Nuclear Receptor Research: Contributions from Latin America · Contents Nuclear Receptor Research:...

AgiAlPublishing HousePublishing House

Nuclear Receptor Research

Nuclear Receptor Research: Contributions from Latin America

Guest Editors: Marcelo H. Napimoga, Mario Galigniana, Susana Castro-Obregon, Sergio A. Onate, and Ana Carolina Migliorini Figueira

Nuclear Receptor Research:Contributions from Latin America

Nuclear Receptor Research:Contributions from Latin America

Guest Editors: Marcelo H. Napimoga,Mario Galigniana, Susana Castro-Obregon,Sergio A. Onate, and Ana Carolina Migliorini Figueira

Nuclear Receptor Research

Copyright © 2014 AgiAl Publishing House. All rights reserved.

This is a special issue published in “Nuclear Receptor Research.” All articles are open access articles distributed under the Cre-ative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.

Editor-in-CheifMostafa Z. Badr, University of Missouri-Kansas City, USA

Geographical Editors Christopher Corton, The Environmental Protection Agency, USA [North America]Jörg Mey, Hospital Nacional de Parapléjicos, Spain [Europe and the Middle East]Marcelo H. Napimoga, Faculty São Leopoldo Mandic, Brazil [South America]Nanping Wang, Peking University, China [Asia and Australia]

Leggy A. Arnold, USAYaacov Barak, USAThomas Burris, USAIgnacio Camacho-Arroyo, MexicoJohn Cidlowski, USALluis Fajas Coll, Switzerland

Brian J. Aneskievich, USAJeffrey Arterburn, USAFrank Beier, CanadaRobert G. Bennett, USACarlos Bocos, SpainMoray Campbell, USAThomas Chang, CanadaTaosheng Chen, USAHueng-Sik Choi, Republic of KoreaColin Clyne, AustraliaAustin Cooney, USAPietro Cozzini, ItalyMaurizio Crestani, ItalyPaul D. Drew, USA

Frédéric Flamant, FranceMario Galigniana, ArgentinaJan-Åke Gustafsson, USAAnton Jetten, USAStafford Lightman, UKSridhar Mani, USA

Nourdine Faresse, SwitzerlandGrace Guo, USAHeather Hostetler, USAWendong Huang, USAHiroki Kakuta, JapanYuichiro Kanno, JapanDouglas Kojetin, USAChristopher Lau, USAAntigone Lazou, GreeceChih-Hao Lee, USAXiaoying Li, ChinaYong Li, ChinaGoldis Malek, USAShaker A. Mousa, USA

Iain J. McEwan, UKAntonio Moschetta, ItalyBryce M. Paschal, USABart Staels, FranceJiemin Wong, ChinaWen Xie, USA

Noa Noy, USASergio A. Onate, ChileEric Ortlund, USARichard P. Phipps, USAEric Prossnitz, USAEnrique Saez, USAEdwin R. Sanchez, USAAndrea Sinz, GermanyKnut Steffensen, SwedenCecilia Williams, USAXiao-kun Zhang, USAChun-Li Zhang, USAChangcheng Zhou, USA

Associate Editors

Editorial Board

Contents

Nuclear Receptor Research: Contributions from Latin America, Marcelo Henrique Napimoga,Mario D. Galigniana, Ana Carolina Migliorini Figueira, Sergio A. Onate, and Susana Castro-ObregonVolume 1 (2014), Article ID 101149, 3 pages

The Modulatory Effect of 15d-PGJ2 in Dendritic Cells, Thaís Soares Farnesi-de-Assunção, Vanessa Carregaro, Carlos Antonio Trindade da Silva, Antonio José de Pinho Jr, and Marcelo Henrique NapimogaVolume 1 (2014), Article ID 101083, 7 pages

The Emerging Role of TPR-Domain Immunophilins in the Mechanism of Action of Steroid Receptors, G. I. Mazaira, M. Lagadari, A. G. Erlejman, and M. D. GalignianaVolume 1 (2014), Article ID 101094, 17 pages

Corticosteroid Receptors, Their Chaperones and Cochaperones: How Do They Modulate Adipogenesis?, Judith Toneatto, Nancy L. CharÓ, Agostina Naselli, Melina Muñoz-Bernart, Antonella Lombardi,and Graciela Piwien-PilipukVolume 1 (2014), Article ID 101092, 17 pages

Investigation of Interactions between DNA and Nuclear Receptors: A Review of the Most Used Methods, Juliana Fattori, Nathalia de Carvalho Indolfo, Jéssica Christina LÓis de Oliveira Campos, Natália Bernardi Videira, Aline Villanova Bridi, Tábata Renée Doratioto, Michelle Alexandrino de Assis, and Ana Carolina Migliorini FigueiraVolume 1 (2014), Article ID 101090, 20 pages

Progesterone Receptor Subcellular Localization and Gene Expression Profile in Human Astrocytoma Cells Are Modified by Progesterone, Aliesha González-Arenas, Alejandro Cabrera-Wrooman, Néstor Fabián Díaz, Tania Karina González-García, Ivan Salido-Guadarrama, Mauricio Rodríguez-Dorantes, and Ignacio Camacho-ArroyoVolume 1 (2014), Article ID 101098, 10 pages

Modulation of the Glucocorticoid Receptor Activity by Post-Translational Modifications, Ana Clara Liberman, María Antunica-Noguerol, and Eduardo ArztVolume 1 (2014), Article ID 101086, 15 pages

Nuclear Receptor ResearchVol. 1 (2014), Article ID 101149, 3 pagesdoi:10.11131/2014/101149

AgiAlPublishing House

http://www.agialpress.com/

Editorial

Nuclear Receptor Research: Contributions fromLatin America

Marcelo Henrique Napimoga1, Mario D. Galigniana2, Ana Carolina Migliorini Figueira3,Sergio A. Onate4, and Susana Castro-Obregon5

1Laboratory of Immunology and Molecular Biology, São Leopoldo Mandic Institute and Research Center, Campinas/SP, Brazil2Departamento de Química Biológica-IQUIBICEN, Facultad de Ciencias Exactas y Naturales, Universidad de Buenos Aires andIBYME-COICET, Buenos Aires, Argentina3Brazilian Biosciences National Laboratory (LNBio), Brazilian Center for Research in Energy and Materials (CNPEM), P.O. Box6192, Campinas-SP, Brazil4School of Medicine, University of Concepcion, Chile5Departamento de Neurodesarrollo y Fisiología, División de Neurociencias, Instituto de Fisiología Celular, Universidad NacionalAutónoma de México, Mexico

Corresponding Author: Mario D. Galigniana; email: [email protected]

Received 6 November 2014; Accepted 6 November 2014

Copyright © 2014 Marcelo Henrique Napimoga et al. This is an open access article distributed under the Creative CommonsAttribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original workis properly cited.

On behalf of the Editorial Board of Nuclear ReceptorResearch, it is a great pleasure to welcome you to theinaugural issue of the journal. We are proud to introduce thefirst thematic issue of many to come.

The fact that virtually every single aspect of cell functionand the complex network of regulatory processes in anorganism involve crucial roles by nuclear receptors is notsurprising at the present time. Accordingly, thousands ofstudies are published every year in hundreds of journals withvery broad spectra, making it difficult for researchers in thefield to find specific information of interest to them. Thisis the reason why Nuclear Receptor Research was born; togather in one journal most of the advances covering all facetsof this cardinal group of regulatory transcription factors.Thus, Nuclear Receptor Research is intended to meet acrucial need of researchers in an ever expanding and excitingfield that has shown an extraordinary progress since the late1800s.

Historical Events: Perhaps the first steps in the discoveryof nuclear receptors may be traced to 1889, when the Frenchphysiologist Charles Édouard Brown-Séquard suggested tothe Society of Biology in Paris that the testes might pro-duce an active and invigorating substance able to act inthe whole body, and proposed that it could be obtainedfrom animals and injected into men, rejuvenating them.Actually, he assayed that “testicular liquid” by injectinghimself and experiencing radical changes such as regaininghis lost strength and natural impetuosity [1]. In 1902, theEnglish physiologists William Bayliss and Ernest Starlingdiscovered the first biological regulator produced by onetissue and conveyed by the bloodstream to another to effectphysiological activity. They isolated the first postman thatdelivered biological messages, the secretin [2]. Three yearslater, Starling coined the name hormone [3] of this type ofcompounds, a word derived from the Greek meaning ‘toarouse or excite’. He defined it as “the chemical messengers

2 Nuclear Receptor Research

which speeding from cell to cell along the blood stream,may coordinate the activities and growth of different partsof the body”. Thus, the concept that hormonal regulation as amajor biological event was first proposed in this sentence andearly physiology took a major step forward. Some years later,Edward Kendall at the Mayo Clinic isolated an iodoaminoacid, thyroxine, and also purified the compound E from theadrenal gland, which was used to treat rheumatoid arthritisand was renamed cortisone [4].

In 1958, Elwood Jensen synthesized a radioactive estrogenin the Fermi laboratory at the University of Chicago andadministered it to ovariectomized rats. The hormone wasretained in the uterus and other reproductive tissues; organsthat grow in response to estrogen [5], and thus the steroidreceptor theory was born. Such organ-specific retentionof estradiol was arguably the first evidence for bindingof a hormone to a receptor, yet even as late as 1968,some pharmacologists felt the use of the word “receptor”,to describe the estradiol-binding entity, was inappropriate[6].

The first cloning of a nuclear receptor was achievedin 1985 [7], a development that led to the birth of asuperfamily of ligand activated transcription factors; thenuclear receptor superfamily. Another term was also born atthe same time, “orphan receptors”. Unlike those membersthat had previously been identified with prior knowledgeof a naturally occurring ligand, “orphan receptors” sharesequence homology and structural similarity with the classicgroup of ligand-activated transcription factors, but theirputative endogenous ligand(s) remained unknown.

To date, nuclear receptors constitute the largest groupof transcription factors in animals comprising 48 familymembers in humans and 270 in Caenorhabditis elegans [8].The study of how these receptors interact with genomicregions to control a plethora of biological processes hasprovided critical insight into physiology, signaling pathways,cell cycle, differentiation, development, evolution, and themolecular basis of most diseases. In view of these factsand the evident widespread relevance of the superfamily,their roles in the etiology of several human diseases havetransformed these receptors into attractive therapeutic targetsfor the design and development of novel specific drugtreatments.

The elucidation of the crystal structure of the nuclearreceptor Ligand Binding Domain revealed various confor-mations and structure conservation among many members ofthis superfamily [9]. Moreover, the advent of structural biol-ogy combined with new technologies like high-throughputmethods, novel biochemical methods, and pathway analysistools have led to new discoveries of different ligand bindingsites, allowing the elucidation of specific molecular mech-anisms of activation of nuclear receptors and increasing thepharmacological efficacies of new drugs. Following this line,new molecules which modulate nuclear receptors have beendiscovered, making this family of receptors one of the top

ten drug targets accounting for 13% of FDA approved drugs[10, 11].

Early contribution to the field from Latin America:Latin American scientists have made important contributionsto the field of nuclear receptor research. The ArgentineanBernardo Houssay is one of the major contributors andfirst Nobel laureate in sciences in the region due to hisdiscoveries on the role of the anterior hypophysis gland incarbohydrate metabolism. In the 1930s, Dr. Houssay showedthe diabetogenic effect of anterior hypophysis extracts andthe decrease in diabetes severity with anterior hypophysec-tomy, leading to other key discoveries such as the pituitary-adrenocortical relationship. These discoveries stimulated thestudy of hormonal feedback control mechanisms which arecentral to all aspects of modern endocrinology and hormone-receptor interaction. Latin America is also credited with anumber of professors and institutions awarded prestigiousprizes and fellowships from philanthropic institutions, likethe John S. Guggenheim Foundation, the Howard HughesMedical Institute, and the PewCharitable Trusts, to name justa few. As economies of the continent improve, governmentsare devoting greater resources to research, as well as pro-viding better infrastructure and policies to support science.Therefore, this inaugural issue was focused on some of themost recent contributions of Latin American researchers inthe field.

Content of this issue: In this thematic issue of NuclearReceptor Research, there is a collection of excellent reviewand research articles contributed by researchers in LatinAmerica.

The paper by Thaís Soares Farnesi-de-Assunção et al.evaluates the effects of the PPAR𝛾 endogenous ligand15-deoxy-Δ12,14-PGJ2 (15d-PGJ2) on the inflammatoryresponse of dendritic cells. Usually, PPAR𝛾 ligands nega-tively regulate the innate and adaptative immune responsein different experimental models. Although several studieshave shown an anti-inflammatory action for 15d-PGJ2, afew reports have focused on the potential mechanism ofits direct action on dendritic cells. Therefore, the authorshave evaluated the expression of surface molecules such asMHC-II, CD80 and CD86 and have also compared cytokineproduction in cells treated with 15-d-PGJ2 or rosiglitazone.The natural ligand 15d-PGJ2 shows as a more efficient agentto reduce both the expression of CD80 and CD86 (withoutaffecting the expression of MCH-class II) and the productionof the proinflammatory cytokines IL-12, IFN-γ, and TNF-α.Because PPAR𝛾 is an attractive pharmacologic target wheredendritic cells are involved, it is suggested that this naturalPPAR𝛾 ligand could be a therapeutic strategy in diseaseto reduce the expression of costimulatory molecules andmodulate the inflammatory response.

Gisela Mazaira et al. evaluate a novel model for themechanism of action of steroid receptors. For several years,it was thought that receptor trafficking throughout thecytoplasm was a stochastic and passive mechanism triggered

Nuclear Receptor Research 3

by the dissociation of the Hsp90-based molecular complexfrom the receptor upon ligand binding. Here, is discussedthe experimental evidence that has led to assign a key roleto Hsp90-binding immunophilins in the regulation of thisprocess, demonstrating that the Hsp90-based heterocomplexis indeed an essential component for receptor movement.Roles of Hsp90-binding immunophilins in the nucleartranslocation of steroid receptors through the nuclear pore,how transcriptional activity is affected, and the consequencein cancer development are also discussed.

Judith Toneatto et al. have analyzed the relevance ofmolecular chaperones and co-chaperones in the processof adipocyte differentiation modulated by both the gluco-corticoid receptor and the mineralocorticoid receptor. Thepotential coordinated action of glucocorticoids and miner-alocorticoids in adipose tissue is evaluated in an attempt tounderstand the molecular basis of obesity and the metabolicsyndrome. The roles of steroid metabolizing enzymes,adipocytes as a source of aldosterone, and the recentlydiscovered influence of the FK506-binding immunophilin of51-kDa are examined in detail.

Ana Liberman et al. dissect several aspects of the post-translational regulation of the glucocorticoid receptor inresponse to external stimuli. The pleiotropic actions of theglucocorticoid receptor depends on the different responsivesequences in different cell types, the multiple receptorisoforms generated by alternative splicing and translationinitiation, the type of associated chaperones, and post-translational modifications. In this article, post-translationalevents on the receptor as well as associated proteins are ana-lyzed. Events including actions of various protein-kinases,acetylation, ubiquitination, methyltion, sumoylation, etc., arepresented. Cross-talk between neuroendocrine responses andimmune system is also discussed.

The article by Juliana Fattory et al. evaluate and providenuances on the modern methodology required for investiga-tions focused on interactions between DNA and the DNAbinding domain of nuclear receptors; an event which isnecessary to shed light on important roles of the participationof these receptors in transcriptional mechanisms and inspecific genes networks. The article discusses advantagesand disadvantages of these methods, provides tools toanswer some specific questions, and helps the reader tochoose the most suitable methodology to study receptor-DNA interactions according to the specific question thatresearchers may wish to answer.

The article by Aliesha González-Arenas et al. studies theeffects of ligand binding on the subcellular localization ofprogesterone receptor in a grade III human astrocytoma cellline, and have analyzed by microarray the profile of expres-sion of genes regulated by the natural agonist progesterone(PR), the PR antagonist RU486, or both steroids. Inasmuchas a direct relation between PR expression and astrocytomatumor grade exists, the authors focused their study onthe identification of genes regulated by intracellular PR or

through other signaling pathways that influence astrocytomasgrowth. Thirty genes were regulated by progesterone, forty-one genes by RU486, and thirteen genes by the co-treatmentwith both steroids. The genes that were modulated positivelyor negatively after 12 h of treatment with steroid encodefor proteins involved in metabolism, transport, cell cycle,proliferation, metastasis, apoptosis, processing of nucleicacids and proteins, adhesion, pathogenesis, immunologicalprocesses, cytoskeleton organization and membrane recep-tors. This agrees with the fact that malignant astrocytomashave a complex process in which the expression of variousgenes is modified to allow the tumor cells to have oxygensupply and nutrients, escape the immune system and have theability to migrate and invade.

Again, on behalf of all members of the Editorial Board ofthis new born journal, you are very welcome to this inauguralissue of Nuclear Receptor Research. We all look forwardto the academic dialogue and prosperous collaborations wehope and wish to initiate with this challenging endeavor.

References

[1] C. E. Brown-Sequard, The effects produced on man bysubcutaneous injections of a liquid obtained from the testicleson animals, The Lancet, 137, 105–107, (1889).

[2] W. M. Bayliss and E. H. Starling, The mechanism of pancreaticsecretion, The Journal of Physiology, 28, 325–353, (1902).

[3] E. H. Starling, The Croonian lectures. I. On the chemicalcorrelation of the functions of the body, The Lancet, 166, 339–341, (1905).

[4] R. D. Simoni, R. L. Hill, and M. Vaughan, The isolation ofthyroxine and cortisone: the work of Edward C. Kendall, TheJournal of Biological Chemistry, 277, p. e10, (2002).

[5] E. V. Jensen, Studies of growth phenomena using tritiumlabeled steroids, in Proceedings of the 4th InternationalCongress of Biochemistry, 15, p. 119, 1958.

[6] R. J. Wurtman, Estrogen receptor: ambiguities in the use of thisterm, Science, 159, no. 820, p. 1261, (1968).

[7] S. M. Hollenberg, C. Weinberger, E. S. Ong, G. Cerelli, A.Oro, R. Lebo, E. B. Thompson, M. G. Rosenfeld, and R. M.Evans, Primary structure and expression of a functional humanglucocorticoid receptor cDNA, Nature, 318, no. 6047, 635–641, (1985).

[8] Z. Zhang, P. E. Burch, A. J. Cooney, R. B. Lanz, F. A.Pereira, J. Wu, R. A. Gibbs, G. Weinstock, and D. A. Wheeler,Genomic analysis of the nuclear receptor family: new insightsinto structure, regulation, and evolution from the rat genome,Genome Research, 14, no. 4, 580–590, (2004).

[9] W. Bourguet, M. Ruff, P. Chambon, H. Gronemeyer, and D.Moras, Crystal structure of the ligand-binding domain of thehuman nuclear receptor RXR-α, Nature, 375, no. 6530, 377–382, (1995).

[10] J. P. Overington, B. Al-Lazikani, and A. L. Hopkins, Howmanydrug targets are there? Nature Reviews Drug Discovery, 5, no.12, 993–996, (2006).

[11] Nuclear Receptors as Drug Targets. Eckhard Ottow andHilmar Weinmann, WILEY-VCH Verlag GmbH & Co. KGaA,Weinheim, Germany, 2008.




Research Article

TheModulatory Effect of 15d-PGJ2in Dendritic Cells

Thaís Soares Farnesi-de-Assunção1, Vanessa Carregaro2, Carlos Antonio Trindade daSilva3, Antonio José de Pinho Jr4, andMarcelo Henrique Napimoga4

1Department of Physiology, Federal University of Triangulo Mineiro, Uberaba, Minas Gerais, Brazil2Department of Immunology, Faculty of Medicine of Ribeirão Preto, University of São Paulo, Ribeirão Preto/SP, Brazil3Institute of Genetics and Biochemestry, Laboratory of Nanobiotecnology, Federal University of Uberlândia,Uberlândia/MG, Brazil4Laboratory of Immunology and Molecular Biology, São Leopoldo Mandic Institute and Research Center, Campinas/SP, Brazil

Corresponding Author: Marcelo H. Napimoga; email: [email protected]

Received 22 April 2014; Accepted 6 May 2014

Editor: Paul D. Drew

Copyright © 2014 Thaís Soares Farnesi-de-Assunção et al. This is an open access article distributed under the Creative CommonsAttribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original work isproperly cited.

Abstract. The PPAR-𝛾 ligands, in special 15-deoxy-Δ12,14-PGJ2 (15d-PGJ2), negatively regulate the cells of innate and adaptativeimmune system and present excellent results in different models of inflammatory diseases. These findings support the notion thatPPAR-𝛾 ligands may be used as therapeutic agents in different diseases. Although PPAR-𝛾 is expressed in different cells and tissuesincluding dendritic cells (DC), few studies have evaluated the effects of these ligands on DCs. Thus, in this study we evaluated theeffect of 15d-PGJ2 on DC surface molecule expression, including MHC-II, CD80, and CD86. In addition, we quantified cytokineproduction in the presence of 15d-PGJ2 or rosiglitazone. Expression of the surface molecules was measured by flow cytometryand cytokines production was measured by ELISA in supernatant of BMDC cultures. The results suggest that 15d-PGJ2 reducedthe expression of costimulatory molecules (CD80 and CD86), without altering MCH-class II expression. Furthermore the naturalPPAR-𝛾 agonist significantly reduced levels of proinflammatory cytokines (IL-12, IFN-𝛾 , and TNF-𝛼) and appears to also reduceIL-1𝛽 levels. Rosiglitazone reduced the expression of these cytokines albeit to a lesser extent. These data suggest the idea that15d-PGJ2 could be a therapeutic strategy in diseases where DCs play a crucial role, due to its ability to reduce costimulatorymolecules expression and modulate the inflammatory environment.

Keywords: PGJ2, inflammation, dendritic cells, PPAR-gamma

1. Introduction

Dendritic cells (DCs) are important professional antigen-presenting cells (APCs) that initiate and modulate immuneresponses [1, 2]. DCs present antigen to T cells inthe context of cell surface major histocompatibilitycomplex (MHC) class II molecules and costimulatory

molecules, such as CD40, CD80 (B7-1), and CD86(B7-2), that are essential for lymphocyte activation[3].

Dendritic cells are present in all tissues in immaturestate characterized by low surface expression of MHC-II andcostimulatory molecules [4]. However, signals associatedwith inflammation or infectious disease cause maturing of


DCs. This process involves complex phenotypic and func-tional chances. These mature DCs exhibited high expressionof costimulatory molecules, such as CD80, CD86, andCD40, upregulated MHC classes I and II, and producedproinflammatory cytokines, such as IL-12 and TNF-𝛼 [5].Thus, DCs migrate from peripheral organs via the lymph tosecondary lymphoid organs, where the antigens are presentedto naïve T cells, generating effector T cells, that producemore and more proinflammatory cytokines activating otherimmune cells, causing tissue damage, and besides establish-ing immunological memory [4].

15-Deoxy-Δ12,14-prostaglandin J2 (15d-PGJ2) is a deriva-tive of prostaglandin D2 and is a natural ligand of per-oxisome proliferator-activated receptor-gamma (PPAR𝛾),which is a transcriptional nuclear receptor [6]. Importantly15d-PGJ2 differs from other prostaglandins, both chemi-cally and biologically, in several respects [7], especiallybecause it has anti-inflammatory [8–11], antiproliferative[12], and antinociceptive effects [13, 14]. Moreover, PPAR-𝛾 is expressed in macrophages, monocytes, eosinophils,fibroblasts, bone marrow precursors, naive and activated Tlymphocytes, and dendritic cells [15–18], which leave PPARligands, such as 15d-PGJ2, a promising therapeutic strategyto treat inflammatory diseases.

Our group has previously demonstrated that 15d-PGJ2decreased F-actin polymerization of mouse neutrophils stim-ulated with MIP-2 [10], downregulated the eosinopoiesis aswell as eosinophil recruitment following allergen challenge[19], and at small doses increased the osteoblast activity andthe bone-related proteins expression [20]. Besides, it wasdemonstrated that 15d-PGJ2 is involved in the regulationof Toll-like receptors and PPAR-𝛾-mediated signaling inDCs, thus representing a novel negative feedback mechanisminvolved in the resolution of immunologic responses [21].

Despite many studies demonstrating the anti-inflammatory capacity of 15d-PGJ2 in various experimentalmodels, there are few studies dedicated to understanding itsdirect action on immune cells such as DCs. Therefore, in thisstudy we have investigated the influence of 15d-PGJ2 on cellsurface expression of MHC and costimulatory moleculesas well as on the ability to inhibit the cytokine release byDCs.

2. Material andMethods

2.1. Animals. C57BL/6 wild-type mice weighing 20–25g, 6-8 weeks old, were kept in appropriate cages in atemperature-controlled room,with a 12h dark/light cycle, andthey had free access to water and food. All animals weremanipulated in accordance with the Guiding Principles inThe Care and Use of Animals, approved by the Council ofthe American Physiologic Society. This animal study wasdeemed to be ethical according to the Brazilian Guidelines(Resolution 11794/2008) and was approved by the AnimalEthics Committee of the São Leopoldo Mandic Faculty (no.

068/2012). The number of animals per group was kept at aminimum and each animal was used once.

2.2. Dendritic cell generation. Dendritic cells were gener-ated in vitro from bone marrow cells from 6- to 8-week-old wild-type C57BL/6 mice as described previously [22].Briefly, femurs were flushed with RPMI 1640 (Gibco-BRLLife Technologies, Grand Island, NY, USA) to release thebone marrow cells that were cultured in 6-well cultureplates in RPMI-1640 (Gibco) supplemented with 10% heat-inactivated FCS, 100 𝜇g/ml penicillin, 100 𝜇g/ml strep-tomycin, 5 × 10−5 2-mercaptoethanol (all from SigmaChemical Co., St. Louis, MO, USA), and murine GM-CSF(30 ng/ml). On days 3 and 6, the supernatants were gentlyremoved and replacedwith the same volume of supplementedmedium. On day 9, the nonadherent cells were collectedto eliminate the residual macrophage contamination. Flowcytometric evaluation of DCs shows high expression ofCD11c (data not shown).

2.3. Treatment of dendritic cells. To evaluate the effect ofdifferent concentrations of 15d-PGJ2 (Sigma–Aldrich, USA)or rosiglitazone (Avandia, Glaxo-Smith Kline, USA) onDCs,these cells (1x106/mL) were incubated with 15d-PGJ2 orrosiglitazone and/or LPS, in RPMI 1640 supplemented with10% FBS. After day 9 from DC generation, DCs werepretreated for 1 hour (37∘C in 5% CO2) with 15d-PGJ2 (1,5, or 10 𝜇M) or rosiglitazone (3, 10, or 30 𝜇M) before LPS(50 ng/mL) stimulation for 24 h (overnight at 37∘C in 5%CO2).

2.4. Flow cytometry. To assess the influence of 15d-PGJ2treatment on the expression of DC surface molecules, thesecells were harvested on plate culture and were characterizedby flow cytometry using antibodies against MHC class-II, CD80, and CD86 conjugated to PE or FITC, as wellas isotype controls. Afterwards, samples obtained from theabovementioned culture were suspended and incubated for 30min at 4∘C in PBS containing 2% of bovine serum albumin(PBS-BSA) and Fc-block to avoid nonspecific backgroundstaining. After the blocking step, DCswere identified by char-acteristic size (FSC) and granulosity (SSC) combined withtwo-color analysis. Briefly, DCs were identified as CD11c+using specific antibody conjugate with PE (BD BiosciencesPharMingen, San Diego, CA, USA), and the expression ofMHC-II, CD80, and CD86 was identified using antibodyconjugate with FITC (BD Biosciences PharMingen, SanDiego, CA, USA). The isotype controls used were rat IgG2bPE and Hamster PE/FITC (BD Biosciences PharMingen).After staining, cells were fixed with 1% paraformaldehydeand analyzed by flow cytometry (FACScan and CELLQuestsoftware; BD Biosciences PharMingen).


Medium Medium LPS 15d-PGJ2 (1μM) 15d-PGJ

2 (10μM)15d-PGJ

2 (5μM)

SS

C-A

SS

C-A

SS

C-A

SS

C-A

SS

C-A

SS

C-A

SS

C-A

SS

C-A

SS

C-A

SS

C-A

SS

C-A

SS

C-A

SS

C-A

SS

C-A

SS

C-A

FITC-A:: MHC-II FITC-A:: MHC-II FITC-A:: MHC-II FITC-A:: MHC-II FITC-A:: MHC-II

FITC-A:: CD86 FITC-A:: CD86 FITC-A:: CD86 FITC-A:: CD86 FITC-A:: CD86

FITC-A:: CD80 FITC-A:: CD80 FITC-A:: CD80 FITC-A:: CD80 FITC-A:: CD80

CD

80

CD

86

MH

C-I

I

1,81 6,12 5,83 1,23 3,38

5,00 32,61 30,90 27,83 34,56

4,11 11,61 9,57 9,49 8,34

64k

128k

192k

256k

64k

128k

192k

256k

64k

128k

192k

256k

64k

128k

192k

256k

64k

128k

192k

256k

64k

128k

192k

256k

64k

128k

192k

256k

64k

128k

192k

256k

64k

128k

192k

256k

64k

128k

192k

256k

64k

128k

192k

256k

64k

128k

192k

256k

64k

128k

192k

256k

64k

128k

192k

256k

64k

128k

192k

256k

101 102 103 104 105 101 102 103 104 105 101 102 103 104 105101 102 103 104 105 101 102 103 104 105

101 102 103 104 105 101 102 103 104 105 101 102 103 104 105 101 102 103 104 105 101 102 103 104 105

101 102 103 104 105 101 102 103 104 105 101 102 103 104 105101 102 103 104 105 101 102 103 104 105

Figure 1: Effect of 15d-PGJ2 on surface molecules expression. BMDC were subjected to the pretreatment with 15d-PGJ2(1, 5, and 10𝜇M),for 1 hour, and then stimulated with LPS. After 24 hours of stimulation, the BMDC were harvested and double-stained for CD11c or CD80,CD86, and MHC-II. Monoclonal antibody conjugated PE or FITC was used for staining and was detected through flow cytometry.

2.5. Cytokine measurements (ELISA). The levels of IL-12,IFN-𝛾 , TNF-𝛼, IL-1𝛽, and IL-10 were detected by ELISAusing protocols supplied by themanufacturer (R&DSystems,Minneapolis, USA). After all standard procedures, the opticaldensity (OD) was measured at 490 nm. Results are expressedas pg/mL of each cytokine, based on the standard curves.Cytokines levels were measured in supernatant of BMDCcultures.

2.6. Quantitative real time PCR of PPAR-γ. Total RNAwas extracted from DCs stimulated, or not, with LPSusing RNAspin Mini isolation kit (GE Healthcare, Buck-inghamshire, Germany) following the manufacturer’s recom-mendations. Gene expression of PPAR-𝛾 was normalized tothe expression of the GAPDH gene.

2.7. Statistical analysis. The means from different treat-ments were compared using ANOVA. When statisticallysignificant differences were identified, individual compar-isons were subsequently made using Bonferroni’s t-test forunpaired values. Statistical significance was set at 𝑃 value <0.05.

3. Results

FACS analysis was used in an attempt to determine theinfluence of 15d-PGJ2 on surface molecules expression ofDCs. Cells stimulated with LPS showed elevated expressionlevels of the CD80 marker (6.12) than nonstimulated DCs(1.18). 15d-PGJ2 at 1 𝜇M reduced LPS-stimulated levels to5.83, at 5𝜇M to 1.23, and at 10 𝜇M to 3.38. The same patternwas observed regarding the expression of CD86 molecule.The DC stimulated with LPS showed elevated expression ofCD86 marker (11.61) than nonstimulated DC (4.11). 15d-PGJ2at 1 and 5𝜇M slightly reduced this expression (9.57and 9.49, resp.) and at 10 𝜇M to 8.34. We also evaluatedthe expression of the MHC-II by DCs after LPS stimulation,and an elevated expression of MHC-II was observed inthe presence of LPS (32.61) compared with nonstimulatedDCs (5.00). 15d-PGJ2 at doses of 1 and 5 𝜇M reduced thisexpression (30.90 and 27.83, resp.), although this effect wasnot observed in the presence of 10 𝜇M of 15d-PGJ2 (34.56).All FACS boxes are summarized in Figure 1.

Next, we analyzed several cytokines in the LPS-stimulatedDCs in the absence and presence of 15d-PGJ2 or rosiglita-zone. The levels of IL-12p40 (Figure 2(a)), IFN-𝛾 (Figure


2500

2000

1500

1000

500

0

500

400

300

200

100

0

50

40

30

20

10

0

100

80

60

40

20

0

4000

2000

0

6000

Mediu

m

PG

J 1

0μ

M

Med

ium

LP

S 1 5

10

Med

ium

PG

J 1

0μ

M

Med

ium

LP

S 1 5

10

Mediu

m

PG

J 1

0μ

M

Mediu

m L

PS 1 5

10

Mediu

m

PG

J 1

0μ

M

Mediu

m L

PS 1 5

10

Mediu

m

PG

J 1

0μ

M

Mediu

m L

PS 1 5

10

IL-12p40

IL-1β IL-10

IFN-γ TNF-α

PGJ(μM) PGJ(μM) PGJ(μM)

LPS (50ng/mL) LPS (50ng/mL)

PGJ(μM)

LPS (50ng/mL)

PGJ(μM)

LPS (50ng/mL)

LPS (50ng/mL)

pg

/mL

pg

/mL

pg

/mL

pg

/mL

pg

/mL

(a)

(d) (e)

(b) (c)

Figure 2: Effect of 15d-PGJ2 on cytokines release. BMDCwere subjected to pretreatment with 15d-PGJ2 (1, 5, or 10𝜇M) for 1 hour, followedby LPS stimulation. After 24 hours of stimulation, the culture supernatant was harvested and the levels of IL12p40 (a), IFN-𝛾 (b, TNF-𝛼 (c),IL-1𝛽 (d), and IL-10 (e) were detected through ELISA assay. Data are the mean ± SD and are triplicate representative. #𝑃 < 0.05 mediumgroup compared with medium + LPS group. *𝑃 < 0.05 medium + LPS group compared with 15d-PGJ2 + LPS group.

2(b)), and TNF-𝛼 (Figure 2(c)) in the DC stimulated withLPS were statistically higher (𝑃 < 0.05) than mediumalone. All tested doses of 15d-PGJ2 decreased the release ofthese cytokines in a dose-dependent fashion. Furthermore,although it was not statistical significant (𝑃 > 0.05), 15d-PGJ2 decreased levels of IL-1𝛽 (Figure 2(d)) and IL-10(Figure 2(e)) in DCs stimulated with LPS. In addition, DCstimulated with LPS and treated with rosiglitazone showedstatistically decreased levels of IL-12p40 only at higher doseof this PPAR𝛾 ligand (Figure 3(a)). The levels of IFN-𝛾(Figure 3(b)) and IL-1𝛽 (Figure 3(d)) were decreased at lowerdoses of rosiglitazone, while the levels of TNF-𝛼 (Figure3(c)) were decreased with all tested doses. Levels of IL-10 (Figure 3(e)) did not show statistical significance withrosiglitazone.

It is important to point out that DC stimulated with LPSshowed elevated levels of PPAR-𝛾 mRNA expression (Figure4).

4. Discussion

In the present study we have demonstrated that the naturalagonist of PPAR-𝛾 , 15d-PGJ2, exerts an immune-modulatoryeffect on dendritic cells by promoting a reduction both inthe expression of costimulatory surface molecules (MHC-II,CD80, and CD86) and in the secretion of proinflammatory

cytokines. The glitazone PPAR-𝛾 agonist, rosiglitazone,showed a lesser modulatory effect.

DCs were discovered in 1973 by Steinman and Cohn[23]. They originate from DC precursors in the bone marrowor from monocytes. Their unique morphology promotesthe establishment of sophisticated networks, which allowsthem to interact with different lymphocyte populations [24].DCs are regarded as professional APCs and provide animportant link between the innate and the adaptive immuneresponses and play a critical role not only in the host defenseagainst pathogens and cancer but also in the tolerance andprevention against autoimmunity [5, 25]. It has recentlybeen highlighted that DCs can survey the lipid environmentthrough various cell membrane receptors, such as lipid-sensing nuclear hormone receptors, including PPAR-𝛾 andconsequently its agonist 15d-PGJ2 [26].

Previous studies have suggested that PPAR-𝛾 activationnegatively affects functional maturation of DCs in responseto environmental stimuli [18, 27]. Furthermore, PPAR-𝛾agonists have been shown to induce the rearrangementof membrane-bound costimulatory molecules [28]. In thepresent study, a downregulation of B7.1 (CD80) and B7.2(CD86) as well as MHC-II expression was observed at lowdoses of 15d-PGJ2, which corroborates the results from aprevious study by Nencioni et al. [29], thus suggesting thatPPAR𝛾 is involved in the regulatory network by stringently


##

*

100

80

60

40

20

0

6000

4000

2000

0

3000

2000

1000

0

400

300

200

100

0

800

600

400

200

0

TNF-αIFN-γ

##

***

(c)(b)(a)

(e)(d)

#

*

pg

/mL

pg

/mL

pg

/mL

pg

/mL

pg

/mL

IL-12p40

IL-1β IL-10

Med

ium

RG

Z 3

0μ

M

Med

ium

LP

S 3

10

30

Med

ium

RG

Z 3

0μ

M

Med

ium

LP

S 3

10

30

Med

ium

RG

Z 3

0μ

M

Med

ium

LP

S 3

10

30

Med

ium

RG

Z 3

0μ

M

Med

ium

LP

S 3

10

30

Med

ium

RG

Z 3

0μ

M

Med

ium

LP

S 3

10

30

RGZ (μM)

LPS (50ng/mL)

RGZ (μM)

LPS (50ng/mL)

RGZ (μM)

LPS (50ng/mL)

RGZ (μM)

LPS (50ng/mL)

RGZ (μM)

LPS (50ng/mL)

* *

Figure 3: Effect of rosiglitazone on cytokines release. BMDCwere subjected to pretreatment with rosiglitazone (3, 10, or 30𝜇M), for 1 hour,followed by LPS stimulation. After 24 hours of stimulation, the culture supernatant was harvested and the levels of IL12p40 (a), IFN-𝛾 (b),TNF-𝛼 (c), IL-1𝛽 (d), and IL-10 (e)were detected through ELISA assay. Data are the mean± SD and are triplicate representative. #𝑃 < 0.05medium group compared with medium LPS group. ∗𝑃 < 0.05 medium + LPS group compared with rosiglitazone + LPS group.

PPA

R-γ

expre

ssio

n

(β-a

ctio

n n

orm

aliz

atio

n)

Med

ium

LP

S

4

3

2

1

0

∗

Figure 4: PPAR-𝛾 expression. BMDC were subjected to LPSstimulation and after 24 hours the mRNA was extracted andquantified by RT-PCR. Data are the mean ± SD and are triplicaterepresentative. The symbol * indicates 𝑃 < 0.05.

controlling the immunostimulatory capacity of DCs. Addi-tionally, PPAR-𝛾 activation in DCs resulted in a reducedcapacity to induce lymphocyte proliferation and to primeAg-specific CTL responses [29]. Activation of PPAR𝛾 hasalso been shown to inhibit the nuclear localization of c-Rel and RelB, both of which are members of the NF-𝜅B

family of transcription factors and are reported to be essentialfor normal DC function [21]. Furthermore, PPAR𝛾 ligand-activated DCs are not only less stimulatory but also less ableto migrate in response to chemokines involved in the homingof DCs to the lymph nodes [30]. Collectively, these findingsreinforce the notion that PPAR𝛾 plays an important role inregulating DC function.

Previous studies have shown that the activation of PPAR-𝛾 reduces the expression of various cytokines suggesting atherapeutic potential for PPAR-𝛾 agonists [21, 31–34]. Theresults from the present study corroborate those findingssince IL-12, IFN-𝛾 , and TNF-𝛼 were significantly down-regulated. IL-1𝛽 and IL-10 were also reduced, althoughthis did not reach statistical significance. The activation ofPPAR-𝛾 in human monocyte-derived DCs has been reportedto decrease the secretion of IL-12, a pivotal cytokine inTh1 polarization [18], which further supports the findingsfrom this study. Dendritic cells are able to produce IL-12, a dominant cytokine involved in the development ofIFN-𝛾-producing T cells [35]. Moreover, interferons arekey effector cytokines of the innate and adaptive immunesystems. When stimulated with IL-12 produced by DC


[36], the inflammatory cytokine IFN-𝛾 is produced in largequantities by Th1 effector CD4 T cells, by CD8 T cells, andby natural killer (NK) cells. On the other hand, TNF-𝛼 andIL-1𝛽 are able to act on leukocytes and resident cells inducingthe expression of integrins and stimulating the productionof platelet-activating factor (PAF), LTB4, and chemokines,which, in turn, can activate neutrophil recruitment [37].Moreover, TNF-𝛼 and IL-1𝛽 act on endothelial cells stimulat-ing the expression of selectin and the upregulation of ICAMs[38].

The data presented in this study suggest that 15d-PGJ2 negatively affects the costimulatory molecules ofDCs as well as proinflammatory cytokines in responseto environmental stimuli. Significant efforts are cur-rently underway to establish novel PPAR roles and touncover molecular mechanisms involved in their activa-tion and repression, as well as to develop safer andmore effective ways to modulate PPAR as therapeu-tic targets to treat a myriad of diseases and conditions[39].

5. Conclusion

In conclusion, the results presented herein indicate thatthe PPAR-𝛾 agonist 15d-PGJ2 exerts an immunomodulatoryeffect on DCs via reducing the expression of costimulatorymolecules and the secretion of proinflammatory cytokines.These data suggest that 15d-PGJ2 could be a therapeu-tic strategy to treat diseases where DCs play a crucialrole.

Conflict of Interests

The authors are responsible for the content and writing ofthe paper and declare that they do not possess any financialinterest.

References

[1] R. M. Steinman, The dendritic cell system and its role inimmunogenicity, Annual Review of Immunology, 9, 271–296,(1991).

[2] J. Banchereau and R. M. Steinman, Dendritic cells and thecontrol of immunity, Nature, 392, no. 6673, 245–252, (1998).

[3] C. P. Larsen, S. C. Ritchie, R. Hendrix, P. S. Linsley, K.S. Hathcock, R. J. Hodes, R. P. Lowry, and T. C. Pearson,Regulation of immunostimulatory function and costimulatorymolecule (B7-1 and B7-2) expression onmurine dendritic cells,Journal of Immunology (Baltimore, Md. : 1950), 152, no. 11,5208–5219, (1994).

[4] V. Lukacs-Kornek and S. J. Turley, Self-antigen presentationby dendritic cells and lymphoid stroma and its implications forautoimmunity,Current Opinion in Immunology, 23, no. 1, 138–145, (2011).

[5] R. M. Steinman and J. Banchereau, Taking dendritic cells intomedicine, Nature, 449, no. 7161, 419–426, (2007).

[6] M. Ricote, A. C. Li, T. M. Willson, C. J. Kelly, and C. K.Glass, The peroxisome proliferator-activated receptor-gammais a negative regulator of macrophage activation, Nature, 391,no. 6662, 79–82, (1998).

[7] Y. J. Surh, H. K. Na, J. M. Park, H. N. Lee, W. Kim, I.S. Yoon, and D. D. Kim, 15-Deoxy-Δ12,14-prostaglandin J2,an electrophilic lipid mediator of anti-inflammatory and pro-resolving signaling, Biochemical Pharmacology, 82, no. 10,1335–1351, (2011).

[8] J. M. Kaplan, J. A. Cook, P. W. Hake, M. O’Connor,T. J. Burroughs, and B. Zingarelli, 15-Deoxy-delta(12,14)-prostaglandin J(2) (15D-PGJ(2)), a peroxisome proliferatoractivated receptor gamma ligand, reduces tissue leukoseques-tration and mortality in endotoxic shock, Shock (Augusta, Ga.),24, no. 1, 59–65, (2005).

[9] M. H. Napimoga, G. R. Souza, T. M. Cunha, L. F. Ferrari, J. T.Clemente-Napimoga, C. A. Parada, W. A. Verri, F. Q. Cunha,and S. H. Ferreira, 15d-prostaglandin J2 inhibits inflammatoryhypernociception: involvement of peripheral opioid receptor,The Journal of Pharmacology and Experimental Therapeutics,324, no. 1, 313–321, (2008).

[10] M. H. Napimoga, S. M. Vieira, D. Dal-Secco, A. Freitas,F. O. Souto, F. L. Mestriner, J. C. Alves-Filho, R. Gres-pan, T. Kawai, S. H. Ferreira, and F. Q. Cunha, Peroxi-some proliferator-activated receptor-gamma ligand, 15-deoxy-Delta12,14-prostaglandin J2, reduces neutrophil migration viaa nitric oxide pathway, Journal of Immunology (Baltimore, Md.: 1950), 180, no. 1, 609–617, (2008).

[11] Z. Z. Shan, K. Masuko-Hongo, S. M. Dai, H. Nakamura,T. Kato, and K. Nishioka, A potential role of 15-deoxy-delta(12,14)-prostaglandin J2 for induction of human articularchondrocyte apoptosis in arthritis, The Journal of BiologicalChemistry, 279, no. 36, 37939–37950, (2004).

[12] V. Paulitschke, S. Gruber, E. Hofstätter, V. Haudek-Prinz, P.Klepeisz, N. Schicher, C. Jonak, P. Petzelbauer, H. Peham-berger, C. Gerner, and R. Kunstfeld, Proteome analysis iden-tified the PPARγ ligand 15d-PGJ2 as a novel drug inhibitingmelanoma progression and interfering with tumor-stroma inter-action, PloS One, 7, no. 9, p. e46103, (2012).

[13] D. R. Pena-dos-Santos, F. P. Severino, S. A. Pereira, D.B. Rodrigues, F. Q. Cunha, S. M. Vieira, M. H. Napi-moga, and J. T. Clemente-Napimoga, Activation of peripheralkappa/delta opioid receptors mediates 15-deoxy-(Delta12,14)-prostaglandin J2 induced-antinociception in rat temporo-mandibular joint,Neuroscience, 163, no. 4, 1211–1219, (2009).

[14] M. S. Quinteiro, M. H. Napimoga, K. P. Mesquita, and J. T.Clemente-Napimoga, The indirect antinociceptive mechanismof 15d-PGJ2 on rheumatoid arthritis-induced TMJ inflamma-tory pain in rats, European Journal of Pain (London, England),16, no. 8, 1106–1115, (2012).

[15] O. Braissant, F. Foufelle, C. Scotto, M. Dauça, and W. Wahli,Differential expression of peroxisome proliferator-activatedreceptors (PPARs): tissue distribution of PPAR-alpha, -beta,and -gamma in the adult rat, Endocrinology, 137, no. 1, 354–366, (1996).

[16] S. G. Harris and R. P. Phipps, The nuclear receptor PPARgamma is expressed by mouse T lymphocytes and PPARgamma agonists induce apoptosis, European journal ofimmunology, 31, no. 4, 1098–1105, (2001).

[17] S. Ueki, T. Adachi, J. Bourdeaux, H. Oyamada, Y. Yamada, K.Hamada, A. Kanda, H. Kayaba, and J. Chihara, Expression ofPPARgamma in eosinophils and its functional role in survival


and chemotaxis, Immunology Letters, 86, no. 2, 183–189,(2003).

[18] M. Kiss, Z. Czimmerer, and L. Nagy, The role of lipid-activatednuclear receptors in shaping macrophage and dendritic cellfunction: From physiology to pathology, Journal of Allergy andClinical Immunology, 132, no. 2, 268–286, (2013).

[19] T. S. Farnesi-de-Assunção, C. F. Alves, V. Carregaro, J. R.de Oliveira, C. A. da Silva, A. B. Cheraim, F. Q. Cunha, andM. H. Napimoga, PPAR-γ agonists, mainly 15d-PGJ(2), reduceeosinophil recruitment following allergen challenge, CellularImmunology, 273, no. 1, 23–29, (2012).

[20] M. H. Napimoga, A. P. Demasi, J. P. Bossonaro, V. C. deAraújo, J. T. Clemente-Napimoga, and E. F. Martinez, Lowdoses of 15d-PGJ2 induce osteoblast activity in a PPAR-gammaindependente manner, International Immunopharmacology,16, no. 2, 131–138, (2013).

[21] S. Appel, V. Mirakaj, A. Bringmann, M. M. Weck, F.Grünebach, and P. Brossart, PPAR-gamma agonists inhibit toll-like receptor-mediated activation of dendritic cells via theMAPkinase and NF-kappaB pathways, Blood, 106, no. 12, 3888–3894, (2005).

[22] V. Carregaro, J. G. Valenzuela, T. M. Cunha, W. A. Verri, R.Grespan, G. Matsumura, J. M. Ribeiro, D. E. Elnaiem, J. S.Silva, and F. Q. Cunha, Phlebotomine salivas inhibit immuneinflammation-induced neutrophil migration via an autocrineDC-derived PGE2/IL-10 sequential pathway, Journal of Leuko-cyte Biology, 84, no. 1, 104–114, (2008).

[23] R. M. Steinman and Z. A. Cohn, Identification of a novel celltype in peripheral lymphoid organs of mice. I. Morphology,quantitation, tissue distribution, The Journal of ExperimentalMedicine, 137, no. 5, 1142–1162, (1973).

[24] B. Legein, L. Temmerman, E. A. L. Biessen, and E. Lutgens,Inflammation and immune system interactions in atherosclero-sis, Cellular and Molecular Life Sciences, 70, no. 20, 3847–3869, (2013).

[25] E. K. Koltsova and K. Ley, How dendritic cells shapeatherosclerosis, Trends in Immunology, 32, no. 11, 540–547,(2011).

[26] I. Szatmari and L. Nagy, Nuclear receptor signalling in den-dritic cells connects lipids, the genome and immune function,The EMBO Journal, 27, no. 18, 2353–2362, (2008).

[27] I. Szatmari, E. Rajnavolgyi, and L. Nagy, PPARgamma, a lipid-activated transcription factor as a regulator of dendritic cellfunction, Annals of the New York Academy of Sciences, 1088,207–218, (2006).

[28] L. Klotz, S. Hucke, D. Thimm, S. Classen, A. Gaarz, J.Schultze, F. Edenhofer, C. Kurts, T. Klockgether, A. Lim-mer, P. Knolle, and S. Burgdorf, Increased antigen cross-presentation but impaired cross-priming after activation ofperoxisome proliferator-activated receptor gamma is mediatedby up-regulation of B7H1, Journal of Immunology (Baltimore,Md. : 1950), 183, no. 1, 129–136, (2009).

[29] A. Nencioni, F. Grünebach, A. Zobywlaski, C. Denzlinger, W.Brugger, and P. Brossart, Dendritic cell immunogenicity is reg-ulated by peroxisome proliferator-activated receptor gamma,Journal of Immunology (Baltimore, Md. : 1950), 169, no. 3,1228–1235, (2002).

[30] T. M. Hanley, W. Blay Puryear, S. Gummuluru, and G.A. Viglianti, PPARgamma and LXR signaling inhibit den-dritic cell-mediated HIV-1 capture and trans-infection, PLoSPathogens, 6, p. e1000981, (2010).

[31] M. I. Iruretagoyena, S. E. Sepúlveda, J. P. Lezana, M. Hermoso,M. Bronfman, M. A. Gutiérrez, S. H. Jacobelli, and A. M.Kalergis, Inhibition of nuclear factor-kappa B enhances thecapacity of immature dendritic cells to induce antigen-specifictolerance in experimental autoimmune encephalomyelitis, TheJournal of Pharmacology and Experimental Therapeutics, 318,no. 1, 59–67, (2006).

[32] C. Jiang, A. T. Ting, and B. Seed, PPAR-gamma agonists inhibitproduction of monocyte inflammatory cytokines, Nature, 391,no. 6662, 82–86, (1998).

[33] G. Woerly, K. Honda, M. Loyens, J. P. Papin, J. Auw-erx, B. Staels, M. Capron, and D. Dombrowicz, Peroxi-some proliferator-activated receptors alpha and gamma down-regulate allergic inflammation and eosinophil activation, TheJournal of Experimental Medicine, 198, no. 3, 411–421,(2003).

[34] Y. Azuma, M. Shinohara, P. L. Wang, and K. Ohura, 15-Deoxy-delta(12,14)-prostaglandin J(2) inhibits IL-10 and IL-12 production by macrophages, Biochemical and BiophysicalResearch Communications, 283, no. 2, 344–346, (2001).

[35] S. E.Macatonia, N. A. Hosken,M. Litton, P. Vieira, C. S. Hsieh,J. A. Culpepper, M. Wysocka, G. Trinchieri, K. M. Murphy,and A. O’Garra, Dendritic cells produce IL-12 and direct thedevelopment of Th1 cells from naive CD4+ T cells, Journal ofImmunology (Baltimore, Md. : 1950), 154, no. 10, 5071–5079,(1995).

[36] A. Suto, H. Nakajima, N. Tokumasa, H. Takatori, S. Kagami,K. Suzuki, and I. Iwamoto, Murine plasmacytoid dendriticcells produce IFN-gamma upon IL-4 stimulation, Journal ofImmunology (Baltimore, Md. : 1950), 175, no. 9, 5681–5689,(2005).

[37] E. Gaudreault, J. Stankova, and M. Rola-Pleszczynski,Involvement of leukotriene B4 receptor 1 signaling inplatelet-activating factor-mediated neutrophil degranulationand chemotaxis,Prostaglandins andOther LipidMediators, 75,no. 1-4, 25–34, (2005).

[38] J. G. Wagner and R. A. Roth, Neutrophil migration mech-anisms, with an emphasis on the pulmonary vasculature,Pharmacological Reviews, 52, no. 3, 349–374, (2000).

[39] J. Youssef and M. Z. Badr, PPARs: History and Advances,Methods in Molecular Biology (Clifton, N.J.), 952, 1–6, (2013).




Review Article

The Emerging Role of TPR-Domain Immunophilinsin theMechanism of Action of Steroid Receptors

G. I. Mazaira1, M. Lagadari2, A. G. Erlejman1, andM. D. Galigniana1,2

1Departamento de Química Biológica-IQUIBICEN, Facultad de Ciencias Exactas y Naturales, Universidad de Buenos Aires,Buenos Aires, Argentina2Instituto de Biología y Medicina Experimental, CONICET, Buenos Aires, Argentina

Corresponding Author: Mario D. Galigniana; email: [email protected]

Recieved 26 May 2014; Accepted 28 August 2014

Editor: Susana Castro-Obregon

Copyright © 2014 G. I. Mazaira et al. This is an open access article distributed under the Creative Commons Attribution License,which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.

Abstract. In the absence of ligand, some members of nuclear receptor family such as corticosteroid receptors are primarily locatedin the cytoplasm, and they rapidly accumulate in the nucleus upon ligand-binding. Other members of the family such as theestrogen receptor are mostly nuclear. Regardless of their primary location, these oligomeric proteins undergo a dynamic nuclear-cytoplasmic shuttling, and their transport through the cytoplasmic compartment has always been assumed to occur in a stochasticmanner by simple diffusion. Although heuristic, this oversimplified model has never been demonstrated. Moreover, it has alwaysbeen assumed that the first step related to receptor activation is the dissociation of the Hsp90-based heterocomplex, a processreferred to as ‘transformation.’ Nonetheless, recent experimental evidence indicates that the chaperone machinery is required forthe retrotransport of the receptor throughout the cytoplasm and facilitates its active passage through the nuclear pore. Therefore,transformation is actually a nuclear event. A group of Hsp90-binding cochaperones belonging to the immunophilin family playsa cardinal role not only in the mechanism for receptor movement, but also in nuclear events leading to interactions with nuclearsites of action and the regulation of transcriptional activity. In this article we analyze the importance of molecular chaperones andTPR-domain immunophilins in the molecular mechanism of action of steroid receptors.

Keywords: Steroid receptor, TPR-domain immunophilins, Hsp90, Dynein, Trafficking

1. Introduction

Protein transport is a fundamental mechanism for the reg-ulation of protein localization and, consequently, proteinfunction. Thus, it is hardly surprising that several patholo-gies are related to mislocalization and altered functionof a variety of proteins, which may lead to cell death,cell proliferation, or initiation and progression of cancer[1–8]. It is currently accepted that soluble proteins arenot confined to the cytoplasm or the nucleus in a static

manner but are capable of shuttling dynamically throughthe nuclear pore [5, 9–11]. This property is particularlyrelevant for members of the nuclear receptor family sincethey may exist in the cytoplasm as transcriptionally inac-tive proteins that must translocate to the nucleus uponligand activation to become transcriptionally active fac-tors. Moreover, the structural reorganization and subcellularredistribution of nuclear receptor proteins is an essen-tial step to acquire certain functions and/or repress oth-ers.


For years, an unsolved question that pertains to allsignalling pathways that act via effects on gene transcriptionrelates to how soluble factors move throughout the cytoplasmto reach the nuclear compartment. The same unsolvedproblem is also valid for the intranuclear movement of thesefactors. Actually, our knowledge about the latter mechanismis even more limited. It has always been assumed thatthe driving force commanding steroid receptor movementthroughout the cytoplasm was a passive, simple diffusionmechanism. According to the classic model, this is triggeredby dissociation of the Hsp90-based chaperone complexand, subsequently, the nuclear localisation signal (NLS)becomes ‘exposed’ and is recognized by the specific nuclearimport machinery formed by importins-RanGTP proteins[12–18]. Such stochastic mechanism of movement impliesthat random collisions occur between soluble receptors andcell structures. After an effective collision, signaling proteinsbecome trapped at their sites of action by protein-proteinor protein-nucleic acid interactions. If the mechanism werethis, it would be difficult to explain how each protein exertsspecific effects when a given cascade is activated sincethe responsible protein for triggering the process wouldfreely spread throughout one or more cell compartments.Moreover, a mechanism based solely on free diffusioncollideswith a basic biological concept; that is, work is highlycompartmentalized in the cell. Inasmuch as proteins normallyoccupy the entire cell compartment upon their activation,additional mechanisms, which may include specific protein-protein interactions, must regulate protein movement to focusthose proteins to specific targets.

Cryoelectron tomography images demonstrated that thecytoplasm has highly packed assembles of organized fil-aments and macromolecules forming interconnected func-tional structures rather than freely diffusing and collidingsoluble complexes [19]. Even though this organizationshould permit the transport of soluble proteins by simplediffusion, it clearly makes the delivery of signaling factorsless efficient. When the efficiency of this transport is low,soluble proteins are usually targeted to degradation [20].

