Nested Polymerase Chain Reaction

Notch1 HDN1 and PEST amplicons were amplified using nested PCR. Primers used were the

same primers utilized as Weng et al117. First HD amplicon primer: F1

5’AGCCCCCTGTACGACCAGTA R1 5’CTTGCGCAGCTCCTCCTC F2

5’GACCAGTACTGCAAGGACCA R2 5’TCCTCGCGGGCCGTAGTAG.

4.4.3 Sequencing

Nested PCR products were cleaned with Qiagen PCR cleanup kit. DNA sample was sequenced

by The Centre for Applied Genomics (TCAG). Trace sequences were viewed with Finch TV

and Chromas. Sequence alignments conducted with BioEdit.

126

Chapter 5 General Discussion

5.1. Targeting Notch in Brain Cancers

5.1.1. Cancer Stem Cells are Controversial

Since the identification of a tumorigenic population in breast95 and brain97,107,98 malignancies

there has been an explosion of international effort to identify similar populations in all forms of

solid and hematopoietic cancers. The effort of dozens of independent laboratories has identified

putative human solid cancer stem cell origins in prostate96, colon99,100, pancreas101,255,

mesenchyme102, skin103,104, ovaries105, head & neck106 and lung56 cancers. These studies,

including the work presented in this thesis, have relied on mouse models of xenotransplantation

to study cells capable of tumor propogation. With technical and ethical limitions in mind, there

is ongoing debate regarding the universality, applicability and clinical relevance of the cancer

stem cell hypothesis. These questions are invoked by a study of B-Cell lymphoma. Utilizing an

Eµ-myc pre-B/B, Eμ-N-Ras and PU.1-/- AML mouse models, it appeared that tumor formation

did not correlate with number of cells injected or surface marker expression256. Another

argument is that identification of cancer stem cells using muring transplant models identifies

cells capable of growing within genetically modified animal strains. Xenograft hosts are been

bred to lack immune response and the compatibility of human cells with a murine

microenvironment arguably differs from syngeneic models. Indeed, a study of skin cancers

revealed that individual unsorted melanoma cells possessed efficient tumor forming capabilities

in transplant assays whereas other studies identified subpopulations of melanoma intiating cells

identified by ABCB5 or CD271 in an NSG mouse strain104,103, Quintana and colleagues showed

that the efficiency of tumor formation was irrespective of marker expression and importantly,

could be increased with the use of a highly immunocompromised NOD/SCID interleukin-2

receptor gamma chain null (Il2rg(-/-)) mouse model257,258. Notwithstanding the future

development of more sophisticated assays, the cancer stem cell hypothesis may not be

universally applicable to all malignancies. Within the central nervous system, mouse models of

various brain cancers support the cancer stem cell and hierarchical organization of these

tumors130,259,260. Recently, Eppert and colleagues characterized gene expression profiles of AML

leukemic stem cells (LSCs) and found that they shared a transcriptional profile similar to HSCs.

Importantly, LSCs were validated to be tumorigenic with NOD/SCID xenograft models and

127

expression of a stemness profile correlated directly with a poor clinical outcome in the original

patient261. Data presented in this thesis demonstrate patterns of gene expression in glioblastoma

stem cells that cluster closely with human fetal neural stem cells. Whether the similarities in

expression profiles found in glioblastoma stem cells and neural stem cells possess similar

prognostic value is a question being addressed by our laboratory. Recent studies indicate that

stemness genes such as CD-133 and Nestin, are associated with a poor outcome in patients with

glioma262,263,264. Using this knowledge in clinical decision making warrants careful validation

since the prognostic value of stem cell markers remains controversial265. Taken together, a

hierarchical cancer stem cell organization may not exist in all tumors but evidence exists to

support such a hierarchy in blood and brain. These studies underscore the importance of

technical validation and healthy skeptiscm when the ultimate goal is attempting to minimize the

human cost of cancer.

5.1.2. Cancer Stem Cells as a Therapeutic Target

Glioblastoma is the most common brain tumor in adults with very poor survivability. While a

great deal of progress has been made in understanding the molecular genetics and determinants

of this disease many of the therapeutic strategies in use are only marginally effective212,147,213,144.

Understanding the cellular origins and molecular vulnerabilities of this disease will be paramount

for the development of successful patient treatments.

Mizutani and colleagues demonstrated that Notch signaling is not an absolute indicator of murine

neural stem cells266. Activated Notch was assayed in murine telencephalic ventricular zone cells

with an EGFP reporter construct and thus stratifies Notch activity upon expression of EGFPhi

versus EGFPlo. Based upon the high and low levels of Notch activity, they were able to

distinguish populations of neural stem cells (NSCs) and intermediate neural precursors (INPs)

respectively. While both populations utlitized Notch receptor signaling, only neural stem cells

signaling through CBF-1 were capable of long term self-renewal. INPs, in contrast, signalled

independently of CBF-1 and, while proliferative, possessed limited self-renewal. Further

downstream of the pathway, it was discovered that NSCs were enriched predominantly in Hes5,

whereas INPs expressed higher relative Ascl1. Upon differentiation, EGFPhi NSCs generated

multipotent cells with a strong bias towards GFAP positive astrocytes whereas EGFPlo cells

overwhelmingly generated β-III-tubulin positive neurons. There are several parallels between

128

the study conducted by Mizutani et al., and the work presented in this thesis. The class of NS

lines that we termed ‘neurogenic’ express high expression of Ascl1 relative to ‘non-neurogenic’

lines. While none of the NS lines demonstrate an exclusive bias towards neuronal lineage

differentiation upon growth factor withdrawal differentiation (Supplementary Figure-5), Ascl1

expressing cell cultures acquire more neuronal lineage markers upon active Notch blockade.

Arguably, the spontaneous neuronal lineage differentiation observed by Mizutani in INPs in their

differentiation assays could be due to spontaneous loss of Notch signaling. Since FGF2 is

known to feed back on Notch signals and suppress neurons, growth factor withdrawal further

pushes INPs along their neurogenic lineage267. That ‘neurogenic’ lines such as GliNS1, do not

undergo overwhelming or exclusive neuronal differentiation upon growth factor withdrawal may

reflect an astrogliogenic role for the Notch axis in a differentiating environment and/or

functional lateral inhibition. Therefore using the framework delineated by normal neural

developmental, ‘non-neurogenic’ lines are most closely analogous to Notchhi NSCs and

‘neurogenic’ lines are more analogous to Notchlo INPs. What is the significance of these

parallels? Evidence suggests that the stemness role of Notch in tissue stem and/or progenitor

cells is preserved. In hematopoietic stem cells (HSC), the EGFPhi and EGFPlo/neg possess equal

colonly forming ability in-vitro. However, the EGFPhi cells were more likely to form colonies

containing multiple hematopoietic lineages whereas the EGFPlo/neg cells formed more unipotent

colonies268. Considering these close parallels, using what known to modulate normal tissue stem

cells to cancer stem cells may be more applicable than previously thought.

5.2. Notch and the Cancer Niche

Cancer stem cells and neural stem cells have been shown to possess many common biochemical

features. Recent focus on the tumor microenvironment has raised the possibility of indirectly

killing cancer stem cells by affecting the physical environment in which it resides. Normal

neural stem cells are found in structured microenvironments capable of supporting metabolic

needs and providing a physical environment that facilitates controlled self-renewal. In normal

adult brain, neural stem cells within the subventricular and hippocampal regions reside within a

perivascular niche269,252,270. Importantly, niche endothelial cells support neural stem cell self-

renewal and neurogenesis by activating Notch signaling in stem cells directly82,29,271 and through

secreted factors272. Many parallels between normal and cancer stem cells can be drawn and

indeed, growing evidence suggests that cancer stem cells also reside within a specialized

129

vascular niche251. Endothelial activation of Notch receptors occurs in the tumor

microenvironment and proof of concept experiments have shown that targeting endothelial cells

within the tumor are effective in limiting activation of Hes proteins140.

Angiogenesis, the process of new blood vessel growth from an existing vascular network, is a

requisite process for supplying the metabolic demands of a solid tumor growth. An attractive

therapeutic target, blockade of the chemokine Vascular Endothelial Growth Factor (VEGF) is the

basis for treatment with monoclonal antibody Bevacizumab. Recently, the process of retinal

angiogenesis was found to be regulated by Dll4-Notch1. High Notch activity in response to local

VEGF restricted tip cell growth and promoted stalk phenotypes, ultimately leading to budding273.

Further, Notch components are targets of downstream VEGFR-3 signaling in stalk cells as

knockdown of the receptor phenotypically recapitulates tip cell hyperplasia and disorganized

vessel growth associated with Notch antagonists274. This mechanism of sprouting is persevered

in tumors and indeed, blockade of Dll4 is sufficient to inhibit tumor growth. Paradoxically,

Notch inhibition induces vascular hyperplasia albeit forming disorganized vasculature that is

postulated to lack appropriate functionality as a nutrient delivery system275. Intriguingly, these

studies raise the question of whether the disorganized vascular niche would be capable of

supporting self-renewal of cancer stem cells in close proximity. At the time of this writing, it is

unclear whether self-renewal of neural and/or glioma stem cells are preferentially regulated by

either tip cells or stalk cells. Whether vascular metaplasia can be co-opted to induce a favorable

clinical outcome deserves investigation.

Interestingly, there is recent evidence to demonstrate that glioma may make direct cell

contributions to their own vascular niche in a mechanism utilizing Notch signaling. Ricci-Vitiani

and colleagues demonstrated that the tumor vasculature contained CD31+/CD144+ endothelial

cells with the same chromosomal alterations as the tumor cells themselves, suggesting a tumor

cell origin276. Wang and colleagues demonstrated similar findings and interestingly found that

differentiation of glioma stem cells into CD144+ endothelial cells was dependent upon active

Notch signaling. Blockade of Notch with DAPT prevented the endothelial differentiation of

CD133+/CD144- tumor cells but not CD105+ endothelial cells lacking tumor origin277.

The Notch signaling pathway may also preside over non-vascular elements of the stem cell

niche. Extracellular matrix proteins (ECM) are often over expressed in tumors possess many

130

diverse functions such as formation of tumor architecture, protection from host immune

surveillance, activation of cell surface ECM binding proteins and providing physical pathways

for migration and dissemination278. Within the spectrum of glioma and breast malignancies,

expression of an ECM protein Tenascin-C is correlated with aggressiveness and is associated

poor patient prognosis279,280. Interestingly, TNC was recently discovered to be a direct target of

activated Notch. Sivasankaran and colleagues demonstrated that the Tenascin-C promoter

possesses RBP-jK binding sequence. Further, they demonstrated that Notch2 actively promotes

transcription and protein production resulting in enhanced cell migration281. While their study

examined the effects of Notch blockade in serum derived glioma lines, their work provides

compelling evidence that shows a multifaceted role for Notch in tumorigenesis that extends far

beyond what is currently understood.

5.2.1. Insight from Neurodegenerative Disease Treatment

The discovery of a rare subpopulation of tumorigenic cancer stem cells identifies an obvious

therapeutic target. We have proven that some patient derived cancer stem cells possess a robust

clonogenic frequency along with migratory abilities, thus it is not surprising that this disease

frequently recurs at locations proximal to the original tumor144. Identifying ways to target this

rare cell population will be critical to improve survival of GBM patients beyond the current

average of 14.6 months143. In Chapter 2, as a proof of concept we have demonstrated that γSI is

an effective Notch antagonist that induces lineage commitment in some CSCs. γ-secretase is not

a novel therapeutic target and lessons from other fields of research could be adapted to target

cancer. One strategy is to utilize the pharmacologic compounds developed for the treatment of

Alzheimer’s disease (AD). AD is a neurodegenerative disorder characterized by buildup of

amyloid-β-protein senile plaques in the brain. The key step in pathology of this disease is γ-

secretase cleavage of amyloid precursor protein (APP)282 which subsequently forms insoluble

protein aggregates which accumulate in the CNS. Existing therapies and research in AD have

identified γ-secretase specific compounds which are well tolerated and effectively cross the

blood brain barrier. One of these drugs is γSI LY450139 (Semagacestat). This compound has

successfully passed phase II clinical trials with well tolerated side effects and is currently in large

scale phase III clinical trials283. While many AD drugs are designed for APP specificity, there is

evidence from clinical trials to demonstrate that these drugs have a Notch inhibitory effect. One

such manifestation in LY450139 trials was the reversible lightening of hair color in some

131

subjects. Interestingly, analogous effects were observed in several murine studies of the Notch

pathway. The survival of melanoblasts and melanocyte stem cells, cell populations responsible

for regulating hair pigmentation, is regulated in a Hes1 dependent mechanism. Abolishing

Notch signaling by topical γSI treatment or melanoblast specific Hes1 knockouts induced

apoptosis in these cell types which manifests as graying hair colour284,285. Taken together, these

human side effects in Alzheimer’s treatments are indicative of Notch antagonism suggesting that

existing drugs in advanced clinical trials could potentially be used to specifically block Notch in

brain cancers. These clinical studies are even more significant due to progress in side effect

management. Systemic Notch blockade at high doses have significant gastrointestinal effects

due to the differentiation of goblet cells in the intestinal crypt niche286,287. Recent studies have

demonstrated that these effects can be mitigated by combination therapy with corticosteroids

such as dexamethasone214. Alternatively, targeting redundant Notch receptors with inhibitory

antibodies197 has been shown to circumvent intestinal goblet cell metaplasia. Thus, targeting

Notch in glioma stem cells through existing Alzheimer’s treatments may be a viable therapeutic

strategy.

5.2.2. Therapeutic Specificity

With the growing popularity of the CSC hypothesis, there is a strong emphasis on the

development of therapies which distinguish CSCs from normal SCs to spare normal tissues and

cells from the toxic effects of chemotherapy. As of yet, very few feasible targets for CSC

specific therapy have been discovered. Underscoring this challenge, our microarray data show

that CSC’s from some glioma subgroups closely resemble normal neural stem cells and therefore

distinguishing cancer from normal stem cells may be difficult based on gene expression. Thus

our data and others highlight some of the fundamental controversies with CSC research: is it

possible to specifically target CSCs with Notch signaling? If not, what are the ramifications of

Notch blockade in the CNS? Few translational studies exist that can help answer these questions

and therefore we must extrapolate animal studies to predict human effects. Blockade of Notch

signaling in adult murine models induces neuronal commitment and depletion of the self-

renewing population over the long term288. Interestingly, neuronal lineage induction appears to

be functional as rats treated with γSI demonstrated enhanced contextual and spatial memory219.

The role of Notch signaling in memory formation is still poorly understood, however it appears

as though canonical Notch/Hes downstream signaling is critical for memory formation in mouse

132

models289,209. It is unknown whether the burst of neurogenesis followed by a deficiency in long

term neural birth would be a perceptible effect in human patients. Under the extreme scenario, a

global deficit in neurogenesis could recapitulate the dramatic effects observed in the patient

“H.M”. This patient had a resection of the medial temporal lobe to alleviate severe epileptic

seizures. In what is known to be a major contribution to the field of neuroscience, a side effect

of this operation resulted in severe anterograde amnesia due to the complete removal of the

hippocampus290, a structure which harbors neural stem cells67 and is critical for the formation of

new declarative memories. In designing cancer treatments that aim to differentiate BTSCs, we

must be cognizant of the chance that normal neural stem cells may be affected. Thus, the

development of anterograde memory defects may be a sign of early neural stem cell depletion.

Since there is a documented age related depletion of normal neural stem cells, these side effects

may be more pronounced in older individuals and therefore this strategy may be contraindicated

in patients determined to be at risk for memory defects291. Although, considering the poor

survival of patients with primary glioma, this trade-off may an acceptable compromise.

5.2.3. Forcing lineage choice as a treatment for cancer

The identification of cancer stem cells with multi-lineage potential raises the prospect of forcing

differentiation to a growth restricted cell type as cancer therapy. This approach has been used

with great effect in ATRA therapy for PML but the mechanisms of steering lineage commitment

is poorly understood in solid malignancies. Since ATRA therapy does not exert a therapeutic

effect in other forms of leukemia292, it clearly illustrates a need for understanding mechanisms

regulating differentiation in each type of cancer. In a study examining the effect of Notch

blockade in a Neu (N202) mouse model of breast cancer, it was found that pharmacologic Notch

blockade was effective in reducing the tumorigenicity of the cancer initiating cells. When

compared to vehicle controls these cells were found to express CK14 and/or α-SMA,

myoepithelial lineage markers293. Indeed, in a clinical setting, absence of CK14 can be

associated with ductal carcinoma and expression of α-SMA is often associated with benign

papilloma294. We have demonstrated that we can induce robust neuronal lineage differentiation

in a subset of glioblastoma stem cell lines upon Notch blockade. However, if we can steer

differentiation to one of the three cell fates in the brain (neuron, astrocyte, oligodendrocytes),

which cell fate would be most limited in proliferative potential and thus the most useful in cancer

treatment? Gross and colleagues demonstrated that astrocytes can be induced through

133

stimulation of the bone morphogenic protein (BMP) signaling pathway295,296. Interestingly,

despite the expression of glial markers, cell counts of NSCs after BMP treatment revealed a

small, but significant increase in the number of cells compared to controls suggesting some

proliferative capacity in BMP induced astrocytes. Their study supports other observations that

show proliferation of glial cells in-vitro297. Cells positive for other glial markers like A2B5298

and S100β299,300 all retain some degree of proliferative ability suggesting that glial lineage may

be an undesirable fate for cancer stem cells. In contrast, our data and others support the finding

that neuronal precursors are less proliferative. Differentiation of E14.5 neurospheres with BDNF

results in cells that fail to incorporate BrdU showing that neuronal lineage is more restricted than

other subtypes found in the CNS297. Determining a linage that is most growth restricted is an

endeavour deserving careful and cautious interpretation. For instance, medulloblastomas are

malignant tumors manifesting in the cerebellum of primarily paediatric patients. These tumors

possess a primitive phenotype and proliferate rapidly, yet express neuronal signature.

Expression of neuron specific markers such as NeuN, synaptophysin and MAP-2 is common

upon gross pathological evaluation of these primitive tumors301,302. However, functional

differentiation is still possible in this class of brain tumors. For instance, miR-34A which

negatively regulates Notch through Dll1 downregulation induces neurite outgrowth and

diminishes tumorigenicity in a Patched1+/- P53-/- model of medulloblastoma303. Treatment

directly with γSI is known to induce functional neuronal differentiation in these cancers304.

Indeed, mouse models of medulloblastoma have illustrated a hierarchical organization of these

tumors. Less differentiated cell populations expressing CD15 give rise to the marker positive

cells lower in the tumor hierarchy and are commonly seen in immunohistochemical staining130.

In the context of neuronal differentiation, these studies underscore the importance of probing for

functional differentiation and highlight the fact that neuronal marker expression is insufficient as

a determinant of differentiation. Therefore, neuronal differentiation of glial brain tumors may

be the most desirable outcome in cancer therapy.

5.2.4. Glioblastoma prevention

Considering the severity of malignant glioma, what are the known risk factors associated with

glioma and what are the countermeasures that can be employed in the prevention of this disease?

γ-secretase is a known target for several different pharmacological compounds. One large class

of compounds are non-steroidal anti-inflammatory drugs (NSAIDs). Ubiquitous NSAIDs such

134

as ibuprofen and flurbiprofen rapidly pass through the blood brain barrier305 and are known to

inhibit γSI function by allosteric inhibition306. Therefore, is it possible that long term use of

these drugs may suppress aberrant Notch signals and prevent/delay brain cancer development?

An epidemiological study by Sivak-sears et al., showed that there was a significant inverse

association of long term NSAID use and GBM incidence. Glioblastoma patients were less likely

than control individuals to have consumed more than 600 doses of NSAIDs over a 10 year

period307. Furthermore, patients who regularly consumed NSAIDs such as acetylsalicylic acid

(Aspirin) which does not have the capacity to block APP processing by γ-secretase308 did not

demonstrate as significant a preventative trend in cancers outside of the gastrointestinal tract309.

Surprisingly, there are few studies examining the role of NSAIDs on Notch signaling and none

investigating the effect of NSAIDs and other Cox-2 inhibitors in cancer stem cells. One recent

study has shown that ibuprofen is effective at blocking Notch activation in serum cultured lines

derived from adenocarcinoma of the colon310. Thus, the use of relatively safe and ubiquitous

NSAIDs is a preventative treatment that should be considered in patients with a familial risk of

cancer.

5.3. Origins and mechanisms of brain tumors

5.3.1. A neural stem cell as the cancer stem cell

Brain cancers have for generations been thought to arise solely due to transforming events

occurring in glial cells in the CNS311. This method of thinking was due, in part, to the poor

understanding of normal brain plasticity and the dogma that the brain was solely a post-mitotic

organ312,313. There is now a wealth of knowledge to support the existence of self-renewing

populations of neural stem cells residing in multiple regions of the mammalian brain67,60,314.

Considering the capacity for self-renewal and ability to proliferate rapidly in response to

injury315,316,317, a reasonable hypothesis is that gliomas are most likely originate from

transformed neural stem cells and not from post mitotic neurons or astrocytes. Indirect evidence

to support this hypothesis exists from insightful experiments conducted by Hopewell and Wright

in the 1960’s. To induce glioma in rat models the researchers implanted a carcinogenic pellet in

various regions of the brain. Placement of the transforming agent adjacent to the subventricular

zone dramatically increased the frequency of cancer compared to other regions318. A more

recent study has shown that conditional inactivation of tumor suppressors p53, nf1 and Pten in

135

Nestin positive stem and/orprogenitor cells of the murine brain were sufficient to induce

malignant astrocytomas319. Additional evidence stems from studies where lentiviral vectors were

employed to transduce cells with h-Ras and Akt in various regions of the mouse brain.

Consistent with previous experiments where Ras and Akt expression in Nestin and not GFAP

positive cells induced cancer320, tumors were only observed when injection of virus occurred in

the proliferative regions: the subventricular zone and hippocampus321. Ultimately, while a

growing body of evidence points to neural stem cells as a cell of origin in CNS tumors, this may

not be the rule in all forms of cancer. Recent reports suggest that peripheral nerve sheath tumors

arising in the peripheral nervous system have a more differentiated cell of origin322,323 and thus

these problems must be solved through careful and thorough characterization. Delinating the cell

of origin for tumors is significant beyond simple scientific curiosity. Understanding how and

when genetic lesions accululate in a succeptible cell population could be important in the

prevention and management of disease. From an anatomic standpoint, understanding where

cancers are most likely to originate can greatly aid in screening and prevention of advanced

malignancies. From a biochemical standpoint, many cell signaling dependancies are preserved

in the pathological population, and thus understanding lesions arising in the cell of origin

provides new rationales for directed treatment. Indeed, in the context of this thesis, comparison

to human fetal stem cells was crucial to identify exploitable vulnerabilities in the cancer

initiating cell.

5.3.2. Symmetrical versus asymmetrical self-renewal in neural stem cells and cancer stem cells

Stem cells undergo a tightly regulated process where they generate additional stem cells or

differentiate into progeny progenitor cells with a more committed phenotype. A mitotic event

where both of the above cell types are generated is asymmetric self-renewal which occurs with

regularity in most postnatal stem cells and is a requisite event in tissue homeostasis. Stem cells

also possess capacity for clonal expansion, a symmetrical self renewal event generating two

identical cells which is an important process during developmental patterning324 or injury

response325. If the cell of origin is a stem cell, is it possible that a lesion in this cell type would

favor symmetric cancer stem cell expansion over asymmetric self-renewal? Cicalese and

colleagues demonstrated that mammary stem cells predominantly undergo asymmetric self

renewal, generating a predictable cluster of five cells over three cell generations. They

136

documented a cytoplasmic fluorescent label retaining stem cell dividing once to maintain its

number, and rapidly dividing progenitors dividing twice to generate four daughters.