Steroid receptors are a good experimental model toanalyze the molecular mechanisms involved in the transportof soluble proteins due to the fact that the subcellularlocalization can be manipulated in a very simple manner.Some of these ligand-activated transcription factors areprimarily located in the cytoplasm in the absence of hormone.This is the case for glucocorticoid receptor (GR) [21, 22],mineralocorticoid receptor (MR) [23, 24], androgen receptor(AR) [25], dioxin receptor (AhR) [26], or vitamin D receptor(DR) [27]. Upon ligand-binding, these receptors rapidlymove (minutes) towards the nucleus, whereas they cycle-backto the cytoplasm in a slower manner (several hours) uponligand withdrawal [28]. Other members of the family suchas ER [29] or PR [30] are primarily nuclear in the absenceof ligand. Of course there are exceptions to the general ruleaccording to the cell type and physiologic condition. For

example, in the absence of steroid, the MR is usually morenuclear in COS- 7 cells [31] and CHO cells [32] than inmouse fibroblasts and rabbit duct cells [24], whereas it isentirely nuclear in cardiomyocytes [33]. Surprisingly, GRis fully nuclear in WCL2 cells [34], and PR is cytoplasmicrather than nuclear in endometrial cancer cells [35]. Regard-less of their primary localization, however, these receptors(and other nuclear factors) undergo a permanent and dynamicnucleocytoplasmic shuttling. Clearly, such diversity is mostlikely related to a dissimilar import/export balance, whichcould be due to the expression balance of TPR-domainimmunophilins [36, 37], as wewill discuss later in this article.The biological relevance of the nucleocytoplasmic shuttlingis implied by the fact that the intersection of the predictedinteractome for the Hsp90/Hsp70 chaperone machinery andthe interactome of steroid receptors represents ˜20% of geneswhose products are related to intracellular transport and/ornucleocytoplasmic shuttling [38].

It was first postulated [39] that GR activation proceededuntil an equilibrium between Hsp90-free and Hsp90-boundreceptors is reached, such that Hsp90 release (a processreferred to as ‘transformation’) consisted of a simple changein the conformation of the receptor molecule inducedby steroid binding. This triggers a series of conforma-tional and structural changes that result in dissociation ofthe chaperone complex unmasking a nuclear localisationsequence that allows receptor trafficking to the nucleusvia classical import mechanism. This classic model forthe mechanism of action of steroid receptors was positedseveral years ago [39, 40] and endured for decades [41]. Itsupported the heuristic notion that the receptor•chaperoneheterocomplex must be dissociated immediately after steroidbinding. This transformation permits the simple diffusionof the receptor towards the nucleus. GR and MR arethe members of the steroid receptor family that show thehighest cytoplasmic to nuclear localization ratio in theabsence of steroid. Therefore, most of the recent advancesto elucidate the putative transport mechanism for steroidreceptors were reached in studies where these two ligand-activated transcription factors have been used as experi-mental model. The current evidence indicates that the cyto-plasmic movement of receptors is not passive and requiresthe assistance of the molecular chaperones associated toreceptors.

2. Molecular Chaperones and TPR-DomainImmunophilins

The classic concept of molecular chaperone sustains thatthey are able to recognize structural elements of unfolded orpartially denatured polypeptides preventing or rescuing theincorrect intermolecular association of improperly folded orunfolded proteins, a situation that ultimately leads to theiraggregation and/or proteasome degradation [42]. They areinduced by several stimuli such as heat, cold, radiation,


UV light, metals, toxics, reactive oxygen species, organicsolvents, and any situation of stress. These chaperons showhighly flexible conformation such that they can adapt todifferent environmental conditions and interact with severalclient proteins.

Conformational changes are triggered by slight modifi-cations of temperature, and the expression of their genes isgreatly and efficiently induced. It is accepted that nearly 50to 200 genes are induced from archaea to human [43] andthat the leading group across the species in terms of inductionlevel are the heat-shock proteins (Hsps). Among them, Hsp90is a distinctive Hsp because, in addition of showing all theproperties that define a molecular chaperone, its principalrole in the cell is to provide biological activity to properlyfolded client proteins that show a preserved tertiary structure[44, 45]. In other words, Hsp90 works as a delicate andrefined sensor of protein function rather than a mere foldingfactor. This is particularly important for steroid receptorsbecause Hsp90 is the protein that provides them ligand-binding capacity [46].

A particular group of chaperones has been classi-fied into a particular group, the immunophilins (IMMs).They are comprised of a family of intracellular pro-teins with peptidyl-prolyl-cis/trans-isomerase (PPIase) activ-ity, that is, cis↔trans interconvertion of Xaa-Pro bonds.In turn, they are subclassified by their ability to bindimmunosuppressant drugs –cyclophilins bind cyclosporineA and FKBPs (FK506- binding proteins) bind FK506[46–48]. The signature domain of the family is thePPIase domain. Only the low molecular weight IMMsFKBP12 and CyPA are related to the immunosuppressiveeffect when the drug•immunophilin complex inhibits theSer/Thr-phosphatase activity of PP2B/calcineurin [49]. Highmolecular weight IMMs have three additional domains–the nucleotide-binding domain, where ATP binds, thecalmodulin-binding domain, a poorly characterized domainable to interact with calmodulin, and TPR domains,sequences of 34 amino acids repeated in tandems throughwhich they bind to Hsp90 [50]. TPR proteins may showtandem arrays from 3 to 16 motifs [51], which usually foldtogether to produce a single and linear solenoid domain. Notall TPR proteins are able to interact with Hsp90, but when theassociation is possible, Hsp90 forms dimers that limit onlyone TPR acceptor site per dimer [52]; that is, TPR-domainproteins are able to associate to Hsp90 when they competeone another for the only one TPR acceptor site generatedper Hsp90 dimer. This shows important consequences fromthe biological point of view. In this regard, the mostfrequent competitive binding showing opposite biologicaleffects takes place between two TPR-domain IMMs thatshare 60% identity and 75% similarity in their amino acidsequences, FKBP51 and FKBP52 [53]. Both proteins arehighly homologous not only because of their amino acidsequences, but also due to their domain organization andthree-dimensional structures [54].

3. The Hsp90•FKBP52•dynein/dynactinMolecular Machinery of Transport

Steroid receptors form heterocomplexes with molecularchaperones. The final heterocomplex undergoes a processof maturation (Figure 1) where the TPR-domain proteinHop/p60 plays an initial key role bringing together dimers ofHsp90 with the Hsp70/Hsp40 complex. Hop/p60 is criticalbecause it stabilizes the open conformation of Hsp90 dimersand prevents its intrinsic ATPase activity and Hsp90 inter-action with p23 [55]. The oligomeric complex is transferredto the receptor in an ATP-dependent manner, favoringthe recruitment of a stabilizer of the complex, the smallacidic cochaperone p23. As a consequence, Hsp90 closesits open conformation weakening Hop/p60 binding, which isreleased in a BAG-1/Hip-assisted mechanism [55, 56]. Theempty TPR acceptor site is then occupied by another TPR-domain protein, a high molecular weight IMM. To date, theIMMs that have been recovered with nuclear receptors areFKBP51, FKBP52, and CyP40, as well as the immunophilin-like proteins PP5, XAP2/AIP, and FKBPL/WisP39 [57].The latter group also possesses both the TPR and PPIasedomains, but their members lack enzymatic activity of prolyl-isomerase.

The stoichiometry of the final receptor complex includesa dimer of Hsp90, one molecule of Hsp70, one moleculeof the cochaperone p23, and one molecule of a TPR-domain protein [58, 59] (Figure 1). While the TPR-domaincochaperone Hop/p60 is only present during the matu-ration cycle and is not part of mature heterocomplexes,most steroid receptors recruit other TPR factors such asFKBP51, FKBP52, PP5, FKBPL/WisP39, or CyP40. Amongthem, FKBP51 is the only IMM unable to interact withdynein/dynactin complexes [60–62]. Even though the bio-logical function of these IMMs remains poorly understood,it is accepted that they are not related to immunosuppression,a property that concerns to the smallest members of thefamily, CyPA and FKBP12 (see [48] for a recent update).Importantly, it was demonstrated that the intermediate chainof the motor protein dynein coimmunoprecipitates with theHsp90•FKBP52 complex bound to the GR [21, 61, 63]and MR [36] suggesting that the motor protein powersthe retrograde movement of the receptor. Actually, the useof inhibitors of the ATPase activity of dynein and/or thedisruption of the complex impairs the retrotransport of thereceptor [36, 64]. Figure 2-A shows an integrated schemeof such proposed molecular machinery of transport and thepoints where the machinery can be interfered. Disruptionof the Hsp90 function with the ansamycin geldanamycin(GA) slows the nuclear translocation rate of receptors byan order of magnitude (from t0.5 = 4-5 min to 45-60min) [21]. Similar results were obtained by blockage ofthe Hsp90•FKBP52 or FKBP52•dynein interactions with anexcess of TPR domain or the PPIase domain of the IMM,respectively, or by disruption of dynein/dynactin function


Figure 1: Steroid Receptor•Hsp90 Assembly. The glucocorticoid receptor (GR) is shown as a standard model. The chaperones Hsp90and Hsp70 (and their associated cochaperone Hsp40) are assembled thanks to the presence of Hop/p60 (heat-shock organizing protein,formerly called p60). Hop/p60 has tetratricopeptide repeats (TPR) and is absolutely required to bring the two master chaperones together.This assembly can be reached spontaneously by mixing all proteins in buffer. When this basic complex is not associated to the GR, thereceptor cannot bind hormone (H, yellow sphere) because its ligand-binding domain is collapsed, but the transference of the chaperonecomplex to the receptor in an ATP- and K+-dependent manner opens the receptors cleft that can be accessed by hormone. The small acidicprotein p23 stabilizes the complex when it is bound to Hsp90 dimers. Even though the chaperone complex can be transferred as a blockto the GR, it can also be primed by Hsp70•Hsp40, and then the Hsp90•p23 complex is recruited. When the GR is properly folded andable to bind steroid, Hop/p60 is released from the complex leaving the TPR acceptor site on the Hsp90 dimer available, which is occupiedby a TPR-domain immunophilin (IMM) to form the ‘mature’ final complex. BAG-1 (Bcl-2- associated gene product-1), an Hsp70-bindingprotein, promotes the release of Hop/p60 from the complex without inhibiting GR•Hsp90 heterocomplex assembly. The release of Hop/p60can be prevented by Hip (Hsp70-interacting protein), a BAG-1 antagonistic cochaperone. Neither BAG-1 nor Hip are essential for the finalfolding of the heterocomplex and are not present in the mature form of the GR•Hsp90 complex, but they play regulatory roles on the dynamicassembly of the heterocomplex and the termination of the transcriptional activity by GR.

after the overexpression of the p50/dynactin-2 subunit ofdynactin [36]. In all these cases, the nuclear localizationof the receptor was not fully inhibited, but it was onlyimpaired (Figure 2-B). This suggests the existence of twomechanisms of transport, a rapid Hsp90•FKBP52•dyneincomplex-dependent mechanism (Figure 2-B, blue contin-uous line) and an alternative, slower and heterocomplex-independent mechanism (Figure 2B, red dotted line), perhapsdue to simple diffusion. Importantly, when the nucleartranslocation rate of these receptors is impaired, theyare highly sensitive to proteasomal degradation [20, 36].The same Hsp90•FKBP52•dynein complex constitutes themolecular machinery responsible for the retrotransport of theproapoptotic factor p53 [65], suggesting that it may play ageneral role in the retrotransport mechanism of a number ofHsp90-associated factors.

A number of publications have demonstrated that thistransport mechanism first proposed for the GR is used by sev-eral other factors such as the AAV-2 (adeno-associated virus-2) [66], poly-glutamine aggregated proteins in Kennedydisease cells [67], the brain specific protein PAHX-AP1 [68],the proapoptotic factor p53 [65], the cell cycle arrestingprotein p21 [69], the mineralocorticoid receptor (MR) [36],FKBPL/DIR1/WisP39 client proteins [62], the transcriptionfactor RAC3 [70], the ecdysone receptor [71], and so on.Moreover, the interaction between dynein and IMMs has alsobeen found in plants [72], suggesting that the functional roleof this complex has been preserved during the evolution. Inall these cases, the disruption of Hsp90 function was critical,which is not surprising if we consider that this chaperone isthe gravity center of the transport molecular machinery. It istempting to justify the inhibitory action of Hsp90 inhibitors


1.0

0.5

00 30 60

Minutes

Nu

cle

ar

Fra

cti

on

Control

+ Inhibitors

(a) (B)

Figure 2: The GR•Hsp90•FKBP52 Molecular Machinery of Movement. (A) The glucocorticoid receptor (GR) is shown as a standardmodel. GR is associated to a dimer of Hsp90 and one molecule of Hsp70, p23, and a TPR-domain immunophilin. The inactive isoforms ofthe heterocomplex are primarily cytoplasmic and FKBP51 is recovered bound to the chaperone complex. Upon steroid binding, FKBP51is exchanged by FKBP52, a highly homologous IMM that is able to interact with dynein/dynactin motor proteins. This molecular complexretrotransports GR to the nuclear compartment using microtubule tracks. Arrows show the points where the complex has been experimentallydisrupted impairing the GR retrotransport, that is, by using the Hsp90 inhibitor geldanamycin, by overexpression of the TPR domain peptidethat prevents the Hsp90•IMM interaction, or by overexpression of the PPIase domain peptide that prevents the IMM•dynein interaction.Also, the overexpression of p50/dynamitin (Dyt) subunit of dynactin interferes with the proper assembly of the dynein/dynactin motorcomplex. Both geldanamycin and overexpression of the TPR peptide interfere with the association of the oligomeric complex with structuresof the nuclear pore making the nuclear accumulation of the receptor slower. (B) Nuclear translocation rate after the addition of steroid atzero time. The dotted red line represents the translocation rate measured when the transport machinery is disrupted in the points shown inpanel A.

such as geldanamycin or radicicol due to their inhibitoryaction on the ATPase activity of Hsp90. Even though itis correct that the ADP-bound isoform of Hsp90 showslow affinity for client proteins, Hsp90 does not dissociateimmediately from the receptor in intact cells. Significantdissociation starts after 2-3 h of cell treatment with the drug[73]. Because of the alternative retrotransport mechanism isslow, but still able to move the receptor towards the nucleus(making it fully nuclear after 45-60 min), it is implied thatsuch alternative mechanism is less efficient because Hsp90 isstabilized in its less active ADP conformation.

The regulation of steroid receptor retrotransport was oneof the first biological roles discovered for FKBP51 andFKBP52. Nonetheless their functions are more extensive.For example, IMMs play important roles in the nucleus astranscriptional regulators [74] and protein-protein linkerswith other nuclear factors and structures [75].

4. The Hsp90-Based Heterocomplex Interactswith the Nuclear Pore

The modern model for steroid receptor action predicts thattransformation should be a nuclear event, and it also raisesthe concept that the chaperone system could interact with

the structures of the nuclear pore complex (NPC). The NPCis a macromolecular structure of ˜125-MDa embedded inthe nuclear envelope [76]. While small molecules are ableto diffuse freely through this structure, molecules largerthan ˜40-kDa require an active passage mediated by adapterreceptors, the importins [77, 78]. Proteins possessing aclassic nuclear localization signals (NLS) such as the caseof the SV40T antigen, nucleoplasmin or steroid receptors,utilize importin-𝛼, a protein that binds the NLS of thesubstrate and forms a trimeric complex with importin-ß, afactor known as the transport receptor that favors the passageof many cargoes through the NPC [79].

Intuitively, the Hsp90•FKBP52-dependent model forsteroid receptor retrotransport opened the possibility thatthe heterocomplex could interact with structures of theNPC such as nucleoporins (Nups). In silico analyses forprotein-protein interactions of the GR•Hsp90•TPR-domainIMM complex yielded a number of potential interactorsrelated to proteins associated with the cytoskeleton, motorproteins, and factors belonging to the nuclear import/exportsystem [80]. This led to analyze the potential interactionof GR•Hsp90 complex with importin-ß and Nups. Proteinsbelonging to the untransformed receptor (Hsp90, Hsp70,p23, and TPR-domain cochaperones such as FKBP52 and


PP5) were recovered associated to the integral nuclear poreglycoprotein Nup62. Interestingly, importin-ß1 was alsorecovered associated to GR and Hsp90 [80].

There are reports showing that the GR also associates toimportin-𝛼 [81–83]. It appears, however, that importin-𝛼 canbind to the NLS in the presence and absence of steroid [24].It has also been reported that the GR binds to importin-7 andimportin-8 in a steroid-independent manner [82], all of whichimply that additional factors are required for the hormonalregulation of GR localization. Importin-7 alone and the 𝛼/𝛽importin heterodimer were able to import an NLS-containingfragment of GR in an in vitro assay where permeabilized cellswere used in the presence of Ran•GDP and ATP, whereasthey failed to import purified full-length GR unless cellcytosol was added [82]. It is unlikely that such diluted extractwas simply providing additional importins for the reactionsince they were in great excess in the mixture. Therefore, theneed of other factors (for example, soluble chaperones andcochaperones) could be inferred. The recent demonstrationthat chaperones and TPR-domain proteins are associatedto structures of the NPC is in line with this speculation[80, 84, 85]. Interestingly, it has recently been shown that thecombined functional chaperone activity of DNA-J/Hsp40-like protein and Hsp70 is required for the formation ofstructures in the nuclear envelope that appear to emergefrom membranes next to specific subsets of NPCs, whichresults in the coordinate influx of membranes into the nucleus[84]. These atypical NPCs are attached to the outer nuclearmembrane only and generate double-membrane structurescalled DNAJ-associated nuclear globular structures, whosecontent and biological function remain to be elucidated todate.

It is possible that in the absence of hormone, the GR istethered to the Hsp90•FKBP52 heterocomplex, which mayalso be required for the proper function of some componentsof the NPC. In a recent study, it was shown that the GR bindsto both importin-𝛽 and Nup62 [80]. Studies of reconstitutionof the heterocomplex using purified proteins and reticulocytelysate as a source of chaperones demonstrated the interactionbetween GR and Nups is strengthened when both factorsare chaperoned. This observation results reasonable from theperspective that the novel model for nuclear import of steroidreceptors proposes that transformation should be nuclear.On the other hand, the discovery that Nups are chaperone-interacting proteins suggests a potential regulatory role ofthe chaperones for the nuclear import process in additionof acting as facilitators of the protein-protein interactionsrequired for the cargo passage through the pore. It is knownthat the affinity of a protein cargo for its cognate importinadaptor influences its nucleocytoplasmic transport efficiencyand represents a subtle effector of transport regulation [86].There is a correlation between the binding affinity of a NLScargo for the NLS receptor, importin-𝛼, and the nuclearimport rate for this cargo. This correlation, however, is notmaintained for cargoes that bind to the NLS receptor with

very weak or very strong affinity. Similarly, the interaction oftheGRwithNupsmay also impair the efficient delivery of thereceptor into the nucleus. In this sense, the strong associationfound betweenGR andNup62 (in their respective chaperonedcomplexes) was weakened by the presence of cytosolicfactors [80], suggesting that soluble cytosolic factors mayaffect the interaction and the import rate of cargoes. Amongthem, there is evidence that importin-𝛼 is cointernalized withthe GR [83], whereas importin-𝛽 is not. Nonetheless, theknock-down of importin-𝛽 significantly delayed GR nuclearimport [80]. In this sense, it has been reported that manyimportins including importin-𝛽 do not only mediate activetransport through NPCs, but also effectively suppress theaggregation of cargoes [87], which enhances the potentialrole of Hsp90 associated to this protein. The antiaggregationactivity of importins involves shielding of basic patcheson the cargo and predicts a precise match between cargoand receptor. However, it is hard to explain how a singletype of factor could shield each of thousands of differentprotein-, RNA-, and DNA-binding domains that are importsubstrates. Therefore, it may be envisioned that the presenceof chaperones and cochaperones associated to importin,Nups, and the cargo itself may act as a whole cooperativesystem to prevent the aggregation of cargoes when relativelyhydrophobic domains are exposed during the translocationstep. This may explain why when the GR and Nup62 areproperly folded with the Hsp90 complex, there is a moreefficient interaction compared to the naked proteins. It islikely that this could favor the translocation step. On theother hand, when these complexes are disrupted by Hsp90inhibitors such as radicicol or geldanamycin, the nucleartranslocation rate of GR [21], MR [88], and AR [89]undergoes a substantial delay (see scheme in Figure 2-A).

Interestingly, it has been reported that proteins carryingNLS bound to the 𝛼/𝛽-importin complex dissociate slowly,whereas the release of the cargo in the nuclear basket struc-ture facing the nucleoplasm milieu is faster. Consequently, itwas postulated that the rate-limiting step in the 𝛼/𝛽- importin-and Nups-mediated import pathway is the dynamic assemblyand disassembly of the importin•cargo complex rather thanthe translocation process per se [90]. Recent studies on therole of FG Nups (nucleoporins containing a high numberof Phe-Gly repeats) as functional elements of the NPCpermeability barrier showed that these proteins are highlyflexible and devoid of an ordered secondary structure [91],but those related to the NPC center are able to bind each othervia hydrophobic attractions generating a sort of cohesivemeshwork that may model the architecture of the pore [92](Figure 2-A). If integral Nups such as Nup62 are chaperonedby Hsp90, Hsp70, p23, and/or TPR-domain IMMs, it wouldbe entirely possible that the putative permeability barriermay be regulated by protein-protein interactions allowing(or not) the passage of certain cargoes. In line with thisoriginal hypothesis, more recent studies have confirmed thatHsc/Hsp70 complexes localize in the nuclear pore and are


able to recruit other proteins and cause effects on the nucleartranslocation [84, 93].

Association of TPR-domain IMMs such as FKBP52 andPP5 to Nup62 seems to be Hsp90- dependent, as it was shownby the almost complete dissociation of these IMMs fromNup62 in the presence of radicicol [80]. However, indirectimmunofluorescence assays performed in intact cells treatedwith radicicol still show the presence of both IMMs in theperinuclear ring, suggesting that these TPR proteins may alsobind to perinuclear structures of the NPC (other Nups?) inan Hsp90- independent manner. Nonetheless, competitionexperiments with the TPR domain overexpressed in intactcells showed that the perinuclear signal of FKBP52 wastotally abolished, indicating that most, if not all, types ofassociations of this IMM with any structure of the nuclearenvelope require the TPR domain. This fact is shown in themodel of Figure 2-A. It should be noted that FKBP51 was notrecovered, associated to cytoplasmic structures of the NPC,although very recent evidence demonstrated that FKBP51 isable to interact with lamin B in the inner face of the nuclearenvelope [94, 95].

The chaperone Hsp70 and the cochaperone p23, bothregular components of the GR•Hsp90 heterocomplex, arealso Nup62-associated proteins. In contrast with Hsp90, thisassociation is constitutive and suggests that both proteins arerequired for the proper architecture of Nup62. Inasmuch asHsp70 uses its ATPase cycle to control substrate bindingand release [96, 97], likewise, substrate binding to importinsis also coupled to Ran•GTP cycles. However, for somereceptor-substrate pairs, the presence of Ran•GTP in notsufficient for cargo release; instead, an appropriate bindingsite for the cargo is also required. Therefore, it would bepossible that Hsp70 may be related to the substrate binding-release equilibrium in the NPC. In this sense, it is noteworthyto emphasize that Hsp70 has been involved in the nuclearexport mechanism of importins depending on its ATPaseactivity [98].

Inasmuch as steroid receptors are constantly shuttlingbetween cytoplasm and nucleus, it is likely to speculate thatGR•importins and GR•nucleoporins complexes form anddisassemble constantly in a highly dynamic manner, even inthe absence of hormone. There are several situations wherecells broadly could alter nuclear translocation of steroidreceptors andmany other nuclear factors, but themechanismsby which this occurs are not well defined to date.

5. Nuclear Events

Steroid receptors must dimerize to become transcriptionallyactive. Dimerization interfaces have been well characterizedin both ligand-binding domain and DNA-binding domain[99]. Nonetheless, the classic model for steroid receptoraction does not explain when and where this essential stepof receptor activation takes place. The course of DNA-protein assembly has been discussed for a number of

transcription factors, and the consensus is that there are threepossible mechanisms. One mechanism implies that receptordimerization could take place in the cytoplasm beforeits nuclear translocation [100, 101]. The dimer pathwaymodel sustains that transcription factors must dimerize onthe nuclear environment to permit DNA binding, and themonomer pathway postulates that two monomers can bindsequentially to promoter sequences and protein assemblytakes place during the in situ dimerization [102, 103]. Also,it has been suggested that the level of receptor expressionaffects the formation of homodimers [101]. Nevertheless,it is still unknown whether steroid receptor homodimersform before or as a result of binding to hormone-responsiveelements because some studies have showed some evi-dence favoring the monomer pathway model [104, 105],whereas others support the dimer pathway model [106–108]. According to the observation that Hsp90•TPR- domainfactor is required for the retrotransport of steroid receptors,the modern model predicts that dimerization is likely tooccur in the nucleus rather than in the cytoplasm. Conse-quently, after the dissociation of the chaperone complex,the dimerization domains are uncovered and monomers caninteract. If this event would take place in the cytoplasm,the movement of receptors towards the nucleus wouldbecome inefficient due to the disassembly of the molecularmachinery of retrotransport. In line with this prediction,very recent experimental evidence suggested that receptortransformation is indeed a nuclear event. For example, nativeheterocomplexes cross-linked with GR [80] or MR [36] areable to reach the nuclear compartment in a steroid-dependentmanner, indicating that Hsp90 dissociation is not requiredfor the nuclear accumulation of steroid receptors. Moreover,immunoprecipitation assays of native receptors present inthe nucleoplasm ˜5 min after the addition of steroid haveshown the presence of Hsp90, p23, FKBP52, and dynein.Accordingly, the receptor is poorly associated to chromatinduring these early events and is fully bound to the insolublechromatin fraction 10 min after the addition of steroid [36].At this point, no receptor is recovered in the nucleoplasm[36].

Sucrose density gradients also demonstrated the associ-ation of the Hsp90•FKBP52 complex in the nuclear poolof receptors during the first steps of nuclear transloca-tion. These observations were confirmed recently [109] byusing extended bioluminescence resonance energy trans-fer (eBRET) and fluorescence resonance energy transfer(FRET) techniques. All these evidences univocally prove thatreceptor transformation and receptor homodimerization are anuclear process. Interestingly, cell treatment with the Hsp90-disrupting agent geldanamycin shows that homodimerizationtakes place even in the absence of ligand because Hsp90is dissociated from the receptor in the cytoplasm [109].However, such Hsp90 inhibition prevents the nuclear translo-cation of the receptor and inhibits receptor binding to DNA.This inhibition is less efficient for GR than for MR [109], adissimilarity that could contribute to themechanism bywhich


MR differs from GR in those cells where both receptors rec-ognize equal hormone-response elements. Importantly, onlyhomodimers formed in the nucleus regulate gene expression,whereas those formed in the cytoplasm do not possess theability to translocate to the nucleus and consequently areunable to influence transactivation.

Very recent findings from our laboratory also demon-strated that the NF-𝜅B transport towards the nucleus isalso regulated by the expression balance of the TPR-domainIMMs FKBP52 and FKBP51 [110]. Interestingly, NF-𝜅Bis not chaperoned by Hsp90, which assigns a cardinalrole to these TPR proteins per se. In both cases, steroidreceptors and NF-𝜅B, the overexpression of FKBP52 favorsthe nuclear retention time and nuclear anchorage of thetranscription factor, whereas the overexpression of FKBP51favors their cytoplasmic localization. Similarly, FKBP52favors transcriptional activity and FKBP51 is regarded asan inhibitory factor, except for the case of the androgenicresponse [111, 112].

The first studies performed decades ago where the nucleardistribution of steroid receptors was analyzed by microscopyevidenced a dispersed localization throughout the nucleuswith a clear exclusion from nucleoli [113, 114]. The subse-quent development of more sophisticated techniques such asconfocal laser scanning microscopy revealed that the nuclearpool of steroid receptors was indeed located in multiple dis-crete foci disseminated throughout the nonnucleolar space,whereas the absence of ligand makes that punctuated nuclearsignal observed in the presence of steroid diffuse [10, 30,115–118].

There is strong evidence that steroid receptors occupytheir nuclear sites in a transient manner relying on a hit-and-runmechanism [119], a phenomenon that is shared by severalother nuclear factors [120]. Studies have revealed rapidcycling processes during transcription, which emphasize thecentral role of time-dependent events in the mechanism ofgene regulation. Thus, after the proper stimulus nuclearproteins are recruited to promoters in an ordered manner ona time scale that may vary from minutes to hours (see [121]and references therein for a very recent update). During thedevelopment of this response, the nuclear factors that areable to interact with chromatin may cycle on and off thepromoter site multiple times, and those factors belonging tofunctional complexes often exchange very rapidly (seconds).This fast exchange of molecules within a given complextakes place independently of long-term cycling on chromatin.These processes count with the active participation of thesame molecular chaperones that form heterocomplexes withsteroid receptors. It was shown that the GR released fromchromatin recycles to chromatin upon rebinding hormonewithout exiting the nucleus [122].When the steroid is washedout from the culture medium, the GR release from chromatinis inhibited by the Hsp90-disrupting agent geldanamycin[123], suggesting a role for the Hsp90-based chaperonecomplex in the termination of transcriptional activation as

free hormone levels decline. A direct evidence for therole of Hsps and TPR-domain cochaperones in nuclearmobility of steroid receptors was provided by the ATP-dependent recovery of nuclear mobility of GR and PR onincubation with various combinations of purified chaperoneand/or cochaperone proteins [124]. The nuclear presenceof FKBP51 increased GR mobility., and more recently, itwas demonstrated that the expression balance of the Hsp90-cochaperones FKBP51 and FKBP52 determines the amountof corticosteroid receptors accumulated in the nucleus in theabsence of ligand [36], this effect being related to ability ofFKBP52 to attach receptors to the nuclear matrix.

The association of steroid receptors to specific hormone-responsive elements results in a localized chromatin transi-tion at these sites, which depends on the formation of a com-plex between the receptor and the ATP-dependent Swi/Snfcoregulator complex by altering nucleosomal structure andincreasing the accessibility of proteins to specific sequences[125]. These Swi/Snf complexes interact with Hsp90 andare rapidly recruited to the chaperone upon the onset ofheat shock [126]. In turn, they are also counted among theSmyD•Hsp90 substrates implicated in chromatin remodel-ing, such that they are upregulated by SmyD. Interestingly,Hsp90 interacts with a TPR domain present at the C-terminalend of SmyD and induces a gain-of-function conformationalchange [127]. It is likely that other TPR-domain proteinssuch as FKBP51 and FKBP52 may also regulate these eventsin similar fashion. It is tempting to hypothesize that theregulatory action of both TPR-domain IMMs on transcriptionmay lie onmechanismswhere they interact with coregulators,although this is uncertain to date.

In addition to the combined effects of heat-shock pro-teins, TPR-domain IMMs, and chromatin remodeling, theresidence times of steroid receptors at the promoter bindingsites are also dependent on proteasomal activity [128,129]. Proteasome modulates steroid receptor function byregulation of receptor bioavailability and also by interferingwith its intranuclear trafficking [129–131]. Accordingly,FRAP assays have shown that the presence of proteasomalinhibitors reduces themobility of the GR [124, 128], an effectwhere the role of nuclear molecular chaperones has beeninvolved. Thus, GR nuclear mobility assayed in digitonin-permeabilized cells was fully restored on incubation with amixture containing purified FKBP51, Hsp90, p23, and theE3 ubiquitin ligase of the GR machinery of proteasomaldegradation, CHIP (carboxyl terminus of Hsc70-interactingprotein) [124]. One possible explanation for these obser-vations is that molecular chaperones may disengage thereceptor from nuclear anchoring sites due to heterocomplexreassembly. Thus, it has been shown that Hsp90 and p23are both recruited to glucocorticoid-responsive elementsupon steroid activation of the GR [132]. The need ofFKBP51 is in agreement with the effect of this IMM on thenuclear retention of nuclear factors by competition with theanchoring effect of FKBP52 [36, 110]. A similar effect is


observed in FKBP52 KO cells and due to the overexpressionof the TPR peptide, which abolishes the nuclear pool ofsteroid receptors in the nucleus due to a ‘dominant-negative’effect on receptor anchorage to nuclear structures [36].

Interestingly, it has been shown that the proteasomeis also required for GR removal from DNA, such thatproteasome inhibition decreases receptor mobility in thenucleus by inducing nuclear matrix binding [133, 134]. Theproteasome could regulate receptor function due to twopossible mechanisms, by decreasing receptor stability byproteolysis or by affecting receptor motility in the nucleus.It has been shown that the average residence time of theGR on GRE sequences depends on the proteasome activityin an ATP-dependent fashion [128], such that the disruptionof either the proteasome pathway or Hsp90 function bygeldanamycin has opposing effects on the exchange rate ofGR [128]. This suggests that a balance between both thechaperone- and proteasome-dependent mechanisms needs tobe in place for proper nuclear recycling of GR. Proteasomeinhibition also results in immobilization of polyubiquitinatedforms of estradiol-bound hER𝛼 within the nuclear matrix[135], and a similar mechanism was also suggested for theaccumulation of polyubiquitinated forms of p53 [136]. Itappears that the nuclear transcription factors are moved fromthe promoter site to active sites of degradation, the nuclearmatrix being the scaffold structure that provides a key role inthis movement since it is the site of proteasome action.

Clusterin is a molecular chaperone whose expression levelis stress-induced via HSF-1 [137]. It is highly expressed invarious cancer types, including prostate cancer. Recently,it was shown that the proteasomal degradation of AR isincreased in prostate cancer cells when clusterin is knockeddown by a mechanism that involves the expression of theTPR domain IMM FKBP52 [138]. Casually, one of thedownstream effectors of clusterin is FKBP52, such that ARproteasomal degradation was prevented by overexpression ofFKBP52 and the expression of prostate-specific antigen wasrestored. This demonstrates that the effects of clusterin onAR stability by the proteasome are mediated by FKBP52.Unfortunately, it was not studied whether the PPIase activityof this IMM is required for such action as to target FKBP52with therapeutic purposes.

6. TPR-Domain Immunophilins in Cancer

Among the TPR-domain familymembers, many of them havebeen described to have a potential role in cancer developmentand chemoresistance. Not surprisingly due to its role insteroid receptor action, FKBP52 was found overexpressedin many hormone-dependent cancers, particularly in ER-positive breast cancer cells and preinvasive breast cancertissues [139, 140]. Also, FKBP52 shows high level ofexpression in hepatocellular carcinomas [141] and prostatecancer cells and has been proposed as a biomarker forthe latter pathology [142]. Recently, we demonstrated that

FKBP52 greatly enhances NF-𝜅B biological response [110],a transcription factor that is linked to chronic inflammationprocesses and progression of multiple diseases, includingcancer, where NF-kB is related to tumor promotion andprogression, as well as chemotherapy and radiotherapyresistance [143, 144].

As it was commented above, FKBP51 is overexpressed ina number of tumor cells and cancer tissues. One of the firstevidences connecting FKBP51 with malignant pathologieswas the observation that this TPR-domain IMM is overex-pressed in idiopathic myelofibrosis [145], a known chronicmyeloproliferative disorder characterized by bone marrowfibrosis and megakaryocyte hyperplasia. The overexpressionof FKBP51 affects the regulation of the growth factorindependence of megakaryocyte progenitors and inducesresistance to apoptosis. Overexpression of FKBP51 hasalso been documented in several human cancers such aslymphomas, gliomas, melanoma, prostate cancer, and soforth [146], but it is downregulated in pancreatic cancer[147]. Interestingly, FKBP51 binding to Hsp90 favors therecruitment of the cochaperone p23 and positively regulatesAR signaling [148] and is associated with chemoresistanceand radioresistance [147, 149]. Actually, AR is the exceptionamong members of the steroid receptor family becauseFKBP51 is regarded as a negative regulator for most of them[54].

FKBPL/WisP39 is a TPR-domain IMM that shares thesame structural properties as the other members of theFKBP family. Nonetheless, it is an IMM-like protein becauseits PPIase domain lacks enzymatic activity [150, 151].FKBPL/WisP39 was originally found during screening forgenes that were protective against ionizing radiation [150,152]. It is most closely related to FKBP52 and also showsthe ability to interact with Hsp90 in steroid receptor com-plexes, sharing with FKBP52 exactly the same properties forthe cytoplasmic retrotransport of the GR [62, 153]. Also,FKBPL/WisP39 stabilizes newly synthesized p21 preventingits degradation [154, 155]. There is conflicting data onFKBPL regarding its role in conferring radiation resistance.It was first reported that, in response to radiation, theFKBPL/Hsp90/p21 heterocomplex favored the stabilizationof p21 leading to a pro-survival effect by G2 cell cycle arrest[155]. Recently, it was shown that after radiatio n there is p21downregulation and that such decrease of p21 is the relevantaction involved in the pro-survival effect [150, 156, 157].In addition to radiation resistance, FKBPL/WisP39 plays asignificant role in tumor progression [150, 152, 155, 157].In tumor cells, FKBPL/WisP39 favors the tumor growthand it is also related to the sensitivity of the tumor tochemotherapeutic compounds [158].

Importantly, FKBPL/WisP39 interacts with theER•Hsp90 heterocomplex [159], and the expression of thisIMM is regulated by estrogens. Increased FKBPL/WisP39levels of expression lead to decreased ER expression[159, 160], and this is associated with increased survival of


untreated breast cancer patients by sensitization of cancercells to the antiproliferative effect of tamoxifen [161, 162].Recently, it was also demonstrated that FKBPL possessesantiangiogenic properties [163].

CyP40 is another TPR-domain IMM able to form hetero-complexes with steroid receptors via Hsp90. In contrast to theFKBP subfamily that bind the immunosuppressive macrolideFK506, CyP40 belongs to the cyclophilin subfamily andbinds the cyclic undecapeptide cyclosporine A. CyP40 isnot recovered with native GR and MR, but with PR andER [37, 164, 165]. Because CyP40 is also known to formcomplexes with dynein/dynactin [60] and associates to thecytoskeleton [166], it is entirely possible that this TPR-domain IMM plays a redundant role with FKBP52 andFKBPL/WisP39 in receptor trafficking. It has been shownthat CyP40 is overexpressed in breast cancer tissues whenit is compared to normal breast tissue [139] and also that thebreast cancer cell line MCF-7 shows 75-fold higher level ofCyp40 mRNA expression in response to high temperaturestress and a marked redistribution of Cyp40 protein froma predominantly nucleolar location to nuclear accumulation[167]. In the same cell type, estradiol increases proteinexpression and also the average half-life of its mRNA [168],and oxidative stress increases Cyp40 expression at higherlevels than in normal cells, a property that was also observedin prostate cancer cell lines [169]. Interestingly, breast cancercells respond similarly for both IMMs, CyP40 and FKBP52,and such upregulation in response to the mitogenic action ofestradiol in breast cancer cells is consistent with a possiblewider role for both TPR-domain IMMs in cell proliferation.

7. Summary

Essential to understanding cellular signalling mechanismsis the ultimate comprehension of how soluble proteinsinvolved in signalling cascades move throughout the cellularmilieu of subcellular compartments to reach their sites ofaction. The first discoveries focused the interest on thenature of the signals present in the travelling proteins, forexample, those conserved amino acid sequences knownas nuclear localization signals or nuclear export signals.Nowadays most studies are trying to understand the mech-anisms of signalling protein movement within both thecytoplasmic compartment and the nuclear compartment.Most of the advances in this field were reached studyingthe properties of steroid receptors, perhaps due to thefact that the members of this subfamily of the nuclearreceptor superfamily are highly versatile factors whosedistribution can be easily manipulated by the operator byadding or withdrawing the ligand from the medium. Asa consequence of this, there is considerable evidence thatthe dynamic assembly of some transcription factors withthe Hsp90•FKBP52-based heterocomplex is involved in themovement of them within the cytoplasm and the nuclearcompartment.

It is still uncertain whether Hsp90•TPR complex assem-bly is related to the subcellular relocalization of a limitednumber of transcription factors or whether the chaperonemachinery also affects long- range movement and localmobility of a wider range of signalling protein solutes. Inthis regard, the number of Hsp90 client proteins is nearly 400proteins, a large number of them belonging to the protein-kinase family [44, 170–172]. Even so, a direct role of proteinssuch as FKBP51 and FKBP52 cannot be ruled out since theseIMMs could also act per se in the subcellular distributionof nuclear factors in an Hsp90-independent manner. Dueto technical reasons, our lack of capability to examine inmore detail molecular events at high time resolution inliving cells has veiled the dynamic complexity of transportmechanisms. This is true for cytoplasmic events, but it is evenmore dramatic for our understanding of those mechanismsresponsible for the intranuclear transport of soluble factors.

Ideally, we will be able to regulate the subcellular local-ization of nuclear factors (and consequently their biologicalactions) when we understand the mechanism of action forthat trafficking. For example, NF-𝜅B is constitutively activein many cancer cells [173] and persistent localization in thenucleus has been implicated in tumor development. On theother hand, p53 activation promotes cell-cycle arrest andapoptotic cell death, and p53mislocalization in the cytoplasmis responsible for tumor development [174]. Unlike NF-𝜅B,localizing p53 to the nucleus would be desirable for thecontrol of cell survival. Similarly, nuclear localization isessential for steroid receptors to trans-activate their targetgenes, but it should also be thought that these receptorsalso have nongenomic functions in the cytoplasm. Therefore,their nucleocytoplasmic trafficking becomes an essentialmechanism able to contribute to the regulation of theirbiological actions and also to integrate nuclear transcriptionwith signalling actions in the cytoplasm. Accordingly, anunbalanced cytoplasmic localization of the 𝛼- isoform of theER is known to enhance the nongenomic actions of ER𝛼,which has been proposed to contribute to tumorigenesis aswell as antiestrogen resistance of breast cancer cells [175,176]. Strikingly, during the progression of the prostate cancerdisease, the AR acquires the ability to undergo androgen-independent nuclear import and androgen-independent trans-activation [177]. Importantly, AR is not mutated, indicat-ing there is a gain-of-function in critical aspects of theAR import and transactivation pathways. The androgen-independent mechanism that controls AR localization iscurrently unknown, although the involvement of MAP kinasepathways has been suggested [178].

Nuclear retention of steroid receptors can also be affectedby other adapter factors, such as 14-3-3 proteins [179]and p160 co-activators [180]. Interestingly, TPR-domainproteins and 14-3-3 proteins share similar structural andfunctional properties [181]. 14-3-3 proteins show a TPR-likedomain and are able to interact with GR thereby favoring itscytoplasmic localization, perhaps through the 14-3-3 export


signal [179], by anchoring the receptor to the cytoskeleton[182], or simply due to interference with the Hsp90•TPRprotein retrotransport. This may play a key role in prostatecancer where GR behaves as a counter-balance factor ofthe oncogenic AR (Mazaira G.I. & Galigniana M.D. et al.,unpublished observations). Similarly, the expression levels ofthe TPR-domain Ser/Thr phosphatase PP5 affect the subcel-lular localization of theGR, increasing nuclear accumulation,interaction with GRE sequences, and increasing GR responsein the absence of steroid [183, 184].

The proper and efficient intracellular localization ofsteroid receptors plays an essential role in maintaining majorfunctions in the cell, such that the manipulation of proteinshuttling could be used for treating diseases [185, 186]. Inthis regard, targeting TPR-domain proteins IMMs, IMM-like factors such as the Ser/Thr-phosphatase PP5, TPR-likeproteins such as 14-3-3, and TPR-containing cochaperonessuch as Hop/p60, all of them able to associate to transcriptionfactors, can certainly affect the final biological response.As we decode the particulars of real-time mechanisms forprotein trafficking, as well as protein-protein and protein-DNA interactions involved at the chromatin- transcriptionfactor interface, we will be able to move towards the designof drugs and/or therapeutic strategies to manipulate eventsthat are critical for the regulation of gene expression and theconsequent biological responses.

References

[1] M. Aridor and L. A. Hannan, Traffic Jams II: An update ofdiseases of intracellular transport, Traffic, 3, no. 11, 781–790,(2002).

[2] C. Cobbold, A. P. Monaco, A. Sivaprasadarao, and S. Pon-nambalam, Aberrant trafficking of transmembrane proteins inhuman disease, Trends in Cell Biology, 13, no. 12, 639–647,(2003).

[3] P. Gurevich, I. Zusman, M. Moldavsky, S. Szvalb, A. Elhayany,R. Halperin, E. Gurevich, and H. Ben-Hur, Secretory immunesystem in human intrauterine development: immunopatho-morphological analysis of the role of secretory component(pIgR/SC) in immunoglobulin transport (review)., Interna-tional journal of molecular medicine, 12, no. 3, 289–297,(2003).

[4] D. Goldschneider, E. Blanc, G. Raguenez, H. Haddada, J.Bénard, and S. Douc-Rasy, When p53 needs p73 to be func-tional - Forced p73 expression induces nuclear accumulation ofendogenous p53 protein, Cancer Letters, 197, no. 1-2, 99–103,(2003).

[5] M. Fabbro and B. R. Henderson, Regulation of tumor sup-pressors by nuclear-cytoplasmic shuttling, Experimental CellResearch, 282, no. 2, 59–69, (2003).

[6] W. J. Welch, Role of quality control pathways in humandiseases involving protein misfolding, Seminars in Cell andDevelopmental Biology, 15, no. 1, 31–38, (2004).

[7] K. J. Evans, E. R. Gomes, S. M. Reisenweber, G. G. Gundersen,and B. P. Lauring, Linking axonal degeneration to microtubuleremodeling by Spastin-mediated microtubule severing, Journalof Cell Biology, 168, no. 4, 599–606, (2005).

[8] J. M. Cronshaw and M. J. Matunis, The nuclear pore complex:Disease associations and functional correlations, Trends inEndocrinology and Metabolism, 15, no. 1, 34–39, (2004).

[9] D. B. Defranco, Navigating steroid hormone receptors throughthe nuclear compartment, Molecular Endocrinology, 16, no. 7,1449–1455, (2002).

[10] G. P. Vicent, A. Pecci, A. Ghini, G. Piwien-Pilipuk, and M.D. Galigniana, Differences in nuclear retention characteristicsof agonist-activated glucocorticoid receptor may determinespecific responses, Experimental Cell Research, 276, no. 2,142–154, (2002).

[11] L. Xu and J. Massague, Nucleocytoplasmic shuttling of signaltransducers, Nat Rev Mol Cell Biol, 5, 209–219, (2004).

[12] M. Beato and J. Klug, Steroid hormone receptors: An update,Human Reproduction Update, 6, no. 3, 225–236, (2000).

[13] A. Guiochon-Mantel, P. Lescop, S. Christin-Maitre, H. Loos-felt, M. Perrot-Applanat, and E. Milgrom, Nucleocytoplasmicshuttling of the progesterone receptor, EMBO Journal, 10, no.12, 3851–3859, (1991).

[14] A. Chauchereau, H. Loosfelt, M. Misrahi, M. Atger, A.Guiochon-Mantel, P. Lescop, M. Perrot-Applanat, and E.Milgrom, Progress in the study of receptors involved insteroidogenesis and steroid hormone action, Journal of SteroidBiochemistry and Molecular Biology, 40, no. 1-3, 21–23,(1991).

[15] G. L. Hager, C. S. Lim, C. Elbi, and C. T. Baumann,Trafficking of nuclear receptors in living cells, Journal ofSteroid Biochemistry and Molecular Biology, 74, no. 5, 249–254, (2000).

[16] S. Kumar, M. Saradhi, N. K. Chaturvedi, and R. K. Tyagi,Intracellular localization and nucleocytoplasmic traffickingof steroid receptors: An overview, Molecular and CellularEndocrinology, 246, no. 1-2, 147–156, (2006).

[17] M. Nishi and M. Kawata, Brain corticosteroid receptor dynam-ics and trafficking: Implications from live cell imaging.,The Neuroscientist : a review journal bringing neurobiology,neurology and psychiatry, 12, no. 2, 119–133, (2006).

[18] M. Kawata, M. Nishi, K. Matsuda, H. Sakamoto, N. Kaku, M.Masugi-Tokita, K. Fujikawa, Y. Hirahara-Wada, K. Takanami,and H. Mori, Steroid receptor signalling in the brain - Lessonslearned from molecular imaging, Journal of Neuroendocrinol-ogy, 20, no. 6, 673–676, (2008).

[19] O. Medalia, I. Weber, A. S. Frangakis, D. Nicastro, G. Gerisch,and W. Baumeister, Macromolecular architecture in eukaryoticcells visualized by cryoelectron tomography, Science, 298, no.5596, 1209–1213, (2002).

[20] M. D. Galigniana, J. M. Harrell, P. R. Housley, C. Patterson,S. K. Fisher, and W. B. Pratt, Retrograde transport of theglucocorticoid receptor in neurites requires dynamic assemblyof complexes with the protein chaperone hsp90 and is linkedto the CHIP component of the machinery for proteasomaldegradation, Molecular Brain Research, 123, no. 1-2, 27–36,(2004).

[21] M. D. Galigniana, C. Radanyi, J. Renoir, P. R. Housley, and W.B. Pratt, Evidence that the Peptidylprolyl Isomerase Domain ofthe hsp90-binding Immunophilin FKBP52 is Involved in BothDynein Interaction and Glucocorticoid Receptor Movement tothe Nucleus, Journal of Biological Chemistry, 276, no. 18,14884–14889, (2001).

[22] M. D. Galigniana, Steroid receptor coupling becomes nuclear,Chemistry and Biology, 19, no. 6, 662–663, (2012).


[23] G. Piwien-Pilipuk and M. D. Galigniana, Tautomycin inhibitsphosphatase-dependent transformation of the rat kidney miner-alocorticoid receptor, Molecular and Cellular Endocrinology,144, no. 1-2, 119–130, (1998).

[24] G. P. Pilipuk, G. P. Vinson, C. G. Sanchez, and M. D. Galig-niana, Evidence for NL1-independent nuclear translocation ofthe mineralocorticoid receptor, Biochemistry, 46, no. 5, 1389–1397, (2007).

[25] M. Thomas, N. Dadgar, A. Aphale, J. M. Harrell, R. Kunkel, W.B. Pratt, and A. P. Lieberman, Androgen Receptor AcetylationSite Mutations Cause Trafficking Defects, Misfolding, andAggregation Similar to Expanded Glutamine Tracts, Journalof Biological Chemistry, 279, no. 9, 8389–8395, (2004).

[26] P. Berg and I. Pongratz, Two parallel pathways mediate cyto-plasmic localization of the dioxin (aryl hydrocarbon) receptor,Journal of Biological Chemistry, 277, no. 35, 32310–32319,(2002).

[27] J. Barsony, I. Renyi, and W. McKoy, Subcellular distributionof normal and mutant vitamin D receptors in living cells.Studies with a novel fluorescent ligand, Journal of BiologicalChemistry, 272, no. 9, 5774–5782, (1997).

[28] M. D. Galigniana, P. R. Housley, D. B. DeFranco, and W. B.Pratt, Inhibition of glucocorticoid receptor nucleocytoplasmicshuttling by okadaic acid requires intact cytoskeleton, Journalof Biological Chemistry, 274, no. 23, 16222–16227, (1999).

[29] H. Htun, L. T. Holth, D. Walker, J. R. Davie, and G. L. Hager,Direct visualization of the human estrogen receptor revealsa role for ligand in the nuclear distribution of the receptor,Molecular Biology of the Cell, 10, no. 2, 471–486, (1999).

[30] C. S. Lim, C. T. Baumann, H. Htun, W. Xian, M. Irie, C. L.Smith, and G. L. Hager, Differential localization and activity ofthe A- and B-forms of the human progesterone receptor usinggreen fluorescent protein chimeras, Molecular Endocrinology,13, no. 3, 366–375, (1999).

[31] B. Gravez, A. Tarjus, R. Jimenez-Canino, S. El Moghrabi,S. Messaoudi, D. Alvarez de la Rosa, and F. Jaisser, Thediuretic torasemide does not prevent aldosterone-mediatedmineralocorticoid receptor activation in cardiomyocytes, PLoSOne, 8, (2013)., e73737.

[32] G. Fejes-Tóth, D. Pearce, and A. Náray-Fejes-Tóth, Subcellularlocalization of mineralocorticoid receptors in living cells:Effects of receptor agonists and antagonists, Proceedings of theNational Academy of Sciences of the United States of America,95, no. 6, 2973–2978, (1998).

[33] I. Hernández-Díaz, T. Giraldez, M. R. Arnau, V. A. J. Smits,F. Jaisser, N. Farman, and D. Alvarez De La Rosa, Themineralocorticoid receptor is a constitutive nuclear factor incardiomyocytes due to hyperactive nuclear localization signals,Endocrinology, 151, no. 8, 3888–3899, (2010).

[34] E. R. Sanchez, M. Hirst, L. C. Scherrer, H. Tang, M. J. Welsh,J. M. Harmon, S. S. Simons Jr., G. M. Ringold, andW. B. Pratt,Hormone-freemouse glucocorticoid receptors overexpressed inChinese hamster ovary cells are localized to the nucleus and areassociated with both hsp70 and hsp90, Journal of BiologicalChemistry, 265, no. 33, 20123–20130, (1990).

[35] K. K. Leslie, M. Stein, N. S. Kumar, D. Dai, J. Stephens, A.Wandinger-Ness, and D. H. Glueck, Progesterone receptor iso-form identification and subcellular localization in endometrialcancer, Gynecologic Oncology, 96, no. 1, 32–41, (2005).

[36] M. D. Galigniana, A. G. Erlejman, M. Monte, C. Gomez-Sanchez, and G. Piwien-Pilipuk, The hsp90-FKBP52 complexlinks the mineralocorticoid receptor to motor proteins and

persists bound to the receptor in early nuclear events,Molecularand Cellular Biology, 30, no. 5, 1285–1298, (2010).

[37] A. Banerjee, S. Periyasamy, I. M. Wolf, T. D. Hinds Jr., W.Yong, W. Shou, and E. R. Sanchez, Control of glucocor-ticoid and progesterone receptor subcellular localization bythe ligand-binding domain is mediated by distinct interactionswith tetratricopeptide repeat proteins, Biochemistry, 47, no. 39,10471–10480, (2008).

[38] P. C. Echeverria and D. Picard Didier, Molecular chaperones,essential partners of steroid hormone receptors for activityand mobility, Biochimica et Biophysica Acta - Molecular CellResearch, 1803, no. 6, 641–649, (2010).

[39] E. Milgrom, Activation of Steroid-Receptor Complexes,, Aca-demic Press, New York, 1981.

[40] M. K. Dahmer, P. R. Housley, and W. B. Pratt, Effectsof molybdate and endogenous inhibitors on steroid-receptorinactivation, transformation, and translocation, Annual Reviewof Physiology, 46, 67–81, (1984).

[41] L. Querol Cano, D. N. Lavery, and C. L. Bevan, Mini-review:Foldosome regulation of androgen receptor action in prostatecancer, Molecular and Cellular Endocrinology, 369, no. 1-2,52–62, (2013).

[42] S. D. Westerheide and R. I. Morimoto, Heat shock responsemodulators as therapeutic tools for diseases of protein confor-mation, Journal of Biological Chemistry, 280, no. 39, 33097–33100, (2005).

[43] K. Richter, M. Haslbeck, and J. Buchner, The Heat ShockResponse: Life on the Verge of Death, Molecular Cell, 40, no.2, 253–266, (2010).

[44] C. Prodromou and L. H. Pearl, Structure and functionalrelationships of Hsp90, Current Cancer Drug Targets, 3, no.5, 301–323, (2003).

[45] H. R. Quintá, N. M. Galigniana, A. G. Erlejman, M.Lagadari, G. Piwien-Pilipuk, and M. D. Galigniana, Manage-ment of cytoskeleton architecture by molecular chaperones andimmunophilins, Cellular Signalling, 23, no. 12, 1907–1920,(2011).

[46] W. B. Pratt and D. O. Toft, Steroid receptor interactions withheat shock protein and immunophilin chaperones, EndocrineReviews, 18, no. 3, 306–360, (1997).

[47] C. B. Kang, Y. Hong, S. Dhe-Paganon, and H. S. Yoon,FKBP family proteins: Immunophilins with versatile biologicalfunctions, NeuroSignals, 16, no. 4, 318–325, (2008).

[48] A. G. Erlejman, M. Lagadari, and M. D. Galigniana, Hsp90-binding immunophilins as a potential new platform for drugtreatment, Future Medicinal Chemistry, 5, no. 5, 591–607,(2013).

[49] N. H. Sigal and F. J. Dumont, Cyclosporin A, FK-506,and rapamycin: Pharmacologic probes of lymphocyte signaltransduction, Annual Review of Immunology, 10, 519–560,(1992).

[50] T. H.Davies and E. R. Sánchez, FKBP52, International Journalof Biochemistry and Cell Biology, 37, no. 1, 42–47, (2005).

[51] G. L. Blatch and M. Lassle, The tetratricopeptide repeat: astructural motif mediating protein-protein interactions, Bioes-says, 21, 932–939, (1999).

[52] A. M. Silverstein, M. D. Galigniana, K. C. Kanelakis, C.Radanyi, J. Renoir, and W. B. Pratt, Different regions ofthe immunophilin FKBP52 determine its association withthe glucocorticoid receptor, hsp90, and cytoplasmic dynein,Journal of Biological Chemistry, 274, no. 52, 36980–36986,(1999).


[53] B. Wu, P. Li, Y. Liu, Y. Ding, C. Shu, S. Ye, M. Bartlam,B. Shen, and Z. Rao, 3D structure of human FK506-bindingprotein 52: Implication for the assembly of the glucocorticoidreceptor/Hsp90/immunophilin heterocomplex, Proceedings ofthe National Academy of Sciences of the United States ofAmerica, 101, no. 22, 8348–8353, (2004).

[54] C. L. Storer, C. A. Dickey, M. D. Galigniana, T. Rein, andM. B.Cox, FKBP51 and FKBP52 in signaling and disease, Trends inEndocrinology and Metabolism, 22, no. 12, 481–490, (2011).