Interestingly, Erbb2 transformed mammary stem cells generated a cluster of eight cells with

equal label retention over the same period of time, reflecting three-generations of symmetric

division326. In the studies we have conducted, human fetal cells expand symmetrically, likely

representing the highly proliferative developmental state from which they were derived and the

inherent bias towards clonal expansion that is due to the NS culture system. The hypothesis that

normal human neural stem cells become transformed and shift from asymmetric to symmetric

self renewal is a theory that is difficult to address owing to the technical challenges and lack of

donor samples. In our study we are able to demonstrate that inducing asymmetric self-renewal

can decrease tumorigenesis in xenograft models. Using pharmacologic inhibitors of Notch we

demonstrated that we are able to induce asymmetric self renewal events in glioma cell lines

programmed to symmetrically self-renew. Our data has important implications for patient

treatment strategies and mechanisms of disease recurrence. Other studies using glioma stem cells

show that γ-secretase blockade results in an proliferative deficit primarily due to an increase in

apoptosis139. To building upon prior works, in addition to apoptosis, we have proven that the

proliferative deficit is due to neuronal lineage commitment of a daughter progenitor cell from an

asymmetrically self-renewing cancer stem cell. We are able to resolve these functional

differences in our in-vivo orthotopic strategy and replating experiments. Fan and colleagues

conducted in-vivo experiments with persistent administration of γSI soaked polymer beads, an

approach that may be subject to variations in dosage in-situ in addition to the potential for very

high proximal concentrations of γSI that may induce non-specific toxicity. Our ex-vivo approach

has the advantage of revealing remission status, a common occurrence in individuals with high

grade glioma.

5.3.3. Cancer as a caricature of development

Cancer has previously been described as a mockery of normal tissue development, often

containing multiple histological characteristics of the different cell types derived from the

originating embryonic germ layer. Therefore, is it possible that a brain tumor can recapitulate a

specific stage in development? Lee and colleagues observed that glioma stem cells derived from

patient GBM were sensitive to BMP treatment and express lineage markers in response to BMPR

activation. Interestingly, they also observed that some patient CSCs increased proliferation and

137

failed to differentiate in response to BMPs. They postulated that this was due to ‘mimicry’ of the

primitive E11 murine stage of development which is insensitive to BMP signals whereas the

majority of BMP responsive lines were BMPR1B positive and recapitulated the later stages of

embryonic neural stem cells327. Our study and others212, have characterized a proneural

expression profile amongst a subset of glioma. We have demonstrated that this subset,

characterized by high Dll3 and Ascl1 expression, acquires neuronal lineage markers upon Notch

blockade. Are there cell types in the normal developing mouse forebrain with similar patterns of

expression? At E12.5 in murine development, neural stem cells highly express neurogenin1/2

and Mash1 to promote a neurogenic program and induce neuronal differentiation. E14.5 cortical

precursors, in contrast are programmed for glial differentiation to support growth and

development existing neurons. Thus, these glial programmed cells are refractory to ectopic

expression of Mash1328. In our observations, neurogenic glioblastoma lines genetically resemble

the early E12.5 stage in development whereas non-neurogenic lines appear to recapitulate the

glial stages of development commonly seen at E14.5 and later. Indeed, we have shown that glial

phenotypes persist in this class of NS lines even when Ascl1 expression is rescued by Notch/Hes

blockade, suggesting insensitivity to the neurogenic effects of Ascl1. Additionally, Hirabayashi

and colleagues showed that E11.5 early neural progenitors are responsive to stabilized β-catenin

and undergo neurogenesis, an effect that diminishes in late culture neurospheres and the more

mature embryonic forebrain SCs. Electroporation of Wnt3A in the E13.5 cortex also promotes

ectopic neuronal growth resulting in cortical dysplasia and neuronal heterotopia.

Correspondingly, electroporation of Dkk1 at E13.5 or E15.5 reduces the prevalence of Ctip2 and

Cux1 positive neurons respectively329. Further, NSCs derived from E17.5 embryos are not

responsive to Wnt pathway activation330. Indeed, this hypothesis is supported by our synergistic

experiments with Wnt agonists. We showed that activation of the Wnt signaling pathway by

blockade of GSK-3β effectively synergizes with Notch antagonists in neurogenic lines but not

non-neurogenic lines. Taken together, human glioblastoma stem cells can be functionally

classified into groups that recapitulate normal stages of CNS development (Figure 5-1).

Identifying the patterns of gene expression which label CSCs as resembling early or late neural

precursors may allow us to predict to the responsiveness of glioblastoma to certain pathway

agonists/antagonists and lead to the development of tailored patient therapies.

138

Figure 4-2

NS lines recapitulate stages of embryonic neocortical development. Glioma and human fetal

neural stem cell lines demonstrate features of gene expression and neurogenic response to

signaling pathway activation that resemble stages of murine development. Based upon the

lineage marker in response to Notch antagonists and Wnt agonists, NS lines can be putatively

stratified into groups resembling ‘early’ neurogenic stem cells (E10-E14) or ‘late-stage’

astrogenic (E14-P0) stem cells.

139

5.4. Future Direction This thesis has provided evidence to support the role of the Notch pathway in cancer stem cell

self-renewal and lineage commitment. As a preclinical model of brain tumor formation, we have

unveiled previously unappreciated roles for Notch in the regulation of symmetric growth in

cancers. These findings raise additional questions and queries that are to be addressed by the

author of this thesis and colleagues; present and future.

5.4.1. How can we target non-neurogenic glioblastoma?

This thesis has shown that a subset of glioblastoma stem cells marked by high Ascl1 and Dll3

expression undergoes neuronal lineage differentiation in response to Notch blockade. Principle

component analysis of the two subgroups identified by neuronal differentiation response showed

significant differences in gene expression between the two groups (Table 2-2). Several probe

sets in this list corresponded to the HMG-box transcription factor Sox4. Evidence from the

literature supports the argument that this gene has critical functions in neuronal survival and

nervous system development. In the developing murine CNS, over expression of Sox4 causes

cerebellar malformation due to an absence of Bergmann glia202 and astrocytic differentiation in-

vitro down regulates Sox4331, suggesting an anti-gliogenic role. Additionally, forced expression

of Sox4 in oligodendrocytes precursors prevents maturation and inhibits myelination332.

Expression of the transcriptional repressor protein REST/NRSF, an inhibitor of Sox4, inhibits the

expression of neuronal markers in undifferentiated neural cells333. Collectively, these studies

support the hypothesis that Sox4 has a role in neuronal lineage commitment at the expense of

other cell types and thus relative under expression of this gene in non-neurogenic NS lines may

explain why these cells fail to undergo neuronal differentiation.

Interestingly, Sox4 may have roles in regulating Wnt and Notch signaling. Sox4 stabilizes

activated β-catenin and can directly interact with the TCF/LEF activation complex thereby

potentiating Wnt signaling334. Moreover, HMG-box factors have classical roles in activating

transcription and Sox4 targets include the frizzled receptors and the Notch Delta-like ligands335.

Therefore, we have presented compelling evidence which would support the role of Sox4 in the

neuronal differentiation of neurogenic NS lines. It is an intriguing possibility that over

expression of Sox4 in NS lines via a delivery vector may rescue neuronal lineage differentiation

140

in our resistant lines. We therefore hypothesize that the defect in neuronal lineage differentiation

may be due to a lack of Sox4 expression and that activation of Sox4 protein expression, either

exogenously or by suppressing negative regulators of Sox4 may restore this cell fate.

5.4.2. Targeting Notch in CNS tumors

Finally, the findings presented in this thesis have been exclusive to glioblastoma. However,

many other brain cancer subtypes contribute to overall cancer deaths. As our lab develops the

technical sophistication to study medulloblastoma and ependymoma stem cells as adherent

precursor cultures, we will use the same approach documented in this thesis to study the role of

Notch in these cancers. We hypothesize that symmetric versus asymmetric cancer stem cell self-

renewal is regulated by Notch signaling in medulloblastoma and ependymoma stem cells. We

perturb Notch signaling in these cell populations and document the effect via live cell imaging.

141

References 1. Jemal, A. et al. Cancer statistics, 2009. CA: a cancer journal for clinicians 59, 225-249

(2009).

2. Committee, C.C.S.s.S. Canadian Cancer Statistics 2009. (2009).

3. Louis, D., Ohgaki, H., Wiestler, OD., Cavenee, WK. WHO Classification of Tumours of the Central Nervous System. WHO Press (2007).

4. Hanahan, D. & Weinberg, R.A. The hallmarks of cancer. Cell 100, 57-70 (2000).

5. Knudson, A.G., Jr. Mutation and cancer: statistical study of retinoblastoma. Proc Natl Acad Sci U S A 68, 820-823 (1971).

6. Darnell, J.E., Jr. Transcription factors as targets for cancer therapy. Nature reviews 2, 740-749 (2002).

7. Louvi, A. & Artavanis-Tsakonas, S. Notch signalling in vertebrate neural development. Nat Rev Neurosci 7, 93-102 (2006).

8. Greenwald, I. LIN-12/Notch signaling: lessons from worms and flies. Genes Dev 12, 1751-1762 (1998).

9. Artavanis-Tsakonas, S., Matsuno, K. & Fortini, M.E. Notch signaling. Science 268, 225-232 (1995).

10. Ellisen, L.W. et al. TAN-1, the human homolog of the Drosophila notch gene, is broken by chromosomal translocations in T lymphoblastic neoplasms. Cell 66, 649-661 (1991).

11. Haines, N. & Irvine, K.D. Glycosylation regulates Notch signalling. Nat Rev Mol Cell Biol 4, 786-797 (2003).

12. Blaumueller, C.M., Qi, H., Zagouras, P. & Artavanis-Tsakonas, S. Intracellular cleavage of Notch leads to a heterodimeric receptor on the plasma membrane. Cell 90, 281-291 (1997).

13. Rand, M.D., Lindblom, A., Carlson, J., Villoutreix, B.O. & Stenflo, J. Calcium binding to tandem repeats of EGF-like modules. Expression and characterization of the EGF-like modules of human Notch-1 implicated in receptor-ligand interactions. Protein Sci 6, 2059-2071 (1997).

14. Rand, M.D. et al. Calcium depletion dissociates and activates heterodimeric notch receptors. Molecular and cellular biology 20, 1825-1835 (2000).

15. Lei, L., Xu, A., Panin, V.M. & Irvine, K.D. An O-fucose site in the ligand binding domain inhibits Notch activation. Development 130, 6411-6421 (2003).

142

16. Le Borgne, R., Bardin, A. & Schweisguth, F. The roles of receptor and ligand endocytosis in regulating Notch signaling. Development 132, 1751-1762 (2005).

17. Brou, C. et al. A novel proteolytic cleavage involved in Notch signaling: the role of the disintegrin-metalloprotease TACE. Molecular cell 5, 207-216 (2000).

18. De Strooper, B. et al. A presenilin-1-dependent gamma-secretase-like protease mediates release of Notch intracellular domain. Nature 398, 518-522 (1999).

19. Chung, H.M. & Struhl, G. Nicastrin is required for Presenilin-mediated transmembrane cleavage in Drosophila. Nature cell biology 3, 1129-1132 (2001).

20. Yu, G. et al. Nicastrin modulates presenilin-mediated notch/glp-1 signal transduction and betaAPP processing. Nature 407, 48-54 (2000).

21. Struhl, G. & Greenwald, I. Presenilin is required for activity and nuclear access of Notch in Drosophila. Nature 398, 522-525 (1999).

22. Struhl, G. & Adachi, A. Requirements for presenilin-dependent cleavage of notch and other transmembrane proteins. Molecular cell 6, 625-636 (2000).

23. Struhl, G. & Greenwald, I. Presenilin-mediated transmembrane cleavage is required for Notch signal transduction in Drosophila. Proc Natl Acad Sci U S A 98, 229-234 (2001).

24. Francis, R. et al. aph-1 and pen-2 are required for Notch pathway signaling, gamma-secretase cleavage of betaAPP, and presenilin protein accumulation. Dev Cell 3, 85-97 (2002).

25. Chen, F. et al. TMP21 is a presenilin complex component that modulates gamma-secretase but not epsilon-secretase activity. Nature 440, 1208-1212 (2006).

26. Pardossi-Piquard, R. et al. TMP21 transmembrane domain regulates gamma-secretase cleavage. J Biol Chem 284, 28634-28641 (2009).

27. Wu, L. et al. MAML1, a human homologue of Drosophila mastermind, is a transcriptional co-activator for NOTCH receptors. Nature genetics 26, 484-489 (2000).

28. Hermanson, O., Jepsen, K. & Rosenfeld, M.G. N-CoR controls differentiation of neural stem cells into astrocytes. Nature 419, 934-939 (2002).

29. Andreu-Agullo, C., Morante-Redolat, J.M., Delgado, A.C. & Farinas, I. Vascular niche factor PEDF modulates Notch-dependent stemness in the adult subependymal zone. Nat Neurosci 12, 1514-1523 (2009).

30. Iso, T. et al. HERP, a novel heterodimer partner of HES/E(spl) in Notch signaling. Molecular and cellular biology 21, 6080-6089 (2001).

143

31. Fleming, R.J., Scottgale, T.N., Diederich, R.J. & Artavanis-Tsakonas, S. The gene Serrate encodes a putative EGF-like transmembrane protein essential for proper ectodermal development in Drosophila melanogaster. Genes Dev 4, 2188-2201 (1990).

32. Kim, I.M., Wolf, M.J. & Rockman, H.A. Gene Deletion Screen for Cardiomyopathy in Adult Drosophila Identifies a New Notch Ligand. Circulation research.

33. Miller, A.C., Lyons, E.L. & Herman, T.G. cis-Inhibition of Notch by endogenous Delta biases the outcome of lateral inhibition. Curr Biol 19, 1378-1383 (2009).

34. Sprinzak, D. et al. Cis-interactions between Notch and Delta generate mutually exclusive signalling states. Nature 465, 86-90.

35. Schmidt, M.H. et al. Epidermal growth factor-like domain 7 (EGFL7) modulates Notch signalling and affects neural stem cell renewal. Nature cell biology (2009).

36. Kelly, D.F. et al. Molecular structure and dimeric organization of the Notch extracellular domain as revealed by electron microscopy. PLoS ONE 5, e10532 (2010).

37. Sanchez-Irizarry, C. et al. Notch subunit heterodimerization and prevention of ligand-independent proteolytic activation depend, respectively, on a novel domain and the LNR repeats. Molecular and cellular biology 24, 9265-9273 (2004).

38. Kopan, R., Nye, J.S. & Weintraub, H. The intracellular domain of mouse Notch: a constitutively activated repressor of myogenesis directed at the basic helix-loop-helix region of MyoD. Development 120, 2385-2396 (1994).

39. Ehebauer, M.T., Chirgadze, D.Y., Hayward, P., Martinez Arias, A. & Blundell, T.L. High-resolution crystal structure of the human Notch 1 ankyrin domain. The Biochemical journal 392, 13-20 (2005).

40. Beatus, P., Lundkvist, J., Oberg, C., Pedersen, K. & Lendahl, U. The origin of the ankyrin repeat region in Notch intracellular domains is critical for regulation of HES promoter activity. Mech Dev 104, 3-20 (2001).

41. Wilson, J.J. & Kovall, R.A. Crystal structure of the CSL-Notch-Mastermind ternary complex bound to DNA. Cell 124, 985-996 (2006).

42. Oberg, C. et al. The Notch intracellular domain is ubiquitinated and negatively regulated by the mammalian Sel-10 homolog. J Biol Chem 276, 35847-35853 (2001).

43. Jin, Y.H. et al. Beta-catenin modulates the level and transcriptional activity of Notch1/NICD through its direct interaction. Biochimica et biophysica acta 1793, 290-299 (2009).

44. Alves-Guerra, M.C., Ronchini, C. & Capobianco, A.J. Mastermind-like 1 Is a specific coactivator of beta-catenin transcription activation and is essential for colon carcinoma cell survival. Cancer Res 67, 8690-8698 (2007).

144

45. Zhao, Y. et al. The notch regulator MAML1 interacts with p53 and functions as a coactivator. J Biol Chem 282, 11969-11981 (2007).

46. Gustafsson, M.V. et al. Hypoxia requires notch signaling to maintain the undifferentiated cell state. Dev Cell 9, 617-628 (2005).

47. Wang, R. et al. Transcriptional regulation of APH-1A and increased gamma-secretase cleavage of APP and Notch by HIF-1 and hypoxia. Faseb J 20, 1275-1277 (2006).

48. Anthony, T.E., Mason, H.A., Gridley, T., Fishell, G. & Heintz, N. Brain lipid-binding protein is a direct target of Notch signaling in radial glial cells. Genes Dev 19, 1028-1033 (2005).

49. Bhattacharya, S., Das, A., Mallya, K. & Ahmad, I. Maintenance of retinal stem cells by Abcg2 is regulated by notch signaling. J Cell Sci 120, 2652-2662 (2007).

50. Shih, A.H. & Holland, E.C. Notch signaling enhances nestin expression in gliomas. Neoplasia (New York, N.Y 8, 1072-1082 (2006).

51. Reya, T. & Clevers, H. Wnt signalling in stem cells and cancer. Nature 434, 843-850 (2005).

52. McCulloch, E.A. & Till, J.E. The sensitivity of cells from normal mouse bone marrow to gamma radiation in vitro and in vivo. Radiation research 16, 822-832 (1962).

53. Barker, N. et al. Identification of stem cells in small intestine and colon by marker gene Lgr5. Nature 449, 1003-1007 (2007).

54. Toma, J.G. et al. Isolation of multipotent adult stem cells from the dermis of mammalian skin. Nature cell biology 3, 778-784 (2001).

55. Shackleton, M. et al. Generation of a functional mammary gland from a single stem cell. Nature 439, 84-88 (2006).

56. Kim, C.F. et al. Identification of bronchioalveolar stem cells in normal lung and lung cancer. Cell 121, 823-835 (2005).

57. Goldman, S.A. & Nottebohm, F. Neuronal production, migration, and differentiation in a vocal control nucleus of the adult female canary brain. Proc Natl Acad Sci U S A 80, 2390-2394 (1983).

58. Reynolds, B.A., Tetzlaff, W. & Weiss, S. A multipotent EGF-responsive striatal embryonic progenitor cell produces neurons and astrocytes. J Neurosci 12, 4565-4574 (1992).

59. Kuhn, H.G., Dickinson-Anson, H. & Gage, F.H. Neurogenesis in the dentate gyrus of the adult rat: age-related decrease of neuronal progenitor proliferation. J Neurosci 16, 2027-2033 (1996).

145

60. Doetsch, F., Caille, I., Lim, D.A., Garcia-Verdugo, J.M. & Alvarez-Buylla, A. Subventricular zone astrocytes are neural stem cells in the adult mammalian brain. Cell 97, 703-716 (1999).

61. Suhonen, J.O., Peterson, D.A., Ray, J. & Gage, F.H. Differentiation of adult hippocampus-derived progenitors into olfactory neurons in vivo. Nature 383, 624-627 (1996).

62. Lois, C., Garcia-Verdugo, J.M. & Alvarez-Buylla, A. Chain migration of neuronal precursors. Science 271, 978-981 (1996).

63. Arvidsson, A., Collin, T., Kirik, D., Kokaia, Z. & Lindvall, O. Neuronal replacement from endogenous precursors in the adult brain after stroke. Nature medicine 8, 963-970 (2002).

64. Emsley, J.G., Mitchell, B.D., Kempermann, G. & Macklis, J.D. Adult neurogenesis and repair of the adult CNS with neural progenitors, precursors, and stem cells. Progress in neurobiology 75, 321-341 (2005).

65. Thored, P. et al. Persistent production of neurons from adult brain stem cells during recovery after stroke. Stem Cells 24, 739-747 (2006).

66. Yamashita, T. et al. Subventricular zone-derived neuroblasts migrate and differentiate into mature neurons in the post-stroke adult striatum. J Neurosci 26, 6627-6636 (2006).

67. Eriksson, P.S. et al. Neurogenesis in the adult human hippocampus. Nature medicine 4, 1313-1317 (1998).

68. Schmidt-Hieber, C., Jonas, P. & Bischofberger, J. Enhanced synaptic plasticity in newly generated granule cells of the adult hippocampus. Nature 429, 184-187 (2004).

69. Curtis, M.A. et al. Human neuroblasts migrate to the olfactory bulb via a lateral ventricular extension. Science 315, 1243-1249 (2007).

70. Nagato, M. et al. Prospective characterization of neural stem cells by flow cytometry analysis using a combination of surface markers. J Neurosci Res 80, 456-466 (2005).

71. Basak, O. & Taylor, V. Identification of self-replicating multipotent progenitors in the embryonic nervous system by high Notch activity and Hes5 expression. Eur J Neurosci 25, 1006-1022 (2007).

72. Yoon, K. & Gaiano, N. Notch signaling in the mammalian central nervous system: insights from mouse mutants. Nat Neurosci 8, 709-715 (2005).

73. Hitoshi, S. et al. Notch pathway molecules are essential for the maintenance, but not the generation, of mammalian neural stem cells. Genes Dev 16, 846-858 (2002).

146

74. Ohtsuka, T., Sakamoto, M., Guillemot, F. & Kageyama, R. Roles of the basic helix-loop-helix genes Hes1 and Hes5 in expansion of neural stem cells of the developing brain. J Biol Chem 276, 30467-30474 (2001).

75. Gaiano, N., Nye, J.S. & Fishell, G. Radial glial identity is promoted by Notch1 signaling in the murine forebrain. Neuron 26, 395-404 (2000).

76. Tanigaki, K. et al. Notch1 and Notch3 instructively restrict bFGF-responsive multipotent neural progenitor cells to an astroglial fate. Neuron 29, 45-55 (2001).

77. Solecki, D.J., Liu, X.L., Tomoda, T., Fang, Y. & Hatten, M.E. Activated Notch2 signaling inhibits differentiation of cerebellar granule neuron precursors by maintaining proliferation. Neuron 31, 557-568 (2001).

78. Stump, G. et al. Notch1 and its ligands Delta-like and Jagged are expressed and active in distinct cell populations in the postnatal mouse brain. Mech Dev 114, 153-159 (2002).

79. Nyfeler, Y. et al. Jagged1 signals in the postnatal subventricular zone are required for neural stem cell self-renewal. The EMBO journal 24, 3504-3515 (2005).

80. Aguirre, A., Rubio, M.E. & Gallo, V. Notch and EGFR pathway interaction regulates neural stem cell number and self-renewal. Nature 467, 323-327 (2010).

81. Namihira, M. et al. Committed neuronal precursors confer astrocytic potential on residual neural precursor cells. Dev Cell 16, 245-255 (2009).

82. Shen, Q. et al. Endothelial cells stimulate self-renewal and expand neurogenesis of neural stem cells. Science 304, 1338-1340 (2004).

83. Hansen, D.V., Lui, J.H., Parker, P.R. & Kriegstein, A.R. Neurogenic radial glia in the outer subventricular zone of human neocortex. Nature 464, 554-561 (2010).

84. Hu, Q.D. et al. F3/contactin acts as a functional ligand for Notch during oligodendrocyte maturation. Cell 115, 163-175 (2003).

85. Hu, Q.D., Ma, Q.H., Gennarini, G. & Xiao, Z.C. Cross-talk between F3/contactin and Notch at axoglial interface: a role in oligodendrocyte development. Dev Neurosci 28, 25-33 (2006).

86. Cui, X.Y. et al. NB-3/Notch1 pathway via Deltex1 promotes neural progenitor cell differentiation into oligodendrocytes. J Biol Chem 279, 25858-25865 (2004).