[55] J. Li, K. Richter, and J. Buchner, Mixed Hsp90-cochaperonecomplexes are important for the progression of the reactioncycle, Nature Structural and Molecular Biology, 18, no. 1, 61–67, (2011).

[56] K. C. Kanelakis, P. J. M. Murphy, M. D. Galigniana, Y.Morishima, S. Takayama, J. C. Reed, D. O. Toft, and W. B.Pratt, hsp70 Interacting protein hip does not affect glucocorti-coid receptor folding by the hsp90-based chaperone machineryexcept to oppose the effect of BAG-1, Biochemistry, 39, no. 46,14314–14321, (2000).

[57] A. G. Erlejman, M. Lagadari, J. Toneatto, G. Piwien-Pilipuk,and M. D. Galigniana, Regulatory role of the 90-kDa-heat-shock protein (Hsp90) and associated factors on gene expres-sion, Biochim Biophys Acta, 1839, 71–87, (2014).

[58] D. F. Smith and D. O. Toft, The intersection of steroid recep-tors with molecular chaperones: Observations and questions,Molecular Endocrinology, 22, no. 10, 2229–2240, (2008).

[59] W. B. Pratt, M. D. Galigniana, Y. Morishima, and P. J. M.Murphy, Role of molecular chaperones in steroid receptoraction, Essays in Biochemistry, 40, 41–58, (2004).

[60] M. D. Galigniana, J. M. Harrell, P. J. M. Murphy, M. Chinkers,C. Radanyi, J. Renoir, M. Zhang, and W. B. Pratt, Binding ofhsp90-associated immunophilins to cytoplasmic dynein: Directbinding and in vivo evidence that the peptidylprolyl isomerasedomain is a dynein interaction domain, Biochemistry, 41, no.46, 13602–13610, (2002).

[61] G. M. Wochnik, J. Rüegg, G. A. Abel, U. Schmidt, F. Holsboer,and T. Rein, FK506-binding proteins 51 and 52 differentiallyregulate dynein interaction and nuclear translocation of the glu-cocorticoid receptor in mammalian cells, Journal of BiologicalChemistry, 280, no. 6, 4609–4616, (2005).

[62] H. D. McKeen, K. McAlpine, A. Valentine, D. J. Quinn, K.McClelland, C. Byrne, M. O’Rourke, S. Young, C. J. Scott, H.O. McCarthy, D. G. Hirst, and T. Robson, A novel FK506-likebinding protein interacts with the glucocorticoid receptor andregulates steroid receptor signaling, Endocrinology, 149, no.11, 5724–5734, (2008).

[63] T. H. Davies, Y. Ning, and E. R. Sánchez, A new first step inactivation of steroid receptors. Hormone-induced switching ofFKBP51 and FKBP52 immunophilins, Journal of BiologicalChemistry, 277, no. 7, 4597–4600, (2002).

[64] M. D. Galigniana, P. C. Echeverría, A. G. Erlejman, andG. Piwien-Pilipuk, Role of molecular chaperones and TPR-domain proteins in the cytoplasmic transport of steroid recep-tors and their passage through the nuclear pore, Nucleus, 1, no.4, 299–308, (2010).

[65] M. D. Galigniana, J. M. Harrell, H.M. O’Hagen,M. Ljungman,and W. B. Pratt, Hsp90-binding immunophilins link p53to dynein during p53 transport to the nucleus, Journal ofBiological Chemistry, 279, no. 21, 22483–22489, (2004).

[66] W. Zhao, L. Zhong, J. Wu, L. Chen, K. Qing, K. A. Weigel-Kelley, S. H. Larsen, W. Shou, K. H. Warrington Jr., and A.Srivastava, Role of cellular FKBP52 protein in intracellular

trafficking of recombinant adeno-associated virus 2 vectors,Virology, 353, no. 2, 283–293, (2006).

[67] M. Thomas, J. M. Harrell, Y. Morishima, H. Peng, W. B. Pratt,and A. P. Lieberman, Pharmacologic and genetic inhibition ofhsp90-dependent trafficking reduces aggregation and promotesdegradation of the expanded glutamine androgen receptorwithout stress protein induction, Human Molecular Genetics,15, no. 11, 1876–1883, (2006).

[68] P. Li, Y. Ding, B. Wu, C. Shu, B. Shen, and Z. Rao,Structure of the N-terminal domain of human FKBP52, ActaCrystallographica - Section D Biological Crystallography, 59,no. 1, 16–22, (2003).

[69] D. R. Bublik, M. Scolz, G. Triolo, M. Monte, and C. Schneider,Human GTSE-1 regulates p21CIP1/WAF1 stability conferringresistance to paclitaxel treatment, Journal of Biological Chem-istry, 285, no. 8, 5274–5281, (2010).

[70] G. P. Colo, M. F. Rubio, I. M. Nojek, S. E. Werbajh, P. C.Echeverría, C. V. Alvarado, V. E. Nahmod, M. D. Galigniana,and M. A. Costas, The p160 nuclear receptor co-activatorRAC3 exerts an anti-apoptotic role through a cytoplasmaticaction, Oncogene, 27, no. 17, 2430–2444, (2008).

[71] X. Vafopoulou and C. G. Steel, Cytoplasmic travels of theecdysteroid receptor in target cells: pathways for both genomicand non-genomic actions, Front Endocrinol (Lausanne), 3, p.43, (2012).

[72] J.M. Harrell, I. Kurek, A. Breiman, C. Radanyi, J. Renoir,W. B.Pratt, and M. D. Galigniana, All of the protein interactions thatlink steroid receptor·Hsp90·immunophilin heterocomplexes tocytoplasmic dynein are common to plant and animal cells,Biochemistry, 41, no. 17, 5581–5587, (2002).

[73] M. J. Czar, M. D. Galigniana, A.M. Silverstein, andW. B. Pratt,Geldanamycin, a heat shock protein 90-binding benzoquinoneansamycin, inhibits steroid-dependent translocation of theglucocorticoid receptor from the cytoplasm to the nucleus,Biochemistry, 36, no. 25, 7776–7785, (1997).

[74] D. L. Cioffi, T. R. Hubler, and J. G. Scammell, Organization andfunction of the FKBP52 and FKBP51 genes, Current Opinionin Pharmacology, 11, no. 4, 308–313, (2011).

[75] Y. Yao, Y. Liang, H. Huang, and W. Yang, FKBPs in chromatinmodification and cancer, Current Opinion in Pharmacology,11, no. 4, 301–307, (2011).

[76] A. Rothballer and U. Kutay, Poring over pores: Nuclearpore complex insertion into the nuclear envelope, Trends inBiochemical Sciences, 38, no. 6, 292–301, (2013).

[77] C. P. Lusk, G. Blobel, and M. C. King, Highway to theinner nuclear membrane: Rules for the road, Nature ReviewsMolecular Cell Biology, 8, no. 5, 414–420, (2007).

[78] L. J. Terry, E. B. Shows, and S. R. Wente, Crossing thenuclear envelope: Hierarchical regulation of nucleocytoplasmictransport, Science, 318, no. 5855, 1412–1416, (2007).

[79] M. Stewart,Molecular mechanism of the nuclear protein importcycle, Nature Reviews Molecular Cell Biology, 8, no. 3, 195–208, (2007).

[80] P. C. Echeverría, G. Mazaira, A. Erlejman, C. Gomez-Sanchez,G. P. Pilipuk, and M. D. Galigniana, Nuclear import of theglucocorticoid receptor-hsp90 complex through the nuclearpore complex is mediated by its interaction with Nup62 andimportin β, Molecular and Cellular Biology, 29, no. 17, 4788–4797, (2009).

[81] J. G. A. Savory, B. Hsu, I. R. Laquian, W. Giffin, T. Reich, R.J. G. Haché, and Y. A. Lefebvre, Discrimination between NL1-


and NL2-mediated nuclear localization of the glucocorticoidreceptor, Molecular and Cellular Biology, 19, no. 2, 1025–1037, (1999).

[82] N. D. Freedman and K. R. Yamamoto, Importin 7 andImportin α/Importin β Are Nuclear Import Receptors for theGlucocorticoid Receptor,Molecular Biology of the Cell, 15, no.5, 2276–2286, (2004).

[83] M. Tanaka, M. Nishi, M. Morimoto, T. Sugimoto, and M.Kawata, Yellow fluorescent protein-tagged and cyan fluores-cent protein-tagged imaging analysis of glucocorticoid receptorand importins in single living cells, Endocrinology, 144, no. 9,4070–4079, (2003).

[84] E. C. Goodwin, N. Motamedi, A. Lipovsky, R. Fernandez-Busnadiego, and D. DiMaio, Expression of DNAJB12 orDNAJB14 causes coordinate invasion of the nucleus by mem-branes associated with a novel nuclear pore structure, PLoSOne, 9, (2014).

[85] S. Kose, M. Furuta, and N. Imamoto, Hikeshi, a nuclear importcarrier for Hsp70s, protects cells from heat shock-inducednuclear damage, Cell, 149, no. 3, 578–589, (2012).

[86] A. E. Hodel, M. T. Harreman, K. F. Pulliam, M. E. Harben, J.S. Holmes, M. R. Hodel, K. M. Berland, and A. H. Corbett,Nuclear localization signal receptor affinity correlates within vivo localization in Saccharomyces cerevisiae, Journal ofBiological Chemistry, 281, no. 33, 23545–23556, (2006).

[87] S. Jäkel, J. Mingot, P. Schwarzmaier, E. Hartmann, and D. Gör-lich, Importins fulfil a dual function as nuclear import receptorsand cytoplasmic chaperones for exposed basic domains, EMBOJournal, 21, no. 3, 377–386, (2002).

[88] L. I. Gallo, A. A. Ghini, G. P. Pilipuk, and M. D. Galig-niana, Differential recruitment of tetratricorpeptide repeatdomain immunophilins to the mineralocorticoid receptor influ-ences both heat-shock protein 90-dependent retrotransport andhormone-dependent transcriptional activity, Biochemistry, 46,no. 49, 14044–14057, (2007).

[89] V. Georget, B. Térouanne, J. Nicolas, and C. Sultan, Mech-anism of antiandrogen action: Key role of hsp90 in confor-mational change and transcriptional activity of the androgenreceptor, Biochemistry, 41, no. 39, 11824–11831, (2002).

[90] D. Gilchrist, B. Mykytka, and M. Rexach, Accelerating therate of disassembly of karyopherin·cargo complexes, Journalof Biological Chemistry, 277, no. 20, 18161–18172, (2002).

[91] D. P. Denning, S. S. Patel, V. Uversky, A. L. Fink, and M.Rexach, Disorder in the nuclear pore complex: The FG repeatregions of nucleoporins are natively unfolded, Proceedingsof the National Academy of Sciences of the United States ofAmerica, 100, no. 5, 2450–2455, (2003).

[92] S. S. Patel, B. J. Belmont, J. M. Sante, and M. F. Rexach,Natively Unfolded Nucleoporins Gate Protein Diffusion acrossthe Nuclear Pore Complex, Cell, 129, no. 1, 83–96, (2007).

[93] M. Moghanibashi, F. Rastgar Jazii, Z. Soheili, M. Zare, A.Karkhane, K. Parivar, and P. Mohamadynejad, Esophagealcancer alters the expression of nuclear pore complex bind-ing protein Hsc70 and eIF5A-1, Functional and IntegrativeGenomics, 13, no. 2, 253–260, (2013).

[94] H. R. Quintá, D. Maschi, C. Gomez-Sanchez, G. Piwien-Pilipuk, and M. D. Galigniana, Subcellular rearrangement ofhsp90-binding immunophilins accompanies neuronal differen-tiation and neurite outgrowth, Journal of Neurochemistry, 115,no. 3, 716–734, (2010).

[95] J. Toneatto, S. Guber, N. L. Charo, J. Schwartz, M. D.Galigniana, and G. Piwien Pilipuk, Dynamic Mitochondrial-Nuclear Redistribution of the Immunophilin FKBP51 is reg-ulated by PKA Signaling Pathway in the process of AdipocyteDifferentiation, J Cell Sci, In press (2013).

[96] P. J. M. Murphy, K. C. Kanelakis, M. D. Galigniana, Y.Morishima, and W. B. Pratt, Stoichiometry, Abundance, andFunctional Significance of the hsp90/hsp70-basedMultiproteinChaperone Machinery in Reticulocyte Lysate, Journal ofBiological Chemistry, 276, no. 32, 30092–30098, (2001).

[97] P. J. M. Murphy, Y. Morishima, H. Chen, M. D. Galig-niana, J. F. Mansfield, S. S. Simons Jr., and W. B. Pratt,Visualization and mechanism of assembly of a glucocorticoidreceptor·Hsp70 complex that is primed for subsequent Hsp90-dependent opening of the steroid binding cleft, Journal ofBiological Chemistry, 278, no. 37, 34764–34773, (2003).

[98] S. Kose, M. Furuta, M. Koike, Y. Yoneda, and N. Imamoto, The70-kD heat shock cognate protein (hsc70) facilitates the nuclearexport of the import receptors, Journal of Cell Biology, 171, no.1, 19–25, (2005).

[99] P. Germain and W. Bourguet, Dimerization of nuclear recep-tors, Methods Cell Biol, 117, (2013).

[100] J. G. A. Savory, G. G. Préfontaine, C. Lamprecht, M. Liao, R.F. Walther, Y. A. Lefebvre, and R. J. G. Haché, Glucocorticoidreceptor homodimers and glucocorticoid-mineralocorticoidreceptor heterodimers form in the cytoplasm through alterna-tive dimerization interfaces, Molecular and Cellular Biology,21, no. 3, 781–793, (2001).

[101] S. Robertson, J. M. Rohwer, J. P. Hapgood, and A. Louw,Impact of Glucocorticoid Receptor Density on Ligand-Independent Dimerization, Cooperative Ligand-Binding andBasal Priming of Transactivation: A Cell Culture Model, PLoSONE, 8, no. 5, Article ID e64831, (2013).

[102] B. Kim and J. W. Little, Dimerization of a specific DNA-binding protein on the DNA, Science, 255, no. 5041, 203–206,(1992).

[103] J. J. Kohler, S. J. Metallo, T. L. Schneider, and A. Schepartz,DNA specificity enhanced by sequential binding of proteinmonomers,Proceedings of the National Academy of Sciences ofthe United States of America, 96, no. 21, 11735–11739, (1999).

[104] W. Liu, J. Wang, G. Yu, and D. Pearce, Steroid receptortranscriptional synergy is potentiated by disruption of theDNA-binding domain dimer interface,Molecular Endocrinology, 10,no. 11, 1399–1406, (1996).

[105] S. Y. Tsai, J. Carlstedt-Duke, N. L. Weigel, K. Dahlman, J.-A. Gustafsson, M.-J. Tsai, and B. W. O’Malley, Molecularinteractions of steroid hormone receptor with its enhancerelement: Evidence for receptor dimer formation, Cell, 55, no.2, 361–369, (1988).

[106] I. Segard-Maurel, K. Rajkowski, N. Jibard, G. Schweizer-Groyer, E. Baulieu, and F. Cadepond, Glucocorticosteroidreceptor dimerization investigated by analysis of receptorbinding to glucocorticosteroid responsive elements using amonomer-dimer equilibrium model, Biochemistry, 35, no. 5,1634–1642, (1996).

[107] P. Dewint, V. Gossye, K. De Bosscher, W. V. Berghe, K. VanBeneden, D. Deforce, S. Van Calenbergh, U. Müller-Ladner, B.V. Cruyssen, G. Verbruggen, G. Haegeman, and D. Elewaut,A plant-derived ligand favoring monomeric glucocorticoidreceptor conformation with impaired transactivation potentialattenuates collagen-induced arthritis, Journal of Immunology,180, no. 4, 2608–2615, (2008).


[108] S. Robertson, F. Allie-Reid, W. Vanden Berghe, K. Visser, A.Binder, D. Africander, M. Vismer, K. De Bosscher, J. Hapgood,G. Haegeman, and A. Louw, Abrogation of glucocorticoidreceptor dimerization correlates with dissociated glucocorti-coid behavior of compoundA, Journal of Biological Chemistry,285, no. 11, 8061–8075, (2010).

[109] C. Grossmann, S. Ruhs, L. Langenbruch, S. Mildenberger,N. Strätz, K. Schumann, and M. Gekle, Nuclear shuttlingprecedes dimerization in mineralocorticoid receptor signaling,Chemistry and Biology, 19, no. 6, 742–751, (2012).

[110] A. G. Erlejman, S. A. De Leo, G. I.Mazaira, A.M.Molinari, M.F. Camisay, V. A. Fontana, M. B. Cox, G. Piwien-Pilipuk, andM. D. Galigniana, NF-κB transcriptional activity is modulatedby FK506-binding proteins FKBP51 and FKBP52: A role forpeptidyl-prolyl isomerase activity, J Biol Chem, 289, no. 38,26263–26276, (2014).

[111] S. Periyasamy, T. Hinds, L. Shemshedini, W. Shou, and E.R. Sanchez, FKBP51 and Cyp40 are positive regulators ofandrogen-dependent prostate cancer cell growth and the targetsof FK506 and cyclosporinA,Oncogene, 29, no. 11, 1691–1701,(2010).

[112] W. Yong, Z. Yang, S. Periyasamy, H. Chen, S. Yucel, W.Li, L. Y. Lin, I. M. Wolf, M. J. Cohn, L. S. Baskin, E. R.Sánchez, and W. Shou, Essential role for co-chaperone Fkbp52but not Fkbp51 in androgen receptor-mediated signaling andphysiology, Journal of Biological Chemistry, 282, no. 7, 5026–5036, (2007).

[113] A.-C. Wikström, O. Bakke, S. Okret, M. Brönnegård, and J.A. Gustafsson, Intracellular localization of the glucocorticoidreceptor: Evidence for cytoplasmic and nuclear localization,Endocrinology, 120, no. 4, 1232–1242, (1987).

[114] D. Picard and K. R. Yamamoto, Two signals mediate hormone-dependent nuclear localization of the glucocorticoid receptor.,EMBO Journal, 6, no. 11, 3333–3340, (1987).

[115] B. Van Steensel, M. Brink, K. Van der Meulen, E. P. VanBinnendijk, D. G. Wansink, L. De Jong, E. R. De Kloet, andR. Van Driel, Localization of the glucocorticoid receptor indiscrete clusters in the cell nucleus, Journal of Cell Science,108, no. 9, 3003–3011, (1995).

[116] B. Van Steensel, E. P. Van Binnendijk, C. D. Hornsby, H.T. M. Van Der Voort, Z. S. Krozowski, E. R. De Kloet,and R. Van Driel, Partial colocalization of glucocorticoid andmineralocorticoid receptors in discrete compartments in nucleiof rat hippocampus neurons, Journal of Cell Science, 109, no.4, 787–792, (1996).


[118] A. Tomura, K. Goto, H. Morinaga, M. Nomura, T. Okabe, T.Yanase, R. Takayanagi, and H. Nawata, The Subnuclear Three-dimensional Image Analysis of Androgen Receptor Fused toGreen Fluorescence Protein, Journal of Biological Chemistry,276, no. 30, 28395–28401, (2001).

[119] J. C. McNally, W. G. Müller, D. Walker, R. Wolford, and G.L. Hager, The glucocorticoid receptor: Rapid exchange withregulatory sites in living cells, Science, 287, no. 5456, 1262–1265, (2000).

[120] G. L. Hager, A. K. Nagaich, T. A. Johnson, D. A. Walker,and S. John, Dynamics of nuclear receptor movement and

transcription, Biochimica et Biophysica Acta - Gene Structureand Expression, 1677, no. 1-3, 46–51, (2004).

[121] T. C. Voss and G. L. Hager, Dynamic regulation of transcrip-tional states by chromatin and transcription factors, Nat RevGenet, 15, 69–81, (2014).

[122] J. Yang, J. Liu, and D. B. DeFranco, Subnuclear traffickingof glucocorticoid receptors in vitro: Chromatin recycling andnuclear export, Journal of Cell Biology, 137, no. 3, 523–538,(1997).

[123] J. Liu and D. B. DeFranco, Chromatin recycling of glucocor-ticoid receptors: Implications for multiple roles of heat shockprotein 90, Molecular Endocrinology, 13, no. 3, 355–365,(1999).

[124] C. Elbi, D. A.Walker, G. Romero,W. P. Sullivan, D. O. Toft, G.L. Hager, and D. B. DeFranco, Molecular chaperones functionas steroid receptor nuclear mobility factors, Proceedings of theNational Academy of Sciences of the United States of America,101, no. 9, 2876–2881, (2004).

[125] J. Chen, H. K. Kinyamu, and T. K. Archer, Changes in attitude,changes in latitude: Nuclear receptors remodeling chromatin toregulate transcription, Molecular Endocrinology, 20, no. 1, 1–13, (2006).

[126] J. Zhao, J. Herrera-Diaz, and D. S. Gross, Domain-widedisplacement of histones by activated heat shock factor occursindependently of Swi/Snf and is not correlated with RNApolymerase II density,Molecular and Cellular Biology, 25, no.20, 8985–8999, (2005).

[127] Y. Jiang, N. Sirinupong, J. Brunzelle, and Z. Yang, Crystalstructures of Histone and p53 Methyltransferase SmyD2 reveala conformational flexibility of the Autoinhibitory C-terminaldomain, PLoS ONE, 6, no. 6, Article ID e21640, (2011).

[128] D. A. Stavreva, W. G. Müller, G. L. Hager, C. L. Smith,and J. G. McNally, Rapid Glucocorticoid Receptor Exchangeat a Promoter Is Coupled to Transcription and Regulated byChaperones and Proteasomes,Molecular and Cellular Biology,24, no. 7, 2682–2697, (2004).

[129] T. B. Miranda, S. A. Morris, and G. L. Hager, Complexgenomic interactions in the dynamic regulation of transcrip-tion by the glucocorticoid receptor, Molecular and CellularEndocrinology, (2013).

[130] G. A. Collins and W. P. Tansey, The proteasome: A utility toolfor transcription? Current Opinion in Genetics and Develop-ment, 16, no. 2, 197–202, (2006).

[131] S. P. Baker and P. A. Grant, The proteasome: Not just degradinganymore, Cell, 123, no. 3, 361–363, (2005).

[132] B. C. Freeman and K. R. Yamamoto, Disassembly of transcrip-tional regulatory complexes by molecular chaperones, Science,296, no. 5576, 2232–2235, (2002).

[133] B. J. Deroo, C. Rentsch, S. Sampath, J. Young, D. B.DeFranco, and T. K. Archer, Proteasomal inhibition enhancesglucocorticoid receptor transactivation and alters its subnucleartrafficking, Molecular and Cellular Biology, 22, no. 12, 4113–4123, (2002).

[134] D. L. Stenoien, A. C. Nye, M. G. Mancini, K. Patel, M.Dutertre, B. W. O’Malley, C. L. Smith, A. S. Belmont, and M.A. Mancini, Ligand-mediated assembly and real-time cellulardynamics of estrogen receptor α-coactivator complexes inliving cells,Molecular and Cellular Biology, 21, no. 13, 4404–4412, (2001).

[135] G. Reid, M. R. Hübner, R. Métivier, H. Brand, S. Denger,D. Manu, J. Beaudouin, J. Ellenberg, and F. Gannon, Cyclic,


proteasome-mediated turnover of unliganded and liganded ERαon responsive promoters is an integral feature of estrogensignaling, Molecular Cell, 11, no. 3, 695–707, (2003).

[136] M. Li, D. Chen, A. Shiloh, J. Luo, A. Y. Nikolaev, J. Qin, andW. Gu, Deubiquitination of p53 by HAUSP is an importantpathway for p53 stabilization, Nature, 416, no. 6881, 648–653,(2002).

[137] F. Lamoureux, C. Thomas, M. Yin, H. Kuruma, E. Beraldi, L.Fazli, A. Zoubeidi, andM. E. Gleave, Clusterin inhibition usingOGX-011 synergistically enhances Hsp90 inhibitor activityby suppressing the heat shock response in castrate-resistantprostate cancer, Cancer Research, 71, no. 17, 5838–5849,(2011).

[138] H. Matsumoto, Y. Yamamoto, M. Shiota, H. Kuruma, E.Beraldi, H. Matsuyama, A. Zoubeidi, and M. Gleave, Cotar-geting androgen receptor and clusterin delays castrate-resistantprostate cancer progression by inhibiting adaptive stressresponse and AR stability, Cancer Research, 73, no. 16, 5206–5217, (2013).

[139] B. K. Ward, P. J. Mark, D. M. Ingram, R. F. Minchin, andT. Ratajczak, Expression of the estrogen receptor-associatedimmunophilins, cyclophilin 40 and FKBP52, in breast cancer,Breast Cancer Research and Treatment, 58, no. 3, 267–280,(1999).

[140] A. Gougelet, C. Bouclier, V. Marsaud, S. Maillard, S. O.Mueller, K. S. Korach, and J. Renoir, Estrogen receptor α andβ subtype expression and transactivation capacity are differen-tially affected by receptor-, hsp90- and immunophilin-ligandsin human breast cancer cells, Journal of Steroid Biochemistryand Molecular Biology, 94, no. 1-3, 71–81, (2005).

[141] Y. Liu, C. Li, Z. Xing, X. Yuan, Y. Wu, M. Xu, K. Tu, Q. Li, C.Wu, M. Zhao, and R. Zeng, Proteomic mining in the dysplasticliver of WHV/c-myc mice - Insights and indicators for earlyhepatocarcinogenesis, FEBS Journal, 277, no. 19, 4039–4053,(2010).

[142] J. Lin, J. Xu, H. Tian, X. Gao, Q. Chen, Q. Gu, G. Xu,J. Song, and F. Zhao, Identification of candidate prostatecancer biomarkers in prostate needle biopsy specimens usingproteomic analysis, International Journal of Cancer, 121, no.12, 2596–2605, (2007).

[143] D. J. Erstad and J. C. Cusack, Targeting the NF-kappaBpathway in cancer therapy, Surg Oncol Clin N Am, 22, 705–746, (2013).

[144] B. Hoesel and J. A. Schmid, The complexity of NF-κBsignaling in inflammation and cancer, Molecular Cancer, 12,no. 1, article no. 86, (2013).

[145] S. Giraudier, H. Chagraoui, E. Komura, S. Barnache, B.Blanchet, J. P. LeCouedic, D. F. Smith, F. Larbret, A. Taksin,F. Moreau-Gachelin, N. Casadevall, M. Tulliez, A. Hulin, N.Debili, and W. Vainchenker, Overexpression of FKBP51 inidiopathic myelofibrosis regulates the growth factor indepen-dence of megakaryocyte progenitors, Blood, 100, no. 8, 2932–2940, (2002).

[146] J. Solassol, A. Mange, and T. Maudelonde, FKBP familyproteins as promising new biomarkers for cancer, CurrentOpinion in Pharmacology, 11, no. 4, 320–325, (2011).

[147] H. Pei, L. Li, B. L. Fridley, G. D. Jenkins, K. R. Kalari,W. Lingle, G. Petersen, Z. Lou, and L. Wang, FKBP51Affects Cancer Cell Response to Chemotherapy by NegativelyRegulating Akt, Cancer Cell, 16, no. 3, 259–266, (2009).

[148] L. Ni, C. Yang, D. Gioeli, H. Frierson, D. O. Toft, and B. M.Paschal, FKBP51 promotes assembly of the Hsp90 chaperone

complex and regulates androgen receptor signaling in prostatecancer cells, Molecular and Cellular Biology, 30, no. 5, 1243–1253, (2010).

[149] S. Romano, A. D’Angelillo, R. Pacelli, S. Staibano, E. De Luna,R. Bisogni, E.-L. Eskelinen, M. Mascolo, G. Cal, C. Arra,and M. F. Romano, Role of FK506-binding protein 51 in thecontrol of apoptosis of irradiated melanoma cells, Cell Deathand Differentiation, 17, no. 1, 145–157, (2010).

[150] T. Robson, M. C. Joiner, G. D. Wilson, W. McCullough, M. E.Price, I. Logan, H. Jones, S. R. McKeown, and D. G. Hirst,A novel human stress response-related gene with a potentialrole in induced radioresistance, Radiation Research, 152, no.5, 451–461, (1999).

[151] O. Sunnotel, L. Hiripi, K. Lagan, J. R. McDaid, J. M. DeLeón, Y. Miyagawa, H. Crowe, S. Kaluskar, M. Ward, C.Scullion, A. Campbell, C. Downes, D. Hirst, D. Barton, E.Mocanu, A. Tsujimura, M. B. Cox, T. Robson, and C. P. Walsh,Alterations in the steroid hormone receptor co-chaperoneFKBPL are associated with male infertility: A case-controlstudy, Reproductive Biology and Endocrinology, 8, article no.22, (2010).

[152] T. A. Robson, H. Lohrert, J. R. Bailie, D. G. Hirst, M.C. Joinert, and J. E. Arrandt, Gene regulation by low-doseionizing radiation in a normal human lung epithelial cell line,Biochemical Society Transactions, 25, no. 1, 335–342, (1997).

[153] D. R. Mccalla and R. K. Allan, Effect of actinomycin D oneuglena chloroplast formation [28],Nature, 201, no. 4918, 504–505, (1964).

[154] T. Robson and I. F. James, The therapeutic and diagnosticpotential of FKBPL; A novel anticancer protein, Drug Discov-ery Today, 17, no. 11-12, 544–548, (2012).

[155] T. Jascur, H. Brickner, I. Salles-Passador, V. Barbier, A. ElKhissiin, B. Smith, R. Fotedar, and A. Fotedar, Regulation ofp21WAF1/CIP1 stability by WISp39, a Hsp90 binding TPRprotein, Molecular Cell, 17, no. 2, 237–249, (2005).

[156] K. Chu, N. Teele, M.W. Dewey, N. Albright, andW. C. Dewey,Computerized video time lapse study of cell cycle delay andarrest, mitotic catastrophe, apoptosis and clonogenic survivalin irradiated 14-3-3σ and CDKN1A (p21) knockout cell lines,Radiation Research, 162, no. 3, 270–286, (2004).

[157] T. Robson, M. E. Price, M. L. Moore, M. C. Joiner, V. J.McKelvey-Martin, S. R. McKeown, and D. G. Hirst, Increasedrepair and cell survival in cells treated with DIR1 antisenseoligonucleotides: Implications for induced radioresistance,International Journal of Radiation Biology, 76, no. 5, 617–623,(2000).

[158] D. R. Bublik, M. Scolz, G. Triolo, M. Monte, and C. Schneider,Human GTSE-1 regulates p21CIP1/WAF1 stability conferringresistance to paclitaxel treatment, Journal of Biological Chem-istry, 285, no. 8, 5274–5281, (2010).

[159] H. D. McKeen, C. Byrne, P. V. Jithesh, C. Donley, A.Valentine, A. Yakkundi, M. O’Rourke, C. Swanton, H. O.McCarthy, D. G. Hirst, and T. Robson, FKBPL regulates estro-gen receptor signaling and determines response to endocrinetherapy, Cancer Research, 70, no. 3, 1090–1100, (2010).

[160] A. M. Abukhdeir, M. I. Vitolo, P. Argani, A. M. De Marzo,B. Karakas, H. Konishi, J. P. Gustin, J. Lauring, J. P.Garay, C. Pendleton, Y. Konishi, B. G. Blair, K. Brenner, E.Garrett-Mayer, H. Carraway, K. E. Bachman, and H. P. Ben,Tamoxifen-stimulated growth of breast cancer due to p21 loss,Proceedings of the National Academy of Sciences of the UnitedStates of America, 105, no. 1, 288–293, (2008).


[161] H. D. McKeen, D. J. Brennan, S. Hegarty, F. Lanigan, K.Jirstrom, C. Byrne, A. Yakkundi, H. O. McCarthy, W. M.Gallagher, and T. Robson, The emerging role of FK506-bindingproteins as cancer biomarkers: A focus on FKBPL,BiochemicalSociety Transactions, 39, no. 2, 663–668, (2011).

[162] W. Han, M. Han, J. J. Kang, J. Bae, J. H. Lee, Y. J. Bae,J. E. Lee, H. Shin, K. Hwang, S. Hwang, S. Kim, and D.Noh, Genomic alterations identified by array comparativegenomic hybridization as prognostic markers in tamoxifen-treated estrogen receptor-positive breast cancer, BMC Cancer,6, article no. 92, (2006).

[163] A. Yakkundi, L. McCallum, A. O’Kane, H. Dyer, J. Worthing-ton, H. D.McKeen, L.McClements, C. Elliott, H. O.McCarthy,D. G. Hirst, and T. Robson, The Anti-Migratory Effects ofFKBPL and Its PeptideDerivative, AD-01: Regulation of CD44and the Cytoskeletal Pathway, PLoS ONE, 8, no. 2, Article IDe55075, (2013).

[164] R. L. Barent, S. C. Nair, D. C. Carr, Y. Ruan, R. A.Rimerman, J. Fulton, Y. Zhang, and D. F. Smith, Analysis ofFKBP51/FKBP52 chimeras andmutants for Hsp90 binding andassociation with progesterone receptor complexes, MolecularEndocrinology, 12, no. 3, 342–354, (1998).

[165] T. Ratajczak, A. Carello, P. J.Mark, B. J.Warner, R. J. Simpson,R. L. Moritz, and A. K. House, The cyclophilin component ofthe unactivated estrogen receptor contains a tetratricopeptiderepeat domain and shares identity with p59 (FKBP59), Journalof Biological Chemistry, 268, no. 18, 13187–13192, (1993).

[166] W. L. Yau, P. Pescher, A. MacDonald, S. Hem, D. Zander, S.Retzlaff, T. Blisnick, B. Rotureau, H. Rosenqvist, M. Wiese,P. Bastin, J. Clos, and G. F. Spath, The Leishmania donovanichaperone cyclophilin 40 is essential for intracellular infectionindependent of its stage-specific phosphorylation status, MolMicrobiol, 93, 80–97, (2014).

[167] P. J.Mark, B. K.Ward, P. Kumar, H. Lahooti, R. F.Minchin, andT. Ratajczak, Human cyclophilin 40 is a heat shock protein thatexhibits altered intracellular localization following heat shock,Cell Stress Chaperones, 6, 59–70, (2001).

[168] P. Kumar, P. J. Mark, B. K. Ward, R. F. Minchin, and T. Rata-jczak, Estradiol-regulated expression of the immunophilinscyclophilin 40 and FKBP52 in MCF-7 breast cancer cells,Biochemical and Biophysical Research Communications, 284,no. 1, 219–225, (2001).

[169] S. D. Hursting, J. Shen, X. Sun, T. T. Y. Wang, J. M. Phang,and S. N. Perkins, Modulation of cyclophilin gene expressionby N-4-(hydroxyphenyl)retinamide: Association with reactiveoxygen species generation and apoptosis, Molecular Carcino-genesis, 33, no. 1, 16–24, (2002).

[170] L. H. Pearl, Hsp90 and Cdc37 - A chaperone cancer conspiracy,Current Opinion in Genetics and Development, 15, no. 1, 55–61, (2005).

[171] V. C. H. da Silva and C. H. I. Ramos, The network interactionof the human cytosolic 90kDa heat shock protein Hsp90: Atarget for cancer therapeutics, Journal of Proteomics, 75, no.10, 2790–2802, (2012).

[172] M. Taipale, D. F. Jarosz, and S. Lindquist, HSP90 at the hubof protein homeostasis: Emerging mechanistic insights, NatureReviews Molecular Cell Biology, 11, no. 7, 515–528, (2010).

[173] M. Karin, Y. Cao, F. R. Greten, and Z. Li, NF-κB in cancer:From innocent bystander to major culprit, Nature ReviewsCancer, 2, no. 4, 301–310, (2002).

[174] P. Chène, Inhibiting the p53-MDM2 interaction: An importanttarget for cancer therapy,Nature Reviews Cancer, 3, no. 2, 102–109, (2003).

[175] A. E. Gururaj, S. K. Rayala, R. K. Vadlamudi, R. Kumar,M. Brown, M. Dowsett, and A. Lee, Novel mechanisms ofresistance to endocrine therapy: Genomic and nongenomicconsiderations, Clinical Cancer Research, 12, no. 3, (2006).

[176] R. K. Vadlamudi, B. Manavathi, S. Balasenthil, S. S. Nair, Z.Yang, A. A. Sahin, and R. Kumar, Functional implications ofaltered subcellular localization of PELP1 in breast cancer cells,Cancer Research, 65, no. 17, 7724–7732, (2005).

[177] L. Zhang, M. Johnson, K. H. Le, M. Sato, R. Ilagan, M.Iyer, S. S. Gambhir, L. Wu, and M. Carey, Interrogatingandrogen receptor function in recurrent prostate cancer,CancerResearch, 63, no. 15, 4552–4560, (2003).

[178] D. Gioeli, J. W. Mandell, G. R. Petroni, H. F. Frierson Jr., andM. J. Weber, Activation of mitogen-activated protein kinaseassociated with prostate cancer progression, Cancer Research,59, no. 2, 279–284, (1999).

[179] T. Kino, E. Souvatzoglou, M. U. De Martino, M. Tsopanomi-halu, Y. Wan, and G. P. Chrousos, Protein 14-3-3σ interactswith and favors cytoplasmic subcellular localization of theglucocorticoid receptor, acting as a negative regulator ofthe glucocorticoid signaling pathway, Journal of BiologicalChemistry, 278, no. 28, 25651–25656, (2003).

[180] L. Amazit, Y. Alj, R. K. Tyagi, A. Chauchereau, H. Loosfelt,C. Pichon, J. Pantel, E. Foulon-Guinchard, P. Leclerc, E.Milgrom, and A. Guiochon-Mantel, Subcellular localizationand mechanisms of nucleocytoplasmic trafficking of steroidreceptor coactivator-1, Journal of Biological Chemistry, 278,no. 34, 32195–32203, (2003).

[181] A. K. Das, P. T. W. Cohen, and D. Barford, The structure of thetetratricopeptide repeats of protein phosphatase 5: Implicationsfor TPR-mediated protein-protein interactions, EMBO Journal,17, no. 5, 1192–1199, (1998).

[182] A. C. Wikström, C. Widén, A. Erlandsson, E. Hedman,and J. Zilliacus, Cytosolic glucocorticoid receptor-interactingproteins., Ernst Schering Research Foundation workshop, no.40, 177–196, (2002).

[183] Z. Zuo, G. Urban, J. G. Scammell, N. M. Dean, T. K. McLean,I. Aragon, and R. E. Honkanen, Ser/Thr protein phosphatasetype 5 (PP5) is a negative regulator of glucocorticoid receptor-mediated growth arrest, Biochemistry, 38, no. 28, 8849–8857,(1999).

[184] D. A. Dean, G. Urban, I. V. Aragon, M. Swingle, B. Miller,S. Rusconi, M. Bueno, N. M. Dean, and R. E. Honkanen,Serine/threonine protein phosphatase 5 (PP5) participates inthe regulation of glucocorticoid receptor nucleocytoplasmicshuttling., BMC cell biology [electronic resource], 2, no. 1, p.6, (2001).

[185] C. Kanwal, S. Mu, S. E. Kern, and C. S. Lim, Bidirectionalon/off switch for controlled targeting of proteins to subcellularcompartments, Journal of Controlled Release, 98, no. 3, 379–393, (2004).

[186] M. Kakar, J. R. Davis, S. E. Kern, and C. S. Lim, Optimizingthe protein switch: Altering nuclear import and export signals,and ligand binding domain, Journal of Controlled Release, 120,no. 3, 220–232, (2007).




Review Article

Corticosteroid Receptors, Their Chaperones andCochaperones: HowDo TheyModulateAdipogenesis?

Judith Toneatto, Nancy L. Charó, Agostina Naselli, Melina Muñoz-Bernart, AntonellaLombardi, and Graciela Piwien-Pilipuk

Laboratory of Nuclear Architecture, Instituto de Biología y Medicina Experimental (IByME)- CONICET, Buenos Aires, Argentina

Corresponding Author: Graciela Piwien-Pilipuk; email: [email protected]

Recieved 9 May 2014; Accepted 5 October 2014

Editor: Sergio A. Onate

Copyright © 2014 Judith Toneatto et al. This is an open access article distributed under the Creative Commons AttributionLicense, which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properlycited.

Abstract. It is well known that glucocorticoids and mineralocorticoids are part of the list of hormones that control adipogenesisas well as different aspects of the physiology of the adipose tissue. Their actions are mediated through their binding to theglucocorticoid and the mineralocorticoid receptors (GR and MR, respectively), in complex with heat shock proteins (Hsps) andhigh molecular weight immunophilins (IMMs). Albeit many aspects of the molecular mechanism of the corticosteroid receptorsare not fully elucidated yet, it was not until recently that the first evidences of the functional importance of Hsps and IMMs inthe process of adipocyte differentiation have been described. Hsp90 and the high molecular weight IMM FKBP51 modulate GRand MR activity at multiple levels, that is, hormone binding affinity, their subcellular distribution, and the transcriptional status,among other aspects of the NR function. Interestingly, it has recently been described that Hsp90 and FKBP51 also participate inthe control of PPAR𝛾 , a key transcription factor in the control of adipogenesis and the maintenance of the adipocyte phenotype.In addition, novel roles have been uncovered for FKBP51 in the organization of the nuclear architecture through its participationin the reorganization of the nuclear lamina and the control of the subnuclear distribution of GR. Thus, the aim of this review isto integrate and discuss the actual understanding of the role of corticosteroid receptors, their chaperones and cochaperones, in theprocess of adipocyte differentiation.

Keywords: Adipogenesis, Hsp90, FKBP51, FKBP52, Nuclear Lamina, PPARgamma

1. Introduction

The pandemic of obesity has brought attention on adiposetissue and the development of fat cells. Undoubtedly, adi-pose tissue plays a central role in the control of energybalance and lipid homeostasis; however, during the last twodecades it has been demonstrated that adipocytes releasea variety of factors, including cytokines, chemokines, and

many other biologically active molecules, generically calledadipokines that made adipose tissue be regarded as anactive endocrine organ [1]. Adipokines signal organs ofmetabolic importance including brain, liver, skeletal muscle,and the immune system [2, 3]. These functions appear tobe modulated by the location of the adipose tissue (visceralvs. subcutaneous vs. bone marrow adipose) [4, 5], by thesize of the average adipocyte in the tissue [6], by the


cross-talk between adipocytes and other cell types presentin this tissue like macrophages [7, 8], and by adipocytemetabolism of glucose [9] and corticosteroids [10]. In thisway, adipose tissue has a central role modulating lipidand glucose metabolism homeostasis, blood pressure, andinflammation; in other words, it is a master regulator of themetabolic homeostasis of the organism. In obese individuals,the secretion of adipokines is deregulated [1] and adiposetissue is generally hypertrophic and infiltrated by a highernumber of macrophages compared to normal tissue [7],events that correlate with measures of adiposity and insulinresistance [11, 12]. This leads to the establishment of astate of chronic inflammation leading to metabolic disease[13]. However, a very recent report shows that up tocertain level proinflammatory signaling is necessary in theadipocyte for the adequate remodeling and expansion of theadipose tissue [14]. Failure of the normal proinflammatoryresponse leads to increased ectopic lipid accumulation due todeficient adipogenesis, accompanied by glucose intoleranceand systemic inflammation, demonstrating that adequatecontrol of adipose tissue inflammatory signaling facilitatesthe appropriate storage of excess nutrients maintaining themetabolic equilibrium [14].

Conversely, lipodystrophy, a disorder characterized byselective total or partial loss of body fat, is also accompaniedby similar metabolic consequences as obesity, includinginsulin resistance, dyslipidemia, hepatic and myocellularsteatosis, and increased risk for diabetes and atherosclerosis[15, 16], reinforcing the notion of the key role of adiposetissue in the control of the homeostasis of body metabolism.Taking into consideration what has been mentioned, itis relevant to uncover the factors that control not onlyadipogenesis but also those that exert control in the functionof the adipose cell itself. It is well known that corticosteroidsare key regulators not only of fat distribution, but also ofadipocyte differentiation as demonstrated both in vitro and invivo [17–21] and are required for the induction of lipogenicgenes and lipolisis in adipocytes [22, 23] as well as forrestraining of adipose tissue inflammation in obesity [24].

Corticosteroids exert their action through the bindingto their cognate receptors, the glucocorticoid and miner-alocorticoid receptor (GR and MR, respectively), that arepresent in the cytoplasm. For proper steroid hormone action,GR and MR need to be part of an heterocomplex withthe 90-kDa and 70-kDa heat shock proteins, Hsp90 andHsp70, respectively, the acidic protein p23, and a proteinthat belongs to the conserved and a large family known asimmunophilins (IMMs) [25, 26]. Among the members of theIMMs family, FK506 binding protein (FKBP)52, FKBP51,Cyclophilin (CyP) 40, and three IMM-like proteins, proteinphosphatase 5 (PP5), hepatitis virus B X-associated protein 2/AhR-associated protein 9 (XAP2/ARA9), and WAF-1/CIP1stabilizing protein (WISp) 39, have been recovered to datein steroid receptor Hsp90 complexes [25, 27]. Detailedrevisions have been made on the roles of glucocorticoidsand mineralocorticoids actions in adipose tissue biology

[28, 29]; thus our aim will be to summarize the molecu-lar mechanism of action of gluco- and mineralocorticoidsand then discuss recent findings of how chaperones andcochaperones not only regulate GR and MR at differentlevels but also exert new roles in the process of adipogen-esis.

2. Glucocorticoids Actions in the Adipose Tis-sue

Glucocorticoids are required for proper adipocyte differen-tiation [17, 30, 31] and have a wide spectrum of actionson adipose tissue biology; for a recent review refer to [28].As already mentioned, they exert their action through theirbinding to the GR that is present in the cytoplasm as partof a heterocomplex with Hsp90, Hsp70, p23, and the highmolecular weight immunophilin FKBP51 or FKBP52. GRmRNA [32] and protein [33] exhibit a particular patternof expression, with higher levels during the first severalhours after induction of the adipogenic program of 3T3-L1 preadipocytes, followed by a period of lower level ofexpression that gradually increases back to preadipocyteslevel after several days. There is still some controversy aboutGR requirement for proper adipogenesis to occur. It has beenreported that knock-down of GR by specific siRNA blocksthe differentiation of 3T3-L1 preadipocytes [34] but anotherreport provides some evidence that this is not the case [21].However the role of GR appears to be more complex, basedon the fact that it has been shown that brown adipose celllines generated from newborn homozygous GR-knockoutmice showed mildly impaired adipocyte differentiation witha decrease of lipid accumulation mainly at early time pointscompared to wild-type adipocytes [35]. Thus, differences incell lines and/or cell sourcesmay account for different results,and more studies are needed to shed light on this complexissue.

There is no doubt that glucocorticoids have a proadi-pogenic effect that is evident in the development of centralobesity in patients with high levels of circulating glucocorti-coids, as observed in Cushing’s syndrome or in patients thatrequired prolonged administration of this steroid hormonetherapeutically [28, 36]. Further, adipose tissue-dependentamplification of glucocorticoid production in transgenicmice results in a full metabolic syndrome, including centralobesity, insulin resistance, and hypertension [10]. In contrast,glucocorticoid inactivation is associated with resistance tometabolic dysfunction [37, 38].

3. Mineralocorticoids Actions in the AdiposeTissue

Aldosterone and its cognate receptor MR besides controllingwater and salt homeostasis are also involved in the complexbiology of the adipocytes [29]. Many reports have shownthat aldosterone is required for proper adipogenesis [20,


21]. 3T3-L1 preadipocyte differentiation is blocked in thepresence of aldosterone antagonists such as ZK91587 [20],spironolactone [21], or drospirenone [39]. Further, knock-down ofMR by siRNAsmarkedly inhibited 3T3-L1 cells dif-ferentiation [21]. Taken together, these studies demonstratethe importance of aldosterone/MR in the adipogenic process.Significantly higher MR mRNA levels are present in whiteadipose tissue (WAT) of obese ob/ob and db/db mice than inlean control mice [40]. Treatment of ob/ob and db/db obesemice with eplerenone, a selective MR antagonist, does notresult in significant changes in body weight; however, thistreatment reduces the number of hypertrophic adipocytes,decreases the infiltration of adipose tissue by macrophages,and corrects glucose tolerance test [40]. Therefore, MR mayplay a key role in the development of the metabolic syndromeand its blockade could be beneficial for obese patients whosuffer insulin resistance and type 2 diabetes.

Interestingly, several reports, some of them even pub-lished when no role was known for aldosterone in adipogene-sis, indicated an association between high serum aldosteronelevels and obesity [41–46]. In this regard, secretory productsisolated from human adipocytes strongly stimulate steroido-genesis in adrenocortical cells with a predominant effecton mineralocorticoid secretion [47]; the identity of theseproducts still remains elusive. Further, visceral adipocytesisolated from SHR/NDmcr-cp, a rat model of metabolicsyndrome, secrete factors that stimulate aldosterone produc-tion in adrenocortical cells, activity that was not detected inadipocytes from non-obese SHR [48]. The stimulatory effectof adipocyte-conditioned medium on aldosterone secretion isindependent of adipose angiotensin II since the effect is notblocked in the presence of antagonists of angiotensin type 1receptor [47, 48].

Importantly, the adipocyte itself is another source of bothaldosterone synthesis and secretion [49, 50]. Preadipocytesas well as adipocytes express CYP11B2 (aldosterone syn-thase) gene and have a functionally active aldosteronesynthase, making these cells aldosterone-producing cells[50]. Specific inhibition of CYP11B2 interferes in the normalprocess of adipogenesis [50]. It remains to be investigatedwhether local synthesis of aldosterone may depend onfat depot and whether changes in the local aldosteroneproduction in the hypertrophic adipocyte may also contributeto the pathophysiology of obesity.

Healthy adipose tissue around small arteries secretesfactors that influence vasodilation by adiponectin-dependentincrease in nitric oxide bioavailability [51]. In perivascu-lar fat from obese subjects with metabolic syndrome thisdilator effect is lost possibly due to defects of hyper-trophic adipocytes to properly secrete adiponectin [51].However, adipose local production of aldosterone mayalso exert a paracrine action modulating the microvasculartone. Small arteries from db/db mice exhibit endothelialdysfunction [52], and acetylcholine-induced relaxation ofmesenteric arteries is improved by pretreatment of db/db

mice with eplerenone [50]. Thus, local aldosterone secretedby perivascular adipocytes may contribute to endothelialcells dysfunction, explaining the beneficial effect of theselective MR antagonist eplerenone on the microvasculature[50].

4. Do Glucocorticoids and MineralocorticoidsExert Coordinated Actions in Adipose Tis-sue?

Glucocorticoids and mineralocorticoids have their own cog-nate receptors; however, the way they exert their biologicalactions is more complex. Circulating levels of aldosteroneare 100 to 1000 times lower than cortisol which can bindto MR with 10-fold higher affinity than to GR [53]. Inorder to control GR/MR activation by glucocorticoids, 11-beta hydroxysteroid dehydrogenases (11𝛽-HSDs) types 1 and2 determine the availability of intracellular concentrationsof active glucocorticoids [54, 55]. 11𝛽-HSD1 is expressedprimarily in glucocorticoid-target tissues, such as liver, thecentral nervous system, and the adipose tissue, and acts as apredominant 11𝛽-reductase NADP(H) dependent that ampli-fies glucocorticoid action. On the other hand, 11𝛽-HSD2is a high affinity NAD-dependent dehydrogenase expressedprimarily in mineralocorticoid target tissues, such as kidney,and metabolizes glucocorticoids to their 11-dehydro deriva-tives, that is, cortisone, 11-dehydrocorticosterone, that haveweak or no affinity for MR [56, 57]. Thus, the presence of11𝛽-HSD2 “protects” MR from its activation through thebinding of glucocorticoids. In adipose tissue, 11𝛽-HDS2,which reduces active levels of glucocorticoids, is expressedat much lower levels than 11𝛽-HDS1 [58–60]. In Flier´slab transgenic mice that expressed 11𝛽-HSD2 driven bythe adipocyte fatty acid binding protein 2 promoter weregenerated. These mice have the highest levels of 11𝛽-HSD2in adipose tissue, and when they are exposed to high-fat dietthey are resistant to weight gain, event that is associatedwith decreased food intake, increased energy expenditure,and improved insulin sensitivity [38]. Further, 11𝛽-HSD-1null mice showed reduced visceral fat accumulation uponhigh-fat feeding and expressed higher PPAR𝛾 , adiponectinand lower resistin, and tumor necrosis factor-𝛼, pattern ofgene expression that indicates high insulin sensitivity [37].Therefore, it is possible that high concentration of cortisolwithin the adipose tissue that cannot be inactivated due tolow levels of 11𝛽-HDS2 may exert their action not onlyupon GR activation but also through MR. In obese patients,serum cortisol levels are not increased and can be evenlower than serum aldosterone levels [61, 62]; thereforeincreased local activation of cortisol from cortisone observedin obesity has detrimental consequences in adipose tissuephysiology.

The requirement of an adequate level of gluco- andmineralocorticoids stimulus is highlighted by the fact that


the activation of GR and MR has some opposite out-comes in adipocytes. For example, MR activation increasesthe expression of interleukin-6 and plasminogen activatorinhibitor (PAI) 1 while GR activation decreases them [35].It has also been reported that the synthetic glucocorticoiddexamethasone (DEXA) decreases the expression of proin-flammatory cytokines [24, 63–65] as well as macrophageinfiltration in adipose tissue [24]. Further, treatment ofobese diabetic db/db mice with eplerenone, a selectiveMR antagonist, decreases the expression of tumor necro-sis factor –𝛼, monocyte chemoattractant protein-1, andmacrophage protein CD69 while it increases the expressionof adiponectin and peroxisome proliferator-activated receptor(PPAR)𝛾 in adipocytes from the retroperitoneal fat depot[66]. Eplerenone treatment also decreases macrophage infil-tration and the generation of reactive oxygen species inadipose tissue [40]. Since the pattern of expressed genes isdifferent depending on the participation of GR or MR, thestrict control of their activation is required in the adiposecell to achieve the proper biological response. We need tokeep in mind that in the genome there are approximately 2–5 × 106 potential recognition elements for binding of thisnuclear receptors (NRs); however, a few thousand bindingsites are occupied [67, 68]. Therefore, how are GR and MRspecificities achieved? Several coordinate layers of GR/MRcontrol allow them to gain such specificity, among themare regulation of their subcellular distribution, posttrans-lational modifications that may modulate their interactionwith factors that control their transcriptional capacity, andmechanisms that mediate the recognition of the responseelements in the architecture of the genome contribute toit.

4.1. GR and MR expression during adipogenesis. In orderto gain insight in a better understanding of the NRs functionduring adipogenesis, Fu et al. analyzed the gene expressionprofiles of NRs during differentiation of murine 3T3-L1preadipocytes. Of the forty-nine NRs analyzed, thirty areexpressed at some point during 3T3-L1 adipogenesis andseventeen of them are expressed in a temporal-specificmanner [32]. GR and MR belong to a group of NRs thatare expressed in a biphasic manner, with higher levels ofexpression during the first several hours after induction ofthe adipogenic program, followed by a period of lower levelof expression that gradually increases back to preadipocyteslevels after several days [32]. GR and MR expression arefound substantially higher in mature primary adipocytesrelative to preadipocytes [32]. In agreement with mRNA,GR protein expression levels follow a similar pattern [33].It was proposed that this temporal pattern of GR andMR expression possibly marked distinct transcriptionallyregulated boundaries at early, middle, and late stages ofadipocyte differentiation [32]. In addition, GR mRNA levelsexhibit differences that depend on the fat depots. GRmRNA is 2- to 4-fold higher in omental than subcutaneous

adipose tissue [22, 69–71]. It will be relevant to determinewhether MR expression is similar or not in different fatdepots.

Besides differences in GR and MR levels of expression,the existence of GR and MR isoforms has to be taken intoconsideration. GR𝛼 and -𝛽 are GR isoforms generated byalternative splicing of exon 9 [72, 73]. The resulting proteinsare identical except that GR𝛼 contains 5 additional aminoacids and GR𝛽 additional non-homologous 15 amino acids.Both are widely expressed in all tissues with GR𝛼 beingpresent at relatively higher levels in themajority of the tissuesexamined in humans and mice [74, 75]. GR𝛽 functions as adominant negative inhibitor of GR𝛼; therefore the GR𝛼/GR𝛽ratio may also mediate differential glucocorticoid responses.Insulin increases GR𝛽 mRNAwithout affecting GR𝛼 mRNAin mouse embryonic fibroblasts [75]. Importantly, GR𝛼/GR𝛽ratio changes in the liver when fasted mice are re-fedindicating that the GRs ratio changes in response to insulin[75]. To add more complexity, different isoforms from theGR𝛼 transcript can be generated by alternative translationinitiation mechanisms [76]. No significant differences havebeen observed in their affinity for glucocorticoids or theircapacity to interact with glucocorticoid response elements(GREs) present in GR target genes, but their subcellulardistribution shows some differences [76]. Importantly, ithas been shown that translationally generated GR𝛼 isoformsregulate both common and distinct sets of genes in thesame cell. Lu et al. showed that, in U-2 OS cells, a humanosteoblastic sarcoma cell line that lacks endogenous GR,expression of different GR isoforms have distinct capabilitiesto activate the cell death program [76, 77]. Since theyhave identical DNA- and ligand-binding domains, it hasbeen proposed that this functional difference may relyon their differential ability to recruit coregulators and/orthe recognition of chromatin modifications on target genes[77].

MR has also isoforms and protein variants that creatediversity around one single gene [78–81]. MR is expressed astwo different protein variants,MRA andMRB, resulting fromKozak sequences that initiate alternative translation [82].Thus, future studies are required to address the contributionof GR and MR isoforms in the process of adipogenesis aswell as their expression in the different adipose depots wherethey may possibly contribute to the differential response tocorticosteroid hormones.

GR and MR undergo different posttranslational modifi-cations that constitute another layer of control to achievespecificity in the corticosteroids response. GR can be sub-strate for phosphorylation [83–87], sumoylation [88–92],ubiquitination [93, 94], and acetylation [95]. These posttrans-lational modifications regulate the final biological outcomedepending on GR bymodulating GR subcellular distribution,protein stability, chromatin binding, transcriptional capacity,and its interaction with coregulatory complexes. In thecase of MR, it has been reported that it can undergo


phosphorylation [96–99], acetylation [100], and sumoylation[101], having consensus sites for possible ubiquitination.How posttranslational modifications may control hormonalresponses as well as the crosstalk of steroid hormones withother signaling molecules in adipose tissue still remains to beelucidated in detail.