87. Kageyama, R., Ohtsuka, T., Shimojo, H. & Imayoshi, I. Dynamic Notch signaling in neural progenitor cells and a revised view of lateral inhibition. Nat Neurosci 11, 1247-1251 (2008).

88. Sestan, N., Artavanis-Tsakonas, S. & Rakic, P. Contact-dependent inhibition of cortical neurite growth mediated by notch signaling. Science 286, 741-746 (1999).

147

89. Ahmad, I., Zaqouras, P. & Artavanis-Tsakonas, S. Involvement of Notch-1 in mammalian retinal neurogenesis: association of Notch-1 activity with both immature and terminally differentiated cells. Mech Dev 53, 73-85 (1995).

90. Brunschwig, A., Southam, C.M. & Levin, A.G. Host resistance to cancer. Clinical experiments by homotransplants, autotransplants and admixture of autologous leucocytes. Annals of surgery 162, 416-425 (1965).

91. Bruce, W.R. & Van Der Gaag, H. A Quantitative Assay for the Number of Murine Lymphoma Cells Capable of Proliferation in Vivo. Nature 199, 79-80 (1963).

92. Park, C.H., Bergsagel, D.E. & McCulloch, E.A. Mouse myeloma tumor stem cells: a primary cell culture assay. Journal of the National Cancer Institute 46, 411-422 (1971).

93. Hamburger, A.W. & Salmon, S.E. Primary bioassay of human tumor stem cells. Science 197, 461-463 (1977).

94. Lapidot, T. et al. A cell initiating human acute myeloid leukaemia after transplantation into SCID mice. Nature 367, 645-648 (1994).

95. Al-Hajj, M., Wicha, M.S., Benito-Hernandez, A., Morrison, S.J. & Clarke, M.F. Prospective identification of tumorigenic breast cancer cells. Proc Natl Acad Sci U S A 100, 3983-3988 (2003).

96. Collins, A.T., Berry, P.A., Hyde, C., Stower, M.J. & Maitland, N.J. Prospective identification of tumorigenic prostate cancer stem cells. Cancer Res 65, 10946-10951 (2005).

97. Singh, S.K. et al. Identification of human brain tumour initiating cells. Nature 432, 396-401 (2004).

98. Galli, R. et al. Isolation and characterization of tumorigenic, stem-like neural precursors from human glioblastoma. Cancer Res 64, 7011-7021 (2004).

99. O'Brien C, A., Pollett, A., Gallinger, S. & Dick, J.E. A human colon cancer cell capable of initiating tumour growth in immunodeficient mice. Nature (2006).

100. Ricci-Vitiani, L. et al. Identification and expansion of human colon-cancer-initiating cells. Nature (2006).

101. Li, C. et al. Identification of pancreatic cancer stem cells. Cancer Res 67, 1030-1037 (2007).

102. Wu, C. et al. Side population cells isolated from mesenchymal neoplasms have tumor initiating potential. Cancer Res 67, 8216-8222 (2007).

103. Schatton, T. et al. Identification of cells initiating human melanomas. Nature 451, 345-349 (2008).

148

104. Boiko, A.D. et al. Human melanoma-initiating cells express neural crest nerve growth factor receptor CD271. Nature 466, 133-137 (2010).

105. Zhang, S. et al. Identification and characterization of ovarian cancer-initiating cells from primary human tumors. Cancer Res 68, 4311-4320 (2008).

106. Prince, M.E. et al. Identification of a subpopulation of cells with cancer stem cell properties in head and neck squamous cell carcinoma. Proc Natl Acad Sci U S A 104, 973-978 (2007).

107. Singh, S.K. et al. Identification of a cancer stem cell in human brain tumors. Cancer Res 63, 5821-5828 (2003).

108. Longley, D.B., Harkin, D.P. & Johnston, P.G. 5-fluorouracil: mechanisms of action and clinical strategies. Nature reviews 3, 330-338 (2003).

109. Scharenberg, C.W., Harkey, M.A. & Torok-Storb, B. The ABCG2 transporter is an efficient Hoechst 33342 efflux pump and is preferentially expressed by immature human hematopoietic progenitors. Blood 99, 507-512 (2002).

110. Goodell, M.A., Brose, K., Paradis, G., Conner, A.S. & Mulligan, R.C. Isolation and functional properties of murine hematopoietic stem cells that are replicating in vivo. J Exp Med 183, 1797-1806 (1996).

111. Zhou, S. et al. The ABC transporter Bcrp1/ABCG2 is expressed in a wide variety of stem cells and is a molecular determinant of the side-population phenotype. Nature medicine 7, 1028-1034 (2001).

112. Dean, M., Fojo, T. & Bates, S. Tumour stem cells and drug resistance. Nature reviews 5, 275-284 (2005).

113. Kondo, T., Setoguchi, T. & Taga, T. Persistence of a small subpopulation of cancer stem-like cells in the C6 glioma cell line. Proc Natl Acad Sci U S A 101, 781-786 (2004).

114. Hirschmann-Jax, C. et al. A distinct "side population" of cells with high drug efflux capacity in human tumor cells. Proc Natl Acad Sci U S A 101, 14228-14233 (2004).

115. Bao, S. et al. Glioma stem cells promote radioresistance by preferential activation of the DNA damage response. Nature 444, 756-760 (2006).

116. Radtke, F. & Raj, K. The role of Notch in tumorigenesis: oncogene or tumour suppressor? Nature reviews 3, 756-767 (2003).

117. Weng, A.P. et al. Activating mutations of NOTCH1 in human T cell acute lymphoblastic leukemia. Science 306, 269-271 (2004).

118. Wilson, A., MacDonald, H.R. & Radtke, F. Notch 1-deficient common lymphoid precursors adopt a B cell fate in the thymus. J Exp Med 194, 1003-1012 (2001).

149

119. Sambandam, A. et al. Notch signaling controls the generation and differentiation of early T lineage progenitors. Nat Immunol 6, 663-670 (2005).

120. Pui, J.C. et al. Notch1 expression in early lymphopoiesis influences B versus T lineage determination. Immunity 11, 299-308 (1999).

121. Purow, B.W. et al. Expression of Notch-1 and its ligands, Delta-like-1 and Jagged-1, is critical for glioma cell survival and proliferation. Cancer Res 65, 2353-2363 (2005).

122. Dontu, G. et al. Role of Notch signaling in cell-fate determination of human mammary stem/progenitor cells. Breast Cancer Res 6, R605-615 (2004).

123. Talora, C., Sgroi, D.C., Crum, C.P. & Dotto, G.P. Specific down-modulation of Notch1 signaling in cervical cancer cells is required for sustained HPV-E6/E7 expression and late steps of malignant transformation. Genes Dev 16, 2252-2263 (2002).

124. Sriuranpong, V. et al. Notch signaling induces cell cycle arrest in small cell lung cancer cells. Cancer Res 61, 3200-3205 (2001).

125. Dufraine, J., Funahashi, Y. & Kitajewski, J. Notch signaling regulates tumor angiogenesis by diverse mechanisms. Oncogene 27, 5132-5137 (2008).

126. Li, J.L. et al. Delta-like 4 Notch ligand regulates tumor angiogenesis, improves tumor vascular function, and promotes tumor growth in vivo. Cancer Res 67, 11244-11253 (2007).

127. Dang, L. et al. Notch3 signaling initiates choroid plexus tumor formation. Oncogene 25, 487-491 (2006).

128. Dakubo, G.D., Mazerolle, C.J. & Wallace, V.A. Expression of Notch and Wnt pathway components and activation of Notch signaling in medulloblastomas from heterozygous patched mice. Journal of neuro-oncology 79, 221-227 (2006).

129. Ingram, W.J., McCue, K.I., Tran, T.H., Hallahan, A.R. & Wainwright, B.J. Sonic Hedgehog regulates Hes1 through a novel mechanism that is independent of canonical Notch pathway signalling. Oncogene (2007).

130. Ward, R.J. et al. Multipotent CD15+ cancer stem cells in patched-1-deficient mouse medulloblastoma. Cancer Res 69, 4682-4690 (2009).

131. Julian, E., Dave, R.K., Robson, J.P., Hallahan, A.R. & Wainwright, B.J. Canonical Notch signaling is not required for the growth of Hedgehog pathway-induced medulloblastoma. Oncogene 29, 3465-3476 (2010).

132. Julian, E., Hallahan, A.R. & Wainwright, B.J. RBP-J is not required for granule neuron progenitor development and medulloblastoma initiated by Hedgehog pathway activation in the external germinal layer. Neural development 5, 27.

150

133. Fan, X. et al. Notch1 and notch2 have opposite effects on embryonal brain tumor growth. Cancer Res 64, 7787-7793 (2004).

134. Kanamori, M. et al. Contribution of Notch signaling activation to human glioblastoma multiforme. Journal of neurosurgery 106, 417-427 (2007).

135. Mei, J., Bachoo, R. & Zhang, C.L. MicroRNA-146a Inhibits Glioma Development by Targeting Notch1. Molecular and cellular biology (2011).

136. Jeon, H.M. et al. Inhibitor of differentiation 4 drives brain tumor-initiating cell genesis through cyclin E and notch signaling. Genes Dev 22, 2028-2033 (2008).

137. Fan, X. et al. Notch pathway inhibition depletes stem-like cells and blocks engraftment in embryonal brain tumors. Cancer Res 66, 7445-7452 (2006).

138. Hu, Y.Y. et al. Notch signaling contributes to the maintenance of both normal neural stem cells and patient-derived glioma stem cells. BMC cancer 11, 82 (2011).

139. Fan, X. et al. Notch Pathway Blockade Depletes CD133-Positive Glioblastoma Cells and Inhibits Growth of Tumor Neurospheres and Xenografts. Stem Cells (2009).

140. Chen, J. et al. Inhibition of Notch Signaling Blocks Growth of Glioblastoma Cell Lines and Tumor Neurospheres. Genes & cancer 1, 822-835 (2010).

141. Wang, J. et al. Notch promotes radioresistance of glioma stem cells. Stem Cells 28, 17-28 (2010).

142. Lin, J., Zhang, X.M., Yang, J.C., Ye, Y.B. & Luo, S.Q. gamma-secretase inhibitor-I enhances radiosensitivity of glioblastoma cell lines by depleting CD133+ tumor cells. Archives of medical research 41, 519-529 (2010).

143. Stupp, R. et al. Effects of radiotherapy with concomitant and adjuvant temozolomide versus radiotherapy alone on survival in glioblastoma in a randomised phase III study: 5-year analysis of the EORTC-NCIC trial. The lancet oncology 10, 459-466 (2009).

144. Tonn, J.C. & ebrary Inc. xvi, 706 p. (Springer, Berlin ; New York; 2006).

145. Yarden, Y. & Sliwkowski, M.X. Untangling the ErbB signalling network. Nat Rev Mol Cell Biol 2, 127-137 (2001).

146. Piccart-Gebhart, M.J. et al. Trastuzumab after adjuvant chemotherapy in HER2-positive breast cancer. The New England journal of medicine 353, 1659-1672 (2005).

147. Network, T.C.G.A.R. Comprehensive genomic characterization defines human glioblastoma genes and core pathways. Nature 455, 1061-1068 (2008).

148. Taipale, J. & Beachy, P.A. The Hedgehog and Wnt signalling pathways in cancer. Nature 411, 349-354 (2001).

151

149. Chojnacki, A., Shimazaki, T., Gregg, C., Weinmaster, G. & Weiss, S. Glycoprotein 130 signaling regulates Notch1 expression and activation in the self-renewal of mammalian forebrain neural stem cells. J Neurosci 23, 1730-1741 (2003).

150. Grandbarbe, L. et al. Delta-Notch signaling controls the generation of neurons/glia from neural stem cells in a stepwise process. Development 130, 1391-1402 (2003).

151. Morrison, S.J. et al. Transient Notch activation initiates an irreversible switch from neurogenesis to gliogenesis by neural crest stem cells. Cell 101, 499-510 (2000).