4.2. GR and MR transformation and nuclear translocation.For proper steroid hormone action, it is well established thatGR and MR need to be part of a heterocomplex with the90-kDa and 70-kDa heat shock proteins, Hsp90 and Hsp70,respectively [25, 26]. In the absence of ligand, GR and MRreside primarily in the cytoplasm, and it has been acceptedthat, upon hormone binding, they dissociate from the Hsp90heterocomplex for their translocation to the nucleus byfree diffusion. However, during the last decade severalreports provided evidence that movement of GR and MR ismore complex than simple diffusion. It was demonstratedthat the intermediate chain of the motor protein dyneincoimmunoprecipitates with the Hsp90•FKBP52 complex ofthe GR [102–104] and MR [105, 106] suggesting that thismotor protein can facilitate the retrograde movement of thesteroid receptor (Figure 1). Blockage of the Hsp90•FKBP52or FKBP52•dynein interactions by overexpressing the tetra-tricopeptide repeat motif (TPR) domain or the peptidyl-prolyl isomerase domain of the IMM, respectively, slowsthe rate of receptor translocation to the nucleus in a similarmanner as inhibition of the Hsp90 function by geldanamycintreatment [107]. In all these cases, the nuclear localizationof the receptor was not fully abrogated, but it was delayed.Therefore, GR andMR possess twomechanisms of transport,a rapid Hsp90•FKBP52•dynein complex-dependent mecha-nism and a slow heterocomplex-independent mechanism bysimple diffusion.

The classic model of GR/MR receptor activation estab-lishes that Hsp90 “anchors” NR in the cytoplasmic compart-ment and, upon hormone binding, the NR has to undergoa process known as “transformation,” that corresponds toits dissociation from Hsp90, for then translocating to thenucleus. Since Hsp90•FKBP52 complex facilitates GR andMR movement towards the nucleus, consequently theirtransformation should not take place immediately uponligand binding (Figure 1). Moreover, it has been shownthat the whole MR•Hsp90-based heterocomplex can betransiently recovered in the nucleoplasmic fraction of thenucleus shortly after steroid hormone incubation [106, 108].Thus, the steroid-receptor transformation could possibly takeplace in the nucleus [109], raising the possibility that theentire oligomeric structure could pass intact through thenuclear pore for transformation to be a nuclear rather thana cytoplasmic event (Figure 1). In this regard, GR and itsassociated chaperones bind with proteins of the nuclear poresuch as nucleoporins (Nups) and importin (Imp)-𝛽, and ithas been shown that the entire Hsp90 heterocomplex cross-linked to GR translocates intact through the nuclear pore in

digitonin-permeabilized cells [110]. There is evidence thatImp-𝛼 is cointernalized with the GR [111], whereas Imp-𝛽is not. Nonetheless, the knock-down of Imp-𝛽 significantlydelayed GR nuclear import [110]. It has been reported thatmany importins including Imp-𝛽 effectively suppress theaggregation of cargoes [112]. It can be envisioned thatthe presence of chaperones and co-chaperones associatedto importin, Nups, and the cargo itself may prevent theaggregation of cargoes when relatively hydrophobic domainsare exposed [109]. When these complexes are disruptedby Hsp90 inhibitors such as radicicol or geldanamycin, thenuclear translocation rate of GR [102, 104] and MR [105,113] undergoes a substantial delay, in line with the ideathat importin-Nup-chaperone complexes may facilitate theirnuclear pore translocation step.

4.3. The chaperone Hsp90: does it play a role in adipo-genesis? During the process of differentiation of 3T3-L1preadipocytes no change is observed in the protein levelsof the chaperones and cochaperones Hsp90, Hsp70, andp23 [33]. Hsp90 accounts for 1-2% of the total solubleproteins in resting cells, ˜6-7 % in cancer cells, and upto 10% in stressed cells [114–116]. Hsp90 is a molecularchaperone that associates with numerous substrate proteinscalled clients modulating their folding and function, amongthem are protein kinases and transcription factors [117–119]. In this manner, Hsp90 controls metastable proteinsthat are regulatory hubs in biological networks. The masterregulator for acquisition and maintenance of the adipocytephenotype PPAR𝛾 has been recently incorporated to the largelist of Hsp90 client proteins. Inhibition of Hsp90 by treatmentof 3T3-L1 cells with geldanamycin or its analogs at earlytime points of the adipogenic process prevented the cells todifferentiate properly [120–122]. It has been proposed thatthe antiadipogenic effect of geldanamycin may result fromthe destabilization of PPAR𝛾 that is targeted to degradationby the proteasome [120], to decrease PDK1-Akt activitiesleading to the blockade of the mitotic clonal expansionat the onset of adipogenesis [121], and the decrease ofGR and MR activities [122]. Hsp90 is essential for widespectrum of cellular processes such as protein folding, proteindegradation, and signal transduction cascades [117, 123],having been recently shown that Hsp90 also participates inthe maintenance of RNA polymerase II pausing, functionrequired for the adequate gene expression when cells haveto respond to environmental stimuli [124]. Therefore theblockade of the adipogenic program upon Hsp90 inhibitioncould be the result of more widely disruption of signalingpathways as well as nuclear events depending on Hsp90surveillance.

4.4. High molecular weight immunophilins: regulatory func-tions beyond NR control. IMMs comprise a family ofproteins classified by their ability to bind immunosuppressantdrugs in which cyclophilins bind cyclosporine A whereas


Figure 1: Model of GR and MR action: the adipogenic media contain DEXA, IBMX, and insulin and are supplemented with fetal bovineserum. Upon corticosteroid hormone binding to its receptor (GR or MR) FKBP51 is exchanged for FKBP52 that facilitates the retrogrademovement of the NR towards the nucleus. IBMX increases cAMP leading to PKA activation that triggers the translocation of FKBP51 frommitochondria to the nucleus, possibly upon changes in its phosphorylation status. In the nucleus GR binds to its target genes, localizing inthe NL (nuclear lamina) and possibly in the NM (nuclear matrix). FKBP51 is retained in the nucleus by its interaction with the NL, the NM,and chromatin, regulating GR-target genes and possibly other genes.

FKBPs bind FK506. The high molecular weight IMMsFKBP51 and FKBP52 do not play a role in immunosup-pression and rather have been related to steroid receptorregulation [125]. The FKBPs are modular proteins thatpossess FKBP12-like peptidyl-prolyl isomerase (PPIase)domains 1 and 2 (FK1 and FK2) and a tetratricopeptiderepeat motif (TPR). The FK1 domain is required for thebinding of the immunosuppressive drug FK506, it confersPPIase activity, and it is also the primary domain requiredfor steroid hormone receptor regulation [125–127]. The TPRdomain contains sequences of 34 amino acids repeatedin tandem through which FKBPs interact with Hsp90.FKBP51 and FKBP52 share 60% identity and 70% similarity;however, the former has been so far mainly reported tobe a negative regulator of steroid hormone receptors whilethe latter is a positive one [103–105, 125, 127]. Whendifferentiation of 3T3-L1 preadipocytes is induced, it wasreported that FKBP51 has a transient expression at veryearly time points (day1 up to day 4 of differentiation)and then its expression decreases to undetectable protein

levels [128]. More recent studies demonstrate that FKBP51and FKBP52 exhibit opposite changes in their level ofexpression during the process of adipocyte differentia-tion. FKBP51 expression progressively increases whereasFKBP52 decreases as adipogenesis progresses [33, 129].The differences observed between early and recent studiesmay possibly depend on the development of highly sensitiveand specific antibodies now available for the study ofthese IMMs. Further, the changes in FKBP51 and FKBP52observed during 3T3-L1 preadipocytes differentiation arein agreement with their expression level in adipose tissuethat is high for FKBP51 and non-detectable for FKBP52[130].

To uncover the functional importance of these IMM,knockout mice were generated [125]. Fkbp51-deficient micewere initially observed to display no overt phenotype, butthese mice are less vulnerable to the detrimental effectsof stress [131–133]. Interestingly, Fkbp51 knockout miceshowed reduced body weight compared to wild-type lit-termates; however, upon exposure to chronic stress, these


animals exhibited a significant increase in body weight [133],results that suggest that the process of adipogenesis may notbe impaired in the absence of FKBP51. A differential spatialpattern of Fkbp51 gene induction in different areas of thebrain depending on either diet or stress conditions has beenrecently reported by Balsevich et al.. Inmice exposed to high-fat diet, Fkbp51 is induced in the ventromedial hypothalamicnuclei, in accordance with the hypothalamus being involvedin the control of energy balance [134]. In contrast, under con-ditions of chronic stress, the expression of this IMM increasesin the hippocampus, area of the brain involved in the responseto stress [134]. Inasmuch as environmental stress is anotherrisk factor for the development of obesity [135], futurestudies will uncover the role of FKBP51 in different areasof the brain, whether this IMM plays a role in the control ofappetite, energy balance and whether FKBP51 is implicatedin the relationship between control of energy, metabolichomeostasis, and stress response. On the other hand,Fkbp52-deficient male mice display phenotypes related to partialandrogen insensitivity syndrome [136, 137]. HeterozygousFkbp52-deficient mice show increased susceptibility to highfat-diet-induced hyperglycemia and hyperinsulinemia thatcorrelates with reduced insulin clearance, hepatic steato-sis, and glucocorticoid resistance [130]. However Fkbp51-Fkbp52 doubled knock-out results in embryonic lethality[125], indicating that these IMMs have some physiologicfunctional redundancies that need to be uncovered by tissue-specific conditional double knockout.

FKBP51 is present in mitochondria [138], and uponoxidative stress the mitochondrial fraction of this IMMrapidly translocates to the nucleus protecting cells fromapoptosis [138]. When 3T3-L1 preadipocytes are induced todifferentiate, FKBP51 also rapidly and transiently translo-cates to the nucleus [33]. Adipogenesis is controlled bymany signaling pathways that coordinately modulate thesequential activation of transcription factors required for cellsto differentiate [139]. We found that IBMX (3-isobutyl-1-methylxanthine), a phosphodiesterase inhibitor that increasesintracellular cAMP, and to a lesser extent DEXA, are respon-sible for the rapid relocalization of mitochondrial FKBP51 tothe nucleus [33]. Several reports have shown that the secondmessenger cAMP is associated with immediate events ofadipogenesis by the classic PKA signaling pathway, as wellas by the non-classic pathway, the exchange proteins acti-vated by cAMP (EPAC) that function as guanine nucleotideexchange factor for the Ras-like small GTPases Rap1 andRap2 [140–143]. FKBP51 nuclear translocation depends onPKA but not on EPAC pathway activation, demonstratinganother differential role of PKA and EPAC/Rap duringadipogenesis [33]. In the case of DEXA, it has been reportedthat corticosterone possibly facilitates arachidonic acid (AA)release and increased synthesis of prostacyclin, which in anautocrine manner leads to cAMP generation required for thedifferentiation of Ob1771 preadipocytes [18, 144]. The effectof corticosterone on AAmetabolism in Obl711 cells could becontradictory considering the anti-inflammatory properties

of glucocorticoids upon inhibition of phospholipase A2;however, there are studies that questioned this effect [145,146]. Further, based on the proadipogenic action of gluco-corticoids, AA and prostacyclin signaling in adipose tissuedevelopment [147], it is tempting to speculate that, in adiposetissue, glucocorticoids may possibly mediate a different bio-logical response in AA pathway, possibility that needs to beinvestigated. DEXA treatment also results in increased levelsof intracellular cAMP in other cell systems. For example,glucocorticoid treatment of 3B4.15 T cells causes activationof adenylate cyclase and a decrease in phosphodiesteraseactivity [148], and in human airway epithelial cells DEXAincreases the beta2-adrenergic receptor-adenylate cyclasesystem [149] leading to the increase in cAMP. It will berelevant to investigate these possibilities in adipose cells, tobetter understand corticosteroids actions both in adipogenesisand the adipose tissue biology.

FKBP51 interacts with PKA-c𝛼 as shown by immuno-precipitation assays, and when PKA signaling is blockeddramatic changes in the electrophoretic pattern of migrationof FKBP51 are observed supporting the notion that FKBP51is a PKA substrate [33]. By using NetPhosk 1.0, we foundthat Serine 312 of FKBP51 is a candidate PKA phospho-acceptor site. Serine 312 is in the TPR domain that confers tothe IMM the ability to bind Hsp90 through the EEVD motifpresent in the extreme C terminus of the chaperone. FKBP51localization in mitochondria depends on TPR integrity, sinceFKBP51 TPR deficient mutants are constitutively nuclear[138]. Therefore, changes in phosphorylation in Serine 312present in the TPR domain of FKBP51 may possibly regulateits interaction with Hsp90 and consequently its subcellularlocalization, possibility that is under current investigation.Interestingly, when the interaction of FKBP51 with Hsp90is disrupted by Hsp90 inhibitors such as radicicol, FKBP51is no longer in mitochondria and concentrates in the nucleus[138]. As mentioned already, geldanamycin and radicicolinhibit 3T3- L1 preadipocytes differentiation [120–122].Therefore, it is also possible that the Hsp90 inhibitorsnot only affect PPAR𝛾 , GR, and MR function but mayalso alter the dynamic mitochondrial- nuclear shuttling ofFKBP51 at the onset of the differentiation process requiredfor adipogenesis to proceed.

However, during the last years several reports demonstratethat FKBP51 functions are not circumscribed only to thecontrol of NRs. FKBP51 participates in the control of theprotein kinase Akt activity. The IMM is a scaffold protein forthe interaction between Akt and the PH domain leucine-richrepeat protein phosphatase (PHLPP) that dephosphorylatesSerine 473 in Akt inhibiting the kinase activity [150].It has been recently demonstrated that FKBP51 interactswith overexpressed PPAR𝛾 in COS7 cells, and reportergene assays show that FKBP51 is a positive regulator ofthis NR [87]. PPAR𝛾 like other NRs can be regulatedby changes in its phosphorylation status. MAPK ERK1/2and JNK are able to phosphorylate PPAR𝛾 at serine 112


reducing its transcriptional capacity [151–153]. Further,inhibition of p38MAPK increases PPAR𝛾 expression andits transcriptional activity [154]. GR is also a substrateof p38MAPK, posttranslational modification that increasesGR transcriptional capacity [155]. Taken together, MAPK-dependent phosphorylation of PPAR𝛾 and GR has oppositeeffects on the transcriptional capacities of these NRs; PPAR𝛾transactivation decreases while GR transactivation increases.Stechschulte et al. showed that in mouse embryonic fibrob-lasts (MEFs) null for FKBP51 elevated Akt activity causes anincreased activation of p38MAPK leading to the phospho-rylation of GR and PPAR𝛾 , posttranslational modificationthat induces the transcriptional activation of the formerand inhibition of the latter [87]. Further, they show thatknock-down of FKBP51 in 3T3- L1 preadipocytes makescells resistant to differentiation and MEFs from mice 51KOhave impaired differentiation [129]. The authors proposed amodel, in which FKBP51 restrains Akt activation by scaf-folding PHLPP [87], favoring the inactive state of p38MAPKthat prevents PPAR𝛾 phosphorylation and keeps this NR ina transcriptionally active state to induce the expression ofthe adipogenic genes [129]. While the role of p38MAPK inadipogenesis is rather controversial [154, 156–158], severallines of evidence demonstrate that Akt is required forproper adipogenesis. Akt is a key component of insulinsignaling and is required for PPAR𝛾 expression [139, 159].Expression of constitutive active Akt induces spontaneousdifferentiation of 3T3-L1 preadipocytes [160], and mice nullfor Akt1 and Akt2 have impaired adipogenesis [159]. Aktis responsible for phosphorylation and nuclear exclusion ofantiadipogenic factors such as the forkhead proteins FOXO-1 [161] and FOXA-2 [162] and the transcription factorGATA2 [163]. Therefore, proper activation of Akt is requiredfor normal adipogenesis and it can be speculated that Aktinhibition by the FKBP51-PHLPP could have a negativeeffect on this process. In line with this possibility, Toneattoet al. showed that knock-down of FKBP51 facilitates theprocess of adipogenesis and its overexpression blocks 3T3-L1 preadipocyte differentiation, based on the fact that thisIMM also restrains the adipogenic potential of GR [33], aswell as MR. It is possible that the discrepancies betweenthese two studies could result, in part, from differences in theprotocol of adipogenesis used in each case. More studies arerequired to precise the role of FKBP51 during adipogenesisand, in this way, shed light on this conundrum.

4.5. FKBP51 and the organization of the nuclear architectureduring adipogenesis. In a very simplistic description, asdepicted in Figure 2, the following compartments can bedistinguished in the interphase nucleus: 1- the nuclear laminathat lies below the nuclear envelope ; 2- the nuclear matrix ornucleoskeleton; 3- the chromosome territories that comprisethe volume of the nucleus in interphase occupied by eachchromosome; 4- the interchromatin domain; and 5- nuclearbodies, including the nucleolus, spliceosomes or nuclear

speckles, paraspeckles, the Cajal bodies, the promyelocyticbodies, and transcription factories, among others [164–168]. The importance of the organization of the nucleararchitecture is highlighted by the evolutionary conservationof chromosome territories [169], by the observation thatchromosome positions are heritable through the cell cyclein mammalian cells [170] and interphase chromosomes, aswell as chromatin organization, undergo changes duringterminal differentiation [171–174]. Great body of evidenceshows that the genome has a dynamic 3D organization thatimpinges in the transcriptional status of the cell. Chromatinis not static and genes can be repositioned from repressiveto transcriptionally favorable nuclear compartments and viceversa for their proper expression or repression [175–182]. Itis relevant to understand how the architecture of the nucleusis delineated to uncover how the cell acquires and sustainsthe pattern of gene expression require for the acquisition andmaintenance of the final phenotype.

The nuclear lamina (NL) is a filamentous protein mesh-work that lines the nucleoplasmic surface of the nuclear enve-lope (NE) interacting with inner nuclear membrane proteinsand the nuclear pores (Figure 2) [183, 184], reviewed in [185,186]. It consists of a polymeric assembly of lamins, membersof the type V intermediate filament proteins family [187] thatare the A-type (LA and LC) and the B-type lamins (LB1 andLB2), respectively. LA and LC are derived from a single geneby alternative splicing and are expressed only in differenti-ated cells. On the other hand, LB1 and LB2 are expressed inall cells throughout development [188]. The NL is thoughtto provide a structural framework for the NE contributingto the size, shape, and mechanical stability of the nucleus.It also provides anchoring site for interphase chromosomesat the nuclear periphery and plays important roles in DNAreplication and repair, RNA polymerase II transcription, andthe epigenetic control of chromatin remodeling [186, 189].The functional importance of NL is demonstrated by the factthat mutations in the lamin A/C or lamin-associated proteinsgenes are responsible for a group of genetic diseases knownas laminopathies [186, 190] to which Dunnigan-type familialpartial lipodystrophy (FPLD) belongs [191–194], partiallipodystrophy with mandibuloacral dysplasia (MAD) [195],and lipoatrophy with diabetes, hepatic steatosis, hypertrophiccardiomyopathy, and leukomelanodermic papules [196], dis-eases that affect the adipose tissue. In addition, laminopathiessuch as Hutchinson-Gilford progeria and atypical Wermer´ssyndrome show generalized lipodystrophy, often combinedwith insulin resistance [197–200].

In a recent study, analysis of mouse and humanmodel sys-tems for adipogenesis showed fragmentation of the nuclearlamina and subsequent loss of lamins A, C, B1, and emerinat the nuclear rim, which coincides with reorganizationof nesprin-3/plectin/vimentin complex [201]. We have alsoobserved fragmentation of nuclear lamina at the early stagesof 3T3-L1 preadipocytes differentiation upon detection oflamin B. Interestingly, fragmented lamin B not only colo-calizes but also interacts with FKBP51 as well as PKA-c𝛼


Figure 2: A) Schematic representation of the compartments of the nucleus in interphase NE: nuclear envelope, NPC: nuclear pore complex,NL: nuclear lamina, NM: nuclear matrix, CTs: chromosome territories, MARs: matrix attachment regions that correspond to DNA sequencesthat allow the interaction of chromatin to NM, and LADs: lamin attachment domains, corresponding to DNA sequences that allow theinteraction of chromatin to the nuclear lamina. B-C) 3T3-L1 preadipocytes grown on coverslips were incubated with DEXA in the absence(B) or presence (C) of IBMX and subjected to indirect immunofluorescence with anti-GR, anti-FKBP51, and secondary antibodies labeledwith Alexa 488 or Alexa 546, respectively, and images were analyzed by confocal microscopy. GR is detected in red, FKBP51 is detectedin green, and chromatin is stained by DAPI in blue. Inserts in each panel were magnified. Observed in panel C is that DEXA plus IBMXtreatment caused enrichment of GR (red signal) in the nuclear area limited by the white dotted lines that correspond to NL.

[33]. Several phosphorylation sites are important in the NLdisassembly, including those for the cyclin B1-(CCNB1)-CDC2 complex, PKC and PKA [202, 203]. Therefore, it ispossible that enrichment of FKBP51 and PKA-c𝛼 in the NLmay facilitate its reorganization by phosphorylation of laminsduring adipocyte differentiation.

During the last few years, several studies revealed adramatic and dynamic modulation of the chromatin land-scape during the first hours of adipocyte differentiation[67, 68, 204–206]. These changes coincide with cooperativebinding of early adipogenic transcription factors, includingGR, to enhancers and promoters of many genes and highlevel of chromatin relaxation [68, 205]. However, genessuch as PPAR𝛾 are not transcriptionally activated until latertime points of the adipogenic program, and it has beenproposed that the activation of additional factors and/orsignals is required for their later activation [68]. It canbe speculated that, in spite of chromatin relaxation andthe increased binding of transcription factors at the earlystages of adipogenesis, gene expression is kept controlled byfactors that restrain the transcriptional capacity of complexesalready bound to those sites. When adipogenesis is triggeredFKBP51 translocates to the nucleus; its interaction with GRprogressively increases rendering a GR less transcriptionallyactive [33]. When cells are treated with DEXA in thepresence of IBMX GR has an increased presence in thenuclear rim, area that corresponds to the NL (Figure 2, panelC vs.B), a domain that is also transiently enriched in PKA-c𝛼[33]. Therefore, we hypothesize that FKBP51 “sequesters”GR in the nuclear rim to control its nuclear bioavailability as

shown for the control of AP-1 transcriptional activity uponthe sequestration of c-fos in the NL in an ERK1/2 dependentmanner [207, 208]. Interestingly, it has been shown that GRinteracts in vitro and in vivo with the catalytic subunit ofPKA in a ligand dependent manner and that GR transcriptiondepends on PKA signaling [209]. In this way PKA may playa dual role in the regulation of GR, on one hand, modulatingpositively GR transcriptional capacity [209] and, on the otherhand, restraining it by increasing the nuclear availability ofFKBP51, a known GR negative regulator [104] that possiblymodulates its nuclear distribution in different compartments.It is possible that the presence of FKBP51 in the nucleusmay be critical for the control not only of GR but also forMR at the onset of adipogenesis. Future studies will possiblydemonstrate the existence of other transcription factors thatdo not belong to the NR family that need to be repressed oreven activated by nuclear FKBP51 to keep their transcriptionunder control, at a step of the adipogenic program in whichhigh level of chromatin remodeling takes place.

5. Final Remarks

Undoubtedly during the last decade, great progress has beenaccomplished in the understanding of the complex biologyof the adipose tissue, the pathophysiology of obesity andits participation in the metabolic syndrome. However, manyaspects of the physiology of the adipocyte including howcorticosteroids modulate its biological responses need tobe explored further in depth. Uncovering at the molecular


level on how different fat depots respond to the gluco- andmineralocorticoid stimuli and how corticosteroid receptors,their chaperones and cochaperones, control adipocyte dif-ferentiation will not only enrich our basic knowledge butalso will be key for the design of new therapeutic strategiesfor the treatment of obesity, lipodystrophies, and metabolicproblems associated with these pathologies.

Acknowledgment

The authors are very grateful to Cecilia Galigniana for herassistance in graphics design.

Funding

This work was supported by a grant from Agencia Nacionalde Promoción Científica y Tecnológica (PICT2012-2612 toG.P.P). J.T is a recipient of a postdoctoral fellowship fromCONICET. N.L.C and A.N. are recipients of a doctoralfellowship from CONICET.

References

[1] H. Cao, Adipocytokines in obesity and metabolic disease, JEndocrinol, 220, 47–59, (2014).

[2] M. W. Schwartz and D. Porte Jr., Diabetes, obesity, and thebrain, Science, 307, no. 5708, 375–379, (2005).

[3] J. M. Olefsky, Fat Talks, Liver and Muscle Listen, Cell, 134,no. 6, 914–916, (2008).

[4] M. Das, I. Gabriely, and N. Barzilai, Caloric restriction, bodyfat and ageing in experimental models, Obesity Reviews, 5, no.1, 13–19, (2004).

[5] W. P. Cawthorn, E. L. Scheller, B. S. Learman, S. D. Parlee,B. R. Simon, H. Mori, X. Ning, A. J. Bree, B. Schell, D. T.Broome, S. S. Soliman, J. L. DelProposto, C. N. Lumeng, A.Mitra, S. V. Pandit, K. A. Gallagher, J. D. Miller, V. Krishnan,S. K. Hui, M. A. Bredella, P. K. Fazeli, A. Klibanski, M. C.Horowitz, C. J. Rosen, and O. A. MacDougald, Bone MarrowAdipose Tissue Is an Endocrine Organ that Contributes toIncreased Circulating Adiponectin during Caloric Restriction,Cell Metab 20, 368–375, (2014).

[6] C. Weyer, J. K. Wolford, R. L. Hanson, J. E. Foley, P.A. Tataranni, C. Bogardus, and R. E. Pratley, Subcutaneousabdominal adipocyte size, a predictor of type 2 diabetes, islinked to chromosome 1q21-q23 and is associated with acommon polymorphism in LMNA in Pima Indians, MolecularGenetics and Metabolism, 72, no. 3, 231–238, (2001).

[7] S. P. Weisberg, D. McCann, M. Desai, M. Rosenbaum, R.L. Leibel, and A. W. Ferrante Jr., Obesity is associated withmacrophage accumulation in adipose tissue, Journal of ClinicalInvestigation, 112, no. 12, 1796–1808, (2003).

[8] K. D. Nguyen, Y. Qiu, X. Cui, Y. P. S. Goh, J. Mwangi,T. David, L. Mukundan, F. Brombacher, R. M. Locksley,and A. Chawla, Alternatively activated macrophages producecatecholamines to sustain adaptive thermogenesis,Nature, 480,no. 7375, 104–108, (2011).

[9] E. D. Abel, O. Peroni, J. K. Kim, Y. Kim, O. Boss, E. Hadro, T.Minnemann, G. I. Shulman, and B. B. Kahn, Adipose-selective

targeting of the GLUT4 gene impairs insulin action in muscleand liver, Nature, 409, no. 6821, 729–733, (2001).

[10] H. Masuzaki, J. Paterson, H. Shinyama, N. M. Morton, J. J.Mullins, J. R. Seckl, and J. S. Flier, A transgenic model ofvisceral obesity and the metabolic syndrome, Science, 294, no.5549, 2166–2170, (2001).

[11] C. N. Lumeng, S. M. DeYoung, J. L. Bodzin, and A. R.Saltiel, Increased inflammatory properties of adipose tissuemacrophages recruited during diet-induced obesity, Diabetes,56, no. 1, 16–23, (2007).

[12] C. N. Lumeng, J. B. Delproposto, D. J. Westcott, and A. R.Saltiel, Phenotypic switching of adipose tissue macrophageswith obesity is generated by spatiotemporal differences inmacrophage subtypes,Diabetes, 57, no. 12, 3239–3246, (2008).

[13] C. N. Lumeng and A. R. Saltiel, Inflammatory links betweenobesity and metabolic disease, Journal of Clinical Investiga-tion, 121, no. 6, 2111–2117, (2011).

[14] I. Wernstedt Asterholm, C. Tao, T. S. Morley, Q. A. Wang,F. Delgado-Lopez, Z. V. Wang, and P. E. Scherer, Adipocyteinflammation is essential for healthy adipose tissue expansionand remodeling, Cell Metab 20, 103–118, (2014).

[15] A. Garg and A. K. Agarwal, Lipodystrophies: Disordersof adipose tissue biology, Biochimica et Biophysica Acta -Molecular and Cell Biology of Lipids, 1791, no. 6, 507–513,(2009).

[16] N. Krahmer, R. V. Farese Jr., and T. C. Walther, Balancingthe fat: Lipid droplets and human disease, EMBO MolecularMedicine, 5, no. 7, 905–915, (2013).

[17] H. Hauner, G. Entenmann, M. Wabitsch, D. Gaillard, G.Ailhaud, R. Negrel, and E. F. Pfeiffer, Promoting effect ofglucocorticoids on the differentiation of human adipocyteprecursor cells cultured in a chemically defined medium,Journal of Clinical Investigation, 84, no. 5, 1663–1670, (1989).

[18] D. Gaillard, M. Wabitsch, B. Pipy, and R. Negrel, Control ofterminal differentiation of adipose precursor cells by glucocor-ticoids, Journal of Lipid Research, 32, no. 4, 569–579, (1991).

[19] F. M. Gregoire, C. M. Smas, and H. S. Sul, Understandingadipocyte differentiation, Physiological Reviews, 78, no. 3,783–809, (1998).

[20] C. M. Rondinone, D. Rodbard, and M. E. Baker, Aldos-terone stimulates differentiation of mouse 3T3-L1 cells intoadipocytes, Endocrinology, 132, no. 6, 2421–2426, (1993).

[21] M. Caprio, B. Fève, A. Claës, S. Viengchareun, M. Lombès,and M. Zennaro, Pivotal role of the mineralocorticoid receptorin corticosteroid-induced adipogenesis,FASEB Journal, 21, no.9, 2185–2194, (2007).

[22] S. B. Pedersen,M. Jønler, and B. Richelsen, Characterization ofregional and gender differences in glucocorticoid receptors andlipoprotein lipase activity in human adipose tissue, Journal ofClinical Endocrinology andMetabolism, 78, no. 6, 1354–1359,(1994).

[23] A. J. Peckett, D. C. Wright, and M. C. Riddell, Theeffects of glucocorticoids on adipose tissue lipid metabolism,Metabolism: Clinical and Experimental, 60, no. 11, 1500–1510, (2011).

[24] D. Patsouris, J. G. Neels, W. Q. Fan, P. Li, M. T. A. Nguyen,and J. M. Olefsky, Glucocorticoids and thiazolidinedionesinterfere with adipocyte-mediated macrophage chemotaxis andrecruitment, Journal of Biological Chemistry, 284, no. 45,31223–31235, (2009).


[25] W. B. Pratt, M. D. Galigniana, Y. Morishima, and P. J. M.Murphy, Role of molecular chaperones in steroid receptoraction, Essays in Biochemistry, 40, 41–58, (2004).

[26] D. F. Smith and D. O. Toft, The intersection of steroid recep-tors with molecular chaperones: Observations and questions,Molecular Endocrinology, 22, no. 10, 2229–2240, (2008).

[27] H. D. McKeen, K. McAlpine, A. Valentine, D. J. Quinn, K.McClelland, C. Byrne, M. O’Rourke, S. Young, C. J. Scott, H.O. McCarthy, D. G. Hirst, and T. Robson, A novel FK506-likebinding protein interacts with the glucocorticoid receptor andregulates steroid receptor signaling, Endocrinology, 149, no.11, 5724–5734, (2008).

[28] M. Lee, P. Pramyothin, K. Karastergiou, and S. K. Fried,Deconstructing the roles of glucocorticoids in adipose tissuebiology and the development of central obesity, Biochimica etBiophysica Acta - Molecular Basis of Disease, (2013).

[29] V. Marzolla, A. Armani, M. Zennaro, F. Cinti, C. Mammi,A. Fabbri, G. M. C. Rosano, and M. Caprio, The role ofthe mineralocorticoid receptor in adipocyte biology and fatmetabolism, Molecular and Cellular Endocrinology, 350, no.2, 281–288, (2012).

[30] H. Green and O. Kehinde, An established preadipose cell lineand its differentiation in culture. II. Factors affecting the adiposeconversion, Cell, 5, no. 1, 19–27, (1975).

[31] D. R. Schiwek and G. Loffler, Glucocorticoid hormones con-tribute to the adipogenic activity of human serum, Endocrinol-ogy, 120, no. 2, 469–474, (1987).

[32] M. Fu, T. Sun, A. L. Bookout, M. Downes, R. T. Yu, R. M.Evans, and D. J. Mangelsdorf, A nuclear receptor atlas: 3T3-L1 adipogenesis, Molecular Endocrinology, 19, no. 10, 2437–2450, (2005).

[33] J. Toneatto, S. Guber, N. L. Charo, S. Susperreguy, J.Schwartz, M. D. Galigniana, and G. Piwien-Pilipuk, Dynamicmitochondrial-nuclear redistribution of the immunophilinFKBP51 is regulated by the PKA signaling pathway to controlgene expression during adipocyte differentiation, J Cell Sci 126,5357–5368, (2013).

[34] C. Pantoja, J. T. Huff, and K. R. Yamamoto, Glucocorticoidsignaling defines a novel commitment state during adipogenesisin vitro, Molecular Biology of the Cell, 19, no. 10, 4032–4041,(2008).

[35] J. Hoppmann, N. Perwitz, B. Meier, M. Fasshauer, D.Hadaschik, H. Lehnert, and J. Klein, The balance betweengluco- and mineralo-corticoid action critically determinesinflammatory adipocyte responses, Journal of Endocrinology,204, no. 2, 153–164, (2010).

[36] J. Newell-Price, X. Bertagna, A. B. Grossman, and L. K.Nieman, Cushing’s syndrome, Lancet, 367, no. 9522, 1605–1617, (2006).

[37] N. M. Morton, J. M. Paterson, H. Masuzaki, M. C. Holmes,B. Staels, C. Fievet, B. R. Walker, J. S. Flier, J. J. Mullins,and J. R. Seckl, Novel Adipose Tissue-Mediated Resistanceto Diet-Induced Visceral Obesity in 11β-Hydroxysteroid Dehy-drogenase Type 1-DeficientMice,Diabetes, 53, no. 4, 931–938,(2004).

[38] E. E. Kershaw, N. M. Morton, H. Dhillon, L. Ramage, J.R. Seckl, and J. S. Flier, Adipocyte-specific glucocorticoidinactivation protects against diet-induced obesity,Diabetes, 54,no. 4, 1023–1031, (2005).

[39] M. Caprio, A. Antelmi, G. Chetrite, A. Muscat, C. Mammi,V. Marzolla, A. Fabbri, M. Zennaro, and B. Fève, Antiadi-pogenic effects of the mineralocorticoid receptor antagonist

drospirenone: Potential implications for the treatment ofmetabolic syndrome, Endocrinology, 152, no. 1, 113–125,(2011).

[40] A. Hirata, N. Maeda, A. Hiuge, T. Hibuse, K. Fujita, T.Okada, S. Kihara, T. Funahashi, and I. Shimomura, Blockade ofmineralocorticoid receptor reverses adipocyte dysfunction andinsulin resistance in obese mice, Cardiovascular Research, 84,no. 1, 164–172, (2009).

[41] M. L. Tuck, J. Sowers, L. Dornfeld, G. Kledzik, and M.Maxwell, The effect of weight reduction on blood pressure,plasma renin activity, and plasma aldosterone levels in obesepatients, New England Journal of Medicine, 304, no. 16, 930–933, (1981).

[42] A. P. Rocchini, J. Key, D. Bondie, R. Chico, C. Moorehead,V. Katch, and M. Martin, The effect of weight loss on thesensitivity of blood pressure to sodium inobese adolescents,NewEngland Journal ofMedicine, 321, no. 9, 580–585, (1989).

[43] B. M. Egan, K. Stepniakowski, and T. L. Goodfriend, Reninand aldosterone are high and the hyperinsulinemic effect ofsalt restriction greater in subjects with risk factors clustering,American Journal of Hypertension, 7, no. 10 I, 886–893,(1994).

[44] S. Engeli, J. Böhnke, K. Gorzelniak, J. Janke, P. Schling, M.Bader, F. C. Luft, and A.M. Sharma,Weight loss and the renin-angiotensin-aldosterone system, Hypertension, 45, no. 3, 356–362, (2005).

[45] M. Bochud, J. Nussberger, P. Bovet, M. R. Maillard, R. C.Elston, F. Paccaud, C. Shamlaye, and M. Burnier, Plasmaaldosterone is independently associated with the metabolicsyndrome, Hypertension, 48, no. 2, 239–245, (2006).

[46] M. Ehrhart-Bornstein, V. Lamounier-Zepter, A. Schraven,J. Langenbach, H. S. Willenberg, A. Barthel, H. Hauner,S. M. McCann, W. A. Scherbaum, and S. R. Bornstein,Human adipocytes secrete mineralocorticoid-releasing factors,Proceedings of the National Academy of Sciences of the UnitedStates of America, 100, no. 2, 14211–14216, (2003).

[47] M. Nagase, S. Yoshida, S. Shibata, T. Nagase, T. Gotoda, K.Ando, and T. Fujita, Enhanced aldosterone signaling in theearly nephropathy of rats with metabolic syndrome: Possiblecontribution of fat-derived factors, Journal of the AmericanSociety of Nephrology, 17, no. 12, 3438–3446, (2006).

[48] A. N. D. Cat, A.M. Briones, G. E. Callera, A. Yogi, Y. He, A. C.Montezano, and R. M. Touyz, Adipocyte-derived factors reg-ulate vascular smooth muscle cells through mineralocorticoidand glucocorticoid receptors,Hypertension, 58, no. 3, 479–488,(2011).

[49] A. M. Briones, A. N. D. Cat, G. E. Callera, A. Yogi, D.Burger, Y. He, J. W. Corrêa, A. M. Gagnon, C. E. Gomez-Sanchez, E. P. Gomez-Sanchez, A. Sorisky, T. C. Ooi, M.Ruzicka, K. D. Burns, and R. M. Touyz, Adipocytes producealdosterone through calcineurin-dependent signaling pathways:Implications in diabetes mellitus-associated obesity and vascu-lar dysfunction, Hypertension, 59, no. 5, 1069–1078, (2012).

[50] A. S. Greenstein, K. Khavandi, S. B. Withers, K. Sonoyama, O.Clancy, M. Jeziorska, I. Laing, A. P. Yates, P. W. Pemberton, R.A.Malik, and A.M. Heagerty, Local inflammation and hypoxiaabolish the protective anticontractile properties of perivascularfat in obese patients, Circulation, 119, no. 12, 1661–1670,(2009).

[51] W. T.Wong, X. Y. Tian, A. Xu, C. F. Ng, H. K. Lee, Z. Y. Chen,C. L. Au, X. Yao, and Y. Huang, Angiotensin II type 1 receptor-dependent oxidative stress mediates endothelial dysfunction in


type 2 diabetic mice, Antioxidants and Redox Signaling, 13, no.6, 757–768, (2010).

[52] J. L. Arriza, C. Weinberger, G. Cerelli, T. M. Glaser, B. L.Handelin, D. E. Housman, and R. M. Evans, Cloning of humanmineralocorticoid receptor complementary DNA: Structuraland functional kinship with the glucocorticoid receptor, Sci-ence, 237, no. 4812, 268–275, (1987).

[53] A. Odermatt and D. V. Kratschmar, Tissue-specific modulationof mineralocorticoid receptor function by 11β-hydroxysteroiddehydrogenases: An overview, Molecular and CellularEndocrinology, 350, no. 2, 168–186, (2012).

[54] K. Chapman, M. Holmes, and J. Seckl, 11β-hydroxysteroiddehydrogenases intracellular gate-keepers of tissue glucocor-ticoid action, Physiological Reviews, 93, no. 3, 1139–1206,(2013).

[55] C. R. W. Edwards, D. Burt, M. A. McIntyre, E. R. De Kloet,P. M. Stewart, L. Brett, W. S. Sutanto, and C. Monder,Localisation of 11β-hydroxysteroid dehydrogenase - Tissuespecific protector of the mineralocorticoid receptor, Lancet, 2,no. 8618, 986–989, (1988).

[56] J. W. Funder, P. T. Pearce, R. Smith, and A. I. Smith,Mineralocorticoid action: Target tissue specificity is enzyme,not receptor, mediated, Science, 242, no. 4878, 583–585,(1988).

[57] S. Engeli, J. Böhnke, M. Feldpausch, K. Gorzelniak, U.Heintze, J. Janke, F. C. Luft, and A. M. Sharma, Regulation of11β-HSD genes in human adipose tissue: Influence of centralobesity and weight loss, Obesity Research, 12, no. 1, 9–17,(2004).

[58] K. Kannisto, K. H. Pietiläinen, E. Ehrenborg, A. Rissanen,J. Kaprio, A. Hamsten, and H. Yki-Järvinen, Overexpressionof 11β-hydroxy steroid dehydrogenase-1 in adipose tissueis associated with acquired obesity and features of insulinresistance: Studies in young adult monozygotic twins, Journalof Clinical Endocrinology and Metabolism, 89, no. 9, 4414–4421, (2004).

[59] M. Lee, S. K. Fried, S. S. Mundt, Y. Wang, S. Sullivan,A. Stefanni, B. L. Daugherty, and A. Hermanowski-Vosatka,Depot-specific regulation of the conversion of cortisone tocortisol in human adipose tissue,Obesity, 16, no. 6, 1178–1185,(2008).

[60] G. W. Strain, B. Zumoff, J. Kream, J. J. Strain, J. Levin, and D.Fukushima, Sex difference in the influence of obesity on the 24hr mean plasma concentration of cortisol, Metabolism, 31, no.3, 209–212, (1982).

[61] T. Ljung, G. Holm, P. Friberg, B. Andersson, B. Bengtsson,J. Svensson, M. Dallman, B. McEwen, and P. Björntorp, Theactivity of the hypothalamic-pituitary-adrenal axis and the sym-pathetic nervous system in relation to waist/hip circumferenceratio in men, Obesity Research, 8, no. 7, 487–495, (2000).

[62] S. K. Fried, D. A. Bunkin, and A. S. Greenberg, Omentaland subcutaneous adipose tissues of obese subjects releaseinterleukin-6: Depot difference and regulation by glucocorti-coid, Journal of Clinical Endocrinology and Metabolism, 83,no. 3, 847–850, (1998).

[63] J. M. Bruun, A. S. Lihn, A. K. Madan, S. B. Pedersen, K.M. Schiøtt, J. N. Fain, and B. Richelsen, Higher production ofIL-8 in visceral vs. subcutaneous adipose tissue. Implicationof nonadipose cells in adipose tissue, American Journal ofPhysiology - Endocrinology and Metabolism, 286, no. 1, E8–E13, (2004).

[64] M. Lee, D. Gong, B. F. Burkey, and S. K. Fried, Pathwaysregulated by glucocorticoids in omental and subcutaneoushuman adipose tissues: A microarray study, American Journalof Physiology - Endocrinology and Metabolism, 300, no. 3,E571–E580, (2011).

[65] C. Guo, V. Ricchiuti, B. Q. Lian, T. M. Yao, P. Coutinho, J.R. Romero, J. Li, G. H. Williams, and G. K. Adler, Miner-alocorticoid receptor blockade reverses obesity-related changesin expression of adiponectin, peroxisome proliferator-activatedreceptor-γ, and proinflammatory adipokines, Circulation, 117,no. 17, 2253–2261, (2008).

[66] R. Nielsen, T. Å. Pedersen, D. Hagenbeek, P. Moulos, R.Siersbæk, E. Megens, S. Denissov, M. Børgesen, K. Francoijs,S. Mandrup, and H. G. Stunnenberg, Genome-wide profilingof PPARγ:RXR and RNA polymerase II occupancy revealstemporal activation of distinct metabolic pathways and changesin RXR dimer composition during adipogenesis, Genes andDevelopment, 22, no. 21, 2953–2967, (2008).

[67] R. Siersbfk, R. Nielsen, S. John, M. Sung, S. Baek, A. Loft, G.L. Hager, and S. Mandrup, Extensive chromatin remodellingand establishment of transcription factor hotspots during earlyadipogenesis, EMBO Journal, 30, no. 8, 1459–1472, (2011).

[68] L. K. Miller, J. G. Kral, G. W. Strain, and B. Zumoff,Differential binding of dexamethasone to ammonium sulfateprecipitates of human adipose tissue cytosols, Steroids, 49, no.6, 507–522, (1987).

[69] M. Rebuffe-Scrive, M. Bronnegard, A. Nilsson, J. Eldh, J.-A.Gustafsson, and P. Bjorntorp, Steroid hormone receptors inhuman adipose tissues, Journal of Clinical Endocrinology andMetabolism, 71, no. 5, 1215–1219, (1990).

[70] A. Veilleux, P. Y. Laberge, J. Morency, S. Noël, V. Luu-The,and A. Tchernof, Expression of genes related to glucocorticoidaction in human subcutaneous and omental adipose tissue,Journal of Steroid Biochemistry and Molecular Biology, 122,no. 1-3, 28–34, (2010).

[71] M. R. Yudt and J. A. Cidlowski, Molecular identificationand characterization of A and B forms of the glucocorticoidreceptor, Molecular Endocrinology, 15, no. 7, 1093–1103,(2001).

[72] M. R. Yudt and J. A. Cidlowski, Molecular identification andcharacterization of a and b forms of the glucocorticoid receptor,Mol Endocrinol, 15, 1093–1103, (2001).

[73] R. H. Oakley and J. A. Cidlowski, The biology of theglucocorticoid receptor: new signaling mechanisms in healthand disease, J Allergy Clin Immunol, 132, 1033–1044, (2013).

[74] N. Z. Lu and J. A. Cidlowski, Glucocorticoid receptor isoformsgenerate transcription specificity, Trends in Cell Biology, 16,no. 6, 301–307, (2006).

[75] T. D. Hinds Jr., S. Ramakrishnan, H. A. Cash, L. A.Stechschulte, G. Heinrich, S. M. Najjar, and E. R. Sanchez,Discovery of glucocorticoid receptor-β in mice with a role inmetabolism, Molecular Endocrinology, 24, no. 9, 1715–1727,(2010).

[76] N. Z. Lu and J. A. Cidlowski, Translational regulatory mech-anisms generate N-terminal glucocorticoid receptor isoformswith unique transcriptional target genes, Molecular Cell, 18,no. 3, 331–342, (2005).

[77] N. Z. Lu, J. B. Collins, S. F. Grissom, and J. A. Cidlowski,Selective regulation of bone cell apoptosis by translational iso-forms of the glucocorticoid receptor, Molecular and CellularBiology, 27, no. 20, 7143–7160, (2007).


[78] M.-C. Zennaro, M.-C. Keightley, Y. Kotelevtsev, G. S. Con-way, F. Soubrier, and P. J. Fuller, Human mineralocorticoidreceptor genomic structure and identification of expressedisoforms, Journal of Biological Chemistry, 270, no. 36, 21016–21020, (1995).

[79] L. J. Bloem, C. Guo, and J. H. Pratt, Identification of a splicevariant of the rat and human mineralocorticoid receptor genes,Journal of Steroid Biochemistry andMolecular Biology, 55, no.2, 159–162, (1995).

[80] M. Zhou, C. E. Gomez-Sanchez, and E. P. Gomez-Sanchez,An alternatively spliced rat mineralocorticoid receptor mRNAcausing truncation of the steroid binding domain, Molecularand Cellular Endocrinology, 159, no. 1-2, 125–131, (2000).

[81] M.-C. Zennaro, A. Souque, S. Viengchareun, E. Poisson, andM. Lombès, A new human MR splice variant is a ligand-independent transactivator modulating corticosteroid action,Molecular Endocrinology, 15, no. 9, 1586–1598, (2001).

[82] L. Pascual-Le Tallec, C. Demange, and M. Lombès, Humanmineralocorticoid receptor A and B protein forms producedby alternative translation sites display different transcriptionalactivities,European Journal of Endocrinology, 150, no. 4, 585–590, (2004).

[83] Z. Wang, J. Frederick, and M. J. Garabedian, Deciphering thephosphorylation ”code” of the glucocorticoid receptor in vivo,Journal of Biological Chemistry, 277, no. 29, 26573–26580,(2002).

[84] I. M. E. Beck, W. V. Berghe, L. Vermeulen, K. R. Yamamoto,G. Haegeman, and K. De Bosscher, Crosstalk in inflammation:The interplay of glucocorticoid receptor-basedmechanisms andkinases and phosphatases, Endocrine Reviews, 30, no. 7, 830–882, (2009).

[85] A. J. Galliher-Beckley and J. A. Cidlowski, Emerging roles ofglucocorticoid receptor phosphorylation in modulating gluco-corticoid hormone action in health and disease, IUBMB Life,61, no. 10, 979–986, (2009).

[86] C. Avenant, K. Ronacher, E. Stubsrud, A. Louw, and J.P. Hapgood, Role of ligand-dependent GR phosphorylationand half-life in determination of ligand-specific transcriptionalactivity, Molecular and Cellular Endocrinology, 327, no. 1-2,72–88, (2010).

[87] L. A. Stechschulte, T. D. Hinds, , S. S. Ghanem, W. Shou,S. M. Najjar, and E. R. Sanchez, FKBP51 ReciprocallyRegulates GRalpha and PPARgamma Activation via the Akt-p38 Pathway, Mol Endocrinol, (2014)., me20141023.

[88] S. Tian, H. Poukka, J. J. Palvimo, and O. A. Jänne, Smallubiquitin-related modifier-1 (SUMO-1) modification of theglucocorticoid receptor, Biochemical Journal, 367, no. 3, 907–911, (2002).

[89] S. Holmstrom, M. E. Van Antwerp, and J. A. Iñiguez-Lluhí,Direct and distinguishable inhibitory roles for SUMO isoformsin the control of transcriptional synergy, Proceedings of theNational Academy of Sciences of the United States of America,100, no. 26, 15758–15763, (2003).

[90] S. R. Holmstrom, S. Chupreta, A. Y. So, and J. A. Iñiguez-Lluhí, SUMO-mediated inhibition of glucocorticoid receptorsynergistic activity depends on stable assembly at the promoterbut not on DAXX, Molecular Endocrinology, 22, no. 9, 2061–2075, (2008).

[91] J. Druker, A. C. Liberman, M. Antunica-Noguerol, J. Gerez,M. Paez-Pereda, T. Rein, J. A. Iñiguez-Lluhí, F. Holsboer, and

E. Arzta, RSUME enhances glucocorticoid receptor SUMOy-lation and transcriptional activity, Molecular and CellularBiology, 33, no. 11, 2116–2127, (2013).

[92] V. Paakinaho, S. Kaikkonen, H. Makkonen, V. Benes, and J.J. Palvimo, SUMOylation regulates the chromatin occupancyand anti-proliferative gene programs of glucocorticoid receptor,Nucleic Acids Res 42, 1575–1592, (2014).

[93] A. D. Wallace and J. A. Cidlowski, Proteasome-mediatedGlucocorticoid Receptor Degradation Restricts TranscriptionalSignaling byGlucocorticoids, Journal of Biological Chemistry,276, no. 46, 42714–42721, (2001).


[95] K. Ito, S. Yamamura, S. Essilfie-Quaye, B. Cosio, M. Ito, P.J. Barnes, and I. M. Adcock, Histone deacetylase 2-mediateddeacetylation of the glucocorticoid receptor enables NF-κBsuppression, Journal of Experimental Medicine, 203, no. 1, 7–13, (2006).

[96] E. S. Alnemri, A. B. Maksymowych, N. M. Robertson, andG. Litwack, Overexpression and characterization of the humanmineralocorticoid receptor, Journal of Biological Chemistry,266, no. 27, 18072–18081, (1991).

[97] M. D. Galigniana, Native rat kidney mineralocorticoid receptoris a phosphoprotein whose transformation to a DNA-bindingform is induced by phosphatases, Biochemical Journal, 333,no. 3, 555–563, (1998).

[98] G. Piwien-Pilipuk and M. D. Galigniana, Tautomycin inhibitsphosphatase-dependent transformation of the rat kidney miner-alocorticoid receptor, Molecular and Cellular Endocrinology,144, no. 1-2, 119–130, (1998).

[99] C. Massaad, N. Houard, M. Lombès, and R. Barouki, Modu-lation of human mineralocorticoid receptor function by proteinkinase A, Molecular Endocrinology, 13, no. 1, 57–65, (1999).

[100] H. Lee, D. Lee, H. Cho, S. Kim, Y. Iwasaki, and I. K. Kim, His-tone deacetylase inhibition attenuates transcriptional activity ofmineralocorticoid receptor through its acetylation and preventsdevelopment of hypertension,Circulation Research, 112, no. 7,1004–1012, (2013).

[101] L. P. Tallec, O. Kirsh, M. Lecomte, S. Viengchareun, M.Zennaro, A. Dejean, and M. Lombès, Protein Inhibitor ofActivated Signal Transducer and Activator of Transcription 1Interacts with the N-Terminal Domain of MineralocorticoidReceptor and Represses Its Transcriptional Activity: Impli-cation of Small Ubiquitin-Related Modifier 1 Modification,Molecular Endocrinology, 17, no. 12, 2529–2542, (2003).



[104] G. M. Wochnik, J. Rüegg, G. A. Abel, U. Schmidt, F. Holsboer,and T. Rein, FK506-binding proteins 51 and 52 differentially


regulate dynein interaction and nuclear translocation of the glu-cocorticoid receptor in mammalian cells, Journal of BiologicalChemistry, 280, no. 6, 4609–4616, (2005).


[106] M. D. Galigniana, A. G. Erlejman, M. Monte, C. Gomez-Sanchez, and G. Piwien-Pilipuk, The hsp90-FKBP52 complexlinks the mineralocorticoid receptor to motor proteins andpersists bound to the receptor in early nuclear events,Molecularand Cellular Biology, 30, no. 5, 1285–1298, (2010).

[107] M. D. Galigniana, J. L. Scruggs, J. Herrington, M. J. Welsh,C. Carter-Su, P. R. Housley, and W. B. Pratt, Heat shockprotein 90-dependent (geldanamycin-inhibited) movement ofthe glucocorticoid receptor through the cytoplasm to thenucleus requires intact cytoskeleton,Molecular Endocrinology,12, no. 12, 1903–1913, (1998).

[108] C. Grossmann, S. Ruhs, L. Langenbruch, S. Mildenberger,N. Strätz, K. Schumann, and M. Gekle, Nuclear shuttlingprecedes dimerization in mineralocorticoid receptor signaling,Chemistry and Biology, 19, no. 6, 742–751, (2012).

[109] M. D. Galigniana, P. C. Echeverría, A. G. Erlejman, andG. Piwien-Pilipuk, Role of molecular chaperones and TPR-domain proteins in the cytoplasmic transport of steroid recep-tors and their passage through the nuclear pore, Nucleus, 1, no.4, 299–308, (2010).

[110] P. C. Echeverría, G. Mazaira, A. Erlejman, C. Gomez-Sanchez,G. P. Pilipuk, and M. D. Galigniana, Nuclear import of theglucocorticoid receptor-hsp90 complex through the nuclearpore complex is mediated by its interaction with Nup62 andimportin β, Molecular and Cellular Biology, 29, no. 17, 4788–4797, (2009).

[111] M. Tanaka, M. Nishi, M. Morimoto, T. Sugimoto, and M.Kawata, Yellow fluorescent protein-tagged and cyan fluores-cent protein-tagged imaging analysis of glucocorticoid receptorand importins in single living cells, Endocrinology, 144, no. 9,4070–4079, (2003).

[112] S. Jäkel, J. Mingot, P. Schwarzmaier, E. Hartmann, and D. Gör-lich, Importins fulfil a dual function as nuclear import receptorsand cytoplasmic chaperones for exposed basic domains, EMBOJournal, 21, no. 3, 377–386, (2002).

[113] G. P. Pilipuk, G. P. Vinson, C. G. Sanchez, and M. D. Galig-niana, Evidence for NL1-independent nuclear translocation ofthe mineralocorticoid receptor, Biochemistry, 46, no. 5, 1389–1397, (2007).

[114] W. J.Welch and J. R. Feramisco, Purification of themajormam-malian heat shock proteins., Journal of Biological Chemistry,257, no. 24, 14949–14959, (1982).

[115] B. T. Lai, N. W. Chin, A. E. Stanek, W. Keh, and K. W. Lanks,Quantitation and intracellular localization of the 85K heatshock protein by using monoclonal and polyclonal antibodies,Molecular and Cellular Biology, 4, no. 12, 2802–2810, (1984).

[116] E. A. A. Nollen and R. I. Morimoto, Chaperoning signalingpathways: Molecular chaperones as stress-sensing ’heat shock’proteins, Journal of Cell Science, 115, no. 14, 2809–2816,(2002).

[117] M. Taipale, D. F. Jarosz, and S. Lindquist, HSP90 at the hubof protein homeostasis: Emerging mechanistic insights, NatureReviews Molecular Cell Biology, 11, no. 7, 515–528, (2010).

[118] M. Taipale, I. Krykbaeva, M. Koeva, C. Kayatekin, K. D.Westover, G. I. Karras, and S. Lindquist, Quantitative analysisof Hsp90-client interactions reveals principles of substraterecognition, Cell, 150, no. 5, 987–1001, (2012).

[119] A. G. Erlejman, M. Lagadari, J. Toneatto, G. Piwien-Pilipuk,and M. D. Galigniana, Regulatory role of the 90-kDa-heat-shock protein (Hsp90) and associated factors on gene expres-sion, Biochim Biophys Acta, 1839, 71–87, (2014).

[120] M. T. Nguyen, P. Csermely, and C. Soti, Hsp90 chaperonesPPARgamma and regulates differentiation and survival of 3T3-L1 adipocytes, Cell Death Differ, 20, 1654–1663, (2013).

[121] Y. He, Y. Li, S. Zhang, B. Perry, T. Zhao, Y. Wang, andC. Sun, Radicicol, a heat shock protein 90 inhibitor, inhibitsdifferentiation and adipogenesis in 3T3-L1 preadipocytes,Biochemical and Biophysical Research Communications, 436,no. 2, 169–174, (2013).

[122] S. Desarzens, W. H. Liao, C. Mammi, M. Caprio, and N.Faresse, Hsp90 blockers inhibit adipocyte differentiation andfat mass accumulation, PLoS One, 9, (2014)., e94127.

[123] V. C. H. da Silva and C. H. I. Ramos, The network interactionof the human cytosolic 90kDa heat shock protein Hsp90: Atarget for cancer therapeutics, Journal of Proteomics, 75, no.10, 2790–2802, (2012).

[124] R. Sawarkar, C. Sievers, and R. Paro, Hsp90 globally tar-gets paused RNA polymerase to regulate gene expression inresponse to environmental stimuli, Cell, 149, no. 4, 807–818,(2012).


[126] F. Pirkl and J. Buchner, Functional analysis of the Hsp90-associated human peptidyl prolyl cis/trans isomerases FKBP51,FKBP52 and Cyp40, Journal of Molecular Biology, 308, no. 4,795–806, (2001).

[127] D. L. Riggs, P. J. Roberts, S. C. Chirillo, J. Cheung-Flynn,V. Prapapanich, T. Ratajczak, R. Gaber, D. Picard, and D. F.Smith, The Hsp90-binding peptidylprolyl isomerase FKBP52potentiates glucocorticoid signaling in vivo, EMBO Journal,22, no. 5, 1158–1167, (2003).

[128] W. Yeh, T. Li, B. E. Bierer, and S. L. McKnight, Identificationand characterization of an immunophilin expressed during theclonal expansion phase of adipocyte differentiation, Proceed-ings of the National Academy of Sciences of the United Statesof America, 92, no. 24, 11081–11085, (1995).

[129] L. A. Stechschulte, T. D. Hinds, , S. S. Khuder, W. Shou,S. M. Najjar, and E. R. Sanchez, FKBP51 Controls CellularAdipogenesis Through p38 Kinase-mediated Phosphorylationof GRalpha and PPARgamma, Mol Endocrinol, (2014).,me20141022.

[130] M. Warrier, T. D. Hinds Jr., K. J. Ledford, H. A. Cash,P. R. Patel, T. A. Bowman, L. A. Stechschulte, W. Yong,W. Shou, S. M. Najjar, and E. R. Sanchez, Susceptibility todiet-induced hepatic steatosis and glucocorticoid resistance inFK506-binding protein 52-deficient mice, Endocrinology, 151,no. 7, 3225–3236, (2010).

[131] J. C. O’Leary III, S. Dharia, L. J. Blair, S. Brady, A. G. Johnson,M. Peters, J. Cheung-Flynn, M. B. Cox, G. de Erausquin, E. J.Weeber, U. K. Jinwal, and C. A. Dickey, A new anti-depressivestrategy for the elderly: Ablation of FKBP5/FKBP51, PLoSONE, 6, no. 9, Article ID e24840, (2011).

[132] C. Touma, N. C. Gassen, L. Herrmann, J. Cheung-Flynn, D.R. Bll, I. A. Ionescu, J. Heinzmann, A. Knapman, A. Siebertz,


A. Depping, J. Hartmann, F. Hausch, M. V. Schmidt, F.Holsboer, M. Ising, M. B. Cox, U. Schmidt, and T. Rein, FK506binding protein 5 shapes stress responsiveness: Modulationof neuroendocrine reactivity and coping behavior, BiologicalPsychiatry, 70, no. 10, 928–936, (2011).

[133] J. Hartmann, K. V. Wagner, C. Liebl, S. H. Scharf, X. Wang,M.Wolf, F. Hausch, T. Rein, U. Schmidt, C. Touma, J. Cheung-Flynn, M. B. Cox, D. F. Smith, F. Holsboer, M. B. Müller,and M. V. Schmidt, The involvement of FK506-binding protein51 (FKBP5) in the behavioral and neuroendocrine effects ofchronic social defeat stress, Neuropharmacology, 62, no. 1,332–339, (2012).

[134] G. Balsevich, A. Uribe, K. V. Wagner, J. Hartmann, S.Santarelli, C. Labermaier, and M. V. Schmidt, Interplaybetween diet-induced obesity and chronic stress in mice:potential role of FKBP51, J Endocrinol, 222, 15–26, (2014).

[135] K. L. K. Tamashiro, Metabolic syndrome: Links to social stressand socioeconomic status, Annals of the New York Academy ofSciences, 1231, no. 1, 46–55, (2011).

[136] J. Cheung-Flynn, V. Prapapanich, M. B. Cox, D. L. Riggs,C. Suarez-Quian, and D. F. Smith, Physiological role forthe cochaperone FKBP52 in androgen receptor signaling,Molecular Endocrinology, 19, no. 6, 1654–1666, (2005).

[137] W. Yong, Z. Yang, S. Periyasamy, H. Chen, S. Yucel, W.Li, L. Y. Lin, I. M. Wolf, M. J. Cohn, L. S. Baskin, E. R.Sánchez, and W. Shou, Essential role for co-chaperone Fkbp52but not Fkbp51 in androgen receptor-mediated signaling andphysiology, Journal of Biological Chemistry, 282, no. 7, 5026–5036, (2007).

[138] L. I. Gallo, M. Lagadari, G. Piwien-Pilipuk, and M. D.Galigniana, The 90-kDa heat-shock protein (Hsp90)-bindingimmunophilin FKBP51 is a mitochondrial protein that translo-cates to the nucleus to protect cells against oxidative stress,Journal of Biological Chemistry, 286, no. 34, 30152–30160,(2011).

[139] E. D. Rosen and O. A. MacDougald, Adipocyte differentiationfrom the inside out, Nature Reviews Molecular Cell Biology, 7,no. 12, 885–896, (2006).

[140] J. E. B. Reusch, L. A. Colton, and D. J. Klemm, CREBactivation induces adipogenesis in 3T3-L1 cells,Molecular andCellular Biology, 20, no. 3, 1008–1020, (2000).

[141] R. K. Petersen, L. Madsen, L. M. Pedersen, P. Hallenborg,H. Hagland, K. Viste, S. O. Døskeland, and K. Kristiansen,Cyclic AMP (cAMP)-mediated stimulation of adipocyte differ-entiation requires the synergistic action of Epac- and cAMP-dependent protein kinase-dependent processes, Molecular andCellular Biology, 28, no. 11, 3804–3816, (2008).

[142] C. N. Martini, M. V. Plaza, and M. D. C. Vila, PKA-dependentand independent cAMP signaling in 3T3-L1 fibroblasts differ-entiation,Molecular and Cellular Endocrinology, 298, no. 1-2,42–47, (2009).

[143] H. Xiao, S. E. LeBlanc, Q. Wu, S. Konda, N. Salma, C. G.A. Marfella, Y. Ohkawa, and A. N. Imbalzano, Chromatinaccessibility and transcription factor binding at the PPARγ2promoter during adipogenesis is protein kinase A-dependent,Journal of Cellular Physiology, 226, no. 1, 86–93, (2011).

[144] G. Vassaux, D. Gaillard, G. Ailhaud, and R. Négrel, Prosta-cyclin is a specific effector of adipose cell differentiation: itsdual role as a cAMP- and Ca2+-elevating agent, Journal ofBiological Chemistry, 267, no. 16, 11092–11097, (1992).

[145] M. D. Mitchell, F. D. Lytton, and L. Varticovski, Paradoxicalstimulation of both lipocortin and prostaglandin production

in human amnion cells by dexamethasone, Biochemical andBiophysical Research Communications, 151, no. 1, 137–141,(1988).

[146] F. Hullin, P. Raynal, J. M. F. Ragab-Thomas, J. Fauvel, andH. Chap, Effect of dexamethasone on prostaglandin synthesisand on lipocortin status in human endothelial cells. Inhibitionof prostaglandin I2 synthesis occurring without alteration ofarachidonic acid liberation and of lipocortin synthesis, Journalof Biological Chemistry, 264, no. 6, 3506–3513, (1989).

[147] F. Massiera, P. Saint-Marc, J. Seydoux, T. Murata, T.Kobayashi, S. Narumiya, P. Guesnet, E. Amri, R. Negrel,and G. Ailhaud, Arachidonic acid and prostacyclin signalingpromote adipose tissue development: A human health concern?Journal of Lipid Research, 44, no. 2, 271–279, (2003).

[148] E. Baus, F. Van Laethem, F. Andris, S. Rolin, J. Urbain, andO. Leo, Dexamethasone increases intracellular cyclic AMPconcentration in murine T lymphocyte cell lines, Steroids, 66,no. 1, 39–47, (2001).

[149] M. O. Aksoy, I. A. Mardini, Y. Yang, W. Bin, S. Zhou, and S.G. Kelsen, Glucocorticoid effects on the β-adrenergic receptor-adenylyl cyclase system of human airway epithelium, Journalof Allergy and Clinical Immunology, 109, no. 3, 491–497,(2002).

[150] H. Pei, L. Li, B. L. Fridley, G. D. Jenkins, K. R. Kalari,W. Lingle, G. Petersen, Z. Lou, and L. Wang, FKBP51Affects Cancer Cell Response to Chemotherapy by NegativelyRegulating Akt, Cancer Cell, 16, no. 3, 259–266, (2009).

[151] E. Hu, J. B. Kim, P. Sarraf, and B. M. Spiegelman, Inhibition ofadipogenesis through MAP kinase-mediated phosphorylationof PPARγ, Science, 274, no. 5295, 2100–2103, (1996).

[152] M. Adams, M. J. Reginato, D. Shao, M. A. Lazar, andV. K. Chatterjee, Transcriptional activation by peroxisomeproliferator-activated receptor γ is inhibited by phosphorylationat a consensus mitogen-activated protein kinase site, Journal ofBiological Chemistry, 272, no. 8, 5128–5132, (1997).

[153] H. S. Camp and S. R. Tafuri, Regulation of peroxisomeproliferator-activated receptor γ activity by mitogen-activatedprotein kinase, Journal of Biological Chemistry, 272, no. 16,10811–10816, (1997).

[154] M. Aouadi, K. Laurent, M. Prot, Y. Le Marchand-Brustel,B. Binétruy, and F. Bost, Inhibition of p38MAPK increasesadipogenesis from embryonic to adult stages, Diabetes, 55, no.2, 281–289, (2006).

[155] A. L. Miller, M. S. Webb, A. J. Copik, Y. Wang, B. H. Johnson,R. Kumar, and E. B. Thompson, p38 mitogen-activated proteinkinase (MAPK) is a key mediator in glucocorticoid-inducedapoptosis of lymphoid cells: Correlation between p38 MAPKactivation and site-specific phosphorylation of the human glu-cocorticoid receptor at serine 211, Molecular Endocrinology,19, no. 6, 1569–1583, (2005).

[156] J. A. Engelman, M. P. Lisanti, and P. E. Scherer, Specificinhibitors of p38 mitogen-activated protein kinase block 3T3-L1 adipogenesis, Journal of Biological Chemistry, 273, no. 48,32111–32120, (1999).

[157] J. A. Engelman, A. H. Berg, R. Y. Lewis, A. Lin, M. P. Lisanti,and P. E. Scherer, Constitutively active mitogen-activated pro-tein kinase kinase 6 (MKK6) or salicylate induces spontaneous3T3-L1 adipogenesis, Journal of Biological Chemistry, 274,no. 50, 35630–35638, (1999).

[158] K. Hata, R. Nishimura, F. Ikeda, K. Yamashita, T. Matsubara,T. Nokubi, and T. Yoneda, Differential roles of Smad1 andp38 kinase in regulation of peroxisome proliferator-activating


receptor γ during bone morphogenetic protein 2-induced adi-pogenesis, Molecular Biology of the Cell, 14, no. 2, 545–555,(2003).

[159] X. Peng, P. Xu, M. Chen, A. Hahn-Windgassen, J. Skeen,J. Jacobs, D. Sundararajan, W. S. Chen, S. E. Crawford, K.G. Coleman, and N. Hay, Dwarfism, impaired skin develop-ment, skeletal muscle atrophy, delayed bone development, andimpeded adipogenesis in mice lacking Akt1 and Akt2, Genesand Development, 17, no. 11, 1352–1365, (2003).

[160] R. Magun, B. M. T. Burgering, P. J. Coffer, D. Pardasani, Y.Lin, J. Chabot, and A. Sorisky, Expression of a constitutivelyactivated form of protein kinase B (c- Akt) in 3T3-L1 preadi-pose cells causes spontaneous differentiation, Endocrinology,137, no. 8, 3590–3593, (1996).

[161] J. Nakae, T. Kitamura, Y. Kitamura, W. H. Biggs III, K. C.Arden, and D. Accili, The forkhead transcription factor Fox01regulates adipocyte differentiation, Developmental Cell, 4, no.1, 119–129, (2003).

[162] C. Wolfrum, D. Q. Shih, S. Kuwajima, A. W. Norris, C. R.Kahn, and M. Stoffel, Role of Foxa-2 in adipocyte metabolismand differentiation, Journal of Clinical Investigation, 112, no.3, 345–356, (2003).

[163] R. Menghini, V. Marchetti, M. Cardellini, M. L. Hribal, A.Mauriello, D. Lauro, P. Sbraccia, R. Lauro, and M. Federici,Phosphorylation of GATA2 by akt increases adipose tissue dif-ferentiation and reduces adipose tissue-related inflammation: Anovel pathway linking obesity to atherosclerosis, Circulation,111, no. 15, 1946–1953, (2005).

[164] C. Y. Ho and J. Lammerding, Lamins at a glance, Journal ofCell Science, 125, no. 9, 2087–2093, (2012).

[165] J. A. Nickerson, Experimental observations of a nuclear matrix,Journal of Cell Science, 114, no. 3, 463–474, (2001).

[166] T. Cremer and V. Zakhartchenko, Nuclear architecture indevelopmental biology and cell specialisation, Reproduction,Fertility and Development, 23, no. 1, 94–106, (2011).

[167] D. L. Spector, Nuclear domains, Journal of Cell Science, 114,no. 16, 2891–2893, (2001).

[168] I. Chung, S. Osterwald, K. I. Deeg, and K. Rippe, PMLbody meets telomere: the beginning of an ALTernate ending?Nucleus (Austin, Tex.), 3, no. 3, 263–275, (2012).

[169] H. Tanabe, S. Müller, M. Neusser, J. Von Hase, E. Calcagno,M. Cremer, I. Solovei, C. Cremer, and T. Cremer, Evolutionaryconservation of chromosome territory arrangements in cellnuclei from higher primates, Proceedings of the NationalAcademy of Sciences of the United States of America, 99, no.7, 4424–4429, (2002).

[170] D. Gerlich, J. Beaudouin, B. Kalbfuss, N. Daigle, R. Eils,and J. Ellenberg, Global chromosome positions are transmittedthrough mitosis in mammalian cells, Cell, 112, no. 6, 751–764,(2003).

[171] D. Koehler, V. Zakhartchenko, L. Froenicke, G. Stone, R.Stanyon, E. Wolf, T. Cremer, and A. Brero, Changes ofhigher order chromatin arrangements during major genomeactivation in bovine preimplantation embryos, ExperimentalCell Research, 315, no. 12, 2053–2063, (2009).

[172] I. Solovei, M. Kreysing, C. Lanctôt, S. Kösem, L. Peichl, T.Cremer, J. Guck, and B. Joffe, Nuclear Architecture of RodPhotoreceptor Cells Adapts to Vision inMammalian Evolution,Cell, 137, no. 2, 356–368, (2009).

[173] M. Kuroda, H. Tanabe, K. Yoshida, K. Oikawa, A. Saito, T.Kiyuna, H. Mizusawa, and K. Mukai, Alteration of chromo-some positioning during adipocyte differentiation, Journal ofCell Science, 117, no. 24, 5897–5903, (2004).

[174] I. Szczerbal, H. A. Foster, and J. M. Bridger, The spatial reposi-tioning of adipogenesis genes is correlatedwith their expressionstatus in a porcine mesenchymal stem cell adipogenesis modelsystem, Chromosoma, 118, no. 5, 647–663, (2009).

[175] K. E. Brown, S. S. Guest, S. T. Smale, K. Hahm, M.Merkenschlager, and A. G. Fisher, Association of transcrip-tionally silent genes with Ikaros complexes at centromericheterochromatin, Cell, 91, no. 6, 845–854, (1997).

[176] K. E. Brown, J. Baxter, D. Graf, M. Merkenschlager, and A.G. Fisher, Dynamic repositioning of genes in the nucleus oflymphocytes preparing for cell division, Molecular Cell, 3, no.2, 207–217, (1999).

[177] E. V. Volpi, E. Chevret, T. Jones, R. Vatcheva, J. Williamson,S. Beck, R. D. Campbell, M. Goldsworthy, S. H. Powis, J.Ragoussis, J. Trowsdale, and D. Sheer, Large-scale chromatinorganization of the major histocompatibility complex and otherregions of human chromosome 6 and its response to interferonin interphase nuclei, Journal of Cell Science, 113, no. 9, 1565–1576, (2000).

[178] S. T. Kosak, J. A. Skok, K. L. Medina, R. Riblet, M. M.Le Beau, A. G. Fisher, and H. Singh, Subnuclear com-partmentalization of immunoglobulin loci during lymphocytedevelopment, Science, 296, no. 5565, 158–162, (2002).

[179] A. Taddei, G. Van Houwe, F. Hediger, V. Kalck, F. Cubizolles,H. Schober, and S. M. Gasser, Nuclear pore association confersoptimal expression levels for an inducible yeast gene, Nature,441, no. 7094, 774–778, (2006).

[180] T. Sexton, H. Schober, P. Fraser, and S. M. Gasser, Generegulation through nuclear organization, Nature Structural andMolecular Biology, 14, no. 11, 1049–1055, (2007).

[181] P.Meister, B. D. Towbin, B. L. Pike, A. Ponti, and S.M. Gasser,The spatial dynamics of tissue-specific promoters during C.elegans development, Genes and Development, 24, no. 8, 766–782, (2010).

[182] W. A. Bickmore and B. Van Steensel, Genome architecture:Domain organization of interphase chromosomes, Cell, 152,no. 6, 1270–1284, (2013).

[183] D. W. Fawcett, On the occurrence of a fibrous lamina onthe inner aspect of the nuclear envelope in certain cells ofvertebrates., American Journal of Anatomy, 119, no. 1, 129–145, (1966).

[184] G. Patrizi and M. Poger, The ultrastructure of the nuclearperiphery. The Zonula Nucleum Limitans, Journal of Ultra-sructure Research, 17, no. 1-2, 127–136, (1967).

[185] K. L. Wilson and J. M. Berk, The nuclear envelope at a glance,Journal of Cell Science, 123, no. 12, 1973–1978, (2010).

[186] T. Shimi, V. Butin-Israeli, and R. D. Goldman, The functionsof the nuclear envelope in mediating the molecular crosstalkbetween the nucleus and the cytoplasm,Current Opinion in CellBiology, 24, no. 1, 71–78, (2012).

[187] F. D. McKeon, M. W. Kirschner, and D. Caput, Homologies inboth primary and secondary structure between nuclear envelopeand intermediate filament proteins,Nature, 319, no. 6053, 463–468, (1986).

[188] T. Dechat, K. Pfleghaar, K. Sengupta, T. Shimi, D. K.Shumaker, L. Solimando, and R. D. Goldman, Nuclear lamins:Major factors in the structural organization and function of the


nucleus and chromatin, Genes and Development, 22, no. 7,832–853, (2008).

[189] T. Shimi, K. Pfleghaar, S. Kojima, C. Pack, I. Solovei, A.E. Goldman, S. A. Adam, D. K. Shumaker, M. Kinjo, T.Cremer, and R. D. Goldman, The A- and B-type nuclear laminnetworks: Microdomains involved in chromatin organizationand transcription, Genes and Development, 22, no. 24, 3409–3421, (2008).

[190] H. J. Worman and G. Bonne, ”Laminopathies”: A widespectrum of human diseases, Experimental Cell Research, 313,no. 10, 2121–2133, (2007).

[191] A. Muchir, G. Bonne, A. J. Van Der Kool, M. Van Meegen,F. Baas, P. A. Bolhuis, M. De Visser, and K. Schwartz,Identification of mutations in the gene encoding lamins A/Cin autosomal dominant limb girdle muscular dystrophy withatrioventricular conduction disturbances (LGMD1B), HumanMolecular Genetics, 9, no. 9, 1453–1459, (2000).

[192] C. Vigouroux, M. Auclair, E. Dubosclard, M. Pouchelet,J. Capeau, J. Courvalin, and B. Buendia, Nuclear envelopedisorganization in fibroblasts from lipodystrophic patients withheterozygous R482Q/W mutations in the lamin A/C gene,Journal of Cell Science, 114, no. 24, 4459–4468, (2001).

[193] A. Muchir, B. G. Van Engelen, M. Lammens, J. M. Mislow,E. McNally, K. Schwartz, and G. Bonne, Nuclear envelopealterations in fibroblasts from LGMD1B patients carryingnonsense Y259X heterozygous or homozygous mutation inlamin A/C gene, Experimental Cell Research, 291, no. 2, 352–362, (2003).

[194] A. Muchir, J. Medioni, M. Laluc, C. Massart, T. Arimura, A.J. Van Der Kooi, I. Desguerre, M. Mayer, X. Ferrer, S. Briault,M. Hirano, J. Worman, A. Mallet, M. Wehnert, K. Schwartz,and G. Bonne, Nuclear envelope alterations in fibroblasts frompatients with muscular dystrophy, cardiomyopathy, and partiallipodystrophy carrying lamin A/C gene mutations, Muscle andNerve, 30, no. 4, 444–450, (2004).

[195] G. Novelli, A. Muchir, F. Sangiuolo, A. Helbling-Leclerc, M.R. D’Apice, C. Massart, F. Capon, P. Sbraccia, M. Federici, R.Lauro, C. Tudisco, R. Pallotta, G. Scarano, B. Dallapiccola, L.Merlini, and G. Bonne, Mandibuloacral dysplasia is caused bya mutation in LMNA-encoding lamin A/C, American Journalof Human Genetics, 71, no. 2, 426–431, (2002).

[196] F. Caux, E. Dubosclard, O. Lascols, B. Buendia, O. Chazouil-lères, A. Cohen, J.-C. Courvalin, L. Laroche, J. Capeau, C.Vigouroux, and S. Christin-Maitre, A new clinical conditionlinked to a novel mutation in lamins A and C with generalizedlipoatrophy, insulin-resistant diabetes, disseminated leukome-lanodermic papules, liver steatosis, and cardiomyopathy, Jour-nal of Clinical Endocrinology andMetabolism, 88, no. 3, 1006–1013, (2003).

[197] H. Cao and R. A. Hegele, LMNA is mutated in Hutchinson-Gilford progeria (MIM 176670) but not in Wiedemann-Rautenstrauch progeroid syndrome (MIM 264090), Journal ofHuman Genetics, 48, no. 5, 271–274, (2003).

[198] A. De Sandre-Giovannoli, R. Bernard, P. Cau, C. Navarro, J.Amiel, I. Boccaccio, S. Lyonnet, C. L. Stewart, A. Munnich,M. LeMerrer, and N. Lévy, Lamin A truncation in Hutchinson-Gilford progeria, Science, 300, no. 5628, p. 2055, (2003).

[199] M. Eriksson, W. T. Brown, L. B. Gordon, M. W. Glynn, J.Singer, L. Scott, M. R. Erdos, C. M. Robbins, T. Y. Moses,P. Berglund, A. Dutra, E. Pak, S. Durkin, A. B. Csoka, M.Boehnke, T. W. Glover, and F. S. Collins, Recurrent de novopoint mutations in lamin A cause Hutchinson-Gilford progeriasyndrome, Nature, 423, no. 6937, 293–298, (2003).

[200] L. Chen, L. Lee, B. A. Kudlow, H. G. Dos Santos, O. Sletvold,Y. Shafeghati, E. G. Botha, A. Garg, N. B. Hanson, G. M.Martin, I. S. Mian, B. K. Kennedy, and J. Oshima, LMNAmutations in atypical Werner’s syndrome, Lancet, 362, no.9382, 440–445, (2003).

[201] V. L. R. M. Verstraeten, J. Renes, F. C. S. Ramaekers,M. Kamps, H. J. Kuijpers, F. Verheyen, M. Wabitsch, P.M. Steijlen, M. A. M. Van Steensel, and J. L. V. Broers,Reorganization of the nuclear lamina and cytoskeleton inadipogenesis, Histochemistry and Cell Biology, 135, no. 3,251–261, (2011).

[202] M. A. D’Angelo and M. W. Hetzer, The role of the nuclearenvelope in cellular organization, Cellular and Molecular LifeSciences, 63, no. 3, 316–332, (2006).

[203] N. Stuurman, Identification of a conserved phosphorylation sitemodulating nuclear lamin polymerization, FEBS Letters, 401,no. 2-3, 171–174, (1997).

[204] M. I. Lefterova, Y. Zhang, D. J. Steger, M. Schupp, J. Schug, A.Cristancho, D. Feng, D. Zhuo, C. J. Stoeckert Jr., X. S. Liu, andM. A. Lazar, PPARγ and C/EBP factors orchestrate adipocytebiology via adjacent binding on a genome-wide scale, Genesand Development, 22, no. 21, 2941–2952, (2008).

[205] D. J. Steger, G. R. Grant, M. Schupp, T. Tomaru, M. I.Lefterova, J. Schug, E. Manduchi, C. J. Stoeckert Jr., andM. A. Lazar, Propagation of adipogenic signals through anepigenomic transition state, Genes and Development, 24, no.10, 1035–1044, (2010).

[206] S. Susperreguy, L. P. Prendes, M. A. Desbats, N. L. Charó,K. Brown, O. A. MacDougald, T. Kerppola, J. Schwartz,and G. Piwien-Pilipuk, Visualization by BiFC of differentC/EBPβ dimers and their interaction with HP1α reveals adifferential subnuclear distribution of complexes in living cells,Experimental Cell Research, 317, no. 6, 706–723, (2011).

[207] C. Ivorra, M. Kubicek, J. M. González, S. M. Sanz-González,A. Álvarez-Barrientos, J. O’Connor, B. Burke, and V. Andrés,Erratum: A mechanism of AP-1 suppression through interac-tion of c-Fos with lamin A/C (Genes and Development (2006)20 (307-320)), Genes and Development, 20, no. 6, p. 747,(2006).

[208] J. M. Gonzàlez, A. Navarro-Puche, B. Casar, P. Crespo, and V.Andrès, Fast regulation of AP-1 activity through interaction oflamin A/C, ERK1/2, and c-Fos at the nuclear envelope, Journalof Cell Biology, 183, no. 4, 653–666, (2008).

[209] V. Doucas, Y. Shi, S. Miyamoto, A. West, I. Verma, and R.M. Evans, Cytoplasmic catalytic subunit of protein kinase amediates cross-repression by NF-κB and the glucocorticoidreceptor, Proceedings of the National Academy of Sciences ofthe United States of America, 97, no. 22, 11893–11898, (2000).




Review Article

Modulation of the Glucocorticoid Receptor Activityby Post-Translational Modifications

Ana Clara Liberman1, María Antunica-Noguerol1,2, and Eduardo Arzt1,2

1Instituto de Investigación en Biomedicina de Buenos Aires - CONICET - Partner Institute of the Max Planck Society2Departamento de Fisiología, Biología Molecular y Celular, Facultad de Ciencias Exactas y Naturales, Universidad de BuenosAires

Corresponding Author: Eduardo Arzt; email: [email protected]

Received 21 April 2014; Accepted 3 August 2014

Editor: Ana Carolina Migliorini Figueira

Copyright © 2014 Ana Clara Liberman et al. This is an open access article distributed under the Creative Commons AttributionLicense, which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properlycited.

Abstract. Glucocorticoids (GCs) regulate numerous physiologic processes in order to maintain homeostasis. Most of their actionsare mediated by an intracellular GC receptor (GR). The dysregulation of the GR function has been associated with differentpathologies such as stress-related disorders and inflammatory and autoimmune diseases. The final outcome of GC actions isregulated at multiple levels and has been extensively reported. Nowadays, novel insights into the modulation of the GR activityarise from the study of the multiprotein chaperone/cochaperone machinery, the nuclear receptor cofactors (coactivators andcorepressors), and chromatin regulation and their concomitant impact on GR-mediated gene transcription. Nevertheless, thecomplexity of GR-mediated gene regulation cannot be explained by a finite number of chaperones and cofactors. A further levelin the regulation of GR activity is achieved by posttranslational modifications (PTMs) in response to external stimuli. PTMs canregulate protein stability, structure, function, activity, intracellular localization, and interaction with other proteins during cellularprocesses. Therefore, dynamic regulation of the molecular properties of these proteins by PTMs allows for further understandingthe complexity of GR-dependent gene expression and its impact on GR-mediated pathophysiological processes.

Keywords: glucocorticoid receptor, posttranslational modifications, chaperones, cofactors

1. Introduction

Activation of the hypothalamic-pituitary-adrenal (HPA)axis after exposure to a stressor is part of an adaptiveresponse that enables an organism to respond appropri-ately to changes in the environment. Under control ofthe HPA axis, the adrenal cortex releases glucocorticoids(GCs) [1] in order to facilitate processes aimed at adapt-ing to the stressor. GCs will trigger different responsesregulating a variety of biological functions [2]. After the

coordinated regulation of immune, endocrine, and neu-rological responses, GCs inhibit their own synthesis andthereby restore homeostasis. Due to its wide range offunctions, the imbalance in the levels of GCs inevitablyleads to a broad range of pathophysiological effects. Inthe brain, the dysregulation of GCs activity is associatedwith hippocampal degeneration and memory impairments[3], with higher risk for psychosis, as well as stress-related disorders [4, 5]. GCs are the most potent anti-inflammatory and immunosuppressive drugs currently in


clinical use. Their immunosuppressive actions are mediatedby the downregulation of numerous inflammatory genes suchas cytokines, chemokines, adhesion molecules, and enzymes[6, 7].

The majority of actions exerted by GCs occur by theirbinding to the GC receptor (GR) [8–10], which regulates theexpression of GC-responsive genes positively or negatively.GR-mediated promoter activation can rely on DNA bindingof a homodimeric GR on a GC response element (GRE) inthe promoter (simple GRE), on a coordinated DNA bindingof a GR/Transcription Factor (TF) complex onto a so-calledcomposite GRE or on GR/TF tethering mechanism [11].The latter two mechanisms can also form the basis forGR-mediated promoter repression [11]. Additionally, GR-regulated transcriptional repression can be exerted via DNAbinding of monomeric GR directly onto a so-called negativeGRE (nGRE) [12–14]. Many of the anti-inflammatory effectsof GCs are mediated by repression of proinflammatoryand immune-related TFs such as NF-𝜅B and AP1, amongothers [15–23]. The endocrine and metabolic effects ofGCs are mostly mediated via GRE, onto which GR candirectly bind as a homodimer and drive gene expression [24–28]. However, a very recent work suggests that, contraryto dogma, there is no clear correlation between the GRmonomeric/dimeric state and the mechanistic pathway thereceptor will follow upon ligand binding [29]. This discoverypresents supporting evidence towards the increasing view ofthe complexity of GC action.

In the absence of hormone, the receptor is presentin the cytoplasm as a complex which contains chaper-one, immunophilins, as well as other proteins which areimplicated in regulating different aspects of GR activity[30] as will be discussed later. Upon ligand binding, thereceptor translocates into the nucleus where it regulatesthe transcription of target genes. GR interacts with specificcofactors to implement a variety of gene promoter effects.However, this simplified signaling cascade does not unveilthe extreme complexity of gene-, cell-, and tissue-specificactivity of GCs [9, 31]. Diversity in GR signaling comes fromthe actions of different Diversity in GR signaling comes fromthe actions of different GREs and multiple receptor isoformsgenerated by alternative splicing and translation initiation[32–34]. GR activity and function are further modulated byposttranslational modifications (PTMs), which modify GRactivity, and also indirectly by modulating the activity of GR-interacting proteins, such as the chaperone heterocomplexesand cofactors, expanding the diversity of GC responses [35].The imbalance of GR activity has been extensively asso-ciated with inflammatory, autoimmune, and stress-relateddisorders. Understanding the influence of PTMs on themolecular mechanisms involved in GR signaling is thus ofutmost importance in the search for therapeutic strategiesaimed at modulating GR responses under pathophysiologicalcircumstances. The current review aims to give an overviewof the progress in our understanding of how GR-mediated

activity is modulated by PTMs and how this contributes tothe increasing diversity in GCs signaling pathways, focusingon the neuroendocrine and immune context in health anddisease.

2. Glucocorticoid Receptor and MolecularChaperones

GR activity is regulated by a dynamic chaperone and cochap-erone multiprotein complex (Figure 1). The GR chaperonecomplex has an important function in assisting the properprotein folding of GR but also supports GR stability andligand binding, facilitating its translocation into the nucleusand modulating GR-mediated transcriptional activation orrepression of target genes [36]. This chaperone complexincludes heat-shock proteins, such as Hsp90 and Hsp70,and immunophilins, such as the FK506-binding protein(FKBP) 51 and FKBP52 [37]. When binding to its ligand,GR undergoes a conformational change that promotes itstranslocation to the nucleus and the recruitment of regulatorycofactor complexes finally impacting gene transcription [38].Interestingly, instead of being kept inactive in the cytoplasmof the cell, a rapid nucleocytoplasmic shuttling of the receptorunderlies its localization [39] (Figure 1). Against previousbeliefs, it is now accepted that GR does not dissociate fromits chaperone complex when binding to its ligand but insteadremains associated within this complex to translocate to thenucleus. GR nuclear translocation is controlled by the Hsp90machinery, specifically by the recruitment of immunophilinFKBP52 to the GR–Hsp90 complex (Figure 1). The integrityof the chaperone complex seems to be critical for GRnuclear translocation [40, 41]. Considering the key regulatoryfunction of these proteins, their regulation by PTMs, as willbe later discussed, represents a novel level of modulating GRactivity and therefore might become interesting therapeutictargets for the treatment of many associated diseases.

While Hsp70 is the molecular chaperone that is essentialfor the folding of nascent chains, it is Hsp90 which regulatesthe finalmaturation of GR by helping it to achieve a hormone-dependent activation state. The relevance of Hsp90 on GRactivity has been extensively documented [37, 42–44]. Apartfrom ensuring ligand accessibility to the ligand-bindingpocket, Hsp90 seems to enable hormones and coregulatorsto act as allosteric effectors, which forms the basis for gene-and cell-specific responses of GR to ligands [45].

In particular, pharmacological manipulation of Hsp90function has become an important tool to shed light uponthe importance of Hsp90 in regulating immune and neu-roendocrine responses in a GR-dependent manner [46–50]. Inhibition of Hsp90 was found to interfere with theanti-inflammatory actions of GR [46, 47], apparently byattenuating GR inhibition of proinflammatory TFs NF-𝜅Band AP1 [48]. Moreover, inhibition of Hsp90 chaperoningfunction in neuroblastoma cells leads to reduced GR transac-tivation by interfering with GR-Hsp90 association, followed


by proteasome-dependent degradation of the receptor [49]. Italso impairs GR retrograde movement along neurites whileinducing GR degradation by the proteasome as well [50].In addition, the alteration of GR-Hsp90 interaction impactson stress-related behavior in vivo due to reduced nucleartranslocation and altered GR function during stress response[51–53]. As will be further discussed in this review, PTMsthat target Hsp90 regulate the chaperone activity and furtherimpact on GR activity.

Other components of the GR-Hsp90 heterocomplex playcritical roles in regulating GR function. It was reported thatimmunophilin composition of the GR chaperone complexcan modulate GR translocation, since FKBP51 inhibits GRnuclear transport while FKBP52 binding to dynein appearsto be responsible for FKBP52-mediated enhancement of GRnuclear translocation [54–56] (Figure 1). Therefore, FKBP52is regarded as a positive regulator of GR transcriptionalactivity [57] and FKBP51 as a negative regulator [58].Accordingly, its overexpression prevents the positive regula-tion by FKBP52 because of the competition of FKBP51 forthe same binding site on Hsp90 [57]. Interestingly, FKBP51gene (FKBP5) mRNA and protein expression are induced byGR activation via intronic hormone response elements [59],suggesting the existence of an ultrashort negative feedbackloop regulating GR activation. The GR-enhanced expressionof FKBP51 in turn moves the equilibrium back towards theFKBP51-containing complexes, resulting in attenuation ofGCs actions.

Adrenal secretion of GCs is one of the major mechanismsby which human responds to stress. Therefore, alterationsin both FKBP51 and FKBP52 have been implicated inimpairedGR signaling and stress-related disorders associatedwith HPA axis dysfunction [60, 61] such as depressionand bipolar disorders [62]. This appears to be at least inpart due to impaired efficiency of the negative feedbackregulation by cortisol-loaded GR in the HPA axis. Singlenucleotide polymorphisms (SNPs) in the FKBP51 gene havebeen associatedwith increased expression of the cochaperoneprotein, which in turn may link to differences in GR activityand contribute to GCs resistance [63]. This deregulatedstress response might be a risk factor for stress-relatedpsychiatric disorders. These same alleles are overrepresentedin individuals with major depression, bipolar disorder, andposttraumatic stress disorder and are also associated withfaster response to antidepressant treatment [63]. Therefore,FKBP5 has been proposed as an interesting therapeutictarget for the prevention and treatment of stress-relatedpsychiatric disorders [63]. FKBP51 has also been associatedwith immune-related diseases and inflammation. Its role inthese pathologies is apparently mediated not only by itscochaperone function but also by its ability to modulateNF-𝜅B activity and its dependent gene expression [61].On the other hand, FKBP52 has also been proposed asa therapeutic target based on results obtained in in vivoexperiments with knockout mice [64, 65]. In particular,heterozygous FKBP52 knockout mice were found to display

an altered phenotype regarding behavioral, neurogenesis, andneuroendocrine parameters under basal and chronic stressconditions. Alteration in these parameters is most likely dueto reduced GR sensitivity of the HPA axis [65], highlightingthe importance of FKBP52 regulation of GR activity. Takinginto consideration that cochaperones, such as FKBP52, aretargeted by PTMs, the complexity of GR regulation becomesof striking importance.

3. Glucocorticoid Receptor and Coregulators

Activation or repression of target genes is achieved byGR recruitment of coregulators that serve as coactivatorsor corepressors to responsive regulatory regions [66, 67].GR agonists exert both GR-mediated transactivation andtransrepression in a promoter and context specific fashion[68–70]. Targeting these proteins by PTMs, as will beexemplified later in this review, further regulates theseprocesses (Figure 2).

To initiate transcription, GR uses its transcriptionalactivation domains, AF-1 and AF-2, as surfaces to interactwith nuclear receptor coactivators and chromatin-remodelingcomplexes. Coactivators include a wide range of pro-teins that enhance nuclear receptor-dependent transcriptionthrough interaction with the ligand-bound receptor. Theygenerally mediate interaction between nuclear receptorsand the general transcription machinery. In addition, mostof the coactivators also display enzymatic activities thatcontribute to their function in promoting transcription, suchas histone acetyl-transferase (HAT) and histone methyl-transferase, supporting the key role of PTMs in regulatingGR activity (Figure 1). They mediate chromatin remodelingand facilitate the association of RNA polymerase II (RNAPol II) complex with the general transcription machineryat the promoter of the target gene [71]. The N-terminaldomain (NTD) AF-1 contributes to the interaction of GRwith cofactors, chromatin-remodeling enzymes, RNA PolII, the TAT-binding protein, and TBP-associated proteins(TAFIIs). However, the C-terminal domain (CTD) whichharbors the ligand-binding domain (LBD) of GR can alsoaccommodate coactivator binding to the C-terminal AF-2 domain [72]. These GR-bound multisubunit coregulatorcomplexes can consist of p300 or CBP, p/CAF, steroidreceptor coactivators SRC1, SRC2, and/or SRC3, all of whichpossess HAT activities, and also PGC-1a, which can recruitHAT activity-containing cofactors, such as SRC-1, p300, orDRIP/TRAP. The GR-bound enhanceosome of promotersgoverned by GREs could also contain the ATP-dependentchromatin-remodeling complex SWI/SNF and/or elements ofthe DRIP/TRAP complex [73].

Recruitment of corepressors by unliganded or antagonist-bound nuclear receptors partly accounts for inhibition of geneexpression. Twomajor corepressors identified to interact withGR are nuclear receptor corepressor (NCoR) and silencingmediator of retinoid and thyroid hormone receptor (SMTR)


STRESSORS

FKBP52

Reuse ReuseReuse

FKBP51

Hsp90

GR (Ubi)n

GR GRGR GR

GR

II

Mediator

TBP

TATA

Transcriptional

outcome

TF

GR

TF

TF

TF

TFGR TFGR GR

GR GR GR

TFTFGR

TETHERING

GRGRGRCOMPETITIVE

COMPOSITE

COMPOSITE

TFTF+/-

-

-

+

SIMPLE GRE

GR

Hsp90

Hsp90

00Hsp900Hsp90FKBP51

Histones

HMT

IIII

+/-

HMTHMTGR

HDAC2 HDAC2GR

SWI/SNF

ATP-dependent chromatin

remodeling

HAT activity

GR GR

SIMPSIMPSIMP

GRE

SRC

RESIMPLE GRESIMPLE GRESIMPLE GRE

GRE GRE

pCAF

SRCSRCSRC

CARM1

p160/

GRIP1

SWI/SNFSWI/SWI/SNFSWI/

HDAC activity

HMT activity

GC

GR

GC

Hsp90 FKBP52

SUMOylation

Phosphorylation

Acetylation

Ubiquitination

Methylation

FKBP51 Hsp90Hsp900Hsp9Hsp900 FKBP51FKBPFKBPFKBP51FKBPFKBPFKBP51FKBPFKBP

GR

Figure 1: GR activity is regulated by the chaperone/cochaperone complex and also by coactivators/corepressors which in turnare targets of posttranslational modifications. The GR is associated with chaperones (e.g. Hsp90) and cochaperones (e.g. FKBP51 andFKBP52), which are implicated in regulating the function, folding and trafficking of the GR. Upon ligand binding, FKBP51 is exchangedfor FKBP52 and translocates to the nucleus. Several PTMs directly target GR and also GR heterocomplex further regulating its activity. GR-mediated promoter activation relies on GR DNA binding on simple GREs, on a coordinated binding of a GR/TF complex onto compositeGRE or on GR/TF tethering. The latter two mechanisms are also implicated in GR-mediated repression. GR uses chaperone/cochaperonecomplexes containing Hsp90 to facilitate dynamic interactions with target sites. Hormone release from GR and GR release from chromatinmight require complexes with Hsp90.GR may be ubiquitinated and degraded by the proteasome or reused. Coactivator and corepressorare required for GR-mediated transcriptional regulation. Most recruited coactivators display enzymatic activities, such as histone acetyl-transferase (HAT), histone methyl-transferase (HMT), and ATP-dependent chromatin remodeling. They mediate chromatin modificationand facilitate the association of RNA polymerase II complex with the general transcription machinery. Corepressors include ATP-dependentchromatin remodeling complexes, basal corepressors, and subcomplexes that may contain histone deacetylase (HDAC) activity and specificcorepressors. The GR can bind to coactivators to inhibit HAT activity directly and recruite HDAC2, which reverses histone acetylationleading to suppression of TF-activated inflammatory genes. Therefore, HATs, HDACs, and HMTs support the key role of PTMs in indirectlyregulating GR activity.

[74–76]. The sites of interaction in steroid and nuclearreceptors for both corepressors and coactivators have beenidentified to be in the ligand-binding domain (LBD); in fact,the two sites appear to overlap [77]. PTMs that target thissite affect GR transcriptional outcomes as will be furtherdiscussed [78].

An interesting example arises from glucocorticoid recep-tor interacting protein (GRIP) 1, which is recruited by GRupon ligand-binding. GRIP1 belongs to the p160/steroidreceptor coactivator (SRC) family of coregulators [73].

GRIP1 displays not only coactivator activity, but alsocorepressor activity when they are recruited to GR tetheredAP-1 or NF-𝜅B target sites [79]. GRIP1 activity is contextdependent but is also influenced by epigenetic regulators,context, and other unrecognized regulatory determinants[80]. It has been described that GRIP interacts with theHMT, Suv4-20h1. Suv4-20h1 is known exclusively as afactor involved in constitutive heterochromatin maintenance,but, when associated to GRIP1, it actively participatesin hormone-dependent transcriptional regulation affecting


PTMs MODULATE:

COMPLEX ASSEMBLY/DISASSEMBLY

GR LIGAND BINDING ACTIVITY

GR INTERACTION WITH TF AND REGULATORY

PROTEINS

GR NUCLEAR TRANSLOCATION

SUBCELULAR LOCALIZATION

PROTEIN STABILITY

COREPRESSORS/COACTIVATORS

RECRUITMENT

+/- GENE TRANSCRIPTION

GR

Hsp90 HspFKBP52

STRESSORS

GC

GRIP1

Coactivator/

corepressor

KINASES (p38, JNK, ERK)

KINASES (CK2)

KINASES (CK2/CDK9)

KINASES (CK2) HAT/HDAC6

HAT/HDAC

(CLOCK-BMAL1/HDAC2)

MT (Smyd2)

p300 MT (CARM1)

Ubiquitin enzymes

Ubiquitin enzymes

Ubiquitin enzymes

SUMOylation enzymes

SUMOylation enzymes

SUMOylation enzymes

SUMOylation

Phosphorylation

Acetylation

Ubiquitination

Methylation

HPA AXIS IMMUNE

SYSTEM REGULATION OF

PATHOPHYSIOLOGICAL

PROCESSES

Figure 2: Posttranslational modifications play a crucial role in the regulation of GR activity which impacts on the neuroendocrineand immune regulatory pathways.GCs are the downstream effectors of the HPA axis response. They play a key role in the communicationbetween the neuroendocrine and immune systems to ensure homeostasis. GCs impact on both HPA-mediated stress responses and immuneresponses. GCs effects aremainlymediated through binding to the GR. A series of mechanisms regulate GR activity to ensure GCs specificity.These mechanisms include modulation of GR by posttranslational modifications (PTMs). Different cellular stressors and also hormonebinding can modulate PTMs of target proteins. PTMs do not only target GR but also key molecules involved in the regulation of GRactivity such as the cochaperone/chaperone heterocomplex and GR coactivators and corepressors. PTMs regulate protein properties includingstability, structure, function, activity, intracellular localization, and interaction with other proteins during cellular processes determiningthe final outcome. This review focuses on PTMs that target GR and GR modulators such as Hsp90, FKBP52, and GRIP1, fine-tuningGR transcriptional outcome, thus adding complexity and specificity to GCs action. GR and Hsp90 activity is modified by SUMOylation,ubiquitination, acetylation, and phosphorylation. Hsp90 is further regulated by methylation by methylatransferases (MT). GRIP1 is targetedby phosphorylation, ubiquitination, and sumoylation. Finally, FKBP52 by phosphorylation and p300 by methylation.

GR target gene expression in a promoter- and cell type-specific manner [81]. A recent study on GR regulationof LPS-stimulated macrophages gene expression showedthat GRIP1 is equally recruited to both up- and down-regulated genes [80]. Mechanisms switching GRIP1 fromcoactivator to corepressor or vice versa depending onthe context remain yet to be elucidated but may alsobe influenced by different PTMs as will be further dis-cussed.

Other corepressors that are recruited by GR are histonedeacetylases (HDACs) (Figure 1). Histone posttranslationalmodification by acetylation is mediated by transcriptionalcoactivators, which have intrinsic HAT activity, whereas

repression is induced by HDACs, which reverse this PTM,allowing for repackaging of the nucleosomes, and, therefore,is generally related with transcriptional repression [82].Therefore acetylation/deacetylation by these enzymes indi-rectly modulates GR transcriptional outcome. Both SMRTand N-CoR interact directly with multiple HDACs [83, 84]andmay associate with HDACs 1 and 2 via the Sin3 repressor[85]. The current view of SMRT and N-CoR functionholds that these corepressors not only deliver HDACs totarget genes but also serve as critical cofactors in theformation of an active HDAC enzyme [86]. Recruitmentof HDACs to GR negatively regulated genes contributesto inhibiting their expression. In this regard, HDAC2 has


been shown to reduce histone acetylation at the activatedinflammatory gene promoter complex, thereby effectivelysuppressing activated inflammatory gene transcription [87–89]. As will be further discussed, HDAC also directlytargets GR and Hsp90 regulating its activity [88, 90]. Inthe context of psychiatric diseases, selective HDAC 1/2inhibition modulates chromatin and gene expression inbrain and alters mouse behavior in mood-related tests [91].Also, HDAC1 has been shown to participate in the down-regulation of corticotropin-releasing hormone gene (CRH)expression by GCs [92]. Collectively, these data point toa role for HDAC1 in the physiopathological regulation ofCRH.

Similarly to GRIP1 dual activity in the regulation ofgene transcription, HDACs have also been associated withGR-dependent transcriptional activation. HDAC1was shownto be required for ligand-induced GR-dependent MMTVpromoter activation [93]. HDAC2 was also found to becritical for GR-mediated transactivation, since knockdown ofHDAC1 or HDAC2 separately decreased MMTV transcrip-tion [94]. HDAC involvement in GR-mediated transcriptionseems to have genome-wide effects [95] and the finaloutcome should be carefully considered. These enzymes donot only target GR and its coregulators as discussed but alsomay themselves be target of other PTMs that may influencethe final transcriptional outcome.

4. Glucocorticoid Receptor and Posttransla-tional Modifications

The existence of an enormous number of receptor variants,having differential characteristics in expression, localization,and transcriptional activity, comprises a tissue- or cell-specific GR population providing an important mechanismfor regulation of GR action [9, 96–98]. However, PTMsrepresent an important mechanism in the regulation ofGR signaling upon ligand binding. These PTMs targetnot only GR and GR variants but also key moleculesinvolved in the regulation of GR activity. PTMs allowfor the regulation of protein properties including stability,structure, function, activity, intracellular localization, andinteraction with other proteins during cellular processesdetermining their final outcome. We will focus in this mattershowing key examples on how PTMs that target GR and itsmodulators (e.g., Hsp90, FKBP52, and GRIP1) fine-tune GRtranscriptional outcomes adding complexity and specificityto GCs action.

5. Phosphorylation

Phosphorylation is an important PTM for the regulationof protein function. The GR is a phosphoprotein, andphosphorylation modulates its activity (Figure 2). GR phos-phorylation occurs in a hormone-dependent manner, atserine/threonine residues located within the DNA-binding

domain [99]. Phosphorylation of GR has been shown tobe critical for its activation. Many target phosphorylationresidues have been characterized up to date, most of whichare located in the AF-1 domain of its NTD [100]. Phos-phorylation at each residue has a specific effect on GRactivity that can be either positive or negative [101]. Forinstance, p38 mitogen-activated kinase- (MAPK-) dependentGR phosphorylation at serine 211 was shown to be criticalfor the induction of AF1-domain conformational changethat subsequently facilitated interaction with coregulatorsand activation of transcription [102]. It was demonstratedthat differentially phosphorylated GR species show spe-cific intracellular sublocalization [103]. Intriguingly, specificGR phosphorylated forms were differentially recruited topromoters of target genes and selectively regulated theirexpression. In addition, phosphorylation status of individualresidues seems to have different impact depending on thetarget gene under analysis [104, 105]. Recently, it wasdescribed that GR phosphorylation occurs not only in ahormone-dependent manner but also, previous to hormonebinding, as a consequence of cellular stress, therefore reg-ulating GR response upon ligand stimulation. This newlydescribed mechanism suggests that cellular history prior toGCs signaling, measured by phosphorylation of the GR, hasan impact on the regulation of its target genes [106]. Inaddition, GR protein stability has been shown to be depen-dent on its phosphorylation state, since phosphorylationmutants displayed increased protein stability and decreasedsensitivity to ligand-induced reduction in protein levels[107].

Many different stress conditions are related to the modu-lation of PTMs on target proteins. Cellular stresses such asstarvation or oxidative stress induce p38 MAPK-dependentphosphorylation of Ser134. This phosphorylation mediatesGR interaction with 14-3-3 𝜁 , a protein associated withoxidative stress, GR binding to selective gene promot-ers, and alters the GR-mediated target gene profile [106].Aberrant GR phosphorylation has been proposed to playa role in disease. For example, some GC-resistant asthmapatients become responsive when p38 MAPK inhibitorsare given with reduced Ser226 phosphorylation as one ofthe results of kinase inhibition [108]. In women, the ratioof nuclear phospho-Ser211/phospho-Ser226 measured inperipheral blood mononucleocytes is inversely correlatedwith depression [109]. In this regard, phosphorylation of GRwas shown to be altered due to stress and antidepressanttreatment, rendering GR phosphorylation a putative target forantidepressant actions. In the chronic mild stress model ofdepression, alterations of GR trafficking and transcription inthe hippocampus and in the prefrontal cortex were suggestedto be sustained by changes in receptor phosphorylation. Inthis same work, antidepressant treatment normalized thesealterations [110]. In line with these results, it was demon-strated that antidepressant treatment increases human hip-pocampal neurogenesis via a GR-dependent mechanism thatrequires PKA signaling, GR phosphorylation, and activation


of a specific set of genes [111], rendering GR phosphoryla-tion a putative target for antidepressant actions.

Interestingly, during inflammation, stimulation throughproinflammatory signals culminates in the activation of AP-1 and NF-𝜅B, together with other relevant inflammatoryTFs, which in turn induce the expression of proinflam-matory genes. Activation of such inflammatory pathwaysinvolves the participation of kinases. Remarkably, thesesame kinases (JNK, p38, and extracellular-signal regulatedkinases (ERK)) are involved in modulation of GR activitythrough phosphorylation. At the same time, GR regulatesactivation of these pathways by modulating the activityof the kinases, thus contributing to the complexity of thelandscape [101] (Figure 2). Moreover, chaperones complexesand coregulators are also targeted by phosphorylation, whichalters their functions and thus impacts on GR activity [112–114]. The immunophilin FKBP52 binds to Hsp90 via its TPRdomain and is important for chaperoning of steroid hormonereceptors. Casein Kinase II (CK2) phosphorylates FKBP52on Thr-143 both in vitro and in vivo (Figure 2). Phos-phorylation of this residue does not affect FK506 bindingto FKBP52, but phosphorylated FKBP52 does not interactwith Hsp90. These findings suggest that phosphorylationof FKBP52 plays a role in modulating steroid hormonereceptor-mediated signal transduction [115, 116]. Hsp90 isa phosphoprotein and its steady-state phosphorylation levelis influenced by different cellular environments in a species-specific manner [117] (Figure 2). A number of serine, threo-nine, and tyrosine phosphorylation sites have been identifiedin Hsp90. Hsp90 phosphorylation can affect its ability tochaperone client proteins [118] and therefore may impact onGR activity [119]. As previously mentioned, GRIP1 p160familymember functions as coactivators for GR.Unlike otherp160s, GRIP1 also potentiates GR-mediated repression ofAP1 and NF-𝜅B targets and, surprisingly, transcriptionalactivation by interferon regulatory factors. What enablesGRIP1 activating or repressing properties is unknown. Ithas recently been demonstrated that GRIP1 undergoes GC-induced, GR interaction-dependent phosphorylation by twoputative GRIP1 kinases, CKII and cyclin-dependent kinase9 (CDK9), and also that GRIP1 phosphorylation potentiatesGR-mediated activation of transcription [120] (Figure 2).These findings suggest that GR actively imparts modifica-tions that dictate GRIP1 function, adding a layer of specificityto GR transcriptional control.

6. Acetylation

Like other nuclear receptors belonging to the same superfam-ily, the GR is acetylated in lysine residues within its DNAbinding domain (Figure 2). The acetylated GR is deacetylatedby histone deacetylase 2 (HDAC2) and this deacetylation isnecessary for the GR to be able to inhibit NF-𝜅B activationof inflammatory genes [88]. By directly targeting acetylatedGR, HDAC2 potentiates the inhibitory effect of GCs [88]

(Figure 2). Moreover, the deacetylation of GR by HDAC2seems critical for the interaction between p65 and thereceptor [88]. In particular, HDAC2 levels were found tobe critical for GCs insensitive response in patients sufferingfrom a chronic inflammatory disease and chronic obstructivepulmonary disease (COPD). Primary alveolar macrophagesfrom these patients presented low HDAC2 protein levels.Overexpression of HDAC2 in GC-insensitive macrophagesrestored GCs sensitivity [88], pointing to a key role forHDAC2 and GR acetylation in the regulation of inflam-matory immune responses. Acetylation/deacetylation of GRwas found to be relevant not only for transrepression butalso for transactivation, since the HAT protein CLOCK andBMAL1 repressed GR transcriptional activity by acetylatingGR target lysine residues [121] (Figure 2). As previouslymentioned, together with GR, other proteins directly orindirectly regulating GR activity are modified by acetylation.In this context, the most relevant target of acetylation isHsp90 (Figure 2). HDACs can also influence gene expressionindirectly. For example, HDAC6 can affect GR function,by regulating Hsp90’s acetylation, which subsequently influ-ences GR nuclear translocation [90]. Deacetylation of Hsp90by HDAC6 was found to be critical for GR complex matu-ration. In HDAC6-deficient cells, GR activity was compro-mised as evidenced by defective GR ligand binding, nucleartranslocation, and transcriptional activation [90]. In line withthese results, the lack of HDAC6 results in deregulationof GR-Hsp90 complex assembly/disassembly and thus GRactivity [122]. Interestingly, a recent study on the relevanceof Hsp90 acetylation and its impact on GR function in amurine model of traumatic stress showed that deacetylationof Hsp90 by HDAC6modulates GR downstream signaling inthe brain, with an effect on stress-related behaviors [53, 123].Therefore, HDAC activity appears to be important not onlyfor transrepression regarding immunosuppressive and anti-inflammatory actions of GCs but also at the neuroendocrinelevel [124]. On the other hand, it has been demonstratedthat Hsp90 acetylation regulates its interaction with clientproteins, including cochaperones such as p23 and FKBP52[125].

7. Methylation

Even though much research has focused on GR expressionregulated by DNA methylation at the transcriptional level,little is known on how protein methylation can alter GRtranscriptional activity. Interestingly, protein methylationhas been associated with modulation of nuclear receptorscoregulators. It has been shown that certain coactivators,such as p300, are methylated in the C-terminal region byarginine methyltransferase (CARM1) (Figure 2) leading toinhibition of interactions between p300 and GRIP1 [126].Therefore, methylation of GR coactivators can also modulateGR signaling. Remarkably, Hsp90 has also been identifiedas a methylation target (Figure 2) of the cytoplasmic lysine


methyltansferase Smyd2 [127, 128] though its impact on GRsignaling has not been reported yet.