152. Ge, W. et al. Notch signaling promotes astrogliogenesis via direct CSL-mediated glial gene activation. J Neurosci Res 69, 848-860 (2002).

153. Breunig, J.J., Silbereis, J., Vaccarino, F.M., Sestan, N. & Rakic, P. Notch regulates cell fate and dendrite morphology of newborn neurons in the postnatal dentate gyrus. Proc Natl Acad Sci U S A 104, 20558-20563 (2007).

154. Salama-Cohen, P., Arevalo, M.A., Grantyn, R. & Rodriguez-Tebar, A. Notch and NGF/p75NTR control dendrite morphology and the balance of excitatory/inhibitory synaptic input to hippocampal neurones through Neurogenin 3. J Neurochem 97, 1269-1278 (2006).

155. Gaiano, N. & Fishell, G. The role of notch in promoting glial and neural stem cell fates. Annu Rev Neurosci 25, 471-490 (2002).

156. Campos, L.S. et al. Beta1 integrins activate a MAPK signalling pathway in neural stem cells that contributes to their maintenance. Development 131, 3433-3444 (2004).

157. Pollard, S.M. et al. Glioma stem cell lines expanded in adherent culture have tumor-specific phenotypes and are suitable for chemical and genetic screens. Cell stem cell 4, 568-580 (2009).

158. Dovey, H.F. et al. Functional gamma-secretase inhibitors reduce beta-amyloid peptide levels in brain. J Neurochem 76, 173-181 (2001).

159. Lammich, S. et al. Presenilin-dependent intramembrane proteolysis of CD44 leads to the liberation of its intracellular domain and the secretion of an Abeta-like peptide. J Biol Chem 277, 44754-44759 (2002).

160. Ni, C.Y., Murphy, M.P., Golde, T.E. & Carpenter, G. gamma -Secretase cleavage and nuclear localization of ErbB-4 receptor tyrosine kinase. Science 294, 2179-2181 (2001).

161. Lyu, J., Yamamoto, V. & Lu, W. Cleavage of the Wnt receptor Ryk regulates neuronal differentiation during cortical neurogenesis. Dev Cell 15, 773-780 (2008).

162. Maillard, I. et al. Mastermind critically regulates Notch-mediated lymphoid cell fate decisions. Blood 104, 1696-1702 (2004).

152

163. Weng, A.P. et al. Growth suppression of pre-T acute lymphoblastic leukemia cells by inhibition of notch signaling. Molecular and cellular biology 23, 655-664 (2003).

164. Hooper, C., Chapple, J.P., Lovestone, S. & Killick, R. The Notch-1 intracellular domain is found in sub-nuclear bodies in SH-SY5Y neuroblastomas and in primary cortical neurons. Neuroscience letters 415, 135-139 (2007).

165. Shearman, M.S. et al. L-685,458, an aspartyl protease transition state mimic, is a potent inhibitor of amyloid beta-protein precursor gamma-secretase activity. Biochemistry 39, 8698-8704 (2000).

166. Tanaka, M., Kadokawa, Y., Hamada, Y. & Marunouchi, T. Notch2 expression negatively correlates with glial differentiation in the postnatal mouse brain. J Neurobiol 41, 524-539 (1999).

167. Lee, M.K., Tuttle, J.B., Rebhun, L.I., Cleveland, D.W. & Frankfurter, A. The expression and posttranslational modification of a neuron-specific beta-tubulin isotype during chick embryogenesis. Cell motility and the cytoskeleton 17, 118-132 (1990).

168. Carleton, A., Petreanu, L.T., Lansford, R., Alvarez-Buylla, A. & Lledo, P.M. Becoming a new neuron in the adult olfactory bulb. Nat Neurosci 6, 507-518 (2003).

169. van Praag, H. et al. Functional neurogenesis in the adult hippocampus. Nature 415, 1030-1034 (2002).

170. Song, H.J., Stevens, C.F. & Gage, F.H. Neural stem cells from adult hippocampus develop essential properties of functional CNS neurons. Nat Neurosci 5, 438-445 (2002).

171. Berninger, B., Guillemot, F. & Gotz, M. Directing neurotransmitter identity of neurones derived from expanded adult neural stem cells. Eur J Neurosci 25, 2581-2590 (2007).

172. Pollard, S.M., Conti, L., Sun, Y., Goffredo, D. & Smith, A. Adherent neural stem (NS) cells from fetal and adult forebrain. Cereb Cortex 16 Suppl 1, i112-120 (2006).

173. Sun, Y. et al. Long-term tripotent differentiation capacity of human neural stem (NS) cells in adherent culture. Molecular and cellular neurosciences 38, 245-258 (2008).

174. Eisen, M.B., Spellman, P.T., Brown, P.O. & Botstein, D. Cluster analysis and display of genome-wide expression patterns. Proc Natl Acad Sci U S A 95, 14863-14868 (1998).

175. McGill, M.A. & McGlade, C.J. Mammalian numb proteins promote Notch1 receptor ubiquitination and degradation of the Notch1 intracellular domain. J Biol Chem 278, 23196-23203 (2003).

176. Pece, S. et al. Loss of negative regulation by Numb over Notch is relevant to human breast carcinogenesis. J Cell Biol 167, 215-221 (2004).

153

177. Zhang, P., Yang, Y., Nolo, R., Zweidler-McKay, P.A. & Hughes, D.P. Regulation of NOTCH signaling by reciprocal inhibition of HES1 and Deltex 1 and its role in osteosarcoma invasiveness. Oncogene.

178. Potzner, M.R. et al. Sequential requirement of Sox4 and Sox11 during development of the sympathetic nervous system. Development 137, 775-784.

179. Hanson, C.A. & Miller, J.R. Non-traditional roles for the Adenomatous Polyposis Coli (APC) tumor suppressor protein. Gene 361, 1-12 (2005).

180. Otero, J.J., Fu, W., Kan, L., Cuadra, A.E. & Kessler, J.A. Beta-catenin signaling is required for neural differentiation of embryonic stem cells. Development 131, 3545-3557 (2004).

181. Hirabayashi, Y. et al. The Wnt/beta-catenin pathway directs neuronal differentiation of cortical neural precursor cells. Development 131, 2791-2801 (2004).

182. Hirabayashi, Y. & Gotoh, Y. Stage-dependent fate determination of neural precursor cells in mouse forebrain. Neuroscience research 51, 331-336 (2005).

183. Fre, S. et al. Notch and Wnt signals cooperatively control cell proliferation and tumorigenesis in the intestine. Proc Natl Acad Sci U S A 106, 6309-6314 (2009).

184. Pannequin, J. et al. The wnt target jagged-1 mediates the activation of notch signaling by progastrin in human colorectal cancer cells. Cancer Res 69, 6065-6073 (2009).

185. Korur, S. et al. GSK3beta regulates differentiation and growth arrest in glioblastoma. PLoS ONE 4, e7443 (2009).

186. Sato, N., Meijer, L., Skaltsounis, L., Greengard, P. & Brivanlou, A.H. Maintenance of pluripotency in human and mouse embryonic stem cells through activation of Wnt signaling by a pharmacological GSK-3-specific inhibitor. Nature medicine 10, 55-63 (2004).

187. Druker, B.J. et al. Efficacy and safety of a specific inhibitor of the BCR-ABL tyrosine kinase in chronic myeloid leukemia. The New England journal of medicine 344, 1031-1037 (2001).

188. Druker, B.J. et al. Effects of a selective inhibitor of the Abl tyrosine kinase on the growth of Bcr-Abl positive cells. Nature medicine 2, 561-566 (1996).

189. Cobleigh, M.A. et al. Multinational study of the efficacy and safety of humanized anti-HER2 monoclonal antibody in women who have HER2-overexpressing metastatic breast cancer that has progressed after chemotherapy for metastatic disease. J Clin Oncol 17, 2639-2648 (1999).

190. Slamon, D.J. et al. Use of chemotherapy plus a monoclonal antibody against HER2 for metastatic breast cancer that overexpresses HER2. The New England journal of medicine 344, 783-792 (2001).

154

191. Ohtsuka, T. et al. Hes1 and Hes5 as notch effectors in mammalian neuronal differentiation. The EMBO journal 18, 2196-2207 (1999).

192. Ishibashi, M. et al. Persistent expression of helix-loop-helix factor HES-1 prevents mammalian neural differentiation in the central nervous system. The EMBO journal 13, 1799-1805 (1994).

193. de la Pompa, J.L. et al. Conservation of the Notch signalling pathway in mammalian neurogenesis. Development 124, 1139-1148 (1997).

194. Wall, D.S. et al. Progenitor cell proliferation in the retina is dependent on Notch-independent Sonic hedgehog/Hes1 activity. J Cell Biol 184, 101-112 (2009).

195. Sang, L., Coller, H.A. & Roberts, J.M. Control of the reversibility of cellular quiescence by the transcriptional repressor HES1. Science 321, 1095-1100 (2008).

196. Esler, W.P. et al. Transition-state analogue inhibitors of gamma-secretase bind directly to presenilin-1. Nature cell biology 2, 428-434 (2000).

197. Aste-Amezaga, M. et al. Characterization of Notch1 antibodies that inhibit signaling of both normal and mutated Notch1 receptors. PLoS ONE 5, e9094 (2010).

198. Schreck, K.C. et al. The Notch target Hes1 directly modulates Gli1 expression and Hedgehog signaling: a potential mechanism of therapeutic resistance. Clin Cancer Res 16, 6060-6070 (2011).

199. Pattyn, A. et al. Ascl1/Mash1 is required for the development of central serotonergic neurons. Nat Neurosci 7, 589-595 (2004).

200. Vierbuchen, T. et al. Direct conversion of fibroblasts to functional neurons by defined factors. Nature (2010).

201. Castro, D.S. et al. A novel function of the proneural factor Ascl1 in progenitor proliferation identified by genome-wide characterization of its targets. Genes Dev 25, 930-945 (2011).

202. Hoser, M. et al. Prolonged glial expression of Sox4 in the CNS leads to architectural cerebellar defects and ataxia. J Neurosci 27, 5495-5505 (2007).

203. Ying, M. et al. Kruppel-like family of transcription factor 9, a differentiation-associated transcription factor, suppresses Notch1 signaling and inhibits glioblastoma-initiating stem cells. Stem Cells 29, 20-31 (2011).

204. Dieter, S.M. et al. Distinct types of tumor-initiating cells form human colon cancer tumors and metastases. Cell stem cell 9, 357-365 (2011).

205. Katoh, M. & Katoh, M. Notch ligand, JAG1, is evolutionarily conserved target of canonical WNT signaling pathway in progenitor cells. Int J Mol Med 17, 681-685 (2006).

155

206. Shimizu, T. et al. Stabilized beta-catenin functions through TCF/LEF proteins and the Notch/RBP-Jkappa complex to promote proliferation and suppress differentiation of neural precursor cells. Molecular and cellular biology 28, 7427-7441 (2008).

207. Foltz, D.R., Santiago, M.C., Berechid, B.E. & Nye, J.S. Glycogen synthase kinase-3beta modulates notch signaling and stability. Curr Biol 12, 1006-1011 (2002).

208. Espinosa, L., Ingles-Esteve, J., Aguilera, C. & Bigas, A. Phosphorylation by glycogen synthase kinase-3 beta down-regulates Notch activity, a link for Notch and Wnt pathways. J Biol Chem 278, 32227-32235 (2003).

209. Conboy, L. et al. Notch signalling becomes transiently attenuated during long-term memory consolidation in adult Wistar rats. Neurobiology of learning and memory 88, 342-351 (2007).

210. Kinzler, K.W. & Vogelstein, B. Lessons from hereditary colorectal cancer. Cell 87, 159-170 (1996).

211. Hamilton, S.R. et al. The molecular basis of Turcot's syndrome. The New England journal of medicine 332, 839-847 (1995).

212. Phillips, H.S. et al. Molecular subclasses of high-grade glioma predict prognosis, delineate a pattern of disease progression, and resemble stages in neurogenesis. Cancer cell 9, 157-173 (2006).