8. Ubiquitination

Ubiquitination is another important PTM that cells use totarget specific proteins, via the covalent attachment of multi-ple ubiquitin molecules, to the proteasome for degradation.Ubiquitin is a highly conserved molecule universally dis-tributed among eukaryotes. The molecule is first activated byE-1 activating enzymes, then transferred to E-2 conjugatingenzymes, and subsequently passed on to E-3 ligases [129].E-3 ligases recognize a wide range of target substrates bytheir conserved ubiquitination motifs and attach ubiquitin tothe appropriate residues on the target proteins. Once tagged,the proteins are degraded by the proteasome. The GR is alsoa target for ubiquitination thus marking it for degradationby the proteasome [130] (Figures 1 and 2). The ubiquitin–proteasomemediated degradation pathway regulates the GCssignaling system by controlling the degradation rates ofGR. Proteasome inhibition leads to decreased ligand-inducedGR protein downregulation and enhanced GR transcriptionalactivity [131, 132]. In support of these findings, mutationof the ubiquitin-target lysine within the PEST motif—thesemotifs are associated to protein degradation by proteasome—mimics the effect of proteasome inhibition, rendering GRprotein levels independent of ligand-induced degradation andenhancing GR transcriptional activity as well [131, 133]. Inaddition, proteasome inhibition alters GR nuclear traffickingtogether with GR binding to the nuclear matrix [132].Interestingly, inhibition of proteasome activity affects GR-target gene expression not only by altering GR proteasomaldegradation but also by modulating histone methylation andRNAPol II association with chromatin. Trimethyl histone H3lysine 4, widely correlated with an active chromatin status,was demonstrated to be enriched at the MMTV activatedgene when proteasome activity is inhibited both underbasal conditions and upon hormone treatment. Moreover,density of activated RNA polymerase II at this gene wasalso found to be increased when inhibiting proteasomalactivity [134]. Therefore, a link between chromatin structureand proteasome activity at GR target genes arises as aplausible explanation beyond GR proteasome degradation[134, 135]. Proteasome components are also found at theMMTV promoter regulating rapid GR exchange at this site,pointing to the proteasome as a regulator of hormone sensingand fine-tuning of GR responses to variable conditions [136].Also, an E3 ubiquitin ligase has been identified for GR𝛼,and alterations in the expression of this enzyme modulatereceptor levels and cellular responsiveness to GCs [137].

The GR protein is subjected to hormone-dependent down-regulation in most cells and tissues. However, conflictingresults have been obtained from in vitro and in vivo studiesin maturing and developing neurons regarding the effects ofGCs-mediated regulation of GR protein levels [4, 138, 139].

In hippocampal neurons, chronic GCs exposure does notalter GR protein levels, probably due to an unappropriatedmaturation of proteasomal degradative or targeting activi-ties [139]. Accordingly, overexpression of the E3 ubiquitinligase CHIP (C-terminus of Hsc70-interacting protein) [137,140] abolishes the steroid-binding activity and transactiva-tion potential of the GR, even though it has little effecton its synthesis. Instead, CHIP induces ubiquitination ofthe GR and degradation through the proteasome. Therefore,these results suggest that relative abundance of an E3 ligasemight confer differential GR sensitivity in the neuronalcontext. Interestingly, CHIP is a component of the Hsp90heterocomplex [140] and also targets Hsp90 for proteasomaldegradation [141–143], further regulating GR activity [140].

Together with GR, nuclear receptor coregulators arealso subjected to regulation by the ubiquitin/proteasomepathway [144]. In particular, GRIP1 is ubiquitinated in acAMP-dependent manner, suggesting GRIP1 ubiquitinationas an additional mechanism for GR-mediated transcriptionalregulation [145] (Figure 2). Interestingly, components ofthe ubiquitin/proteasome pathway have also been describedto act as nuclear receptor coregulators themselves, therebyproviding a new link between nuclear receptors and theproteasome/ubiquitin pathway [135]. As an example, Ube3a,an E3 ubiquitin ligase, was shown to enhance ligand-boundGR degradation and also to act as a GR transcriptionalcoactivator [135]. This ubiquitin ligase plays a critical rolein Angelman syndrome, a neurodevelopmental disorder. GR-mediated signaling was impaired in the brain of ube3amaternal-deficient mice, a murine model of Angelman syn-drome [146]. At the same time, these mice showed increasedchronic stress and anxiety-like behavior, probably due toimpaired GR signaling regulating the HPA axis. Also, Hsp90is a ubiquitination target (Figure 2) and, as a consequence,Hsp90 chaperone function is inhibited [147, 148].

9. SUMOylation

Small ubiquitin-related modifier (SUMO) is an 11 kDa pro-tein moiety that can be covalently ligated to lysine residues ina variety of target proteins. The protein is similar to ubiquitinin size and three-dimensional structure, yet the functionalconsequences of SUMOylation are distinct [149]. Whileubiquitination largely leads to the proteasome-mediatedtarget protein degradation, modifications by SUMO regulatemore diverse biological effects including protein-proteininteractions, subcellular localization, protein stability, andtranscriptional capacity [150, 151]. SUMO conjugation hasalso been found to play an important role in modulating GRtranscriptional activity [152, 153]. Covalent attachment ofSUMO to GR takes place in the absence of ligand (Figure2), but GR agonists increase SUMOylation of the receptor[154]. A quantitative proteomic analysis of the SUMOylationstates of proteins in response to heat shock identified GR as aSUMO target [155], suggesting a role for GR SUMOylation


in the modulation of its transcriptional activity under cellularstress. GR contains three consensus SUMOylation sites. Thefirst two are located in the NTD while the third one islocated in the LBD. The NTD SUMOylation sites are partof the synergy control (SC) motif sequence [152] whichconsists of short regulatory sequences that limit the syner-gistic transactivation in a promoter-dependent manner. It iswell established that SUMO modification of the two NTDSUMOylation sites in the GR is responsible for the functionaleffect of the SC motifs, thereby exerting a negative effecton GR transcriptional activity at multiple GREs withoutaltering GR-mediated transcription at promoters containingonly a single GRE [152]. SC motifs limit transcriptionalsynergy of multiple DNA-bound regulators at compoundbinding sites, so that disruption of these motifs increasestheir activity. Thereby, SC motifs do not affect intrinsicactivity of TFs but rather modulate their ability to synergizeat compound-binding elements [156]. Based on these results,it has been hypothesized that GR SUMOylation withinits SC motif would affect recruitment of corepressors andtherefore transcriptional regulation of downstream genes[156, 157]. In line with these results, SUMO modificationof GR at the N-terminal sites influences transcriptionalregulation depending on context promoter, since no effect ofSUMO conjugation to GR could be detected at the MMTVpromoter [154]. Interestingly, we have demonstrated that aRWD-containing SUMOylation enhancer, RSUME [158], isresponsible for SUMO conjugation to the LBD of the GRunder heat stress conditions and uncovers a positive rolefor SUMO in GR-mediated transcriptional regulation duringstress adaptation [78]. SUMOylation at this residue may becritical for GRIP1 cofactor-mediated GR activity, since itspoint mutation diminishes GRIP1 coactivator activity whileit does not disrupt GR-GRIP1 interaction [78].

A genome-wide analysis of GR SUMOylation impactson gene expression revealed that both hormone up- anddownregulated genes are affected by SUMO modification ofthe GR, and that genes differentially regulated are related toproliferation and apoptosis pathways [159].

SUMO modification of the GR is influenced by otherPTMs, since it was demonstrated that c-Jun N-terminalkinase- (JNK-) dependent phosphorylation enhances GRSUMOylation to fine-tune GR transcriptional activity in atarget gene-specific manner [160].

Since regulators of the SUMOylation pathway such asRSUME are induced under stress [78, 158, 161], they mightcontribute to fine-tuning the cellular response to GCs duringstress adaptation. Thus, understanding these mechanismsmight contribute to the establishment of potential targets tomodulate physiological and therapeutic responses to GCs.

Coregulators are also subjected to SUMO modification,as exemplified by Hsp90 and GRIP1 (Figure 2). SUMOy-lation of Hsp90 has been reported previously [162–164].Interestingly, SUMOylation of an N-terminal domain lysineconserved in both yeastand human Hsp90 facilitates both

recruitment of the adenosine triphosphatase- (ATPase-)activating cochaperone Aha1 and the binding of Hsp90inhibitors, suggesting that these drugs associate preferen-tially with Hsp90 proteins that are actively engaged in thechaperone cycle, providing a mechanism to explain thesensitivity of cancer cells to these drugs [165]. GRIP1 issubjected to SUMO-1 modification. Lysine residues 239,731, and 788 of GRIP1 serve as principal attachment sitesfor SUMO-1. Lys-731 and Lys-788 are located in the nuclearreceptor interaction domain (NID), and their substitution byarginines impairs the ability of GRIP1 to colocalize withandrogen receptor in nuclei, modifying the ability of GRIP1to function as a steroid receptor coactivator [166].

10. Concluding Remarks

Since GCs effects are mainly mediated by GR, the devel-opment of therapeutic strategies necessarily requires theunderstanding of the underpinning molecular mechanismsimplicated in the regulation of GR biological activity. Inthis regard, PTMs are important modulators of GR activity.However, the relevance of these PTMs on GR activity shouldbe carefully analyzed considering the cellular context. Theoccurrence of these PTMs contributes to the developmentof tissue-specific responses. Therefore, understanding howPTMs impact on GR activity (by directly targeting GRor indirectly by targeting its coregulators) is of crucialrelevance. Particularly, since GCs play a critical role in theregulation and communication between the neuroendocrineand immune systems ensuring the homeostatic balance (Fig-ure 2), the knowledge of this regulatory level is fundamentalfor the development of novel therapeutic approaches aimed atdifferentially modulating GR function in order to overcomepathologies in which these systems are involved.

Conflict of Interests

The authors declare that there is no conflict of interests thatcould be perceived as prejudicing the impartiality of theresearch reported.

Acknowledgments

This work was supported by grants from the Max PlanckSociety, Germany; the University of Buenos Aires; CON-ICET; the Agencia Nacional de Promoción Científica y Tec-nológica, Argentina; and FOCEM-Mercosur (COF 03/11).

References

[1] E. R. De Kloet, M. Joëls, and F. Holsboer, Stress and the brain:From adaptation to disease, Nature Reviews Neuroscience, 6,no. 6, 463–475, (2005).

[2] R. M. Sapolsky, L. M. Romero, and A. U. Munck, How do glu-cocorticoids influence stress responses? Integrating permissive,


suppressive, stimulatory, and preparative actions, EndocrineReviews, 21, no. 1, 55–89, (2000).

[3] S. J. Lupien, M. De Leon, S. De Santi, A. Convit, C.Tarshish, N. P. V. Nair, M. Thakur, B. S. McEwen, R. L.Hauger, and M. J. Meaney, Cortisol levels during human agingpredict hippocampal atrophy and memory deficits, NatureNeuroscience, 1, no. 1, 69–73, (1998).

[4] B. L. Conway-Campbell, M. A. McKenna, C. C. Wiles, H. C.Atkinson, E. R. De Kloet, and S. L. Lightman, Proteasome-dependent down-regulation of activated nuclear hippocampalglucocorticoid receptors determines dynamic responses to cor-ticosterone, Endocrinology, 148, no. 11, 5470–5477, (2007).

[5] G. P. Chrousos and T. Kino, Glucocorticoid action networksand complex psychiatric and/or somatic disorders, Stress, 10,no. 2, 213–219, (2007).

[6] A. C. Liberman, J. Druker, F. A. Garcia, F. Holsboer, and E.Arzt, Intracellular molecular signaling: Basis for specificity toglucocorticoid anti-inflammatory actions, Annals of the NewYork Academy of Sciences, 1153, 6–13, (2009).

[7] A. E. Coutinho and K. E. Chapman, The anti-inflammatory andimmunosuppressive effects of glucocorticoids, recent devel-opments and mechanistic insights, Molecular and CellularEndocrinology, 335, no. 1, 2–13, (2011).

[8] E. Charmandari, T. Kino, and G. P. Chrousos, Glucocorticoidsand their actions: An introduction, Annals of the New YorkAcademy of Sciences, 1024, 1–8, (2004).

[9] J. Zhou and J. A. Cidlowski, The human glucocorticoidreceptor: One gene, multiple proteins and diverse responses,Steroids, 70, no. 5-7, 407–417, (2005).

[10] D. Duma, C. M. Jewell, and J. A. Cidlowski, Multiple glucocor-ticoid receptor isoforms and mechanisms of post-translationalmodification, Journal of Steroid Biochemistry and MolecularBiology, 102, no. 1-5, 11–21, (2006).

[11] A. C. Liberman, J. Druker, M. J. Perone, and E. Arzt, Gluco-corticoids in the regulation of transcription factors that controlcytokine synthesis, Cytokine and Growth Factor Reviews, 18,no. 1-2, 45–56, (2007).

[12] M. Surjit, K. P. Ganti, A. Mukherji, T. Ye, G. Hua, D. Met-zger, M. Li, and P. Chambon, Widespread negative responseelements mediate direct repression by agonist-liganded gluco-corticoid receptor, Cell, 145, no. 2, 224–241, (2011).

[13] A. Dostert and T. Heinzel, Negative glucocorticoid receptorresponse elements and their role in glucocorticoid action, Cur-rent Pharmaceutical Design, 10, no. 23, 2807–2816, (2004).

[14] W. H. Hudson, C. Youn, and E. A. Ortlund, The structuralbasis of direct glucocorticoid-mediated transrepression, NatureStructural and Molecular Biology, 20, no. 1, 53–58, (2013).

[15] K. De Bosscher, Selective Glucocorticoid Receptor modula-tors, Journal of Steroid Biochemistry and Molecular Biology,120, no. 2-3, 96–104, (2010).

[16] I. Rogatsky and L. B. Ivashkiv, Glucocorticoid modulation ofcytokine signaling, Tissue Antigens, 68, no. 1, 1–12, (2006).

[17] T.-J. Chang, B. M. Scher, S. Waxman, and W. Scher, Inhibitionof mouse GATA-1 function by the glucocorticoid receptor:Possible mechanism of steroid inhibition of erythroleukemiacell differentiation, Molecular Endocrinology, 7, no. 4, 528–542, (1993).

[18] E. Caldenhoven, J. Liden, S. Wissink, A. Van de Stolpe,J. Raaijmakers, L. Koenderman, S. Okret, J.-A. Gustafsson,and P. T. Van der Saag, Negative cross-talk between RelAand the glucocorticoid receptor: A possible mechanism for

the antiinflammatory action of glucocorticoids, MolecularEndocrinology, 9, no. 4, 401–412, (1995).

[19] E. Imai, J. N. Miner, J. A. Mitchell, K. R. Yamamoto,and D. K. Granner, Glucocorticoid receptor-cAMP responseelement-binding protein interaction and the response of thephosphoenolpyruvate carboxykinase gene to glucocorticoids,Journal of Biological Chemistry, 268, no. 8, 5353–5356,(1993).

[20] J. Liden, I. Rafter, M. Truss, J. Gustafsson, and S. Okret,Glucocorticoid effects on NF-κB binding in the transcriptionof the ICAM-1 gene, Biochemical and Biophysical ResearchCommunications, 273, no. 3, 1008–1014, (2000).

[21] H. Yang-Yen, J. Chambard, Y. Sun, T. Smeal, T. J. Schmidt, J.Drouin, and M. Karin, Transcriptional interference between c-Jun and the glucocorticoid receptor: Mutual inhibition of DNAbinding due to direct protein-protein interaction, Cell, 62, no.6, 1205–1215, (1990).

[22] A. C. Liberman, D. Refojo, J. Druker, M. Toscano, T. Rein, F.Holsboer, and E. Arzt, The activated glucocorticoid receptorinhibits the transcription factor T-bet by direct protein-proteininteraction, FASEB Journal, 21, no. 4, 1177–1188, (2007).

[23] A. C. Liberman, J. Druker, D. Refojo, F. Holsboer, and E. Arzt,Glucocorticoids inhibit GATA-3 phosphorylation and activityin T cells, FASEB Journal, 23, no. 5, 1558–1571, (2009).

[24] M. Beato, Transcriptional control by nuclear receptors, FASEBJournal, 5, no. 7, 2044–2051, (1991).

[25] E. Ayroldi, G.Migliorati, S. Bruscoli, C.Marchetti, O. Zollo, L.Cannarile, F. D’Adamio, and C. Riccardi, Modulation of T-cellactivation by the glucocorticoid-induced leucine zipper factorvia inhibition of nuclear factor κB, Blood, 98, no. 3, 743–753,(2001).

[26] P. Hasselgren, Glucocorticoids and muscle catabolism,CurrentOpinion in Clinical Nutrition and Metabolic Care, 2, no. 3,201–205, (1999).

[27] G. Van De Werve, A. Lange, C. Newgard, M. Méchin, Y. Li,and A. Berteloot, New lessons in the regulation of glucosemetabolism taught by the glucose 6-phosphatase system,European Journal of Biochemistry, 267, no. 6, 1533–1549,(2000).

[28] J. Adom, K. D. Carr, F. Gouilleux, V. Marsaud, and H. Richard-Foy, Chromatin structure of hormono-dependent promoters,Journal of Steroid Biochemistry andMolecular Biology, 40, no.1-3, 325–332, (1991).

[29] D. M. Presman, M. F. Ogara, M. Stortz, L. D. Alvarez, J.R. Pooley, R. L. Schiltz, L. Grontved, T. A. Johnson, P. R.Mittelstadt, J. D. Ashwell, S. Ganesan, G. Burton, V. Levi, G. L.Hager, and A. Pecci, Live cell imaging unveils multiple domainrequirements for in vivo dimerization of the glucocorticoidreceptor, PLoS Biology, 12, p. e1001813, (2014).

[30] W. B. Pratt, The role of heat shock proteins in regulating thefunction, folding, and trafficking of the glucocorticoid receptor,Journal of Biological Chemistry, 268, no. 29, 21455–21458,(1993).

[31] N. Z. Lu and J. A. Cidlowski, Glucocorticoid receptor isoformsgenerate transcription specificity, Trends in Cell Biology, 16,no. 6, 301–307, (2006).

[32] R. H. Oakley and J. A. Cidlowski, Cellular processing of theglucocorticoid receptor gene and protein: New mechanisms forgenerating tissue-specific actions of glucocorticoids, Journal ofBiological Chemistry, 286, no. 5, 3177–3184, (2011).

[33] S. John, P. J. Sabo, T. A. Johnson, M. Sung, S. C. Biddie,S. L. Lightman, T. C. Voss, S. R. Davis, P. S. Meltzer,


J. A. Stamatoyannopoulos, and G. L. Hager, Interaction ofthe Glucocorticoid Receptor with the Chromatin Landscape,Molecular Cell, 29, no. 5, 611–624, (2008).

[34] S. John, P. J. Sabo, R. E. Thurman, M. Sung, S. C. Biddie,T. A. Johnson, G. L. Hager, and J. A. Stamatoyannopoulos,Chromatin accessibility pre-determines glucocorticoid receptorbinding patterns, Nature Genetics, 43, no. 3, 264–268, (2011).

[35] M. Anbalagan, B. Huderson, L. Murphy, and B. G. Rowan,Post-translational modifications of nuclear receptors andhuman disease, Nuclear Receptor Signaling, 10, p. e001,(2012).

[36] I. Grad and D. Picard, The glucocorticoid responses areshaped by molecular chaperones, Molecular and CellularEndocrinology, 275, no. 1-2, 2–12, (2007).

[37] W. B. Pratt and D. O. Toft, Steroid receptor interactions withheat shock protein and immunophilin chaperones, EndocrineReviews, 18, no. 3, 306–360, (1997).

[38] K. De Bosscher and G. Haegeman, Minireview: Latest perspec-tives on antiinflammatory actions of glucocorticoids, Molecu-lar Endocrinology, 23, no. 3, 281–291, (2009).

[39] A. P. Madan and D. B. Defranco, Bidirectional transport of glu-cocorticoid receptors across the nuclear envelope, Proceedingsof the National Academy of Sciences of the United States ofAmerica, 90, no. 8, 3588–3592, (1993).

[40] C. Elbi, D. A.Walker, G. Romero,W. P. Sullivan, D. O. Toft, G.L. Hager, and D. B. DeFranco, Molecular chaperones functionas steroid receptor nuclear mobility factors, Proceedings of theNational Academy of Sciences of the United States of America,101, no. 9, 2876–2881, (2004).

[41] S. Vandevyver, L. Dejager, and C. Libert, On the Trail of theGlucocorticoid Receptor: Into the Nucleus and Back, Traffic,13, no. 3, 364–374, (2012).

[42] M. Denis and J.-A. Gustafsson, The M(r) 90,000 heat shockprotein: An important modulator of ligand and DNA-bindingproperties of the glucocorticoid receptor, Cancer Research, 49,no. 8, (1989).

[43] D. Picard, Chaperoning steroid hormone action, Trends inEndocrinology and Metabolism, 17, no. 6, 229–235, (2006).

[44] E. R. Sanchez, Chaperoning steroidal physiology: Lessonsfrom mouse genetic models of Hsp90 and its cochaperones,Biochimica et Biophysica Acta - Molecular Cell Research,1823, no. 3, 722–729, (2012).

[45] D. Ricketson, U. Hostick, L. Fang, K. R. Yamamoto, and B.D. Darimont, A Conformational Switch in the Ligand-bindingDomain Regulates the Dependence of the GlucocorticoidReceptor on Hsp90, Journal of Molecular Biology, 368, no. 3,729–741, (2007).

[46] J. J. Kovacs, T. J. Cohe, and T. P. Yao, Chaperoning steroidhormone signaling via reversible acetylation, Nuclear ReceptorSignaling, 3, p. e004, (2005).

[47] M. Bucci, F. Roviezzo, C. Cicala, W. C. Sessa, and G. Cirino,Geldanamycin, an inhibitor of heat shock protein 90 (Hsp90)mediated signal transduction has anti-inflammatory effects andinteracts with glucocorticoid receptor in vivo, British Journalof Pharmacology, 131, no. 1, 13–16, (2000).

[48] K. Tago, F. Tsukahara, M. Naruse, T. Yoshioka, and K. Takano,Hsp90 inhibitors attenuate effect of dexamethasone on activatedNF-κB and AP-1, Life Sciences, 74, no. 16, 1981–1992, (2004).

[49] M. C. Rosenhagen, C. Sõti, U. Schmidt, G. M. Wochnik, F.U. Hartl, F. Holsboer, J. C. Young, and T. Rein, The HeatShock Protein 90-Targeting Drug Cisplatin Selectively Inhibits

Steroid Receptor Activation,Molecular Endocrinology, 17, no.10, 1991–2001, (2003).

[50] M. D. Galigniana, J. M. Harrell, P. R. Housley, C. Patterson,S. K. Fisher, and W. B. Pratt, Retrograde transport of theglucocorticoid receptor in neurites requires dynamic assemblyof complexes with the protein chaperone hsp90 and is linkedto the CHIP component of the machinery for proteasomaldegradation, Molecular Brain Research, 123, no. 1-2, 27–36,(2004).

[51] T. Noguchi, S. Makino, R. Matsumoto, S. Nakayama, M.Nishiyama, Y. Terada, and K. Hashimoto, Regulation ofglucocorticoid receptor transcription and nuclear translocationduring single and repeated immobilization stress, Endocrinol-ogy, 151, no. 9, 4344–4355, (2010).

[52] H. Shen, Y. Zhao, X. Chen, R. Xiong, J. Lu, J. Chen, L.Chen, and Y. Zhou, Differential alteration of heat shock protein90 in mice modifies glucocorticoid receptor function andsusceptibility to trauma, Journal of Neurotrauma, 27, no. 2,373–381, (2010).

[53] J. Espallergues, S. L. Teegarden, A. Veerakumar, J. Boulden,C. Challis, J. Jochems, M. Chan, T. Petersen, E. Deneris,P. Matthias, C. Hahn, I. Lucki, S. G. Beck, and O. Berton,HDAC6 regulates glucocorticoid receptor signaling in sero-tonin pathways with critical impact on stress resilience, Journalof Neuroscience, 32, no. 13, 4400–4416, (2012).

[54] G. M. Wochnik, J. Rüegg, G. A. Abel, U. Schmidt, F. Holsboer,and T. Rein, FK506-binding proteins 51 and 52 differentiallyregulate dynein interaction and nuclear translocation of the glu-cocorticoid receptor in mammalian cells, Journal of BiologicalChemistry, 280, no. 6, 4609–4616, (2005).



[57] D. L. Riggs, P. J. Roberts, S. C. Chirillo, J. Cheung-Flynn,V. Prapapanich, T. Ratajczak, R. Gaber, D. Picard, and D. F.Smith, The Hsp90-binding peptidylprolyl isomerase FKBP52potentiates glucocorticoid signaling in vivo, EMBO Journal,22, no. 5, 1158–1167, (2003).

[58] H. Vermeer, B. I. Hendriks-Stegeman, B. Van Der Burg, S.C. Van Buul-Offers, and M. Jansen, Glucocorticoid-inducedincrease in lymphocytic FKBP51 messenger ribonucleic acidexpression: A potential marker for glucocorticoid sensitivity,potency, and bioavailability, Journal of Clinical Endocrinologyand Metabolism, 88, no. 1, 277–284, (2003).

[59] V. Paakinaho, H. Makkonen, T. Jääskeläinen, and J. J. Palvimo,Glucocorticoid receptor activates poised FKBP51 locusthrough long-distance interactions, Molecular Endocrinology,24, no. 3, 511–525, (2010).

[60] T. Jääskeläinen, H. Makkonen, and J. J. Palvimo, Steroidup-regulation of FKBP51 and its role in hormone signaling,Current Opinion in Pharmacology, 11, no. 4, 326–331, (2011).



[62] C. M. Pariante and S. L. Lightman, The HPA axis in majordepression: classical theories and new developments, Trends inNeurosciences, 31, no. 9, 464–468, (2008).

[63] E. B. Binder, The role of FKBP5, a co-chaperone of theglucocorticoid receptor in the pathogenesis and therapy ofaffective and anxiety disorders,Psychoneuroendocrinology, 34,no. 1, S186–S195, (2009).

[64] J. C. Sivils, C. L. Storer, M. D. Galigniana, and M. B. Cox,Regulation of steroid hormone receptor function by the 52-kDa FK506-binding protein (FKBP52), Current Opinion inPharmacology, 11, no. 4, 314–319, (2011).

[65] J. Hartmann, K. V. Wagner, N. Dedic, D. Marinescu, S. H.Scharf, X. Wang, J. M. Deussing, F. Hausch, T. Rein, U.Schmidt, F. Holsboer, M. B. Müller, and M. V. Schmidt,Fkbp52 heterozygosity alters behavioral, endocrine and neuro-genetic parameters under basal and chronic stress conditionsin mice, Psychoneuroendocrinology, 37, no. 12, 2009–2021,(2012).

[66] C. K. Glass and M. G. Rosenfeld, The coregulator exchangein transcriptional functions of nuclear receptors, Genes andDevelopment, 14, no. 2, 121–141, (2000).

[67] N. J. McKenna and B. W. O’Malley, Combinatorial control ofgene expression by nuclear receptors and coregulators, Cell,108, no. 4, 465–474, (2002).

[68] Q. Wang, J. A. Blackford Jr., L. Song, Y. Huang, S. Cho,and S. S. Simons Jr., Equilibrium interactions of corepressorsand coactivators with agonist and antagonist complexes ofglucocorticoid receptors, Molecular Endocrinology, 18, no. 6,1376–1395, (2004).

[69] R. R. Kroe, M. A. Baker, M. P. Brown, N. A. Farrow,E. Gautschi, J. L. Hopkins, R. R. LaFrance, A. Kronkaitis,D. Freeman, D. Thomson, G. Nabozny, C. A. Grygon, andM. E. Labadia, Agonist versus antagonist induce distinctthermodynamic modes of co-factor binding to the glucocorti-coid receptor, Biophysical Chemistry, 128, no. 2-3, 156–164,(2007).

[70] K. Ronacher, K. Hadley, C. Avenant, E. Stubsrud, S. S. SimonsJr., A. Louw, and J. P. Hapgood, Ligand-selective transactiva-tion and transrepression via the glucocorticoid receptor: Roleof cofactor interaction,Molecular and Cellular Endocrinology,299, no. 2, 219–231, (2009).

[71] D. M. Lonard and B. W. O’Malley, Expanding functionaldiversity of the coactivators, Trends in Biochemical Sciences,30, no. 3, 126–132, (2005).

[72] T. Kucera, M. Waltner-Law, D. K. Scott, R. Prasad, and D. K.Granner, A point mutation of the AF2 transactivation domain ofthe glucocorticoid receptor disrupts its interaction with steroidreceptor coactivator 1, Journal of Biological Chemistry, 277,no. 29, 26098–26102, (2002).

[73] M. G. Rosenfeld, V. V. Lunyak, and C. K. Glass, Sensorsand signals: A coactivator/corepressor/epigenetic code for inte-grating signal-dependent programs of transcriptional response,Genes and Development, 20, no. 11, 1405–1428, (2006).

[74] M. Schulz, M. Eggert, A. Baniahmad, A. Dostert, T. Heinzel,and R. Renkawitz, RU486-induced glucocorticoid receptoragonism is controlled by the receptor N terminus and bycorepressor binding, Journal of Biological Chemistry, 277, no.29, 26238–26243, (2002).

[75] R. Kurokawa, M. Soderstrom, A. Horlein, S. Halachmi, M.Brown, M. G. Rosenfeld, and C. K. Glass, Polarity-specificactivities of retinoic acid receptors determined by a co-repressor, Nature, 377, no. 6548, 451–454, (1995).

[76] J. D. Chen and R. M. Evans, A transcriptional co-repressorthat interacts with nuclear hormone receptors, Nature, 377, no.6548, 454–457, (1995).

[77] Y. Yamamoto, O. Wada, M. Suzawa, Y. Yogiashi, T. Yano,S. Kato, and J. Yanagisawa, The Tamoxifen-responsive Estro-gen Receptor α Mutant D351Y Shows Reduced Tamoxifen-dependent Interaction with Corepressor Complexes, Journal ofBiological Chemistry, 276, no. 46, 42684–42691, (2001).

[78] J. Druker, A. C. Liberman, M. Antunica-Noguerol, J. Gerez,M. Paez-Pereda, T. Rein, J. A. Iñiguez-Lluhí, F. Holsboer, andE. Arzta, RSUME enhances glucocorticoid receptor SUMOy-lation and transcriptional activity, Molecular and CellularBiology, 33, no. 11, 2116–2127, (2013).

[79] I. Rogatsky, H. F. Luecke, D. C. Leitman, and K. R.Yamamoto, Alternate surfaces of transcriptional coregulatorGRIP1 function in different glucocorticoid receptor activationand repression contexts, Proceedings of the National Academyof Sciences of the United States of America, 99, no. 26, 16701–16706, (2002).

[80] N. H. Uhlenhaut, G. D. Barish, R. T. Yu, M. Downes, M.Karunasiri, C. Liddle, P. Schwalie, N. Hübner, and R. M.Evans, Insights into Negative Regulation by the Glucocorti-coid Receptor from Genome-wide Profiling of InflammatoryCistromes, Molecular Cell, 49, no. 1, 158–171, (2013).

[81] Y. Chinenov, M. A. Sacta, A. R. Cruz, and I. Rogatsky, GRIP1-associated SET-domain methyltransferase in glucocorticoidreceptor target gene expression, Proceedings of the NationalAcademy of Sciences of the United States of America, 105, no.51, 20185–20190, (2008).

[82] F. D. Urnov and A. P. Wolffe, Chromatin remodeling andtranscriptional activation: The cast (in order of appearance),Oncogene, 20, no. 24, 2991–3006, (2001).

[83] M. G. Guenther, W. S. Lane, W. Fischle, E. Verdin, M. A.Lazar, and R. Shiekhattar, A core SMRT corepressor complexcontaining HDAC3 and TBL1, a WD40-repeat protein linkedto deafness, Genes and Development, 14, no. 9, 1048–1057,(2000).

[84] E. Y. Huang, J. Zhang, E. A. Miska, M. G. Guenther, T.Kouzarides, and M. A. Lazar, Nuclear receptor corepressorspartner with class II histone deacetylases in a Sin3-independentrepression pathway, Genes and Development, 14, no. 1, 45–54,(2000).

[85] C. D. Laherty,W. Yang, S. Jian-Min, J. R. Davie, E. Seto, and R.N. Eisenman, Histone deacetylases associated with the mSin3corepressor mediate Mad transcriptional repression, Cell, 89,no. 3, 349–356, (1997).

[86] M. G. Guenther, O. Barak, and M. A. Lazar, The SMRTand N-CoR corepressors are activating cofactors for histonedeacetylase 3, Molecular and Cellular Biology, 21, no. 18,6091–6101, (2001).

[87] K. Ito, S. Lim, G. Caramori, B. Cosio, K. F. Chung, I. M.Adcock, and P. J. Barnes, A molecular mechanism of actionof theophylline: Induction of histone deacetylase activity todecrease inflammatory gene expression, Proceedings of theNational Academy of Sciences of the United States of America,99, no. 13, 8921–8926, (2002).

[88] K. Ito, S. Yamamura, S. Essilfie-Quaye, B. Cosio, M. Ito, P.J. Barnes, and I. M. Adcock, Histone deacetylase 2-mediateddeacetylation of the glucocorticoid receptor enables NF-κBsuppression, Journal of Experimental Medicine, 203, no. 1, 7–13, (2006).


[89] D. Ratman, W. Vanden Berghe, L. Dejager, C. Libert, J.Tavernier, I. M. Beck, and K. De Bosscher, How glucocorticoidreceptors modulate the activity of other transcription factors: Ascope beyond tethering, Molecular and Cellular Endocrinol-ogy, (2013).

[90] J. J. Kovacs, P. J. M. Murphy, S. Gaillard, X. Zhao, J. Wu, C.V. Nicchitta, M. Yoshida, D. O. Toft, W. B. Pratt, and T. Yao,HDAC6 regulates Hsp90 acetylation and chaperone-dependentactivation of glucocorticoid receptor,Molecular Cell, 18, no. 5,601–607, (2005).

[91] T. Van Nguyen, P. Angkasekwinai, H. Dou, F. Lin, L. Lu, J.Cheng, Y. E. Chin, C. Dong, and E. T. H. Yeh, SUMO-SpecificProtease 1 Is Critical for Early Lymphoid Development throughRegulation of STAT5 Activation, Molecular Cell, 45, no. 2,210–221, (2012).

[92] L. Miller, C. D. Foradori, A. S. Lalmansingh, D. Sharma, R.J. Handa, and R. M. Uht, Histone deacetylase 1 (HDAC1)participates in the down-regulation of corticotropin releasinghormone gene (crh) expression, Physiology and Behavior, 104,no. 2, 312–320, (2011).

[93] Y. Qiu, Y. Zhao, M. Becker, S. John, B. S. Parekh, S. Huang, A.Hendarwanto, E. D. Martinez, Y. Chen, H. Lu, N. L. Adkins,D. A. Stavreva, M. Wiench, P. T. Georgel, R. L. Schiltz, andG. L. Hager, HDAC1 Acetylation Is Linked to ProgressiveModulation of Steroid Receptor-Induced Gene Transcription,Molecular Cell, 22, no. 5, 669–679, (2006).

[94] Y. Luo, W. Jian, D. Stavreva, X. Fu, G. Hager, J. Bungert,S. Huang, and Y. Qiu, Trans-regulation of histone deacetylaseactivities through acetylation, Journal of Biological Chemistry,284, no. 50, 34901–34910, (2009).

[95] V. Kadiyala, N. M. Patrick, W. Mathieu, R. Jaime-Frias, N.Pookhao, L. An, and C. L. Smith, Class I lysine deacetylasesfacilitate glucocorticoid-induced transcription, The Journal ofbiological chemistry, 288, 28900–28912, (2013).

[96] M. R. Yudt and J. A. Cidlowski, Molecular identificationand characterization of A and B forms of the glucocorticoidreceptor, Molecular Endocrinology, 15, no. 7, 1093–1103,(2001).

[97] N. C. Nicolaides, Z. Galata, T. Kino, G. P. Chrousos, and E.Charmandari, The human glucocorticoid receptor: Molecularbasis of biologic function, Steroids, 75, no. 1, 1–12, (2010).

[98] K. L. Gross and J. A. Cidlowski, Tissue-specific glucocor-ticoid action: a family affair, Trends in Endocrinology andMetabolism, 19, no. 9, 331–339, (2008).

[99] E. Orti, D. B. Mendel, L. I. Smith, and A. Munck, Agonist-dependent phosphorylation and nuclear dephosphorylation ofglucocorticoid receptors in intact cells, Journal of BiologicalChemistry, 264, no. 17, 9728–9731, (1989).

[100] N. Ismaili and M. J. Garabedian, Modulation of glucocorticoidreceptor function via phosphorylation, Annals of the New YorkAcademy of Sciences, 1024, 86–101, (2004).

[101] I. M. E. Beck, W. V. Berghe, L. Vermeulen, K. R. Yamamoto,G. Haegeman, and K. De Bosscher, Crosstalk in inflammation:The interplay of glucocorticoid receptor-basedmechanisms andkinases and phosphatases, Endocrine Reviews, 30, no. 7, 830–882, (2009).

[102] A. M. S. Garza, S. H. Khan, and R. Kumar, Site-specificphosphorylation induces functionally active conformation inthe intrinsically disordered N-terminal activation function(AF1) domain of the glucocorticoid receptor, Molecular andCellular Biology, 30, no. 1, 220–230, (2010).

[103] Z. Wang, J. Frederick, and M. J. Garabedian, Deciphering thephosphorylation “code” of the glucocorticoid receptor in vivo,Journal of Biological Chemistry, 277, no. 29, 26573–26580,(2002).

[104] Z. Wang, W. Chen, E. Kono, T. Dang, and M. J. Garabedian,Modulation of glucocorticoid receptor phosphorylation andtranscriptional activity by a C-terminal-associated proteinphosphatase, Molecular Endocrinology, 21, no. 3, 625–634,(2007).

[105] R. D. Blind and M. J. Garabedian, Differential recruitmentof glucocorticoid receptor phospho-isoforms to glucocorticoid-induced genes, Journal of Steroid Biochemistry and MolecularBiology, 109, no. 1-2, 150–157, (2008).

[106] A. J. Galliher-Beckley, J. G. Williams, and J. A. Cidlowski,Ligand-independent phosphorylation of the glucocorticoidreceptor integrates cellular stress pathways with nuclear recep-tor signaling, Molecular and Cellular Biology, 31, no. 23,4663–4675, (2011).

[107] J. C. Webster, C. M. Jewell, J. E. Bodwell, A. Munck,M. Sar, and J. A. Cidlowski, Mouse glucocorticoid receptorphosphorylation status influences multiple functions of thereceptor protein, Journal of Biological Chemistry, 272, no. 14,9287–9293, (1997).

[108] N. Mercado, A. Hakim, Y. Kobayashi, S. Meah, O. S.Usmani, K. F. Chung, P. J. Barnes, and K. Ito, Restorationof corticosteroid sensitivity by p38 mitogen activated proteinkinase inhibition in peripheral blood mononuclear cells fromsevere asthma, PLoS ONE, 7, no. 7, p. e41582, (2012).

[109] I. Simic, M. Adzic, N. Maric, D. Savic, J. Djordjevic, M.Mihaljevic, M. Mitic, Z. Pavlovic, I. Soldatovic, M. Krstic-Demonacos, M. Jasovic-Gasic, andM. Radojcic, A preliminaryevaluation of leukocyte phospho-glucocorticoid receptor as apotential biomarker of depressogenic vulnerability in healthyadults, Psychiatry Research, (2013).

[110] G. Guidotti, F. Calabrese, C. Anacker, G. Racagni, C. M.Pariante, and M. A. Riva, Glucocorticoid receptor and fkbp5expression is altered following exposure to chronic stress:Modulation by antidepressant treatment, Neuropsychopharma-cology, 38, no. 4, 616–627, (2013).

[111] C. Anacker, P. A. Zunszain, A. Cattaneo, L. A. Carvalho,M. J. Garabedian, S. Thuret, J. Price, and C. M. Pariante,Antidepressants increase human hippocampal neurogenesis byactivating the glucocorticoid receptor, Molecular Psychiatry,16, no. 7, 738–750, (2011).

[112] N. L. Weigel and N. L. Moore, Kinases and protein phosphory-lation as regulators of steroid hormone action,Nuclear receptorsignaling, 5, p. e005, (2007).

[113] J. Trepel, M. Mollapour, G. Giaccone, and L. Neckers, Tar-geting the dynamic HSP90 complex in cancer, Nature ReviewsCancer, 10, no. 8, 537–549, (2010).

[114] L. S. Treviño andN. L.Weigel, Phosphorylation: a fundamentalregulator of steroid receptor action, Trends in Endocrinologyand Metabolism, 24, no. 10, 515–524, (2013).

[115] Y. Miyata, CK2: The kinase controlling the Hsp90 chaperonemachinery, Cellular and Molecular Life Sciences, 66, no. 11-12, 1840–1849, (2009).

[116] Y. Miyata, B. Chambraud, C. Radanyi, J. Leclerc, M. Lebeau,J. Renoir, R. Shirai, M. Catelli, I. Yahara, and E. Baulieu,Phosphorylation of the immunosuppressant FK506-bindingprotein FKBP52 by casein kinase II: Regulation of HSP90-binding activity of FKBP52, Proceedings of the National


Academy of Sciences of the United States of America, 94, no.26, 14500–14505, (1997).

[117] M. Mollapour, S. Tsutsumi, and L. Neckers, Hsp90 phospho-rylation, Wee1, and the cell cycle, Cell Cycle, 9, no. 12, 2310–2316, (2010).

[118] E. G. Mimnaugh, P. J. Worland, L. Whitesell, and L. M.Neckers, Possible role for serine/threonine phosphorylation inthe regulation of the heteroprotein complex between the hsp90stress protein and the pp60v-src tyrosine kinase, Journal ofBiological Chemistry, 270, no. 48, 28654–28659, (1995).

[119] M. Mollapour, S. Tsutsumi, A. W. Truman, W. Xu, C. K.Vaughan, K. Beebe, A. Konstantinova, S. Vourganti, B. Panare-tou, P. W. Piper, J. B. Trepel, C. Prodromou, L. H. Pearl, andL. Neckers, Threonine 22 Phosphorylation Attenuates Hsp90Interaction with Cochaperones and Affects Its ChaperoneActivity, Molecular Cell, 41, no. 6, 672–681, (2011).

[120] J. Dobrovolna, Y. Chinenov, M. A. Kennedy, B. Liu, andI. Rogatsky, Glucocorticoid-dependent phosphorylation of thetranscriptional coregulator GRIP1, Molecular and CellularBiology, 32, no. 4, 730–739, (2012).

[121] N. Nader, G. P. Chrousos, and T. Kino, Circadian rhythm tran-scription factor CLOCK regulates the transcriptional activityof the glucocorticoid receptor by acetylating its hinge regionlysine cluster: Potential physiological implications, FASEBJournal, 23, no. 5, 1572–1583, (2009).

[122] P. J. M. Murphy, Y. Morishima, J. J. Kovacs, T. Yao, andW. B. Pratt, Regulation of the dynamics of hsp90 actionon the glucocorticoid receptor by acetylation/deacetylation ofthe chaperone, Journal of Biological Chemistry, 280, no. 40,33792–33799, (2005).

[123] M. Fukada, A. Hanai, A. Nakayama, T. Suzuki, N. Miyata, R.M. Rodriguiz, W. C. Wetsel, T. Yao, and Y. Kawaguchi, Lossof deacetylation activity of Hdac6 affects emotional behavior inmice, PLoS ONE, 7, no. 2, p. e30924, (2012).

[124] S. Bilodeau, S. Vallette-Kasic, Y. Gauthier, D. Figarella-Branger, T. Brue, F. Berthelet, A. Lacroix, D. Batista, C.Stratakis, J. Hanson, B. Meij, and J. Drouin, Role of Brg1 andHDAC2 inGR trans-repression of the pituitary POMCgene andmisexpression in Cushing disease,Genes and Development, 20,no. 20, 2871–2886, (2006).

[125] B. T. Scroggins, K. Robzyk, D. Wang, M. G. Marcu, S.Tsutsumi, K. Beebe, R. J. Cotter, S. Felts, D. Toft, L. Karnitz,N. Rosen, and L. Neckers, An Acetylation Site in the MiddleDomain of Hsp90 Regulates Chaperone Function, MolecularCell, 25, no. 1, 151–159, (2007).

[126] Y. Lee, S. A. Coonrod, W. L. Kraus, M. A. Jelinek, and M.R. Stallcup, Regulation of coactivator complex assembly andfunction by protein arginine methylation and demethylimina-tion, Proceedings of the National Academy of Sciences of theUnited States of America, 102, no. 10, 3611–3616, (2005).

[127] M. Abu-Farha, S. Lanouette, F. Elisma, V. Tremblay, J. Butson,D. Figeys, and J. Couture, Proteomic analyses of the SMYDfamily interactomes identify HSP90 as a novel target forSMYD2, Journal of Molecular Cell Biology, 3, no. 5, 301–308,(2011).

[128] L. T. Donlin, C. Andresen, S. Just, E. Rudensky, C. T.Pappas, M. Kruger, E. Y. Jacobs, A. Unger, A. Zieseniss,M. Dobenecker, T. Voelkel, B. T. Chait, C. C. Gregorio, W.Rottbauer, A. Tarakhovsky, and W. A. Linke, Smyd2 controlscytoplasmic lysine methylation of Hsp90 and myofilamentorganization, Genes and Development, 26, no. 2, 114–119,(2012).

[129] A. Ciechanover, A. Orian, and A. L. Schwartz, The ubiquitin-mediated proteolytic pathway: mode of action and clinicalimplications, Journal of cellular biochemistry. Supplement, 34,40–51, (2000).

[130] D. Kornitzer and A. Ciechanover, Modes of regulation ofubiquitin-mediated protein degradation, Journal of CellularPhysiology, 182, no. 1, 1–11, (2000).

[131] A. D. Wallace and J. A. Cidlowski, Proteasome-mediatedGlucocorticoid Receptor Degradation Restricts TranscriptionalSignaling byGlucocorticoids, Journal of Biological Chemistry,276, no. 46, 42714–42721, (2001).


[133] A. D. Wallace, Y. Cao, S. Chandramouleeswaran, and J. A.Cidlowski, Lysine 419 targets human glucocorticoid receptorfor proteasomal degradation, Steroids, 75, no. 12, 1016–1023,(2010).

[134] H. K. Kinyamu and T. K. Archer, Proteasome activitymodulates chromatin modifications and RNA polymerase IIphosphorylation to enhance glucocorticoid receptor-mediatedtranscription, Molecular and Cellular Biology, 27, no. 13,4891–4904, (2007).

[135] H. K. Kinyamu, J. Chen, and T. K. Archer, Linkingthe ubiquitin-proteasome pathway to chromatin remodel-ing/modification by nuclear receptors, Journal of MolecularEndocrinology, 34, no. 2, 281–297, (2005).

[136] D. A. Stavreva, W. G. Müller, G. L. Hager, C. L. Smith,and J. G. McNally, Rapid Glucocorticoid Receptor Exchangeat a Promoter Is Coupled to Transcription and Regulated byChaperones and Proteasomes,Molecular and Cellular Biology,24, no. 7, 2682–2697, (2004).

[137] X. Wang and D. B. DeFranco, Alternative effects of theubiquitin-proteasome pathway on glucocorticoid receptordown-regulation and transactivation are mediated by CHIP, anE3 ligase, Molecular Endocrinology, 19, no. 6, 1474–1482,(2005).

[138] R. M. Sapolsky and B. S. McEwen, Down-regulation of neuralcorticosterone receptors by corticosterone and dexamethasone,Brain Research, 339, no. 1, 161–165, (1985).

[139] X. Wang, J. L. Pongrac, and D. B. DeFranco, Glucocorticoidreceptors in hippocampal neurons that do not engage protea-somes escape from hormone-dependent down-regulation butmaintain transactivation activity, Molecular Endocrinology,16, no. 9, 1987–1998, (2002).

[140] P. Connell, C. A. Ballinger, J. Jiang, Y. Wu, L. J. Thompson, J.Höhfeld, and C. Patterson, The co-chaperone CHIP regulatesprotein triage decisions mediated by heat-shock proteins,Nature Cell Biology, 3, no. 1, 93–96, (2001).

[141] S. Qian, H. McDonough, F. Boellmann, D. M. Cyr, andC. Patterson, CHIP-mediated stress recovery by sequentialubiquitination of substrates and Hsp70, Nature, 440, no. 7083,551–555, (2006).

[142] J. L. Morales and G. H. Perdew, Carboxyl terminus of hsc70-interacting protein (CHIP) can remodel mature Aryl hydrocar-bon Receptor (AhR) complexes and mediate ubiquitination ofboth the AhR and the 90 kDa heat-shock protein (hsp90) invitro, Biochemistry, 46, no. 2, 610–621, (2007).


[143] L. Kundrat and L. Regan, Identification of Residues on Hsp70and Hsp90 Ubiquitinated by the Cochaperone CHIP, Journal ofMolecular Biology, 395, no. 3, 587–594, (2010).

[144] F. Yan, X. Gao, D.M. Lonard, and Z. Nawaz, Specific ubiquitin-conjugating enzymes promote degradation of specific nuclearreceptor coactivators, Molecular Endocrinology, 17, no. 7,1315–1331, (2003).

[145] T. Hoang, I. S. Fenne, C. Cook, B. Børud,M. Bakke, E. A. Lien,and G. Mellgren, cAMP-dependent protein kinase regulatesubiquitin-proteasome-mediated degradation and subcellularlocalisation of the nuclear receptor coactivator GRIP1, Journalof Biological Chemistry, 279, no. 47, 49120–49130, (2004).

[146] S. K. Godavarthi, P. Dey, M. Maheshwari, and N. R. Jana,Defective glucocorticoid hormone receptor signaling leads toincreased stress and anxiety in a mouse model of Angelmansyndrome, Human Molecular Genetics, 21, no. 8, 1824–1834,(2012).

[147] J. Murtagh, H. Lu, and E. L. Schwartz, Taxotere-inducedinhibition of human endothelial cell migration is a result ofheat shock protein 90 degradation, Cancer Research, 66, no.16, 8192–8199, (2006).

[148] M. Blank, M. Mandel, Y. Keisari, D. Meruelo, and G. Lavie,Enhanced Ubiquitinylation of Heat Shock Protein 90 as aPotential Mechanism for Mitotic Cell Death in Cancer CellsInduced with Hypericin, Cancer Research, 63, no. 23, 8241–8247, (2003).

[149] R. T. Hay, SUMO: A history of modification, Molecular Cell,18, no. 1, 1–12, (2005).

[150] J. R. Gareau and C. D. Lima, The SUMO pathway: Emergingmechanisms that shape specificity, conjugation and recognition,Nature Reviews Molecular Cell Biology, 11, no. 12, 861–871,(2010).

[151] S. Müller, C. Hoege, G. Pyrowolakis, and S. Jentsch, Sumo,ubiquitin’s mysterious cousin, Nature Reviews Molecular CellBiology, 2, no. 3, 202–210, (2001).

[152] S. Holmstrom, M. E. Van Antwerp, and J. A. Iñiguez-Lluhí,Direct and distinguishable inhibitory roles for SUMO isoformsin the control of transcriptional synergy, Proceedings of theNational Academy of Sciences of the United States of America,100, no. 26, 15758–15763, (2003).

[153] Y. Le Drean, N. Mincheneau, P. Le Goff, and D. Michel,Potentiation of glucocorticoid receptor transcriptional activityby sumoylation,Endocrinology, 143, no. 9, 3482–3489, (2002).

[154] S. Tian, H. Poukka, J. J. Palvimo, and O. A. Jänne, Smallubiquitin-related modifier-1 (SUMO-1) modification of theglucocorticoid receptor, Biochemical Journal, 367, no. 3, 907–911, (2002).

[155] F. Golebiowski, I. Matic, M. H. Tatham, C. Cole, Y. Yin, A.Nakamura, J. Cox, G. J. Barton, M. Mann, and R. T. Hay,System-wide changes to sumomodifications in response to heatshock, Science Signaling, 2, no. 72, p. ra24, (2009).

[156] J. A. Iniguez-Lluhi and D. Pearce, A common motif within thenegative regulatory regions of multiple factors inhibits theirtranscriptional synergy, Molecular and Cellular Biology, 20,no. 16, 6040–6050, (2000).

[157] S. R. Holmstrom, S. Chupreta, A. Y. So, and J. A. Iñiguez-Lluhí, SUMO-mediated inhibition of glucocorticoid receptorsynergistic activity depends on stable assembly at the promoterbut not on DAXX, Molecular Endocrinology, 22, no. 9, 2061–2075, (2008).

[158] A. Carbia-Nagashima, J. Gerez, C. Perez-Castro, M. Paez-Pereda, S. Silberstein, G. K. Stalla, F. Holsboer, and E. Arzt,

RSUME, a Small RWD-Containing Protein, Enhances SUMOConjugation and Stabilizes HIF-1α during Hypoxia, Cell, 131,no. 2, 309–323, (2007).

[159] V. Paakinaho, S. Kaikkonen, H. Makkonen, V. Benes, and J.J. Palvimo, SUMOylation regulates the chromatin occupancyand anti-proliferative gene programs of glucocorticoid receptor,Nucleic Acids Research, 42, no. 3, 1575–1592, (2014).

[160] L. Davies, N. Karthikeyan, J. T. Lynch, E. Sial, A. Gkourtsa, C.Demonacos, andM. Krstic-Demonacos, Cross talk of signalingpathways in the regulation of the glucocorticoid receptorfunction, Molecular Endocrinology, 22, no. 6, 1331–1344,(2008).

[161] D. Tempé, M. Piechaczyk, and G. Bossis, SUMO under stress,Biochemical Society Transactions, 36, no. 5, 874–878, (2008).

[162] V. G. Panse, U. Hardeland, T. Werner, B. Kuster, and E. Hurt,A proteome-wide approach identifies sumoylated substrateproteins in yeast, Journal of Biological Chemistry, 279, no. 40,41346–41351, (2004).

[163] D. L. Pountney, M. J. Raftery, F. Chegini, P. C. Blumbergs, andW. P. Gai, NSF, Unc-18-1, dynamin-1 and HSP90 are inclusionbody components in neuronal intranuclear inclusion diseaseidentified by anti-SUMO-1-immunocapture, Acta Neuropatho-logica, 116, no. 6, 603–614, (2008).

[164] W. Zhou, J. J. Ryan, and H. Zhou, Global analyses ofsumoylated proteins in Saccharomyces cerevisiae. Induction ofprotein sumoylation by cellular stresses, Journal of BiologicalChemistry, 279, no. 31, 32262–32268, (2004).

[165] M. Mollapour, D. Bourboulia, K. Beebe, M. R. Woodford, S.Polier, A. Hoang, R. Chelluri, Y. Li, A. Guo, M. J. Lee, E.Fotooh-Abadi, S. Khan, T. Prince, N. Miyajima, S. Yoshida,S. Tsutsumi, W. Xu, B. Panaretou, W. G. Stetler-Stevenson,G. Bratslavsky, J. B. Trepel, C. Prodromou, and L. Neckers,Asymmetric Hsp90 N Domain SUMOylation Recruits Aha1and ATP-Competitive Inhibitors, Molecular Cell, 53, no. 2,317–329, (2014).

[166] N. Kotaja, S. Aittomäki, O. Silvennoinen, J. J. Palvimo, andO. A. Jänne, ARIP3 (androgen receptor-interacting protein 3)and other PIAS (protein inhibitor of activated STAT) proteinsdiffer in their ability to modulate steroid receptor-dependenttranscriptional activation, Molecular Endocrinology, 14, no.12, 1986–2000, (2000).




Review Article

Investigation of Interactions between DNA andNuclear Receptors: A Review of theMost UsedMethods

Juliana Fattori, Nathalia de Carvalho Indolfo, Jéssica Christina Lóis de Oliveira Campos,Natália Bernardi Videira, Aline Villanova Bridi, Tábata RenéeDoratioto,Michelle Alexan-drino de Assis, and Ana CarolinaMigliorini Figueira

Brazilian Biosciences National Laboratory (LNBio), Brazilian Center for Research in Energy and Materials (CNPEM), P.O. Box6192, Campinas-SP, Brazil

Corresponding Author: Ana Carolina Migliorini Figueira; email: [email protected]

Recieved 29 April 2014; Accepted 5 August 2014

Editor: Mario Galigniana

Copyright © 2014 Juliana Fattori et al. This is an open access article distributed under the Creative Commons Attribution License,which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.

Abstract. Nuclear receptors (NRs) comprise a superfamily of proteins modulated by ligands that regulate the expression of targetgenes. These proteins share a multidomain structure harboring an N-terminal domain, a highly conserved DNA binding domain,and a ligand binding domain, which has ligand dependent activation function. They play key roles in development, metabolism,and physiology being closely related to diseases. Most of the knowledge about this superfamily emerges from investigations on newligands and are mostly centered in the ligand binding domain. However, more investigation focusing on interactions between DNAand DNA binding domain is necessary to shed light on important roles of NRs’ participation in transcriptional mechanisms andin specific genes network. Here, our goal is to discuss some nuances of NRs-DNA interaction, describing details of the most usedtechniques in this sort of study, such as gel shift (EMSA), DNA footprinting, reporter gene assay, ChIP-Seq, 3C, and fluorescenceanisotropy. Additionally, we aim to provide tools, presenting advantages and disadvantages of these common methods, whenchoosing the most suitable one to study NRs-DNA interactions to answer specific questions.

Keywords: nuclear receptors, DNA binding domain, protein-DNA interaction, ChiP-seq, DNA footprinting, EMSA, fluorescenceanisotropy

1. Introduction

Nuclear receptors (NRs) are members of a superfamily oftranscription factors modulated by ligands, which regulatethe expression of target genes and, therefore, play key rolesin development, metabolism, physiology, and disease [1–3].The activity of the majority of NRs is induced by ligandsor small lipophilic molecules such as steroids, hormones,

vitamins, and fatty acids. However, this family also possessesthe orphan nuclear receptors, for which once ligands remainunknown or could not exist, presenting unknown activity andsuggesting that NRs’ activity can also be regulated by otherprocesses [2, 4, 5].

Traditionally, NRs act as homo- or heterodimers andshare the same mechanism of action. In a classical view,unliganded NRs may be located in the cytoplasm, bound to


chaperones, or in the nucleus, bound to DNA, where theyrecruit corepressor complexes, which associate with HDAC(histone deacetyltransferases) to inhibit gene expression.Ligand addition induces translocation of cytoplasmatic NRsto the nucleus and promotes conformational changes inthe NR structure, allowing corepressor dissociation and therecruitment of coactivator complexes that have HAT (histoneacetyltransferase) activity to activate the transcription oftarget genes [1, 6].

However, alternative mechanisms of action have beendescribed for this class of proteins, which includes bothactivation by posttranslational modifications and associationwith other transcription factors (TFs) [7]. For instance,the PPAR𝛾 sumoylation is a critical event that signalscorepressor recruitment, even after PPAR𝛾 ligand binding,keeping inflammatory gene promoters in a transrepressedstate [6, 8]. Moreover, the interaction between different TFs,resulting in cooperative enhancing or inhibition of geneexpression, also named crosstalk, is an alternative NR actionthat explains, for example, the negative regulation of TSH𝛽gene by TR [7], or the blocked activity of NF-k𝛽 by differentNRs, such as GR, ER, PR, and AR [6].

Apart from sharing the general action mechanism, allNRs also present a similar modular structure including anaminoterminal domain, which contains the ligand indepen-dent activation function-1 (AF-1), a core DNA bindingdomain (DBD) that is responsible for recognizing andbinding to DNA sequences, linked by a hinge to the ligandbinding domain (LBD), which binds to ligands and recruitscoregulators (Figure 1) [1].

Discovery of the NRs and most of the knowledge aboutthem came from physiological investigations on hormonesand ligands [9–12]. The identification of natural or syntheticligands shed light over NRs roles in human physiology, wherethey are considered drug targets [13–17]. Meanwhile, there isstill a lot to be understood about NRs in the context of specificgene networks’ transcription [18]. In other words, there aremany studies focusing on NRs binding to ligands, seekingmolecules that can modulate them, and less studies focusingon how NRs bind to DNA.

In fact, the protein’s ability to recognize DNA sequences,associated with the capacity of binding to specific sites acrossthe genome, is a hallmark in gene regulation andmaintenance[19, 20]. Initially, some codes for protein-DNA recognitionwere reported based on hydrogen bonding patterns betweenamino acids and nucleotides, in the DNAmajor groove. Also,arginine side chain was considered important to make thesecontacts [21]. Recently, the development of new technolo-gies, such as computational simulations and high-throughputspectroscopic techniques, is uncovering new complexities ofprotein-DNA interactions, displaying that simple recognitioncodes for these interactions are much more complex. In thisway, it is known that there are multiple modes of DNAbinding to proteins, and variables such as spacers of DNAbinding sites, multimeric protein binding, and alternative

structural conformations should be considered together withcooperativity, allostery, and cofactor presence [19]. Partic-ularly, to nuclear receptors, the main interactions betweenprotein and DNA are made by the DNA binding domain.Albeit other interactions with N-terminal domain and LBDhave been reported, they are specific to few receptors and stillshould not have been considered as functions [2, 3, 5].

1.1. A brief review of the DNA binding domain structure.For nuclear receptors, DNA recognition is controlled bythe highly conserved DNA binding domain (or C domain).Structurally, the DBD is a very compact globular domain,generally composed by 100 amino acids which are organizedin two main perpendicular helices, with conserved cysteinesrequired for high-affinity DNA binding (Figure 2) [1]. Thefirst DBD structure determination was in 1990 throughnuclear magnetic resonance (NMR) [22]. However, since thefirst crystallographic structure of DBD on DNA was solved,in 1991 [23], X-ray crystallography has become a pivotalmethod in unraveling DBD-DNA interaction at atomic levels[24].

As shown in Figure 2, the DNA binding domain ofall NRs presents two helices that pack together throughtheir hydrophobic faces in a perpendicular way, formingthe core domain with the two zinc fingers, contributingto the DBD integral fold [25]. The first 𝛼-helix, termedrecognition helix, directly inserts itself to the DNA majorgroove, making contacts with the DNA phosphate backbone,forming a crucial substructure for the DNA-protein binding[25]. Amino acid residues at the base of the first zincfinger constitute the so-called P box that is involved inthe discrimination of the response elements. Furthermore,residues in the second zinc finger form the D box and areinvolved in dimerization [1] and the C-terminal extension ofDBD harbors T and A boxes, which contribute to contacts inthe flanking DNA core recognition sequences [1, 26, 29].

Protein-DNA binding interfaces are also extended byordered water molecules which make specific interactionsbetween protein side chains and DNA functional groups.Apart from the specific interactions, there are several non-specific ones formed between basic side chains of the DBDand the DNA phosphodiester backbone [25–28].

Despite mediating DNA specificity, 𝛼-helix 1 contributeslittle to the discrimination of target-site symmetry. It has beenshown that 𝛼-helix 2 is the main responsible for selectingsymmetry for DNA recognition motifs, which also projectsacross the minor groove of the DNA, creating additionalcontacts that stabilize DBD-DNA binding. Additionally,some studies suggest that the specificity in DBD-DNArecognition is derived not only from the DNA sequence, butalso from its geometry [25–28].

1.2. DBD-DNA binding and specificity. Although some NRscan bind to DNA as monomers, it was shown that the mostcommon DNA binding happens when NRs are organized as


N-terminal

domian

C-terminal

domian

Ligand binding

domian

AF-2

AF-2 DNA biniding domain Hinge

Figure 1: Typical domain organization of NRs, showing, in purple, the N-terminal domain, harboring the activation function ligandindependent (AF-1); in light brown, the DNA binding domain, responsible for DNA binding; in light green, the hinge, which connects DBDand LBD; in yellow, the ligand binding domain (LBD) with the activation function ligand dependent (AF-2); and, in pink, the C-terminalportion.

Figure 2: Illustration of the nuclear receptors’ DBD. DBD is shown in dimeric form (in purple and pink) with two zinc ions (in gray)coordinated to each monomer bound to DNA (PDB: 1HCQ modified). On the right side, details of the two zinc fingers, each one beingcoordinated by four cysteines. Helix 1 or the recognition 𝛼-helix shown in light pink comprises the P box. The second zinc finger comprisesresidues forming the highlighted D box or dimerization interface. Finally, helix 2 is shown in red in the carboxiterminal extension (CTE).Adapted from 21.

homo- or heterodimers, with this being the best geometryarray for recognition of binding sites [25]. Generally, bindingto DNA occurs in specific DNA motifs, also termed asDNA response elements (REs). It has also been postulatedthat the formation of homo- and heterodimers betweenreceptors DBDs occurs simultaneously to element responserecognition [25].

In general, the REs are composed by hexameric sequencesarranged in distinct configurations, including inverted,everted, and direct repeats. The specificities of one RE, towhich each NR binds to, affects directly its function, andwhether the receptor will work as an activator or repressorof the transcription [25]. The response elements may belocated in regulatory sequences, generally found in the 5’region of the target gene, near the core promoter accordingto the NRs classical mechanism of action [1]. However,recent studieswith new technologies posit that themajority ofREs are found distally from promoters, as enhancers withintranscription initiation site and, also, within intergenic andintronic regions [30, 31].

Typically, the consensus RE is composed by variationsof two half-sites, which are in turn composed by hexamericsequences of 5’-PuAGGTCA-3’. These half-sites may beseparated by different numbers of nucleotides [1], whichcan vary from 1 to hundreds of base pairs [32]. Idealized

REs were divided into two generic groups: one is betterrecognized by steroid receptors, composed by 5’-AGAACA-3’, and the other, composed by 5’-AGGTCA-3’, is preferablybound by nonsteroidal and orphan receptors [1, 25, 28, 33].Nevertheless, it has been shown that these sequences may bedegenerated, since PuGGTCA and PuGGACA were identi-fied as the best binders for ER andGR, respectively [27]. Thisvariety of combinations may lead to increases in selectivityfor each NR, as it was presented for TRs and RAR preferablybinds to response elements comprised by AGGACA andAGTTCA, respectively [34]. Obviously, natural occurrenceof these REs can present slight variations from the consensussequence. Furthermore, structural studies have unraveledthat the spacing between the half-sites is pivotal to the RErecognition and that the dimerization patterns of the NRsDBDs are reflected in their RE architectures [25].

However, to address questions about specificity andrecognition, it is inevitable to mention the NR regardingchromatin context. While NRs act as sensors of externalsignals leading to a rapid regulatory response, chromatinaccessibility plays as a way to specify the recruitment of NRsto regulatory elements [35]. In a classical mode, NRs bindto specific REs and recruit cofactors that modify the localchromatin structure and recruit RNA polymerases enhancingtranscription (Figure 3). These structure modifications define


the chromatin state (active or silent) via histones modifica-tion.

In this context, the best characterized ones, mediated byNRs, are histone acetylation, deacetylation, and methylation[36]. While histone acetylation generally confers chromatindecondensation, via acetyltransferases recruitment (HAT),histone deacetylation, via deacetyltransferases (HDAC),counterparts by associating to chromatin condensation withthe deacetylate histones complexes. Themethylation process,on the other hand, is associated with both activation andrepression, depending on the modified residue and onthe number of incorporated methyl groups. For instance,methylation of lysine four (K4) in histone H3 activates achromatin state, which stimulates transcriptional activation.Otherwise, methylation of K9 in histone H3 is associatedwith transcriptional suppression, inducing an inactivatedchromosomal state [35, 36].

According to previous studies, the main functions ofhistone modification can be divided into two categories:(i) establishment, helping maintenance of the euchromatinaccessibility for transcriptional machinery, and (ii) orches-tration of DNA, giving support for DNA repair, replication,or chromosome condensation [40].

Besides the classical pathway of NRs action, the emer-gence of genome scale technologies has helped uncovernew mechanisms that regulate NRs binding to DNA inthe chromatin context. For instance, based on observationsfrom the nucleosome crystal structure, it was proposedthat these chromatin changes are, in fact, posttranslationalmodifications for histones. Moreover, it was suggested thathistone N-terminal tails may be modified by processes suchas acetylation, deacetylation, methylation, phosphorylation,ubiquitination, and sumoylation [35, 36, 41]. Another processinvolved in this new postulated mechanism is the ATP-dependent remodeling of nucleosomal arrays, which exposesnewDNA naked sites, allowing for transcriptional machineryrecruitment [36]. Essentially, according to this new hypoth-esis the chromatin, via its preexisting open sites, specifiesNRs genomic localization and its interactions with regulatoryelements. NR binding confers further changes to chromatinaccessibility through remodeling of the underlying chromatinand associated nucleosomes by recruitment of cofactors andcoregulators. Therefore, chromatin is though as an integralcomponent in this mechanism, guiding NRs action in cell-type-specific and cell-state-dependent manners [35].

This brief discussion aims to show that the pathwaysthat govern NRs selective activity in moderating cell- andsignal-specific physiological programs are still a conundrum.However, new emerging genome scale technologies, alongwith new structural studies of full-length receptors, will shedlight on the role of chromatin in selectively regulating NRsbinding. Furthermore, these new approaches have also helpeddeciphering some new roles of NR cofactors in regulatingDNA methylation, histone posttranslational modifications,and chromatin remodeling [35]. These events show that, from

a global view, transcription selectively regulated by NRsthrough chromatin is a really well-orchestrated dance amongchromatin histones, NRs, transcription factors, corepressors,coactivators, and modifying enzymes.

Moreover, the explanation of how NR-DNA specificity isachieved, considering that all NRs use a highly conservedDBD core region to specifically choose to bind to some DNAsequences is still obscure and need to be further investigated.Also, the chromatin context, conformational modifications,and further contacts between NRs and DNA should beconsidered in this discussion. However, it is important tohighlight that this issue is crucial to the understanding oftranscription regulation and studies with full-length NRs andchromatin are key points to answering this.

Regarding this issue, some reviews about DNA bindingdomain and hormone response elements have been reportedrecently [4, 18, 35]; herein, we focus on the descriptionand applications of the most used analytical techniques toidentify and study NR-DNA interaction. Our main goal inthis review is to discuss advantages and disadvantages of themost applicable methodologies to NRs, providing a range ofevidences that may assist in better methodological choice forthe study of NRs.

1.3. Electrophoretic mobility shift assay (EMSA). Elec-trophoretic mobility shift assay (EMSA), also known as gelshift, is one method largely applied to study gene regulationand NR-DNA interactions. This method provides valuableinformation about sort of regulatory proteins involved ingene expression and may be adapted to a wide choiceof cultured cell lines, DNA sequences, and transcriptionfactors. In general, it is based on the propriety of retardedmobility in-gel, characteristics of protein-DNA complexes,when compared to free protein and DNA [42, 43].

Basically, gel shift assay consists of three key steps:binding reactions between DNA and protein, native elec-trophoresis, and probe detection. The DNA fragment usedin this method is the target sequence, which is usuallyfrom restriction fragment, or a PCR product, or even, isobtained by DNA synthesis. The DNA labelling before is themost common approach, allowing for its specific detectionafter electrophoresis. Traditionally, DNA probes have beenradiolabeled with 32P, but, due to the concerns involvingthis kind of material, numerous nonradioactive labellingmethods for performing EMSA have been developed, such asfluorescent probes that can be detected in-gel using an appro-priate imaging system. Besides that, hapten-modified DNAprobes can be visualized via secondary detection reagents,such as streptavidin or anti-DIG antibodies, in systemswith enzymatic substrates similar to those used for Westernblotting. Regarding the binding reaction components, thereare many unique requirements for different nucleic acidbinding proteins, so there is no universal set of reactionconditions for EMSA assays, which must be investigated inthe literature for each specific case. Also important, the gels


Inactive chromatin

Chromatin remodeling

Chromatin remodeling

Active Chromatin

NRs

Coactivators

histone acetylation

histone methylation

NRs

Correpressors

Histone Deacetylation

Transcriptional

Repression

Transcriptional Activation

Figure 3: Scheme representing chromatin accessibility and NRs classical mechanism of action. Chromatin accessibility and histonemodifications contribute to NR binding. The N-termini of histones have specific amino acids that are sensitive to posttranslationalmodifications, which contribute to chromatin status (active or silent). At the top of the scheme (inactive chromatin), there is an exampleof NRs bound to its RE and associated with transcription corepressor complexes. The presence of histone deacetylases (e.g., HDAC) leadsto removal of any chromatin activating histone acetylation sites causing formation of transcriptionally repressed chromatin structure. Atthe bottom (active chromatin) there is an example of NRs heterodimers bound to the corresponding RE and associated with coactivatorcomplexes. Formation of a coactivator complex induces histone modifications such as acetylation (Ac) by histone acetyltransferases (HAT)and methylation (Me) that in turn alter chromatin structure. This allows for the entry of the basal transcriptional machinery, including RNApol II and transcription factors (TFs). The complete assembly then leads to the activation of target gene transcription (adapted from [37–39]).

used in this method are nondenaturing TBE-polyacrylamidegels or TAE-agarose gels [44].

EMSA is a reference technique that presents a greatdiversity of applications. In some cases, it may be appliedin a simpler way to show DNA-NR binding events [45–50],or even to present that a heterologous expressed NR is able tobinding to DNA [51]. But, in another way, more sophisticatedquestions have been answer using this sort of experiment. Forinstance, it was applied to show some particularities of TRisoforms in DNA binding, presenting that TR𝛽0 can bind astrimers to a subset of naturally occurring DNA elements andnot just as homo- or heterodimers with Retinoid X Receptor(RXR), as it was thought [52]. Also, gel shift was employedto analyze the RXR/TR and RXR/PPAR heterodimerizationand DNA binding [53]. In this study, the authors assessedthe capability of these proteins to bind DNA in consensustarget sites, with the heterodimers RXR/PPAR or RXR/TRefficiently bound to DR1 and DR4, respectively [53].

Other reports illustrate the use of EMSA in the study ofnuclear receptors, identifying consensus DNA sequences thatbind to different NR complexes. The interactions betweencoactivators and NRs on REs were studied by EMSA,searching for interactions among Vitamin D receptor (VDR),

coactivators, and response elements. In this study, the effectof SRC-1 and TRAM-1 coactivators on VDR homodimerand VDR/RXR heterodimer was analyzed, showing thatVDR forms stable homodimers after interaction with thecoactivators on the VDRE DR3 (direct repeat spaced by3 base pairs) and DR4 and DR5 REs may support theseinteractions, but in a weaker way [54].

In another example, a novel approach was developedto isolate large complexes of proteins associated with theDNA-bound estrogen receptor 𝛼 (ER𝛼) using an agarose-based EMSA, in order to understand how ER𝛼 regulatestranscription of estrogen-responsive genes [55]. This methodwas adapted to other nuclear receptors and their responsiveelements to provide better understanding of how they regu-late gene transcription of certain genes.

Additionally, recent EMSAs were applied to study speci-ficity in DNA–NR binding. It was reported that artificialDNA binding sites based on “AGGTCA” half-sites conferhigh affinity, but poor specificity, and that spacing alone doesnot account for the divergent DNA recognition properties ofTRs and RARs, as it has been proposed [34]. In this case,the gel shift assay was used to explore the ability of TR𝛼 orRAR𝛼 to bind to artificial DR4 and DR5 response elements


comprised of AGGTCA consensus half-sites and comparethe binding profiles obtained from consensus REs to thetwo naturally occurring response elements, 𝛼MHC promoter(DR4), and the 𝛽RAR promoter (DR5). Although theseelements were bound by their cognate receptors less stronglythan were the artificial AGGTCA elements, they were boundwith much greater specificity. Therefore, they conclude thathalf-site spacing contributes to DNA recognition by thesereceptors but is not the dominant discriminatory factor underthese conditions [34]. All these results indicate the presenceof particular abilities that different NRs have to discriminatebetween various promoter regions in similar arrays (as DRs),but with sequences that diverge slightly from the consensus.

All these examples, together with many others whichapply EMSAs for NRs investigation [56–58], illustrate thewide application of this technique in the study of NR-DNA interaction. Though having some limitations such assamples that are not in the chemical equilibrium duringthe electrophoresis step or as that rapid dissociation duringexperiment may prevent detection of complexes or, even, thelittle direct information about the localization of the nucleicacid sequences; this assay is, in general, a rapid and sensitivemethod in the detection of protein-DNA interactions. Thebasic technique is simple to perform and highly sensitive,mainly with the use of radioisotope-labeled nucleic acids,allowing assays to be performed with small content of proteinand nucleic acid.

Additionally, when this high sensitivity is not required,variants using fluorescence, chemiluminescence, andimmunohistochemical detection are also available, avoidingthe danger of radiation. Nucleic acids can be used in a widerange of sizes and structures and proteins can also include arange from small oligopeptides to transcription complexes.Another advantage is the possibility of using highly purifiedproteins and crude cell extracts, which accounts in large partfor the continuing popularity of this assay [59]. In this way,the electrophoretic mobility shift assay is still a referencemethod generally used in the study of in vitro binding ofnuclear receptors to DNA response elements.

1.4. DNA footprinting. Another important technique abun-dantly used to study interactions between NRs and DNA isDNA footprinting, which was one of the first’s techniquesapplied in NRs field in this concern [60, 61]. This is anin vitro assay that investigates protein binding to specificDNA sites, studying protein-DNA interactions outside andinside the cell environment [62, 63]. It is based on thefact that when a transcription factor is bound to DNA, itis protected from degradation by nucleases, providing its”footprinting” on DNA sequence [62, 63]. Traditionally,this experiment was used in the studies on NRs to identifytheir binding sites in DNA. In the past, the DNA regionof interest, harboring one or more transcription factors, wasradioactively labeled, followed by DNAse I treatment, whichdigest unprotected or free DNA. After that, the digested DNA

was separated by polyacrylamide gel and visualized on X-rays films [62, 63]. Nowadays instead, some other approacheshave been associated with this method, such as the use offluorescent probes over radioactive DNA labelling or theuse of polymerase chain reaction (PCR) to amplify specificDNA regions over electrophoresis, in searching for theprotected DNA sequences [64]. Additionally, application ofsynchrotron X-ray footprinting has been used to study time-resolved structural changes of nucleic acid conformation andprotein-nucleic acid complexes. In this case, nucleases aresubstituted by X-ray to produce the cleavage patterns in DNA[65].

Remarkably, one of the first applications of this techniqueon NRs was the definition of specific REs, such as theelucidation of glucocorticoid response elements (GREs) intyrosine aminotransferase gene promoter, which is regulatedby GR in the presence of ligands [66]. Other applicationsinclude the regulation of tyrosine hydroxylase by Nurr1orphan receptor [67] or, even, the binding of NGFI-B inthe steroid 21-hydroxylase (21-OHase) gene promoter [68].Some other regulatory regions in gene promoters were alsofound using footprinting, such as the regulation of growthhormones, GH1, and GC, by TR. In this case, authors foundtwo regions that were selectively regulated by TR in strainsof rat pituitary cells [69]. In the same way, other reportsshowed that the prostate antigen gene promoter was foundto be regulated by AR [70], GR, and PR [71] and, also, byTR and ER [72, 73].

DNA footprinting also solved questions about how anNR recognizes specific promoters, considering that manyreceptors can bind to the same RE sequences. For example,the responsive elements composed by TGACC and TGTTCTsequences, known as glucocorticoid receptor REs, werefound upstream several genes regulated by PR and AR. Amore detailed investigation of these sequences, by usingDNA footprinting, showed that one of these sequences wasregulating rat probasin gene promoter by AR. This study alsosuggested that AR binds to another sequence in the samepromoter with a different affinity, but the highest androgeninduction was reached when both sites are filled with AR ina cooperative and mutually dependent manner [74].

Later, other studies using DNA footprinting revealedconformational changes in DNA upon NR binding, as itwas observed for estrogen related receptor 𝛼 1 (ERR𝛼-1) binding to a silencer element (S1), downregulating theaction of human aromatase gene promoter. In this case,DNA footprinting was used to confirm the previous dataobtained by gel shift mobility assay and presented the exactbinding site for ERR𝛼-1. However, it showed some intriguingconformational changes of DNA upon binding of ERR𝛼-1[75], another important feature obtained by EMSA.

It is undoubted that DNA footprinting is a fairly stan-dardized technique and has numerous applications in NRsstudies as showed above. However, the development of theseexperiments has been presented as quite laborious and it is a


costly expensivemethod, generating hard data to be analyzed.To overcome these problems some improvements have beenmade, such as the development of softwares for quantitativeanalysis of gel images, to reduce the time of data analysis[76]. Also, digital approaches to evaluating regulatory pro-tein occupancy on genomic DNA, using massively parallelDNA sequencing, have changed the paradigm of the absenceof informatics tools specifically designed for footprintinganalysis, which makes it a less tedious, time consumable andoverwhelmed experiment [77].

These improvements and updates in DNA footprintingmethods allowed for the identification of protein-bindingfootprints with high resolution on a genome scale. DigitalDNase I Analysis is one of these advances, providing aperspective of the genome mapping and quantifying theaccessibility of chromatin and the NRs occupancy [78, 79].The approach is based on techniques of chromatin analysisthat have been developed andwidely used to detect regulatoryregions, which uses data generated from chromatin by DNaseI digestion with parallel massive sequencing [78, 80]. In thecontext of nuclear receptors, the Digital DNase I was appliedto map GR accessibility in chromatin regarding genomewide scale [81]. According to this qualitative analysis [82],GR was qualified as an NR capable of autonomous bindingto genomic DNA target sites, resulting in local chromatinremodeling, and 95% of these sites were recognized aspreexisting accessible sites in chromatin [81].

However, even with the advances in technology, to inferaccurately the location of these footprints remains a challeng-ing computational task. To avoid this, the development ofdynamic Bayesian network had improved the identificationand statistical calculation of protein binding sites from thegenome digital footprinting data in a probabilistic framework[83].

Parallel to this, the development of new DNA labellingmethodologies, avoiding the radiolabelling, combined withnew bioinformatics tools for data processing and, moreover,the development of in silico footprinting [84] have greatlyaided the use of DNA footprinting, which continues to be apowerful tool to answer many questions, especially about theNR-DNA interaction. On the other hand, it is important tomention that the identification of REs depends on differentfactors, like cell type and treatment conditions, which makesthis process more complicated. Nowadays, the advent ofchromatin immunoprecipitation assays made it possible toidentify large genomic fragments to which NRs bind directlyand indirectly, evaluating cellular contexts [85]. The insertionof this technology on genome wide scale after the advent ofDigital DNase I analysis updated this assay, which still maybe associated with different methods in the elucidation ofmore complex questions concerning NR-DNA interactions.

1.5. Transactivation assays—transfection and reporter geneassays. In addition to the techniques mentioned above, awidely used in vivo method to measure NR activity is the

reporter gene assay. In general, this method is based oninserting a DNA construction inside the cell, which owns anRE followed by a reporter gene. This is a fundamental toolto monitor cellular events associated with gene expression,regulation, and signal transduction. After the development ofthis assay, researchers have acquired one sensitive, reliableand convenient assay, providing one efficient report ofthe activation of particular NRs and their effects on geneexpression [86, 87].

Aiming to understand the biological role of NRs in geneexpression by using this assay, primarily it is important tomonitor the protein in the cellular context. In order to achievethis, the first step would be the introduction of the targetgene inside the cell; otherwise, it is still possible to considerendogenous levels of NR, which is one of many advantagesof this technique [88]. However, when the introductionof interest gene is required, transfection is a widely usedprocedure and a powerful analytical tool for study geneand protein function and regulation [88]. There are twomajor transfection types: stable, where gene is integrated togenome, and transient, where a plasmid containing the genesupports expression for short periods of time [89, 90].

In the first one, transgene becomes as dependent as othergenes of transcription regulation machinery, which could beconsidered a disadvantage if compared with the second one,but it is more similar to the cell real conditions. Within thefirst scenario, in a natural in vivo system, transgene may beassociated or not with histones in a dense chromatin waitingto be transcripted and translated [35, 36]. In contrast, inthe second method, plasmids probably are in a supercoiledshape, but the regulation sequence access is still easierbecause of the absence of histones and chromatinized DNA[90, 91], with this approach being widely applied for fasttransactivation assays. On the other hand, it is an artificialsystem for cell metabolism. Overall, both transfections typeshave advantages and disadvantages, and the best choicebetween them should be done after some questioning aboutcell toxicity, transfection efficiency, effects on normal physi-ology, and also reproducibility [88].

The second step for reporter assays is the choice ofreporter gene since there are several types of systemsavailable today. Remarkably, some important features haveto be considered in the reporter’s choice: effectiveness andsensitivity, level of expression, stability of expressed protein,and, background, due to endogenous protein [86, 92].

Historically, chloramphenicol acetyltransferase (CAT)was the first reporter gene to be used. However, it has becomeobsolete nowadays mostly because of the fast decay of theenzymatic activity [87, 92]. To overcome this, luciferase(LUC), which is more stable than CAT, is widely used. LUCassay is highly sensitive, it requires fewer cells than CATassay, and its response can be measured within 25 hoursafter transfection. Nevertheless, it remains a simple, rapid,and sensitive method for NR activity on promoters [93].Overall, Renilla luciferase together with firefly luciferase


reporters is considered the most efficient ones, emitting thehighest bioluminescence signal, allowing for the detectionof subattomoles amounts of enzyme. Both are excellentmarkers for gene expression, as they lack posttranslationalmodifications, have absent endogenous proteins or enzymes,and exhibit fast enzymatic interactions.

Moreover, luciferase reporter gene system can be usedfor monitoring gene expression in vivo. One example wasthe generation of the ERE-LUC transgenic mice [94], whichhad the luciferase reporter gene under the control of anestrogen-responsive element (ERE-LUC). In this report theluciferase activity in estrogen cycles indicated that the highesttranscriptional activity of ER occurred during proestrus inreproductive tissue [94]. These ERE-LUC model mice alsofacilitated kinetics, monitoring, and quantitative analysis ofER activity in specific tissues [87].

Later, a novel reporter assay system was developed as animprovement of luciferase reporter gene system. This assay,termed as the tricolor reporter in vitro assay system, consistsof the use of green- and red-emitting Phrixothrix luciferases,as dual reporters, and of blue-emitting Renilla luciferase,as internal control. This system was developed firstly tostudy the RAR-related orphan receptor alpha (ROR𝛼) andwas successfully employed to verify the clock effects ofgene products on the enhancer elements of Bmal1 and Per1promoters [95].

As already mentioned, the reporter gene technique iswidely applied and may provide data to solve distinctquestions. One example was the study highlighting the needto investigate the (anti-) androgenic activity of compoundsdepending on cellular and promoter context [96]. In thisstudy, the reporter activity of plasmids containing ARresponse elements derived from the human secretory compo-nent (rat probasin gene), as well as, the GREs, was evaluatedtogether with mouse mammary tumor virus promoter [96].

Interestingly, another application of reporter gene methodencompasses its use as an adjuvant to corroborate pro-tein structural hypothesis. For example, to understandTR LBD conformation and its conformational changesafter ligand binding, experiments of H/D exchange MSwere performed and suggested a new regulation step incoactivator recruitment [97]. This hypothesis was testedby site direct mutagenesis and TR transactivation assays,showing that the detected changes in TR conformationare important, influencing the activation of this receptor[97].

The development of a new reporter gene assay to test NR-coregulators interactions inside the cells using a chimericsystem was also described as another application of thisassay for NR, combining reporter gene assay with two-hybridmammalian system [98–102]. Additionally, reporter geneassay technique is also capable of searching and understand-ing novel NRs’ interactions with DNA itself, investigatinggene regulation by NRs inside promoter regions. Moreover, it

is common to use reporter gene along with EMSA and ChIP-chip to discover and validate where transcription factorsare binding to [103–105]. As an example, a recent reportshows that TM (thrombomodulin) expression and activitywere upregulated by FXR activation in vascular endothelialcells [106]. FXR activation significantly enhanced the tran-scriptional activity of human TM gene promoter, as seen inreporter gene assays, and EMSA and Chip-chip indicated thatFXR induced TM expression by binding to a novel FXR-responsive element.

Remarkably, there are a considerable number of studiesin the literature searching for selective ER modulators withbalanced high affinity for ER𝛼 and ER𝛽, which could actas therapeutics for the treatment of hormone-response breastcancer, osteoporosis, and many other diseases using thesereporter gene assays [107–112]. One of them is aimed to dis-cover novel selective ligands for ER𝛽, through developmentand characterization of a cell-based Gal4-ER𝛽 𝛽-lactamasereporter gene assay (GERTA) for ligand-induced activationof the human ER𝛽. This assay was optimized for high-throughput screening, using 3,456-well nanoplate format,and it was successfully used to screen a large compoundcollection for ER𝛽 agonists [111]. Alternatively, one studyfocused on the development of second- and third-generationselective ER modulators, with the goal of reducing toxicityand improving tissue-selective efficacy, developing a newcell-based ER𝛼-transactivation assay, where ER𝛼-specificantagonists were screened after only 4h of incubation time,using a fully automated ultrahigh throughput screen, and anumber of valuable leads were identified [112].

So far, there are some different methods to understandthe activity of NRs in DNA response elements, and novelones are under development right now. Among all, the mostwidely used and easiest way to standardize in mammalcells continues to be transactivation using luciferase enzymesystem. One of the reasons for this preference is its repro-ducibility and easy way to perform measurements. However,it is important to mention that LUC activity does not alwaysimply a direct interaction of NR-DNA, and this activity maybe a response to an indirect interaction via different partnersthrough crosstalk, for example, which may be confirmed byEMSA or DNA footprinting assay.

Nevertheless, LUC assays are excellent markers for geneexpression and, altogether, the discussed characteristics turnluciferase reporter gene assay into the most sophisticatedand robust method used nowadays to study nuclear receptorinteractions with DNA in vivo. Here we show that this assaymay be applied to answer a large spectrum of questions,as the analysis of NR activity in different cell contexts,or new promoters; or as the evaluation of interactionswith coregulator and new ligands; and, even, to confirmstructural hypothesis. Also important, this assay allows forthe study of NRs in naked DNA reporters or in chromatinizedDNA, according to the chosen transfection method, which,


depending on the objective of the study, may present morerealistic results, closer to cellular environment.

1.6. Chromatin immunoprecipitation sequencing (ChIP-Seq).While EMSA and DNA footprinting are mostly used for invitro analyses of NR and DNA interactions, another tech-nique used to investigate this interaction in cellular context, asreporter gene assay, is the chromatin immunoprecipitation-sequencing, or ChIP-S Nowadays, as far as we know, this isone of the most used assays for investigation of NRs-DNAbinding.

ChIP-Seq is applied to map NR binding sites in genomic-wide scale throughout the DNA, without significant cellularmodification [113], and to map chromatin modifications andnucleosome positions [114]. The method is an evolution ofChIP [115] and ChIP-chip procedures, which initially werebased on applications of specific primers and DNA microar-rays, towards next generation DNA sequencing (NGS),allowing for the study through the whole genome [116]. Thefirst ChIP-Seq application mapped histone modifications inthe entire genome, identifying DNA binding sites, and thelocation of different histone methylation patterns in lysineand arginine residues, in human CD4CT cells [117].

ChIP-Seq and ChIP-chip are currently the two main com-peting technologies for the genome-wide identification ofchromatin immunoprecipitated material [118]. The generalprinciple of ChIP is immunoprecipitation of specific proteinscross-linked together with their associated DNA. In classicalprotocols DNA-proteins complexes from cells extracts arecross-linked and the chromatin is fragmented by sonication.During basic ChIP procedure, after DNA purification, aPCR with specific primers for known DNA sequences isperformed [115]. In the ChIP-chip procedure, purified DNAis applied in a microarray plate, which allows for the positiverecognition of several, but limited, known DNA sequences.Differently, in ChIP-Seq procedures, the purified DNA issubmitted to the NGS and most of the binding sites areidentified.

When compared with the other two ChIP methodologies,ChIP-Seq is the one that provides a large amount of results. Ina comparison between ChIP-chip and ChIP-Seq, the latter hashigher signal-to-noise ratios, is less expensive, and requireslower amounts of DNA for genome analysis [113]. Also, thesequencing step did not limit ChIP-Seq to the few bindingsites, allowing for analysis of the whole genome [119].Therefore, based onChIP-Seq advantages, as it is largely usednowadays in NRs field, our review will focus on this ChIPmethod.

The importance of ChIP-Seq assay is totally relatedto understanding how a huge number of transcriptionalfactors in living cells can interact with some specific DNAsequences, improving our knowledge about the functionalsites. Several studies show ChIP-Seq experiments appliedin the search of NRs binding sites in DNA, using distinctcell types. For example, ChIP-Seq together with ChIP

found 8,848 GR binding sites in mouse adipocytes treatedwith synthetic glucocorticoid dexamethasone [84]. Also inadipocytes, more than 5,000 PPAR𝛾 binding sites wereisolated [120]. In human lung adenocarcinoma cells, morethan 4,000 GR binding sites were identified [121], while inhuman breast cancer cell lines more than 10,000 ER bindingsites [122] and 20,000,000 PPAR𝛽/𝛿 binding sites were found[123].

Importantly, we observe in the abovementioned examplesthat the diversity of cell types and experimental conditionsresults in data variability in ChIP-Seq, being impossible todefine regular guidelines appropriate to a more general rule[124]. Although, taking together the ChIP-Seq results fromdistinct NRs and cell lines, the identification of overlappingor unique DNA binding sites can lead to new therapeuticstrategies [125].

ChIP-Seq also has been extensively used tomap the in vivogenome-wide binding (cistrome) of NRs in both normal andcancer cells due to evidences that NRs play a differential rolein cancer cells [126]. ChIP-seq assays have confirmed theseevidences as presented in studies of AR in prostate cancer cell[127, 128] and of ER [129–131], GR [132], and PPAR𝛽 [133]in breast cancer cells. In these investigations authors foundnew insights into the DNA sequences, in which ones NRscan bind and identify cooperating transcription factors. Also,they identified potential NRs regulated genes that are not seenin normal cells, providing enlightenment into the biologicalprocesses regulated by them. This kind of application mayelucidate meta-analysis data of the same cancer cell line andgenerate consensus cistrome and expression profiles, whichcan be used to understand the pathologies and guide newtherapeutics developments for cancer treatment [125].

As therapeutics targeting for NRs are mainly ligands,ChIP-Seq may also be applied to identify and characterizeNRs behavior in presence and absence of them. As anexample, it was observed that triiodothyronine hormone(T3) treatment altered TR𝛽1 binding at distinct genomicsites and also change expression patterns, suggesting anew mechanism of regulation of target genes by TR𝛽1[134]. Another recent development of ChIP-Seq allowedperforming this assay with a low input of cells, as it wasshowed in ER𝛼 ChIP-Seq that was successfully performedwith an input of only 5,000 cells by using single tube linearamplification (LinDA) [135].

Besides the large amount of examples of ChIP-Seq, itis important to highlight the difficulty in finding specificantibodies for NRs. Essentially, the success of the experimentdepends on validations and use of highly specific antibodies[124]. An example showing the efforts in validation ofspecific antibodies could be seen in the case of LXR genome-wide mapping of binding sites studies [136]. One alternativeto solve this issue may be outlined with a tag-based approach,by using transgenesis to express NRs tagged with an epitopeor a tag as EGFP. By this way, the only required antibodywould be the one specific to the tag. This approach allows for


the use of just one antibody to study several proteins [137],as it was shown in ChIP-Seq study of 24 NRs expressed inbreast cancer cell lines [125].

Another important point of ChIP-Seq application for NRsis the huge amount of data generated by NGS and therequirement of both bioinformatics and statistics tools toprocess the data and turn them into understandable results.Moreover, big amounts of data generated by ChIP-Seqstudies are available on databanks and can be analyzed inparallel. The development of novel bioinformatics analysescan compare some patterns of REs, distance distributionsof transcription start sites of known genes, evolutionaryconservations, and collaborating partners of several NRs[126], also generating consensus cistromes and expressionprofiles among NRs.

However, albeit the binding sites can be predicted by insilico studies, this kind of prediction still did not achievesufficient success or accuracy, qualifying ChIP-Seq as onetechnique capable of performing an effective detection ofNRs genome-wide in vivo binding sites or cistromes [126].As an example, although some computational analysesdetermined a potential of 105 – 106 binding sites to VDRresponsive elements- (VDRE-) like sequence motifs, ChIP-Seq showed that less than 1000 sites were generally occupiedby the VDR in the absence of ligand and between 2000and 8000 sites were occupied following vitamin D treatment[116].

In another recent example, the comparison between ChIPand ChIP-Seq assays of human and mice had demonstrateda common feature of NRs in recognizing relatively shortAT-rich motifs [124]. In addition, it was verified that NRsbind to introns and distal intergenetic regions far away fromtranscription start sites [126] and counterpoint the classicalstatement which suggests REs may be located in the 5’ regionof the target gene, closely to the core promoter.

Other evident and specific limitations of ChIP-seq arethat it only provides information about the NRs bindingsites and regions nearby, which may harden the identificationof genes that are under particular regulation. Moreover, ithas been shown that many NRs binding sites land in distalintergenic regions or introns, according to recent data inthe literature. The AR ChIP-seq in prostate cancer cellssuggested AR binding in nonpromoter regions and actionthrough chromatin loopings [138]. Despite the difficulties touse ChIP-seq to predict target genes that are not straight-forward [126] and as some binding sites are distal fromgene promoter; it is difficult to predict what distal NRsbinding sites are nonfunctional fortuitous binding sites andwhat are involved in transcriptional activity through a remotecontrol mechanism [139]. This sort of difficult could beovercome by the application of recently developed methods,such as chromosome conformation capture (3C), which havebeen performed to observe long-range chromatin interactionsbetween DNA elements engaged in transcriptional regulation[140].

Overall, taking together, the advantages of ChIP-seqinclude the capacity of whole genome analysis of responsiveelements both in vivo and in vitro, the low input of cellsrequiring the reliability of results compared with in silicopredictions, the higher signal to noise ratio, the large amountof results, and the capacity of understand network regulationsthat will generate new therapeutic approaches. With thedevelopment of high-throughput sequencing platforms, likeIllumina, Genome Analyzer, and SOLiD, and, with theavailability of ChIP-grade antibodies, ChIP-Seq has becomeone of the most widely used methods for determiningde novo functional elements in the sequenced genome[113].

1.7. Chromosome conformation capture (3C). The 3C isa technique that investigates chromosomes’ organization ina cell’s natural state. It was originally developed in 2002aiming at the identification, location, and mapping physicalinteractions between genetic elements located throughout thehuman genome [140]. Basically, it is based on binding prox-imity to investigate the interaction between any two genomicloci, in the same or different chromosomes, revealing theirrelative spatial disposition [140]. Knowledge about struc-tural properties and spatial organization of chromosomes isimportant for the understanding of the regulation of geneexpression. A chromosomal region that folds in order to bringan enhancer and associated transcription factors within closeproximity of a gene is an example of how chromosomalinteractions can influence gene expression, as it was shownfirstly in the beta-globin locus [141]. Also, the developmentof 3C technique enables researchers to investigate this kindof interaction/regulation.

The general 3C procedure comprises the isolation of intactnuclei and fixation to cross-link proteins to other proteinsand DNA. The interacting segments will be physically boundvia cross-linking and digested with restriction enzymes.Following this step, these bound fragments are subjectedto ligation at very low DNA concentration, which favorsthe ligation of relevant DNA fragments over the randomones. Finally, cross-linking is reversed and individual ligationproducts are detected and quantified by the polymerase chainreaction (PCR), using locus-specific primers [140, 142].

One of the first applications of 3C in NRs studiesinvestigated ER in breast cancer cells [143]. In this study,it was observed that carbonic anhydrase XII gene, which iswidely related to breast cancer, is regulated by estrogen viaER𝛼. Also, applying 3C authors that observed this regulationinvolves a distal region giving new insights into CA12regulation mechanism and its strong relationship with ER inbreast cancer [143]. In another example, 3Cmethod was usedto identify distal chromosomal regions which interact withGR-induced Lipocalin2 (Lcn2) gene [144]. Through thesestudies, GR activation in the Ciz1-Lcn2 locus by long rangeinteractions was observed, suggesting a relationship betweena chromatin looping and gene regulation tissue specific [144].


Moreover, recent studies have found that the distal-binding AR transcription complex, including AR, associatedtranscription factors, and coactivators, regulates the expres-sion of several AR target genes involved in prostate cancergrowth, through chromatin looping. By using a global 3Cassay, future studies should address whether such a long-range combinatorial regulation can be generalized to includeother AR-dependent genes in the genome [138].

At last, a recent study used 3C to investigate whetherPPAR𝛾 locus position is changed during cell differentiationover other adipogenic genes. These results allowed theobservation that the genome organization is remodeled inresponse to adipogenic signaling [145].

Besides 3C advantages, such as detecting remote chro-matin interactions between DNA elements engaged in tran-scriptional regulation, to overcome the ChIP-seq limitationand to understand a specific protein-DNA interaction thathas a role in gene expression; this method also presentslimitations. Some of them are the requirement of priorknowledge of different complexes to choose the best DNAprimers [146], which may be limited to detection of one-point or partial sites in genome. In addition, it is incapable ofde novo detecting genome-wide chromatin interactions, alsopresenting low signal-to-noise ratios [139].

Due to these limitations, improvements of 3C resultedin new technologies, such as 4C, 5C, and 6C. Circularchromosome conformation capture (4C) was developed toovercome the requests of previous knowledge of the differentcomplexes identity by applying the maternally inherited H19imprinting control region primer present near to the targetsequence, during ligation [146]. Chromosome conformationcapture-CarbonCopy (5C) is a high-throughput 3C approach,which employs microarrays or quantitative DNA sequencingusing 454-technology as detection methods [147]. Anotherimprovement is the combined 3C-ChIP-Cloning assay (6C)that combines the standard looping approaches previouslydefined with an immunoprecipitation step to investigateinvolvement of a specific protein that maymediate long-rangechromatin interactions [148]. This merge of ChIP and 3Caims to reduce noisy and increase specificity for chromatininteraction detection; however, new approaches to separatechromatin complexes from nonspecific chromatin fragmentsare necessary to overcome high levels of false positives [139].

Overall, a common problem found in 3C and its deriva-tives methods is the frequent random collisions of chromo-somal regions to one another, which means that the detectionof a product does not always indicate a specific interac-tion between two regions. Therefore, a specific interactionbetween two regions is only confirmed when the interactionoccurs at a higher frequency than with neighboring DNA.Another disadvantage of these techniques (3C, 4C, 5C, and6C) is the requirement of a large number of cells, especially inthe high-throughput methodologies. Experiments using the4C technique, for example, routinely process ten million cellsfor analysis on a single microarray. However, in contrast

with 3C and 5C, the 4C method does not require the priorknowledge of both interacting chromosomal regions [142].

Finally, 3C technology now becomes a standard methodfor studying the relationship between nuclear organizationand transcription in the native cellular state. It allowsresearchers to analyze the folding of chromatin in the nativecellular state at a resolution beyond that provided by currentmicroscopy techniques. Moreover, considering the shape ofthe genome is thought to play an important part in thecoordination of transcription and, more specifically thatNRs mechanism of action involves REs distant from targetgenes, 3C emerges as a remarkably method in NRs field.Furthermore, together with ChIP-Seq, 3C technologies areindicated assays to discover new relationship between NRsand DNA or to monitor previously described interactionsand, also, to study particularities on genome.

1.8. Fluorescence anisotropy. Apart from the techniquesdescribed above, there is also another in vitromethod largelyused to identify and characterize protein-DNA interac-tions, termed fluorescence polarization (FP), or fluorescenceanisotropy (FA). Classically, this sort of experiment is ableto measure interactions between molecules in solution, ina quantitative way, informing whether they physically arecapable of interacting. More detailed, it is a biophysicalmeasurement, based on the timescale of rotational mobilityof biological macromolecules and excited-state lifetime.Essentially, when a molecule is excited by polarized light, thefluorescence emission will be depolarized in relation to theincident light, mainly due to rotation mobility of moleculesin solution [149]. For example, fluorescence polarizationincreases as rotational mobility decreases or, indirectly, asthe size of the molecule increases. Therefore, FP is affectedby molecular size, viscosity of the medium, and temperature.The FP experimental setup involves a vertical polarizing filterfor the exciting monochromatic light, which makes that onlythe properly oriented molecules in the vertically polarizedplane to absorb light and become excited. The emitted lightfrom these excited molecules is then measured in both thehorizontal and vertical planes. In this sort of measurementsthe calculated parameters are polarization (P) and anisotropy(r), obtained from the equations below:

𝑃 = 𝐼𝑉 𝑉 −𝐼𝑉 𝐻𝐼𝑉 𝑉 +𝐼𝑉 𝐻

𝑟 = 𝐼𝑉 𝑉 −𝐼𝑉 𝐻𝐼𝑉 𝑉 +2𝐼𝑉 𝐻

,(1)

where 𝐼𝑉 𝑉 is the fluorescence emission intensity measuredin the plane parallel to the plane of vertically polarizedexcitation and 𝐼𝑉 𝐻 is the fluorescence emission intensity,measured in the plane perpendicular to the plane of verticallypolarized excitation [149].

Furthermore, applying Hill approach to fit the anisotropydata, as showed in the following equation, one can determine


dissociation constant (𝐾𝑑) and Hill cooperativity coefficient(n) [150, 151]:

𝑟𝑜𝑏𝑠 = 𝑟𝑖 + (𝑟𝑓 − 𝑟𝑖)∗{[𝑁𝑅+𝑛

𝑘𝑛 ][1 + (𝑁𝑅𝑛

𝑘𝑛 )]}, (2)

where 𝑟𝑜𝑏𝑠 is the observed anisotropy at total protein con-centration NR, 𝑟𝑖 and 𝑟𝑓 are the lower and upper anisotropyvalues, k is the 𝐾𝑑 value, and n is the Hill cooperativitycoefficient. There are other plots which could be appliedto fit anisotropy data; however, it was observed [151–154] for the majority of NR-DNA interactions that theoccupancy of some binding sitesmay affect the affinity for theunfilled ones. Therefore the Hill approach, which accountsfor the possibility that not all receptor sites are independent(cooperativity), may be properly applied in these systems.

Many examples of fluorescence anisotropy application instudies of DNA-NRs interactions can be found since thebeginning of these studies until nowadays [155–158]. Oneof them applied fluorescence anisotropy assays to verify theinteraction of RAR: RXR heterodimer with DNA in thepresence of ligands was also investigated by FP [159]. Inthis study presence or absence of both agonists (retinoic acidand 9-cis retinoic acid) did not influence the heterodimeraffinity to DNA. However, when they tested a number ofother antagonists, it was noticed that the DNA bindingwas destabilized directly or by destabilizing the heterodimer[159]. Later, the TR DBD homodimerization was alsoinvestigated with the same assay, leading to the conclusionthat the DBD is also responsible for TR dimerization [160].

Specificity is another variable investigated by FP, as itwas reported in an affinity study of ER by different ERE.Firstly, estradiol (E2) roles and salt dependence in ER-EREbinding were studied, presenting almost the same bindingaffinity in presence or absence of E2, suggesting ER-DNAbinding is E2 independent. Moreover, the more complete isprotein constructs, it is more able to distinguish between thetwo different DNA sequences, allowing for the conclusionthat other regions of the protein, besides DBD, are importantin ERE binding and specificity [161].

Following the same line, other detailed report aiming atdeciphering whether minimal TR domains are capable todistinguish among different DNA sequences was performed[154]. In this study, FP assays investigated the affinity ofthree different constructs of TR (containing just Helix 1, orjust DBD, or both DBD and LBD) to four different arraysof AGGTCA (PAL0, IP-6, DR-4, and DR-1) [154]. Based onthis study, we found firstly that TR binds to DNA as dimer.We verify that only a small peptide derived from the DBD(Helix 1) is sufficient for recognition of the DNA, the entireDBD is sufficient to bind with high affinity to F2, PAL, andDR-4, but the highest specificity was achieved when LBD ispresent in the protein, defining differences in Kds, in low nMrange [154]. These results confirm that more complete NRsbetter distinguish among different REs, indicating that other

domains may be important for selectivity of NRs in DNAbinding, as it was shown for ER [161].

Apart from this, some interactions of NR-protein and NR-Protein-DNA also were defined by fluorescence anisotropy,as it was shown in a study involving ER, transcriptionintermediary factor 1-alpha (hTIF1𝛼), and ERE binding[162]. A trial of anisotropy of ER interacting with theERE sequence was performed, and the interaction of thiscomplex with ER-DNA-hTIF1𝛼 was verified. It was foundthat ER interacts with the hTIF1𝛼 bound to DNA in hormonedependent manner and that, especially in the absence of E2,the hTIF1𝛼 interacts better with ER𝛽 than with ER𝛼, withDNA being requested in ER-hTIF1𝛼 binding.

With similar purposes, in 2010, we reported a fluorescenceanisotropy study of binding affinities of TR and GATA2 onTSH𝛽 promoter, to postulate a model of interaction wherein absence of ligand (T3) thyroid hormone receptor bindsto its TRE, while GATA2 binds to GATA-RE. However, inpresence of T3, TR-TRE bond is weakened, facilitating theinteraction of TR with GATA2 zinc finger domain, which, inturns, binds to GATA-RE [153].

Interestingly, FP studies have shown particularities inthe measured systems, like the addition of ligands andions, which may change affinities of some NRs to specificDNA arrays, helping to elucidate mechanisms of actions ofNRs in DNA [153, 154, 161]. As a memorable technique,fluorescence anisotropy has been widely applied for testinginteractions between different molecules. Among severaladvantages presented by FP, this assay is also very wellemployed in high-throughput screening assays [163]. Similartechnologies for large-scale identification of pharmaceuticalcompounds and environmental have been currently presented[164, 165], whose compounds that alter the ability ofER to bind to DNA are searched, since this interactionis known as a good target for cancer treatment [165].

There are no doubts that the application of fluorescenceanisotropy in studies of DNA-protein interactions maypresent several advantages over other standard methods ofassessing these interactions. On the other hand, it is clearthat this sort of experiment may present disadvantages,like the need for purified protein and labeled samples,which is quite laborious, but it is feasible for differentsorts of proteins, such as NRs. In addition this is anartificial in vitro assay that does not consider physiologicalconditions, like the cell environment. Apart from this,FP is a quantitative technique that provides definition ofthermodynamic parameters for biological systems and allowsfor inferring about physical conditions for biomoleculesinteraction systems. The measurements are performed insolution and in the binding reaction equilibrium, opposedto methods such as EMSA and DNA footprinting, whichinvolves separation of free and bound ligand, disturbing thisequilibrium. Also, in contrast with DNA footprinting andEMSA, no hazardous radioactive waste is generated. FP has


Table 1: Advantages and disadvantages of techniques on studies of NR-DNA interaction.

Technique Application Advantages DisadvantagesEMSA Investigation of interaction between NR and specific

DNA sequences.• Simple technique• Rapid and Sensitive

• Radioactive labeling• Rapid dissociation ofcomplexes

DNAfootprinting

Identify interactions with DNA. •Whole genome analysis• in vitro

• Radioactive labelling• X-rays films

Reporter gene Quantitative measure of NR activation/repression. • In vivo• Easy to standardize

• Expensive• NR could act indirectly

Chip-seq Identification of DNA binding sites. •Whole genome analysis• in vitro and in vivo

• Require specific antibody• Huge amount of data

3C Identification and mapping NR-DNA physicalinteractions

• Detection of remotechromatin interactions innative cellular state

• Require prior knowledge• Low signal-to-noise ratios

Fluorescenceanisotropy

Quantitative measurement of affinity of interactionof NR-DNA.

• Quantitative fast • Require pure protein• Fluorescent labeling

a lower limit of detection, in subnanomolar range; therefore,low quantity of sample is needed. Also, all componentsare in solution, requiring relatively simple instrumentation,which makes this method more applicable than calorimetry.Moreover, this technique is generally applicable and does notneed molecules with dissimilar size to measure equilibriumbinding, allowing for real-time measurements for kineticassays. Several conditions of buffer, ionic strength, andothers can be tested rapidly [166] and it is feasible to testmore physiological like systems, such as the NRs binding toreconstituted chromatin.

1.9. Overview of discussed methods to detect NR-DNA inter-actions. This minireview aimed to discuss some of the mostcommon techniques used to study DNA-protein interactions,as summarized in Table 1. Although other methods, suchcalorimetry and surface plasmon resonance, may also beapplied to study these interactions [167–173], the techniquesdiscussed above have been used to elucidate details of NRs-DNA interactions since theywere first characterized. Herewepresent applicability, advantages, and disadvantages of suchmethods, discussing some details and providing evidencesfound in literature, aiming to help choosing the best one toperform NR experiments.

Among all the discussed assays, DNA footprinting andEMSA were largely used in the beginning of the inves-tigations regarding interactions between NR and DNA.However, the development of new technologies and instru-ments allowed the outbreak of modern techniques, and theirapplications have been decreasing. This is also due to theuse of radioactive reagents, which is an inconvenient of thesetwo techniques, and due to the fact that these experimentshave been considered quite laborious. Apart from theseinconveniences, both techniques are very informative andprovide specific information of DNA binding, especiallyfor NR. While EMSA is applied to verify NR binding tospecific DNA sequences in vitro, DNA footprinting provides

information on which sequences of NRs are bound to, takinginto account cellular context. As already discussed, thedevelopment of fluorescent and chemiluminescent probesmakes easier the manipulation of samples for both assays,avoiding radioactivity. Specifically to DNA footprinting, theadvent of Digital DNase I Analysis increased its usability,facilitating analysis of huge amount of data.

Parallel to this, ChIP-seq and transactivation assaysare applied to cell systems, abundantly investigating NR-DNA interactions. Transfection/reporter gene assays are usedsince the beginning of this sort of investigation, sufferingconstantly improvements. In other words, it seems that thistechnique will continue to be applied for many years asone way to measure activity of NRs. Despite this assay noteven being applied in most physiological conditions, dueto the fact that many times the RE and the reporter geneare artificially inserted in the cell environment, this is stillthe best way to verify NRs behavior. Remarkable, ChIP-seq starts to be applied to NR-DNA interaction investigationmore recently, being developed from ChIP and ChIP-chipassays. Nowadays, it is one of the most used techniques toinvestigate the binding sites of NRs in chromatin context,allowing for the identification of roles in gene regulationby NRs. However, as discussed before, this assay alsopresents some limitations, as many reports have shown thatNRs bind to distal sites from gene promoters, making itdifficult to predict NR transcriptional activity through aremote control mechanism. In this context, the developmentof 3C technique increased the possibilities of observation oflong-range chromatin interactions between DNA elementsengaged in transcriptional regulation by NRs. Also, combin-ing both methodologies applied to NRs (6C) could result ina huge advance to a better understanding of transcriptionalregulation mediated by NRs.

Finally, fluorescence polarization might be considered anoutside point in this review, as it is a more biophysical andin vitro technique, which may be judged as artificial. Butit is important to consider that this has been used in NRs


research for many years, providing valuable information assome thermodynamic parameters, quantifying affinities fordifferent DNA sequences, and also providing some cluesabout selectivity. Regarding all its advantages discussedabove and its application to HTS systems, the FP makesinvestigation faster and may be combined with other cellassays like ChIP-seq and transactivation assays. Togetherwith the abovementioned techniques, FP added to other struc-tural methods (such as NMR and X-ray crystallography),which are very important and useful in studying NR-DNAinteraction, may broaden horizons in the best understandingof RN-DNA interactions, answering important questionsabout gene regulation and transcriptional networks regulatedby NRs.

2. Conclusion

This review aimed to discuss different methodologies thatmay be applied to the study of nuclear receptors and theirinteractions with DNA. Apart from all the particularitiesof this superfamily of proteins, we presented differentmethodological aspects of each technique that can be appliedto NRs, aiming at better understanding different aspectsof its interaction with DNA, which could improve overallknowledge of some of its roles in transcriptional regulation.

Acknowledgments

The authors thank FAPESP for financial support (Grant no.2013/08743-2). They also acknowledge T. M .A. Moreira forreviewing this manuscript.