213. Verhaak, R.G. et al. Integrated genomic analysis identifies clinically relevant subtypes of glioblastoma characterized by abnormalities in PDGFRA, IDH1, EGFR, and NF1. Cancer cell 17, 98-110 (2010).

214. Real, P.J. et al. gamma-secretase inhibitors reverse glucocorticoid resistance in T cell acute lymphoblastic leukemia. Nature medicine (2008).

215. Boltan, D.D. & Fenves, A.Z. Effectiveness of normal saline diuresis in treating lithium overdose. Proceedings (Baylor University 21, 261-263 (2008).

216. Huang, M.E. et al. Use of all-trans retinoic acid in the treatment of acute promyelocytic leukemia. Blood 72, 567-572 (1988).

217. Campos, B. et al. Differentiation Therapy Exerts Antitumor Effects on Stem-like Glioma Cells. Clin Cancer Res (2010).

218. Clynes, R.A., Towers, T.L., Presta, L.G. & Ravetch, J.V. Inhibitory Fc receptors modulate in vivo cytoxicity against tumor targets. Nature medicine 6, 443-446 (2000).

219. Dash, P.K., Moore, A.N. & Orsi, S.A. Blockade of gamma-secretase activity within the hippocampus enhances long-term memory. Biochem Biophys Res Commun 338, 777-782 (2005).

156

220. Oya, S. et al. Attenuation of Notch signaling promotes the differentiation of neural progenitors into neurons in the hippocampal CA1 region after ischemic injury. Neuroscience 158, 683-692 (2009).

221. Strijbosch, L.W., Buurman, W.A., Does, R.J., Zinken, P.H. & Groenewegen, G. Limiting dilution assays. Experimental design and statistical analysis. Journal of immunological methods 97, 133-140 (1987).

222. Sharrock, C.E., Kaminski, E. & Man, S. Limiting dilution analysis of human T cells: a useful clinical tool. Immunology today 11, 281-286 (1990).

223. Lefort, K. et al. Notch1 is a p53 target gene involved in human keratinocyte tumor suppression through negative regulation of ROCK1/2 and MRCKalpha kinases. Genes Dev 21, 562-577 (2007).

224. Klassen, H., Ziaeian, B., Kirov, II, Young, M.J. & Schwartz, P.H. Isolation of retinal progenitor cells from post-mortem human tissue and comparison with autologous brain progenitors. J Neurosci Res 77, 334-343 (2004).

225. Nijjar, S.S., Wallace, L., Crosby, H.A., Hubscher, S.G. & Strain, A.J. Altered Notch ligand expression in human liver disease: further evidence for a role of the Notch signaling pathway in hepatic neovascularization and biliary ductular defects. The American journal of pathology 160, 1695-1703 (2002).

226. Lathia, J.D. et al. Distribution of CD133 reveals glioma stem cells self-renew through symmetric and asymmetric cell divisions. Cell death & disease 2, e200 (2011).

227. Johnson, K. & Wodarz, A. A genetic hierarchy controlling cell polarity. Nature cell biology 5, 12-14 (2003).

228. Langevin, J. et al. Lethal giant larvae controls the localization of notch-signaling regulators numb, neuralized, and Sanpodo in Drosophila sensory-organ precursor cells. Curr Biol 15, 955-962 (2005).

229. Le Borgne, R. & Schweisguth, F. Unequal segregation of Neuralized biases Notch activation during asymmetric cell division. Dev Cell 5, 139-148 (2003).

230. McGill, M.A., Dho, S.E., Weinmaster, G. & McGlade, C.J. Numb regulates post-endocytic trafficking and degradation of Notch1. J Biol Chem 284, 26427-26438 (2009).

231. Smith, C.A., Dho, S.E., Donaldson, J., Tepass, U. & McGlade, C.J. The cell fate determinant numb interacts with EHD/Rme-1 family proteins and has a role in endocytic recycling. Molecular biology of the cell 15, 3698-3708 (2004).

232. Coumailleau, F., Furthauer, M., Knoblich, J.A. & Gonzalez-Gaitan, M. Directional Delta and Notch trafficking in Sara endosomes during asymmetric cell division. Nature 458, 1051-1055 (2009).

157

233. Zhong, W., Feder, J.N., Jiang, M.M., Jan, L.Y. & Jan, Y.N. Asymmetric localization of a mammalian numb homolog during mouse cortical neurogenesis. Neuron 17, 43-53 (1996).

234. Zhong, W., Jiang, M.M., Weinmaster, G., Jan, L.Y. & Jan, Y.N. Differential expression of mammalian Numb, Numblike and Notch1 suggests distinct roles during mouse cortical neurogenesis. Development 124, 1887-1897 (1997).

235. Androutsellis-Theotokis, A. et al. Notch signalling regulates stem cell numbers in vitro and in vivo. Nature 442, 823-826 (2006).

236. Iwasa, Y., Nowak, M.A. & Michor, F. Evolution of resistance during clonal expansion. Genetics 172, 2557-2566 (2006).

237. Iwasa, Y., Michor, F. & Nowak, M.A. Evolutionary dynamics of escape from biomedical intervention. Proceedings 270, 2573-2578 (2003).

238. Michor, F., Nowak, M.A. & Iwasa, Y. Evolution of resistance to cancer therapy. Current pharmaceutical design 12, 261-271 (2006).

239. Curry, C.L., Reed, L.L., Nickoloff, B.J., Miele, L. & Foreman, K.E. Notch-independent regulation of Hes-1 expression by c-Jun N-terminal kinase signaling in human endothelial cells. Laboratory investigation; a journal of technical methods and pathology 86, 842-852 (2006).

240. Ramunas, J. et al. True monolayer cell culture in a confined 3D microenvironment enables lineage informatics. Cytometry A 69, 1202-1211 (2006).

241. Perumalsamy, L.R., Nagala, M. & Sarin, A. Notch-activated signaling cascade interacts with mitochondrial remodeling proteins to regulate cell survival. Proc Natl Acad Sci U S A 107, 6882-6887 (2010).

242. Tropepe, V. et al. Distinct neural stem cells proliferate in response to EGF and FGF in the developing mouse telencephalon. Developmental biology 208, 166-188 (1999).

243. Stehelin, D., Varmus, H.E., Bishop, J.M. & Vogt, P.K. DNA related to the transforming gene(s) of avian sarcoma viruses is present in normal avian DNA. Nature 260, 170-173 (1976).

244. Capobianco, A.J., Zagouras, P., Blaumueller, C.M., Artavanis-Tsakonas, S. & Bishop, J.M. Neoplastic transformation by truncated alleles of human NOTCH1/TAN1 and NOTCH2. Molecular and cellular biology 17, 6265-6273 (1997).

245. Pear, W.S. et al. Exclusive development of T cell neoplasms in mice transplanted with bone marrow expressing activated Notch alleles. J Exp Med 183, 2283-2291 (1996).

246. Malecki, M.J. et al. Leukemia-associated mutations within the NOTCH1 heterodimerization domain fall into at least two distinct mechanistic classes. Molecular and cellular biology 26, 4642-4651 (2006).

158

247. Puget, S. et al. Candidate Genes on Chromosome 9q33-34 Involved in the Progression of Childhood Ependymomas. J Clin Oncol (2009).

248. Maliekal, T.T., Bajaj, J., Giri, V., Subramanyam, D. & Krishna, S. The role of Notch signaling in human cervical cancer: implications for solid tumors. Oncogene 27, 5110-5114 (2008).

249. Jeffries, S., Robbins, D.J. & Capobianco, A.J. Characterization of a high-molecular-weight Notch complex in the nucleus of Notch(ic)-transformed RKE cells and in a human T-cell leukemia cell line. Molecular and cellular biology 22, 3927-3941 (2002).

250. Weijzen, S. et al. Activation of Notch-1 signaling maintains the neoplastic phenotype in human Ras-transformed cells. Nature medicine 8, 979-986 (2002).

251. Calabrese, C. et al. A perivascular niche for brain tumor stem cells. Cancer cell 11, 69-82 (2007).

252. Tavazoie, M. et al. A specialized vascular niche for adult neural stem cells. Cell stem cell 3, 279-288 (2008).

253. Colmone, A. et al. Leukemic cells create bone marrow niches that disrupt the behavior of normal hematopoietic progenitor cells. Science 322, 1861-1865 (2008).

254. Klinakis, A. et al. A novel tumour-suppressor function for the Notch pathway in myeloid leukaemia. Nature 473, 230-233 (2011).

255. Hermann, P.C. et al. Distinct populations of cancer stem cells determine tumor growth and metastatic activity in human pancreatic cancer. Cell stem cell 1, 313-323 (2007).

256. Kelly, P.N., Dakic, A., Adams, J.M., Nutt, S.L. & Strasser, A. Tumor growth need not be driven by rare cancer stem cells. Science 317, 337 (2007).

257. Quintana, E. et al. Efficient tumour formation by single human melanoma cells. Nature 456, 593-598 (2008).

258. Quintana, E. et al. Phenotypic heterogeneity among tumorigenic melanoma cells from patients that is reversible and not hierarchically organized. Cancer cell 18, 510-523 (2010).

259. Read, T.A. et al. Identification of CD15 as a marker for tumor-propagating cells in a mouse model of medulloblastoma. Cancer cell 15, 135-147 (2009).

260. Harris, M.A. et al. Cancer stem cells are enriched in the side population cells in a mouse model of glioma. Cancer Res 68, 10051-10059 (2008).

261. Eppert, K. et al. Stem cell gene expression programs influence clinical outcome in human leukemia. Nature medicine 17, 1086-1093 (2011).

159

262. Colman, H. et al. A multigene predictor of outcome in glioblastoma. Neuro-oncology 12, 49-57 (2010).

263. He, J. et al. Expression of glioma stem cell marker CD133 and O6-methylguanine-DNA methyltransferase is associated with resistance to radiotherapy in gliomas. Oncology reports 26, 1305-1313 (2011).

264. Sato, A. et al. Association of stem cell marker CD133 expression with dissemination of glioblastomas. Neurosurgical review 33, 175-183; discussion 183-174 (2010).

265. Kim, K.J. et al. The presence of stem cell marker-expressing cells is not prognostically significant in glioblastomas. Neuropathology 31, 494-502 (2011).

266. Mizutani, K., Yoon, K., Dang, L., Tokunaga, A. & Gaiano, N. Differential Notch signalling distinguishes neural stem cells from intermediate progenitors. Nature 449, 351-355 (2007).

267. Faux, C.H., Turnley, A.M., Epa, R., Cappai, R. & Bartlett, P.F. Interactions between fibroblast growth factors and Notch regulate neuronal differentiation. J Neurosci 21, 5587-5596 (2001).

268. Duncan, A.W. et al. Integration of Notch and Wnt signaling in hematopoietic stem cell maintenance. Nat Immunol 6, 314-322 (2005).

269. Palmer, T.D., Willhoite, A.R. & Gage, F.H. Vascular niche for adult hippocampal neurogenesis. J Comp Neurol 425, 479-494 (2000).

270. Shen, Q. et al. Adult SVZ stem cells lie in a vascular niche: a quantitative analysis of niche cell-cell interactions. Cell stem cell 3, 289-300 (2008).

271. Zhu, T.S. et al. Endothelial Cells Create a Stem Cell Niche in Glioblastoma by Providing NOTCH Ligands That Nurture Self-Renewal of Cancer Stem-Like Cells. Cancer Res 71, 6061-6072 (2011).

272. Charles, N. et al. Perivascular nitric oxide activates notch signaling and promotes stem-like character in PDGF-induced glioma cells. Cell stem cell 6, 141-152.

273. Hellstrom, M. et al. Dll4 signalling through Notch1 regulates formation of tip cells during angiogenesis. Nature 445, 776-780 (2007).

274. Tammela, T. et al. Blocking VEGFR-3 suppresses angiogenic sprouting and vascular network formation. Nature 454, 656-660 (2008).

275. Noguera-Troise, I. et al. Blockade of Dll4 inhibits tumour growth by promoting non-productive angiogenesis. Novartis Foundation symposium 283, 106-120; discussion 121-105, 238-141 (2007).

276. Ricci-Vitiani, L. et al. Tumour vascularization via endothelial differentiation of glioblastoma stem-like cells. Nature 468, 824-828 (2010).

160

277. Wang, R. et al. Glioblastoma stem-like cells give rise to tumour endothelium. Nature 468, 829-833 (2010).

278. Miyazaki, K. Laminin-5 (laminin-332): Unique biological activity and role in tumor growth and invasion. Cancer science 97, 91-98 (2006).

279. Leins, A. et al. Expression of tenascin-C in various human brain tumors and its relevance for survival in patients with astrocytoma. Cancer 98, 2430-2439 (2003).

280. Oskarsson, T. et al. Breast cancer cells produce tenascin C as a metastatic niche component to colonize the lungs. Nature medicine 17, 867-874 (2011).

281. Sivasankaran, B. et al. Tenascin-C is a novel RBPJkappa-induced target gene for Notch signaling in gliomas. Cancer Res 69, 458-465 (2009).

282. Haass, C. & Selkoe, D.J. Soluble protein oligomers in neurodegeneration: lessons from the Alzheimer's amyloid beta-peptide. Nat Rev Mol Cell Biol 8, 101-112 (2007).

283. Fleisher, A.S. et al. Phase 2 safety trial targeting amyloid beta production with a gamma-secretase inhibitor in Alzheimer disease. Archives of neurology 65, 1031-1038 (2008).

284. Moriyama, M. et al. Notch signaling via Hes1 transcription factor maintains survival of melanoblasts and melanocyte stem cells. J Cell Biol 173, 333-339 (2006).

285. Kumano, K. et al. Both Notch1 and Notch2 contribute to the regulation of melanocyte homeostasis. Pigment cell & melanoma research 21, 70-78 (2008).

286. van Es, J.H. et al. Notch/gamma-secretase inhibition turns proliferative cells in intestinal crypts and adenomas into goblet cells. Nature 435, 959-963 (2005).

287. Riccio, O. et al. Loss of intestinal crypt progenitor cells owing to inactivation of both Notch1 and Notch2 is accompanied by derepression of CDK inhibitors p27Kip1 and p57Kip2. EMBO reports 9, 377-383 (2008).

288. Imayoshi, I., Sakamoto, M., Yamaguchi, M., Mori, K. & Kageyama, R. Essential roles of Notch signaling in maintenance of neural stem cells in developing and adult brains. J Neurosci 30, 3489-3498 (2010).

289. Lee, C.T., Ma, Y.L. & Lee, E.H. Serum- and glucocorticoid-inducible kinase1 enhances contextual fear memory formation through down-regulation of the expression of Hes5. J Neurochem 100, 1531-1542 (2007).

290. Scoville, W.B. & Milner, B. Loss of recent memory after bilateral hippocampal lesions. Journal of neurology, neurosurgery, and psychiatry 20, 11-21 (1957).

291. Encinas, J.M. et al. Division-coupled astrocytic differentiation and age-related depletion of neural stem cells in the adult hippocampus. Cell stem cell 8, 566-579.

161

292. Wang, Z.Y. & Chen, Z. Acute promyelocytic leukemia: from highly fatal to highly curable. Blood 111, 2505-2515 (2008).

293. Kondratyev, M. et al. Gamma-secretase inhibitors target tumor-initiating cells in a mouse model of ERBB2 breast cancer. Oncogene (2011).

294. Moriya, T. et al. New trends of immunohistochemistry for making differential diagnosis of breast lesions. Medical molecular morphology 39, 8-13 (2006).

295. Mabie, P.C. et al. Bone morphogenetic proteins induce astroglial differentiation of oligodendroglial-astroglial progenitor cells. J Neurosci 17, 4112-4120 (1997).

296. Gross, R.E. et al. Bone morphogenetic proteins promote astroglial lineage commitment by mammalian subventricular zone progenitor cells. Neuron 17, 595-606 (1996).

297. Ahmed, S., Reynolds, B.A. & Weiss, S. BDNF enhances the differentiation but not the survival of CNS stem cell-derived neuronal precursors. J Neurosci 15, 5765-5778 (1995).

298. Gard, A.L. & Pfeiffer, S.E. Two proliferative stages of the oligodendrocyte lineage (A2B5+O4- and O4+GalC-) under different mitogenic control. Neuron 5, 615-625 (1990).

299. Donato, R. S100: a multigenic family of calcium-modulated proteins of the EF-hand type with intracellular and extracellular functional roles. The international journal of biochemistry & cell biology 33, 637-668 (2001).

300. Reeves, R.H. et al. Astrocytosis and axonal proliferation in the hippocampus of S100b transgenic mice. Proc Natl Acad Sci U S A 91, 5359-5363 (1994).

301. Eberhart, C.G., Kaufman, W.E., Tihan, T. & Burger, P.C. Apoptosis, neuronal maturation, and neurotrophin expression within medulloblastoma nodules. Journal of neuropathology and experimental neurology 60, 462-469 (2001).

302. Meurer, R.T. et al. Immunohistochemical expression of markers Ki-67, neun, synaptophysin, p53 and HER2 in medulloblastoma and its correlation with clinicopathological parameters. Arquivos de neuro-psiquiatria 66, 385-390 (2008).

303. de Antonellis, P. et al. MiR-34a Targeting of Notch Ligand Delta-Like 1 Impairs CD15/CD133 Tumor-Propagating Cells and Supports Neural Differentiation in Medulloblastoma. PLoS ONE 6, e24584 (2011).

304. Pistollato, F. et al. Interaction of hypoxia-inducible factor-1alpha and Notch signaling regulates medulloblastoma precursor proliferation and fate. Stem Cells 28, 1918-1929 (2011).

305. Parepally, J.M., Mandula, H. & Smith, Q.R. Brain uptake of nonsteroidal anti-inflammatory drugs: ibuprofen, flurbiprofen, and indomethacin. Pharmaceutical research 23, 873-881 (2006).

162

306. Beher, D. et al. Selected non-steroidal anti-inflammatory drugs and their derivatives target gamma-secretase at a novel site. Evidence for an allosteric mechanism. J Biol Chem 279, 43419-43426 (2004).

307. Sivak-Sears, N.R., Schwartzbaum, J.A., Miike, R., Moghadassi, M. & Wrensch, M. Case-control study of use of nonsteroidal antiinflammatory drugs and glioblastoma multiforme. American journal of epidemiology 159, 1131-1139 (2004).

308. Weggen, S. et al. A subset of NSAIDs lower amyloidogenic Abeta42 independently of cyclooxygenase activity. Nature 414, 212-216 (2001).

309. Thun, M.J., Namboodiri, M.M., Calle, E.E., Flanders, W.D. & Heath, C.W., Jr. Aspirin use and risk of fatal cancer. Cancer Res 53, 1322-1327 (1993).

310. Kwon, C. et al. Notch post-translationally regulates beta-catenin protein in stem and progenitor cells. Nature cell biology (2011).

311. Singh, S.K., Clarke, I.D., Hide, T. & Dirks, P.B. Cancer stem cells in nervous system tumors. Oncogene 23, 7267-7273 (2004).

312. Rakic, P. DNA synthesis and cell division in the adult primate brain. Annals of the New York Academy of Sciences 457, 193-211 (1985).

313. Gross, C.G. Neurogenesis in the adult brain: death of a dogma. Nat Rev Neurosci 1, 67-73 (2000).

314. Seri, B. et al. Composition and organization of the SCZ: a large germinal layer containing neural stem cells in the adult mammalian brain. Cereb Cortex 16 Suppl 1, i103-111 (2006).

315. Nakatomi, H. et al. Regeneration of hippocampal pyramidal neurons after ischemic brain injury by recruitment of endogenous neural progenitors. Cell 110, 429-441 (2002).

316. Yoshimura, S. et al. FGF-2 regulation of neurogenesis in adult hippocampus after brain injury. Proc Natl Acad Sci U S A 98, 5874-5879 (2001).

317. Liu, J., Solway, K., Messing, R.O. & Sharp, F.R. Increased neurogenesis in the dentate gyrus after transient global ischemia in gerbils. J Neurosci 18, 7768-7778 (1998).

318. Hopewell, J.W. & Wright, E.A. The importance of implantation site in cerebral carcinogenesis in rats. Cancer Res 29, 1927-1931 (1969).

319. Alcantara Llaguno, S. et al. Malignant astrocytomas originate from neural stem/progenitor cells in a somatic tumor suppressor mouse model. Cancer cell 15, 45-56 (2009).

320. Holland, E.C. et al. Combined activation of Ras and Akt in neural progenitors induces glioblastoma formation in mice. Nature genetics 25, 55-57 (2000).

163

321. Marumoto, T. et al. Development of a novel mouse glioma model using lentiviral vectors. Nature medicine 15, 110-116 (2009).

322. Joseph, N.M. et al. The loss of Nf1 transiently promotes self-renewal but not tumorigenesis by neural crest stem cells. Cancer cell 13, 129-140 (2008).

323. Zheng, H. et al. Induction of abnormal proliferation by nonmyelinating schwann cells triggers neurofibroma formation. Cancer cell 13, 117-128 (2008).

324. Kriegstein, A., Noctor, S. & Martinez-Cerdeno, V. Patterns of neural stem and progenitor cell division may underlie evolutionary cortical expansion. Nat Rev Neurosci 7, 883-890 (2006).

325. Bodine, D.M., Seidel, N.E. & Orlic, D. Bone marrow collected 14 days after in vivo administration of granulocyte colony-stimulating factor and stem cell factor to mice has 10-fold more repopulating ability than untreated bone marrow. Blood 88, 89-97 (1996).

326. Cicalese, A. et al. The tumor suppressor p53 regulates polarity of self-renewing divisions in mammary stem cells. Cell 138, 1083-1095 (2009).

327. Lee, J. et al. Epigenetic-mediated dysfunction of the bone morphogenetic protein pathway inhibits differentiation of glioblastoma-initiating cells. Cancer cell 13, 69-80 (2008).

328. Britz, O. et al. A role for proneural genes in the maturation of cortical progenitor cells. Cereb Cortex 16 Suppl 1, i138-151 (2006).

329. Munji, R.N., Choe, Y., Li, G., Siegenthaler, J.A. & Pleasure, S.J. Wnt signaling regulates neuronal differentiation of cortical intermediate progenitors. J Neurosci 31, 1676-1687 (2011).

330. Hirabayashi, Y. et al. Polycomb limits the neurogenic competence of neural precursor cells to promote astrogenic fate transition. Neuron 63, 600-613 (2009).

331. Obayashi, S., Tabunoki, H., Kim, S.U. & Satoh, J.I. Gene Expression Profiling of Human Neural Progenitor Cells Following the Serum-Induced Astrocyte Differentiation. Cellular and molecular neurobiology (2009).

332. Potzner, M.R. et al. Prolonged Sox4 expression in oligodendrocytes interferes with normal myelination in the central nervous system. Molecular and cellular biology 27, 5316-5326 (2007).

333. Bergsland, M., Werme, M., Malewicz, M., Perlmann, T. & Muhr, J. The establishment of neuronal properties is controlled by Sox4 and Sox11. Genes Dev 20, 3475-3486 (2006).

334. Sinner, D. et al. Sox17 and Sox4 differentially regulate beta-catenin/T-cell factor activity and proliferation of colon carcinoma cells. Molecular and cellular biology 27, 7802-7815 (2007).

164

335. Scharer, C.D. et al. Genome-wide promoter analysis of the SOX4 transcriptional network in prostate cancer cells. Cancer Res 69, 709-717 (2009).

Date post:	17-Jan-2020
Category:	Documents
Upload:	others
View:	2 times
Download:	0 times

Notch Pathway Blockade in Human Glioblastoma Stem Cells ... · Notch Pathway Blockade in...

Documents