References

[1] A. Aranda and A. Pascual, Nuclear hormone receptors andgene expression, Physiological Reviews, 81, no. 3, 1269–1304,(2001).

[2] P. Huang, V. Chandra, and F. Rastinejad, Structural overviewof the nuclear receptor superfamily: insights into physiologyand therapeutics, Annual Review of Physiology, 72, 247–272,(2009).

[3] J. C. Nwachukwu and K. W. Nettles, The nuclear receptorsignalling scaffold: insights from full-length structures, TheEMBO Journal, 31, no. 2, 251–253, (2012).

[4] C. Helsen, S. Kerkhofs, L. Clinckemalie, L. Spans, M. Laurent,S. Boonen, D. Vanderschueren, and F. Claessens, Structuralbasis for nuclear hormone receptor DNA binding, Molecularand Cellular Endocrinology, 348, no. 2, 411–417, (2012).

[5] D. J. Mangelsdorf, C. Thummel, M. Beato, P. Herrlich, G.Schütz, K. Umesono, B. Blumberg, P. Kastner, M. Mark, P.Chambon, and R. M. Evans, The nuclear receptor super-family:the second decade, Cell, 83, no. 6, 835–839, (1995).

[6] K. De Bosscher, W. V. Berghe, and G. Haegeman, Cross-talkbetween nuclear receptors and nuclear factor κB,Oncogene, 25,no. 51, 6868–6886, (2006).

[7] G. M. Santos, L. Fairall, and J. W. R. Schwabe, Negativeregulation by nuclear receptors: a plethora of mechanisms,

Trends in Endocrinology and Metabolism, 22, no. 3, 87–93,(2011).

[8] G. Pascual, A. L. Fong, S. Ogawa, A. Gamliel, A. C. Li, V.Perissi, D. W. Rose, T. M. Willson, M. G. Rosenfeld, andC. K. Glass, A SUMOylation-dependent pathway mediatestransrepression of inflammatory response genes by PPAR-γ,Nature, 437, no. 7059, 759–763, (2005).

[9] E. V. Jensen, On themechanism of estrogen action,Perspectivesin Biology and Medicine, 6, 47–59, (1962).

[10] R. M. Evans, The steroid and thyroid hormone receptorsuperfamily, Science, 240, no. 4854, 889–895, (1988).

[11] W. B. O’Malley, Mechanisms of action of steroid hormones,The New England Journal of Medicine, 284, 370–377, (1971).

[12] K. R. Yamamoto, Steroid receptor regulated transcription ofspecific genes and gene networks, Annual Review of Genetics,19, 209–252, (1985).

[13] J. P. Overington, B. Al-Lazikani, and A. L. Hopkins, Howmanydrug targets are there? Nature Reviews Drug Discovery, 5, no.12, 993–996, (2006).

[14] A. L. Hopkins andC. R. Groom, The druggable genome,NatureReviews Drug Discovery, 1, no. 9, 727–730, (2002).

[15] S. Mandrekar-Colucci and G. E. Landreth, Nuclear receptors astherapeutic targets for Alzheimer’s disease, Expert Opinion onTherapeutic Targets, 15, no. 9, 1085–1097, (2011).

[16] G. Landreth, Q. Jiang, S. Mandrekar, and M. Heneka, PPARγagonists as therapeutics for the treatment of Alzheimer’sdisease, Neurotherapeutics, 5, no. 3, 481–489, (2008).

[17] M. Makishima, Nuclear receptors as targets for drug develop-ment: regulation of cholesterol and bile acid metabolism bynuclear receptors, Journal of Pharmacological Sciences, 97,177–183, (2005).

[18] D. Cotnoir-White, D. Laperrière, and S. Mader, Evolution ofthe repertoire of nuclear receptor binding sites in genomes,Molecular and Cellular Endocrinology, 334, no. 1-2, 76–82,(2011).

[19] T. Siggers and R. Gordan, Protein. DNA binding: complexitiesand multi-protein codes, Nucleic Acids Research, 1–13, (2013).

[20] R. Rohs, S. M. West, A. Sosinsky, P. Liu, R. S. Mann, and B.Honig, The role of DNA shape in protein-DNA recognition,Nature, 461, no. 7268, 1248–1253, (2009).

[21] N. C. Seeman, J. M. Rosenberg, and A. Rich, Sequencespecific recognition of double helical nucleic acids by proteins,Proceedings of the National Academy of Sciences of the UnitedStates of America, 73, no. 3, 804–808, (1976).

[22] J. W. R. Schwabe, D. Neuhaus, and D. Rhodes, Solutionstructure of the DNA-binding domain of the oestrogen receptor,Nature, 348, no. 6300, 458–461, (1990).

[23] B. F. Luisi, W. X. Xu, Z. Otwinowski, L. P. Freedman, K. R.Yamamoto, and P. B. Sigler, Crystallographic analysis of theinteraction of the glucocorticoid receptor with DNA, Nature,352, no. 6335, 497–505, (1991).

[24] Y. Brélivet, N. Rochel, and D. Moras, Structural analysis ofnuclear receptors: from isolated domains to integral proteins,Molecular and Cellular Endocrinology, 348, no. 2, 466–473,(2012).

[25] S. A. Chasse and F. Rastinejad, Physical structure of nuclearreceptor-DNA complexes,Methods in Molecular Biology, 176,91–103, (2001).

[26] F. Rastinejad, P. Huang, V. Chandra, and S. Khorasanizadeh,Understanding nuclear receptor form and function using struc-tural biology, Journal of Molecular Endocrinology, 51, T1–T21, (2013).


[27] P. Germain, L. Altucci, W. Bourguet, C. Rochette-Egly, andH. Gronemeyer, Nuclear receptor superfamily: principles ofsignaling, Pure and Applied Chemistry, 75, no. 11-12, 1619–1664, (2003).

[28] S. Khorasanizadeh and F. Rastinejad, Nuclear-receptor inter-actions on DNA-response elements, Trends in BiochemicalSciences, 26, no. 6, 384–390, (2001).

[29] M. Pawlak, P. Lefebvre, and B. Staels, General molecularbiology and architecture of nuclear receptors, Current Topicsin Medicinal Chemistry, 12, no. 6, 486–504, (2012).

[30] B. O’Hara, D. A. de la Rosa, and V. M. Rajendran, Multiplemineralocorticoid response elements localized in differentintrons regulate intermediate conductance K+ (Kcnn4) channelexpression in the rat distal colon, PLoS ONE, 9, Article IDe98695, (2014).

[31] J. S. Carroll, C. A. Meyer, J. Song, W. Li, T. R. Geistlinger, J.Eeckhoute, A. S. Brodsky, E. K. Keeton, K. C. Fertuck, G. F.Hall, Q.Wang, S. Bekiranov, V. Sementchenko, E. A. Fox, P. A.Silver, T. R. Gingeras, X. S. Liu, and M. Brown, Genome-wideanalysis of estrogen receptor binding sites,Nature Genetics, 38,no. 11, 1289–1297, (2006).

[32] S. Kato, H. Sasaki, M. Suzawa, S. Masushige, L. Tora,P. Chambon, and H. Gronemeyer, Widely spaced, directlyrepeated PuGGTCA elements act as promiscuous enhancers fordifferent classes of nuclear receptors, Molecular and CellularBiology, 15, no. 11, 5858–5867, (1995).

[33] F. Claessens and D. T. Gewirth, DNA recognition by nuclearreceptors, Essays in Biochemistry, 40, 59–72, (2004).

[34] T. Q. Phan, M. M. Jow, and M. L. Privalsky, DNA recognitionby thyroid hormone and retinoic acid receptors: 3,4,5 rulemodified,Molecular and Cellular Endocrinology, 319, no. 1-2,88–98, (2010).

[35] S. C. Biddie and S. John, Conversing with chromatin: thelanguage of nuclear receptors, Molecular Endocrinology, 28,3–15, (2014).

[36] M. Kishimoto, R. Fujiki, S. Takezawa, Y. Sasaki, T. Nakamura,K. Yamaoka, H. Kitagawa, and S. Kato, Nuclear receptormediated gene regulation through chromatin remodeling andhistone modifications, Endocrine Journal, 53, no. 2, 157–172,(2006).

[37] X. Zhang and S.-M. Ho, Epigenetics meets endocrinology,Journal of Molecular Endocrinology, 46, no. 1, R11–R32,(2011).

[38] R. M. Gadaleta and L. Magnani, Nuclear receptors and chro-matin: an inducible couple, Journal of Molecular Endocrinol-ogy, 52, R137–R149, (2014).

[39] M. W. King, The medical biochemistry,http://www.themedicalbiochemistrypage.org.

[40] T. Kouzarides, Chromatin modifications and their function,Cell, 128, no. 4, 693–705, (2007).

[41] K. Luger, A. W. Mäder, R. K. Richmond, D. F. Sargent, and T.J. Richmond, Crystal structure of the nucleosome core particleat 2.8 Å resolution, Nature, 389, no. 6648, 251–260, (1997).

[42] W. Hendrickson, Protein-DNA interactions studied by the gelelectrophoresis-DNA binding assay, BioTechniques, 3, no. 3,198–207, (1985).

[43] A. Revzin, Gel electrophoresis assays for DNA-protein interac-tions, BioTechniques, 7, no. 4, 346–355, (1989).

[44] I. P. Chernov, S. B. Akopov, L. G. Nikolaev, and E. D.Sverdlov, Identification and mapping of DNA binding proteinstarget sequences in long genomic regions by two-dimensionalEMSA, BioTechniques, 41, no. 1, 91–96, (2006).

[45] M. A. Lazar, T. J. Berrodin, and H. P. Harding, DifferentialDNA binding by monomeric, homodimeric, and potentiallyheteromeric forms of the thyroid hormone receptor, Molecularand Cellular Biology, 11, no. 10, 5005–5015, (1991).

[46] R. C. J. Ribeiro, P. J. Kushner, J. W. Apriletti, B. L. West, andJ. D. Baxter, Thyroid hormone alters in vitro DNA binding ofmonomers and dimers of thyroid hormone receptors,MolecularEndocrinology, 6, no. 7, 1142–1152, (1992).

[47] K. Shulemovich, D. D. Dimaculangan, D. Katz, and M. A.Lazar, DNA bending by thyroid hormone receptor: influenceof half-site spacing and RXR, Nucleic Acids Research, 23, no.5, 811–818, (1995).

[48] Y. Wu, Y.-Z. Yang, and R. J. Koenig, Protein-protein interac-tion domains and the heterodimerization of thyroid hormonereceptor variant α2 with retinoid X receptors, MolecularEndocrinology, 12, no. 10, 1542–1550, (1998).

[49] L. F. R. Velasco, M. Togashi, P. G. Walfish, R. P. Pessanha,F. N. Moura, G. B. Barra, P. Nguyen, R. Rebong, C. Yuan, L.A. Simeoni, R. C. J. Ribeiro, J. D. Baxter, P. Webb, and F. A.R. Neves, Thyroid hormone response element organization dic-tates the composition of active receptor, Journal of BiologicalChemistry, 282, no. 17, 12458–12466, (2007).

[50] Y. Chen and M. A. Young, Structure of a thyroid hor-mone receptor DNA-binding domain homodimer bound toan inverted palindrome DNA response element, MolecularEndocrinology, 24, no. 8, 1650–1664, (2010).

[51] A. C. M. Figueira, S. M. G. Dias, M. A. M. Santos, J. W.Apriletti, J. D. Baxter, P. Webb, F. A. R. Neves, L. A. Simeoni,R. C. J. Ribeiro, and I. Polikarpov, Human thyroid receptorforms tetramers in solution, which dissociate into dimers uponligand binding, Cell Biochemistry and Biophysics, 44, no. 3,453–462, (2006).

[52] B. J. Mengeling, S. Lee, and M. L. Privalsky, Coactivatorrecruitment is enhanced by thyroid hormone receptor trimers,Molecular and Cellular Endocrinology, 280, no. 1-2, 47–62,(2008).

[53] M.Mulero, J. Perroy, C. Federici, G. Cabello, andV.Ollendorff,Analysis of RXR/THR and RXR/PPARG2 heterodimerizationby bioluminescence resonance energy transfer (BRET), PLoSONE, 8, Article ID e84569, (2013).

[54] A. Takeshita, Y. Ozawa, and W. W. Chin, Nuclear receptorcoactivators facilitate vitamin D receptor homodimer action ondirect repeat hormone response elements, Endocrinology, 141,no. 3, 1281–1284, (2000).

[55] J. R. Schultz-Norton, Y. S. Ziegler, V. S. Likhite, and A. M.Nardulli, Isolation of proteins associated with the DNA-boundestrogen receptor alpha, Methods in Molecular Biology, 590,209–221, (2009).

[56] J. T. Read, H. Cheng, S. C. Hendy, C. C. Nelson, and P. S.Rennie, Receptor-DNA interactions: EMSA and footprinting,Methods in Molecular Biology, 505, 97–122, (2009).

[57] E. F. Greiner, J. Kirfel, H. Greschik, D. Huang, P. Becker, J.P. Kapfhammer, and R. Schüle, Differential ligand-dependentprotein-protein interactions between nuclear receptors anda neuronal-specific cofactor, Proceedings of the NationalAcademy of Sciences of the United States of America, 97, no.13, 7160–7165, (2000).

[58] J. J. Eloranta, C. Hiller, S. Häusler, B. Stieger, and G. A.Kullak-Ublick, Vitamin D3 and its nuclear receptor increasethe expression and activity of the human proton-coupled folatetransporter, Molecular Pharmacology, 76, no. 5, 1062–1071,(2009).


[59] L. M. Hellman and M. G. Fried, Electrophoretic mobility shiftassay (EMSA) for detecting protein-nucleic acid interactions,Nature Protocols, 2, no. 8, 1849–1861, (2007).

[60] T. E. Wilson, A. R. Mouw, C. A. Weaver, J. Milbrandt, andK. L. Parker, The orphan nuclear receptor NGFI-B regulatesexpression of the gene encoding steroid 21-hydroxylase,Molec-ular and Cellular Biology, 13, no. 2, 861–868, (1993).

[61] O. Chumsakul, K. Nakamura, T. Kurata, T. Sakamoto, N. Oga-sawara, T. Oshima, and S. Shikawa, High-resolution mappingof in vivo genomic transcription factor binding sites using insitu DNase I footprinting and ChIP-seq, DNA Research, 20,325–337, (2013).

[62] D. J. Galas and A. Schmitz, DNAase footprinting: a simplemethod for the detection of protein-DNA binding specificity,Nucleic Acids Research, 5, no. 9, 3157–3170, (1978).

[63] A. Ralston, Do transcription factors actually bind DNA? DNAfootprinting and gel shift assays, Nature Education, 1, p. 121,(2008).

[64] A. J. Hampshire, D. A. Rusling, V. J. Broughton-Head, and K.R. Fox, Footprinting: a method for determining the sequenceselectivity, affinity and kinetics of DNA-binding ligands,Methods, 42, no. 2, 128–140, (2007).

[65] B. Sclavi, S. Woodson, M. Sullivan, M. R. Chance, and M.Brenowitz, Time-resolved synchrotron X-ray “footprinting”,a new approach to the study of nucleic acid structure andfunction: application to Protein-DNA interactions and RNAfolding, Journal of Molecular Biology, 266, no. 1, 144–159,(1997).

[66] P. B. Becker, B. Gloss, W. Schmid, U. Strähle, and G. Schütz,In vivo protein-DNA interactions in a glucocorticoid responseelement require the presence of the hormone, Nature, 324, no.6098, 686–688, (1986).

[67] K. Sakurada, M. Ohshima-Sakurada, T. D. Palmer, and F. H.Gage, Nurr1, an orphan nuclear receptor, is a transcriptionalactivator of endogenous tyrosine hydroxylase in neural progen-itor cells derived from the adult brain, Development, 126, no.18, 4017–4026, (1999).

[68] T. E. Wilson, K. A. Padgett, M. Johnston, and J. Milbrandt, Agenetic method for defining DNA-binding domains: applicationto the nuclear receptor NGFI-B, Proceedings of the NationalAcademy of Sciences of the United States of America, 90, no.19, 9186–9190, (1993).

[69] Z. S. Ye and H. H. Samuels, Cell- and sequence-specificbinding of nuclear proteins to 5′-flankingDNAof the rat growthhormone gene, Journal of Biological Chemistry, 262, no. 13,6313–6317, (1987).

[70] P. H. J. Riegman, R. J. Vlietstra, J. A. G. M. Van der Korput, A.O. Brinkmann, and J. Trapman, The promoter of the prostate-specific antigen gene contains a functional androgen responsiveelement, Molecular Endocrinology, 5, no. 12, 1921–1930,(1991).

[71] M. Truss, G. Chalepakis, and M. Beato, Contacts betweensteroid hormone receptors and thymines in DNA: an interfer-ence method, Proceedings of the National Academy of Sciencesof the United States of America, 87, no. 18, 7180–7184, (1990).

[72] M. D. Driscoll, C. M. Klinge, R. Hilf, and R. A. Bambara,Footprint analysis of estrogen receptor binding to adjacentestrogen response elements, Journal of Steroid Biochemistryand Molecular Biology, 58, no. 1, 45–61, (1996).

[73] C. M. Klinge, D. L. Bodenner, D. Desai, R. M. Niles, and A.M. Traish, Binding of type II nuclear receptors and estrogen

receptor to full and half-site estrogen response elements in vitro,Nucleic Acids Research, 25, no. 10, 1903–1912, (1997).

[74] S. Kasper, P. S. Rennie, N. Bruchovsky, P. C. Sheppard,H. Cheng, L. Lin, R. P. C. Shiu, R. Snoek, and R. J.Matusik, Cooperative binding of androgen receptors to twoDNA sequences is required for androgen induction of theprobasin gene, Journal of Biological Chemistry, 269, no. 50,31763–31769, (1994).

[75] C. Yang, D. Zhou, and S. Chen, Modulation of aromataseexpression in the breast tissue by ERRα-1 orphan receptor,Cancer Research, 58, no. 24, 5695–5700, (1998).

[76] R. Das, A. Laederach, S. M. Pearlman, D. Herschlag, and R. B.Altman, SAFA: semi-automated footprinting analysis softwarefor high-throughput quantification of nucleic acid footprintingexperiments, RNA, 11, no. 3, 344–354, (2005).

[77] J. R. Hesselberth, X. Chen, Z. Zhang, P. J. Sabo, R. Sandstrom,A. P. Reynolds, R. E. Thurman, S. Neph, M. S. Kuehn, W. S.Noble, S. Fields, and J. A. Stamatoyannopoulos, Global map-ping of protein-DNA interactions in vivo by digital genomicfootprinting, Nature Methods, 6, no. 4, 283–289, (2009).

[78] J. R. Hesselberth, X. Chen, Z. Zhang, P. J. Sabo, R. Sandstrom,A. P. Reynolds, R. E. Thurman, S. Neph, M. S. Kuehn, W. S.Noble, S. Fields, and J. A. Stamatoyannopoulos, Global map-ping of protein-DNA interactions in vivo by digital genomicfootprinting, Nature Methods, 6, no. 4, 283–289, (2009).

[79] M. Sekimata, M. Pérez-Melgosa, S. A.Miller, A. S.Weinmann,P. J. Sabo, R. Sandstrom, M. O. Dorschner, J. A. Stamatoy-annopoulos, and C. B. Wilson, CCCTC-binding factor and thetranscription factor T-bet orchestrate T helper 1 cell-specificstructure and function at the interferon-γ locus, Immunity, 31,no. 4, 551–564, (2009).

[80] M. O. Dorschner, M. Hawrylycz, R. Humbert, J. C. Wallace,A. Shafer, J. Kawamoto, J. Mack, R. Hall, J. Goldy, P. J. Sabo,A. Kohli, Q. Li, M. McArthur, and J. A. Stamatoyannopoulos,High-throughput localization of functional elements by quanti-tative chromatin profiling, Nature Methods, 1, no. 3, 219–225,(2004).

[81] S. John, P. J. Sabo, R. E. Thurman, M.-H. Sung, S. C. Biddie,T. A. Johnson, G. L. Hager, and J. A. Stamatoyannopoulos,Chromatin accessibility pre-determines glucocorticoid receptorbinding patterns, Nature Genetics, 43, no. 3, 264–268, (2011).

[82] P. Becker, R. Renkawitz, and G. Schütz, Tissue-specific DNaseIhypersensitive sites in the 5′-flanking sequences of the trypto-phan oxygenase and the tyrosine aminotransferase genes, TheEMBO Journal, 3, no. 9, 2015–2020, (1984).

[83] X. Chen, M. M. Hoffman, J. A. Bilmes, J. R. Hesselberth,and W. S. Noble, A dynamic Bayesian network for identi-fying protein-binding footprints from single molecule-basedsequencing data, Bioinformatics, 26, no. 12, Article ID btq175,i334–i342, (2010).

[84] J. D. Turner, L. P. L. Pelascini, J. A. MacEdo, and C. P. Muller,Highly individual methylation patterns of alternative gluco-corticoid receptor promoters suggest individualized epigeneticregulatory mechanisms, Nucleic Acids Research, 36, no. 22,7207–7218, (2008).

[85] R. De Bruyn, R. Bollen, and F. Claessens, Identification andcharacterization of androgen response elements, Methods inMolecular Biology, 776, 81–93, (2011).

[86] L. H. Naylor, Reporter gene technology: the future looks bright,Biochemical Pharmacology, 58, no. 5, 749–757, (1999).

[87] T. Jiang, B. Xing, and J. Rao, Recent developments ofbiological reporter technology for detecting gene expression,


Biotechnology and Genetic Engineering Reviews, 25, 41–76,(2008).

[88] T. K. Kim and J. H. Eberwine,Mammalian cell transfection: thepresent and the future, Analytical and Bioanalytical Chemistry,397, no. 8, 3173–3178, (2010).

[89] F. Recillas-Targa, Multiple strategies for gene transfer, expres-sion, knockdown, and chromatin influence in mammalian celllines and transgenic animals,Molecular Biotechnology, 34, no.3, 337–354, (2006).

[90] D. J. Glover, H. J. Lipps, and D. A. Jans, Towards safe, non-viral therapeutic gene expression in humans, Nature ReviewsGenetics, 6, no. 4, 299–310, (2005).

[91] D. L. Nelson, A. L. Lehninger, and M. M. Cox, LehningerPrinciples of Biochemistry, W.H. Freeman, New York, NY,USA, 4th edition, 2005.

[92] I. Bronstein, J. Fortin, P. E. Stanley, G. S. A. B. Stewart, and L.J. Kricka, Chemiluminescent and bioluminescent reporter geneassays, Analytical Biochemistry, 219, no. 2, 169–181, (1994).

[93] T. M. Williams, J. E. Burlein, S. Ogden, L. J. Kricka, andJ. A. Kant, Advantages of firefly luciferase as a reportergene: application to the interleukin-2 gene promoter, AnalyticalBiochemistry, 176, no. 1, 28–32, (1989).

[94] P. Ciana, M. Raviscioni, P. Mussi, E. Vegeto, I. Que, M.G. Parker, C. Lowik, and A. Maggi, In vivo imaging oftranscriptionally active estrogen receptors, Nature Medicine, 9,no. 1, 82–86, (2003).

[95] Y. Nakajima, M. Ikeda, T. Kimura, S. Honma, Y. Ohmiya,and K.-I. Honma, Bidirectional role of orphan nuclear receptorRORα in clock gene transcriptions demonstrated by a novelreporter assay system, FEBS Letters, 565, no. 1–3, 122–126,(2004).

[96] S. Simon and S. O. Mueller, Human reporter gene assays:transcriptional activity of the androgen receptor is modulatedby the cellular environment and promoter context, Toxicology,220, no. 2-3, 90–103, (2006).

[97] A. C. M. Figueira, D. M. Saidemberg, P. C. T. Souza, L.Martínez, T. S. Scanlan, J. D. Baxter, M. S. Skaf, M. S.Palma, P. Webb, and I. Polikarpov, Analysis of agonist andantagonist effects on thyroid hormone receptor conformation byhydrogen/deuterium exchange, Molecular Endocrinology, 25,no. 1, 15–31, (2011).

[98] C. M. Tyree and K. Klausing, The mammalian two-hybridassay for detection of coactivator-nuclear receptor interactions,Methods in Molecular Medicine, 85, 175–183, (2003).

[99] C. Pan, Y.-P. Liu, Y.-F. Li, J.-X. Hu, J.-P. Zhang, H.-M.Wang, J. Li, and L.-C. Xu, Effects of cypermethrin on theligand-independent interaction between androgen receptor andsteroid receptor coactivator-1, Toxicology, 299, no. 2-3, 160–164, (2012).

[100] Z.-G. Sheng, Y. Tang, Y.-X. Liu, Y. Yuan, B.-Q. Zhao, X.-J. Chao, and B.-Z. Zhu, Low concentrations of bisphenola suppress thyroid hormone receptor transcription through anongenomic mechanism, Toxicology and Applied Pharmacol-ogy, 259, no. 1, 133–142, (2012).

[101] M. Nakka, I. U. Agoulnik, and N. L. Weigel, Targeted disrup-tion of the p160 coactivator interface of androgen receptor (AR)selectively inhibits AR activity in both androgen-dependentand castration-resistant AR-expressing prostate cancer cells,International Journal of Biochemistry and Cell Biology, 45, no.4, 763–772, (2013).

[102] L. Nagy, H.-Y. Kao, D. Chakravarti, R. J. Lin, C. A. Hassig,D. E. Ayer, S. L. Schreiber, and R. M. Evans, Nuclear receptor

repression mediated by a complex containing SMRT, mSin3A,and histone deacetylase, Cell, 89, no. 3, 373–380, (1997).

[103] J. Ang, J. Sheng, K. Lai, S. Wei, and X. Gao, Identificationof estrogen receptor-related receptor gamma as a direct tran-scriptional target of angiogenin, PLoS ONE, 8, no. 8, ArticleID e71487, (2013).

[104] S. Swami, A. V. Krishnan, L. Peng, J. Lundqvist, and D.Feldman, Transrepression of the estrogen receptor promoter bycalcitriol in human breast cancer cells via two negative vitaminD response elements, Endocrine-Related Cancer, 20, no. 4,565–577, (2013).

[105] F. Fang, Q. Zheng, J. Zhang, B. Dong, S. Zhu, X. Huang, Y.Wang, B. Zhao, S. Li, H. Xiong, J. Chen, N. Wu, S. W. Song,C. Chang, and Y. Yang, Testicular orphan nuclear receptor 4-associated protein 16 promotes non-small cell lung carcinomaby activating estrogen receptor β and blocking testicular orphannuclear receptor 2, Oncology Reports, 29, no. 1, 297–305,(2013).

[106] X. He, Z. Xu, B. Wang, Y. Zheng, W. Gong, G. Huang, L.Zhang, Y. Li, and F. He, Upregulation of thrombomodulinexpression by activation of farnesoid X receptor in vascularendothelial cells, European Journal of Pharmacology, 718,283–289, (2013).

[107] B. S. Katzenellenbogen and J. A. Katzenellenbogen, Estro-gen receptor alpha and estrogen receptor beta: regulation byselective estrogen receptor modulators and importance in breastcancer, Breast Cancer Research, 2, no. 5, 335–344, (2000).

[108] B. R. Henke, T. G. Consler, N. Go, R. L. Hale, D. R. Hohman,S. A. Jones, A. T. Lu, L. B. Moore, J. T. Moore, L. A. Orband-Miller, R. G. Robinett, J. Shearin, P. K. Spearing, E. L. Stewart,P. S. Turnbull, S. L. Weaver, S. P. Williams, G. B. Wisely, andM. H. Lambert, A new series of estrogen receptor modulatorsthat display selectivity for estrogen receptor β, Journal ofMedicinal Chemistry, 45, no. 25, 5492–5505, (2002).

[109] M. J. Meyers, J. Sun, K. E. Carlson, G. A. Marriner, B.S. Katzenellenbogen, and J. A. Katzenellenbogen, Estrogenreceptor-β potency-selective ligands: structure-activity rela-tionship studies of diarylpropionitriles and their acetylene andpolar analogues, Journal of Medicinal Chemistry, 44, no. 24,4230–4251, (2001).

[110] H. A. Harris, L. M. Albert, Y. Leathurby, M. S. Malamas, R.E. Mewshaw, C. P. Miller, Y. P. Kharode, J. Marzolf, B. S.Komm, R. C. Winneker, D. E. Frail, R. A. Henderson, Y. Zhu,and J. C. Keith Jr., Evaluation of an estrogen receptor-β agonistin animal models of human disease, Endocrinology, 144, 4241–4249, (2003).

[111] N. T. Peekhaus, M. Ferrer, T. Chang, O. Kornienko, J. E.Schneeweis, T. S. Smith, I. Hoffman, L. J. Mitnaul, J. Chin, P.A. Fischer, T. A. Blizzard, E. T. Birzin, W. Chan, J. Inglese, B.Strulovici, S. P. Rohrer, and J. M. Schaeffer, A beta-lactamase-dependent Gal4-estrogen receptor beta transactivation assay forthe ultra-high throughput screening of estrogen receptor betaagonists in a 3456-well format, ASSAY and Drug DevelopmentTechnologies, 1, no. 6, 789–800, (2003).

[112] X. Shi, W. Zheng, J. E. Schneeweis, P. A. Fischer, B. Strulovici,and N. T. Peekhaus, A short-incubation reporter-gene assay forhigh-throughput screening of estrogen receptor-α antagonists,ASSAY andDrugDevelopment Technologies, 3, no. 4, 393–400,(2005).

[113] D. Raha, M. Hong, and M. Snyder, ChIP-Seq: a method forglobal identification of regulatory elements in the genome,Current Protocols in Molecular Biology, no. 91, 1–14, (2010).


[114] W. Sikora-Wohlfeld, M. Ackermann, E. Christodoulou, K.Singaravelu, and A. Beyer, Assessing computational methodsfor transcription factor target gene identification based onChIP-seq data, PLOS Computational Biology, 9, Article IDe1003342, (2013).

[115] M.-H. Kuo and C. D. Allis, In vivo cross-linking and immuno-precipitation for studying dynamic protein:DNA associations ina chromatin environment,Methods, 19, no. 3, 425–433, (1999).

[116] J. Pike and M. Meyer, Fundamentals of vitamin D hormone-regulated gene expression, The Journal of Steroid Biochemistryand Molecular Biology, 144, part A, 5–11, (2014).

[117] A. Barski, S. Cuddapah, K. Cui, T.-Y. Roh, D. E. Schones,Z. Wang, G. Wei, I. Chepelev, and K. Zhao, High-resolutionprofiling of histone methylations in the human genome, Cell,129, no. 4, 823–837, (2007).

[118] J. Wu, L. T. Smith, C. Plass, and T. H.-M. Huang, ChIP-chipcomes of age for genome-wide functional analysis, CancerResearch, 66, no. 14, 6899–6902, (2006).

[119] B. G. Hoffman and S. J. M. Jones, Genome-wide identificationofDNA-protein interactions using chromatin immunoprecipita-tion coupled with flow cell sequencing, Journal of Endocrinol-ogy, 201, no. 1, 1–13, (2009).

[120] R. Nielsen, T. Å. Pedersen, D. Hagenbeek, P. Moulos, R. Siers-bæk, E. Megens, S. Denissov, M. Børgesen, K.-J. Francoijs,S. Mandrup, and H. G. Stunnenberg, Genome-wide profilingof PPARγ:RXR and RNA polymerase II occupancy revealstemporal activation of distinct metabolic pathways and changesin RXR dimer composition during adipogenesis, Genes andDevelopment, 22, no. 21, 2953–2967, (2008).

[121] T. E. Reddy, F. Pauli, R. O. Sprouse, N. F. Neff, K. M.Newberry, M. J. Garabedian, and R. M. Myers, Genomic deter-mination of the glucocorticoid response reveals unexpectedmechanisms of gene regulation, Genome Research, 19, no. 12,2163–2171, (2009).

[122] W.-J. Welboren, M. A. Van Driel, E. M. Janssen-Megens,S. J. Van Heeringen, F. C. Sweep, P. N. Span, and H. G.Stunnenberg, ChIP-Seq of ERα and RNA polymerase II definesgenes differentially responding to ligands, The EMBO Journal,28, no. 10, 1418–1428, (2009).

[123] T. Adhikary, D. T. Brandt, K. Kaddatz, J. Stockert, S.Naruhn, W. Meissner, F. Finkernagel, J. Obert, S. Lieber, M.Scharfe, M. Jarek, P. M. Toth, F. Scheer, W. E. Diederich,S. Reinartz, R. Grosse, S. Müller-Brüsselbach, and R. Müller,Inverse PPARβ/δ agonists suppress oncogenic signaling to theANGPTL4 gene and inhibit cancer cell invasion,Oncogene, 32,5241–5252, (2013).

[124] T. S. Furey, ChIP-seq and beyond: new and improved method-ologies to detect and characterize protein-DNA interactions,Nature Reviews Genetics, 13, no. 12, 840–852, (2012).

[125] R. Kittler, J. Zhou, S. Hua, L. Ma, Y. Liu, E. Pendleton, C.Cheng, M. Gerstein, and K. P. White, A comprehensive nuclearreceptor network for breast cancer cells, Cell Reports, 3, no. 2,538–551, (2013).

[126] Q. Tang, Y. Chen, C. Meyer, T. Geistlinger, M. Lupien,Q. Wang, T. Liu, Y. Zhang, M. Brown, and X. S. Liu, Acomprehensive view of nuclear receptor cancer cistromes,Cancer Research, 71, no. 22, 6940–6947, (2011).

[127] C. E. Massie and I. G. Mills, Global identification of androgenresponse elements, Methods in Molecular Biology, 776, 255–273, (2011).

[128] K. R. Chng and E. Cheung, Sequencing the transcriptionalnetwork of androgen receptor in prostate cancer, CancerLetters, 340, 254–360, (2012).

[129] Q. Li, H. Wang, L. Yu, J. Zhou, J. Chen, X. Zhang, L. Chen,Y. Gao, and Q. Li, ChIP-seq predicted estrogen receptor bidingsites in human breast cancer cell line MCF7, Tumor Biology,35, 4779–4784, (2014).

[130] W. Zwart, R. Koornstra, J. Wesseling, E. Rutgers, S. Linn, andJ. S. Carroll, A carrier-assisted ChIP-seq method for estrogenreceptor-chromatin interactions from breast cancer core needlebiopsy samples, BMC Genomics, 14, no. 1, article no. 232,(2013).

[131] M. Ding, H. Wang, J. Chen, B. Shen, and Z. Xu, Identificationand functional annotation of genome-wide ER-regulated genesin breast cancer based on ChIP-Seq data, Computational andMathematical Methods in Medicine, 2012, Article ID 568950,10 pages, (2012).

[132] D. Pan, M. Kocherginsky, and S. D. Conzen, Activation of theglucocorticoid receptor is associated with poor prognosis inestrogen receptor-negative breast cancer, Cancer Research, 71,no. 20, 6360–6370, (2011).

[133] T. Adhikary, D. T. Brandt, K. Kaddatz, J. Stockert, S.Naruhn, W. Meissner, F. Finkernagel, J. Obert, S. Lieber, M.Scharfe, M. Jarek, P. M. Toth, F. Scheer, W. E. Diederich,S. Reinartz, R. Grosse, S. Müller-Brüsselbach, and R. Müller,Inverse PPARβ/δ agonists suppress oncogenic signaling to theANGPTL4 gene and inhibit cancer cell invasion,Oncogene, 32,5241–5252, (2013).

[134] P. Ramadoss, B. Abraham, L. Tsai, Y. Zhou, R. Costa-E-Sousa, F. Ye, M. Bilban, K. Zhao, and A. Hollenberg,Novel mechanism of positive versus negative regulation bythyroid hormone receptor β1 (TRβ1) Identified by genome-wide profiling of binding sites in mouse liver, Journal ofBiological Chemistry, 289, 1313–1328, (2014).

[135] P. Shankaranarayanan, M.-A. Mendoza-Parra, W. Van Gool,L. M. Trindade, and H. Gronemeyer, Single-tube linear DNAamplification for genome-wide studies using a few thousandcells, Nature Protocols, 7, no. 2, 328–339, (2012).

[136] M. Boergesen, T. Å. Pedersen, B. Gross, S. J. van Heeringen,D. Hagenbeek, C. Bindesbøll, S. Caron, F. Lalloyer, K. R.Steffensen, H. I. Nebb, J.-A. Gustafsson, H. G. Stunnenberg,B. Staels, and S. Mandrup, Genome-wide profiling of liverX receptor, retinoid X receptor, and peroxisome proliferator-activated receptor α in mouse liver reveals extensive sharing ofbinding sites, Molecular and Cellular Biology, 32, no. 4, 852–867, (2012).

[137] I. Poser, M. Sarov, J. R. A. Hutchins, J.-K. Hériché, Y. Toyoda,A. Pozniakovsky, D. Weigl, A. Nitzsche, B. Hegemann, A. W.Bird, L. Pelletier, R. Kittler, S. Hua, R. Naumann,M. Augsburg,M. M. Sykora, H. Hofemeister, Y. Zhang, K. Nasmyth, K. P.White, S. Dietzel, K. Mechtler, R. Durbin, A. F. Stewart, J.-M.Peters, F. Buchholz, and A. A. Hyman, BAC TransgeneOmics:a high-throughput method for exploration of protein function inmammals, Nature Methods, 5, 409–415, (2008).

[138] D. Wu, C. Zhang, Y. Shen, K. P. Nephew, and Q. Wang,Androgen receptor-driven chromatin looping in prostate cancer,Trends in Endocrinology and Metabolism, 22, no. 12, 474–480,(2011).

[139] M. J. Fullwood and Y. Ruan, ChIP-based methods for theidentification of long-range chromatin interactions, Journal ofCellular Biochemistry, 107, no. 1, 30–39, (2009).


[140] J. Dekker, K. Rippe, M. Dekker, and N. Kleckner, Capturingchromosome conformation, Science, 295, no. 5558, 1306–1311, (2002).

[141] B. Tolhuis, R.-J. Palstra, E. Splinter, F. Grosveld, and W. DeLaat, Looping and interaction between hypersensitive sites inthe active β-globin locus,Molecular Cell, 10, no. 6, 1453–1465,(2002).

[142] M. Simonis, J. Kooren, and W. de Laat, An evaluation of 3C-based methods to capture DNA interactions, Nature Methods,4, no. 11, 895–901, (2007).

[143] D. H. Barnett, S. Sheng, T. H. Charn, A. Waheed, W. S. Sly,C.-Y. Lin, E. T. Liu, and B. S. Katzenellenbogen, Estrogenreceptor regulation of carbonic anhydrase XII through a distalenhancer in breast cancer, Cancer Research, 68, no. 9, 3505–3515, (2008).

[144] O. Hakim, S. John, J. Q. Ling, S. C. Biddie, A. R. Hoffman,andG. L. Hager, Glucocorticoid receptor activation of the Ciz1-Lcn2 locus by long range interactions, Journal of BiologicalChemistry, 284, no. 10, 6048–6052, (2009).

[145] S. E. LeBlanc, Q. Wu, A. R. Barutcu, H. Xiao, Y. Ohkawa,and A. N. Imbalzano, The PPARγ locus makes long-rangechromatin interactions with selected tissue-specific gene lociduring adipocyte differentiation in a protein kinase A dependentmanner, PLoS ONE, 9, 1–12, (2014).

[146] Z. Zhao, G. Tavoosidana, M. Sjölinder, A. Göndör, P. Mariano,S. Wang, C. Kanduri, M. Lezcano, K. S. Sandhu, U. Singh,V. Pant, V. Tiwari, S. Kurukuti, and R. Ohlsson, Circularchromosome conformation capture (4C) uncovers extensivenetworks of epigenetically regulated intra- and interchromo-somal interactions, Nature Genetics, 38, no. 11, 1341–1347,(2006).

[147] J. Dostie, T. A. Richmond, R. A. Arnaout, R. R. Selzer, W.L. Lee, T. A. Honan, E. D. Rubio, A. Krumm, J. Lamb,C. Nusbaum, R. D. Green, and J. Dekker, ChromosomeConformation Capture Carbon Copy (5C): a massively parallelsolution for mapping interactions between genomic elements,Genome Research, 16, no. 10, 1299–1309, (2006).

[148] V. K. Tiwari, L. Cope, K. M. McGarvey, J. E. Ohm, and S. B.Baylin, A novel 6C assay uncovers Polycomb-mediated higherorder chromatin conformations, Genome Research, 18, no. 7,1171–1179, (2008).

[149] E. M. Goldys, Fluorescence Applications in Biotechnology andthe Life Sciences, Wiley-Blackwell, Hoboken, NJ, USA, 2009.

[150] A. V. Hill, The possible effects of the aggregation of themolecules of haemoglobin on its oxygen dissociation curve,The Journal of Physiology, 40, 4–7, (1910).

[151] L. M. T. R. Lima and J. L. Silva, Positive contribution ofhydration onDNA binding by E2c protein from papillomavirus,Journal of Biological Chemistry, 279, no. 46, 47968–47974,(2004).

[152] Fluorescence Polarization Technical Resource Guide, Invitro-gen Co., Madison, Wis, USA, 4th edition, 2006.

[153] A. C. M. Figueira, I. Polikarpov, D. Veprintsev, and G. M.Santos, Dissecting the relation between a nuclear receptor andGATA: binding affinity studies of thyroid hormone receptor andGATA2 on TSHβ promoter, PloS ONE, 5, no. 9, Article IDe12628, (2010).

[154] A. C. M. Figueira, L. M. T. R. Lima, L. H. F. Lima, A. T.Ranzani, G. D. S. Mule, and I. Polikarpov, Recognition by thethyroid hormone receptor of canonical DNA response elements,Biochemistry, 49, no. 5, 893–904, (2010).

[155] S. Wang, C. Zhang, S. K. Nordeen, and D. J. Shapiro, Invitro fluorescence anisotropy analysis of the interaction of full-length SRC1a with estrogen receptors α and β supports anactive displacement model for coregulator utilization, Journalof Biological Chemistry, 282, no. 5, 2765–2775, (2007).

[156] C. Zhang, S. K. Nordeen, and D. J. Shapiro, Fluorescenceanisotropy microplate assay to investigate the interaction offull-length steroid receptor coactivator-1a with steroid recep-tors, Methods in Molecular Biology, 977, 339–351, (2013).

[157] V. Pogenberg, J.-F. Guichoul, V. Vivat-Hannah, S. Kammerer,E. Pérez, P. Germain, A. R. De Lera, H. Gronemeyer, C. A.Royer, and W. Bourguet, Characterization of the interactionbetween retinoic acid receptor/retinoid X receptor (RAR/RXR)heterodimers and transcriptional coactivators through structuraland fluorescence anisotropy studies, Journal of BiologicalChemistry, 280, no. 2, 1625–1633, (2005).

[158] M. Boyer, N. Poujol, E. Margeat, and C. A. Royer, Quantitativecharacterization of the interaction between purified humanestrogen receptor α and DNA using fluorescence anisotropy,Nucleic Acids Research, 28, no. 13, 2494–2502, (2000).

[159] N. Poujol, E. Margeat, S. Baud, and C. A. Royer, RAR antag-onists diminish the level of DNA binding by the RAR/RXRheterodimer, Biochemistry, 42, no. 17, 4918–4925, (2003).

[160] Y. Chen and M. A. Young, Structure of a thyroid hor-mone receptor DNA-binding domain homodimer bound toan inverted palindrome DNA response element, MolecularEndocrinology, 24, no. 8, 1650–1664, (2010).

[161] M. S. Ozers, J. J. Hill, K. Ervin, J. R. Wood, A. M. Nardulli,C. A. Royer, and J. Gorski, Equilibrium binding of estrogenreceptor with DNA using fluorescence anisotropy, Journal ofBiological Chemistry, 272, no. 48, 30405–30411, (1997).

[162] S. Thénot, S. Bonnet, A. Boulahtouf, E. Margeat, C. A.Royer, J.-L. Borgna, and V. Cavailles, Effect of ligand andDNA binding on the interaction between human transcriptionintermediary factor 1α and estrogen receptors, MolecularEndocrinology, 13, no. 12, 2137–2150, (1999).

[163] S. Y. Wang, B. S. Ahn, R. Harris, S. K. Nordeen, and D. J.Shapiro, Fluorescence anisotropy microplate assay for analysisof steroid receptor-DNA interactions, BioTechniques, 37, no. 5,807–817, (2004).

[164] R. Bolger, T. E. Wiese, K. Ervin, S. Nestich, andW. Checovich,Rapid screening of environmental chemicals for estrogenreceptor binding capacity, Environmental Health Perspectives,106, no. 9, 551–557, (1998).

[165] C.Mao, N.M. Patterson,M. T. Cherian, I. O. Aninye, C. Zhang,J. B. Montoya, J. Cheng, K. S. Putt, P. J. Hergenrother, E. M.Wilson, A. M. Nardulli, S. K. Nordeen, and D. J. Shapiro, Anew small molecule inhibitor of estrogen receptor α binding toestrogen response elements blocks estrogen-dependent growthof cancer cells, Journal of Biological Chemistry, 283, no. 19,12819–12830, (2008).

[166] J. R. Lundblad, M. Laurance, and R. H. Goodman, Fluores-cence polarization analysis of protein-DNA and protein-proteininteractions, Molecular Endocrinology, 10, no. 6, 607–612,(1996).

[167] B. Cheskis and L. P. Freedman, Modulation of nuclear receptorinteractions by ligands: kinetic analysis using surface plasmonresonance, Biochemistry, 35, no. 10, 3309–3318, (1996).

[168] B. J. Cheskis, S. Karathanasis, and C. R. Lyttle, Estrogenreceptor ligands modulate its interaction with DNA, Journal ofBiological Chemistry, 272, no. 17, 11384–11391, (1997).


[169] J. N. Siew, X. Su, and J. S. Thomsen, Surface plasmonresonance study of cooperative interactions of estrogen receptorα and transcriptional factor Sp1 with composite DNA elements,Analytical Chemistry, 81, no. 9, 3344–3349, (2009).

[170] B. J. Deegan, K. L. Seldeen, C. B. McDonald, V. Bhat, and A.Farooq, Binding of the ERα nuclear receptor to DNA is coupledto proton uptake, Biochemistry, 49, no. 29, 5978–5988, (2010).

[171] L. Y. Low, H. Hernández, C. V. Robinson, R. O’Brien, J.G. Grossmann, J. E. Ladbury, and B. Luisi, Metal-dependentfolding and stability of nuclear hormone receptor DNA-bindingdomains, Journal of Molecular Biology, 319, no. 1, 87–106,(2002).

[172] M. L. Cutress, H. C. Whitaker, I. G. Mills, M. Stewart, and D.E. Neal, Structural basis for the nuclear import of the humanandrogen receptor, Journal of Cell Science, 121, no. 7, 957–968, (2008).

[173] B.-D. K. Putcha and E. J. Fernandez, Direct interdomaininteractions can mediate allosterism in the thyroid receptor,Journal of Biological Chemistry, 284, no. 34, 22517–22524,(2009).




Research Article

Progesterone Receptor Subcellular Localizationand Gene Expression Profile in HumanAstrocytoma Cells Are Modified by Progesterone

Aliesha González-Arenas1, Alejandro Cabrera-Wrooman2, Néstor Fabián Díaz3, TaniaKarina González-García2, Ivan Salido-Guadarrama4, Mauricio Rodríguez-Dorantes4, andIgnacio Camacho-Arroyo2

1Departamento de Medicina Genómica y Toxicología Ambiental, Instituto de Investigaciones Biomédicas, Universidad NacionalAutónoma de México, Ciudad Universitaria, 04510, Distrito Federal, México2Facultad de Química, Departamento de Biología, Universidad Nacional Autónoma de México, Ciudad Universitaria, 04510Coyoacán, DF, México3Departamento de Biología Celular, Instituto Nacional de Perinatología, 11000 México City, DF, México4Instituto Nacional de Medicina Genómica, Periférico Sur 4809, Arenal Tepepan, Tlalpan, 14610 Ciudad de México, DF, México

Corresponding Author: Ignacio Camacho-Arroyo; email: [email protected]

Recieved 11 July 2014; Accepted 30 September 2014

Editor: Marcelo H. Napimoga

Copyright © 2014 Aliesha González-Arenas et al. This is an open access article distributed under the Creative CommonsAttribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original workis properly cited.

Abstract. Intracellular progesterone receptor (PR) has been identified in human astrocytomas, the most common and aggressiveprimary brain tumors in humans. It has been reported that PR cell distribution affects their transcriptional activity and turnover.In this work we studied by immunofluorescence the effects of estradiol and progesterone on the subcellular localization of PRin a grade III human astrocytoma derived cell line (U373). We observed that total PR was mainly distributed in the cytoplasmwithout hormonal treatment. Estradiol (10 nM) increased PR presence in the cytoplasm of U373 cells, whereas progesterone(10 nM) and RU486 (PR antagonist, 1 µM) blocked this effect. To investigate the role of PR activity in the regulation of geneexpression pattern of U373 cells, we evaluated by microarray analysis the profile of genes regulated by progesterone, RU486, orboth steroids. We found different genes regulated by steroid treatments that encode for proteins involved in metabolism, transport,cell cycle, proliferation, metastasis, apoptosis, processing of nucleic acids and proteins, adhesion, pathogenesis, immune response,cytoskeleton, and membrane receptors. We determined that 30 genes were regulated by progesterone, 41 genes by RU486 alone,and 13 genes by the cotreatment of progesterone+RU486, suggesting that there are many genes regulated by intracellular PRor through other signaling pathways modulated by progesterone. All these data suggest that PR distribution and activity shouldmodify astrocytomas growth.

Keywords: progesterone receptor, progesterone regulated genes, human astrocytomas, gliomas, immunofluorescence, microarrays

1. Introduction

Progesterone (P4) participates in the regulation of diversefunctions and diseases in the brain by interacting with

its intracellular receptors (PR) [1–3]. In humans, two PRisoforms with different functions and regulation have beencharacterized: PR-A (94 kDa) and PR-B (116 kDa). Bothisoforms are encoded by the same gene but are regulated by


distinct promoters and generated from alternative transcrip-tion initiation sites [4–6].

PR has been detected in several human brain tumorssuch as astrocytomas, meningiomas, chordomas, and cran-iopharyngiomas [7–11]. In astrocytomas, a direct relationbetween PR expression and tumor grade has been reported[9, 10, 12, 13]. The most frequent and aggressive humanbrain tumors are astrocytomas, which are glial cell derivedtumors (gliomas) with high malignant potential. They arisefrom astrocytes, glial progenitor cells, or cancer stem cells[14–18]. They originate anywhere in the brain but are mainlylocated in the cerebral cortex, appearing more frequently inadults between 40 and 60 years old [19]. Astrocytomas areclassified according to their histopathological and molecularfeatures into four grades (I-IV), where grade IV, also knownas glioblastoma, represents the maximal evolution stage. Thesurvival of patients is inversely related to the degree of tumorprogression [19, 20].

PR is expressed in biopsies from human astrocytomas [9,12, 21] and cell lines U373 and D54 which are derived fromhuman astrocytomas grades III and IV, respectively [19]. Thecontent of PR increased after estradiol treatment in U373cells [13]. In many cell types, PR expression is upregulatedby estradiol at transcriptional level by estrogen-responsiveelements located in the PR promoter [22], while P4 inducesphosphorylation of PR which marks it to be degraded by theproteasome pathway resulting in PR downregulation [23].

Proliferation of many cancer cells is under P4 control.P4 significantly increased the number of D54 cells from thesecond day of culture and the number of U373 cells on days3-5 whereas the PR antagonist, RU486, blocked P4 effects inboth astrocytoma cell lines [21]. A transient increase in phaseS of cell cycle was seen in U373 astrocytoma cells after P4treatment, which was correlated with the induction of genesassociated with cell cycle progression, such as cyclin D1 [21,24]. Growth factors and their receptors have been proposedas candidate mediators of P4 effects on cell proliferation. ThemRNA and protein expression of vascular endothelial growthfactor and epidermal growth factor receptor were increasedby P4 in astrocytoma cells, and this increase was blockedby RU486 [24]. However, the effects of PR activation on theprofile of gene expression in U373 cells are unknown.

Since the subcellular distribution and the expression of PRare critical for cell function, we studied PR localization byimmunofluorescence as well as the gene expression patternin U373 cells after P4 and RU486 treatments.

2. Materials andMethods

2.1. Cell culture and treatments. Human astrocytomaderived cell line U373 (ATCC, Manassas, VA) grade IIIwas used. For immunofluorescence experiments 5 x 103cellswere plated in 4-well glass slides and for microarrays andRT-PCR experiments 1 × 106 cells were plated in 10 cmdishes. Cells were cultured in Dulbecco’s modification of

Eagle’s medium (DMEM) for U373 cells, supplemented with10% fetal bovine serum, 1 mM pyruvate, 2 mM glutamine,0.1 mM nonessential amino acids (GIBCO, NY) for 24 h.Medium was changed by DMEM phenol red free mediumsupplemented with 10% fetal bovine serum without steroidhormones (HyClone, Utah), at 37 ∘C under a 95% air, 5%CO2 atmosphere during 24 h. The following treatmentswere applied for locating PR by immunofluorescence assays:(1) vehicle (0.02% cyclodextrin in sterile water), 48 h; (2)estradiol (10 nM), 48 h; (3) estradiol, 48 h followed byP4 (10 nM), 24 h; (4) estradiol, 48 h followed by RU 486(PR antagonist, 1 µM), 24 h; (5) estradiol, 48 h followedby P+RU 486, 24 h. Each experiment was performed inthree independent cultures. Cyclodextrin, P4, estradiol, andRU486 were purchased from Sigma-Aldrich (St. Louis,MO, USA). In the case of the gene expression profiledetermined by microarray assays, cells were treated withvehicle, 10 nM of P4, 1 µM of RU486, or both steroids for12 h.

2.2. Immunofluorescence. Indirect immunofluorescence wasused to characterize total PR subcellular location in U373cells. After all treatments cells were rinsed with phosphate-buffered saline (PBS), fixed with 4% paraformaldehydefor 20 min at room temperature, washed with PBS, andpermeabilized with 100% methanol for 6 min at 4∘C.After washing again with PBS, nonspecific binding wasblocked by applying 5% normal goat serum and 1% BSAfor 1 h at room temperature. Cells were incubated withprimary antibody (rabbit anti-PR polyclonal antibody SC-539, Santa Cruz Biotechnology, Dallas, TX, USA) (8µg/ml) at 4∘C overnight. Cells were incubated with thesecondary anti-rabbit antibody conjugated with the fluo-rophore FITC (Invitrogen, Carlsbad, CA, USA) (1:1000),for 2 h at room temperature. Nuclei were stained with 1ng/ml of Hoechst 33258 (Sigma, St. Louis, MO, USA).Negative controls consisted of cells in which the primaryantibody was omitted. These experiments did not produceany staining (data not shown). Images were acquired in anOlympus BX43 microscope (Olympus, PA, USA), to detectFITC and Hoechst fluorescence in a sequential manner, byexciting with different wavelengths. To establish coexpres-sion of the used markers, merged images were generated.The examiner was unaware of the treatment condition ofcells.

2.3. Microarrays and analysis. TRIzol Reagent (Invitro-gen, CLD, CA, USA) was employed to isolate total RNAaccording to manufacturer’s recommendations. RNA quan-tity and purity were assessed by using the spectrophotometerNanoDrop-2000 (Thermo Scientific, Waltham, MA, USA).RNA samples were tested on the Agilent 2100 Bioanalyzer(Agilent Technologies, Santa Clara, CA, USA) to evaluateRNA integrity. RNA samples with RIN above 9 were usedto generate labeled cRNA, which were hybridized to Human


Gene 1.0 ST Array microarrays (Affymetrix, Cleveland, OH,USA). RNAwas obtained with these features, and exogenouspositive controls included in the GeneChip Eukaryotic Poly-A RNA Control Kit (Affymetrix, Cleveland, OH, USA)were added. Subsequently, we used the WT Expression Kit(Ambion, Life Technologies, Waltham, MA, USA) for thesynthesis and amplification of complementary DNA (cDNA)which was fragmented and labeled at its 3 ’end with theWT Terminal Labeling Kit (Affymetrix, Cleveland, OH,USA). GeneChip Human Gene 1.0 ST Array (Affymetrix,Cleveland, OH, USA) consisting of 28,000 full-length humangenes was used for hybridization of fragmented cDNA thatwas added to a hybridization mixture and stained withstreptavidin/phycoerythrin.

The data were preprocessed and analyzed using the oligoand LIMMA (linear models for microarray data) libraries,both part of the bioconductor project, on the R statisticalenvironment. Raw intensity data were normalized usingquantile normalization. Differential expression between dif-ferent groups was analyzed using empirical Bayes methodimplemented in the LIMMA package and P values werecomputed. P value cutoff of < 0.05 and fold change cutoffof >1.5 were used as criteria to identify differences in geneexpression.

2.4. RNA isolation and RT-PCR. TRIzol Reagent (Invitro-gen, CLD, CA, USA) was employed to isolate total RNAaccording to manufacturer’s recommendations. RNA quan-tity and purity were assessed by using the spectrophotometerNanoDrop-2000 (Thermo Scientific, MA, USA). RNA sam-ples were tested on the Agilent 2100 Bioanalyzer (AgilentTechnologies, Santa Clara, CA, USA) to evaluate RNAintegrity. cDNA was synthesized from 3 𝜇g of total RNA byusing SuperScript II reverse transcription (Invitrogen CLD,CA, USA) and oligo (dT)12−18 primers (Sigma-Aldrich, St.Louis, MO, USA) according to its protocol. 3 𝜇L of RT reac-tion was subjected to PCR in order to simultaneously amplifydifferent genes fragments. 18S ribosomal RNA was used asan internal control. The sequences of the specific primers(Sigma-Aldrich, St. Louis, MO, USA) for GLIPR2, IL7RSREBF1, IL18, TGF𝛽2, MAP1B, ANLN, HBG1, STARD4,AOC3, and 18S amplification fragments are indicated inTable 1. The 25 𝜇l PCR reaction included 2 𝜇l of previouslysynthesized cDNA, 2.5 𝜇l 10X buffer PCR, 1.25 mMMgCl2,0.25 mM of each dNTP, 15 𝜇M of each primer, and 2.5 unitsof Taq DNA polymerase. Negative controls without RNAand with nonretrotranscribed RNA were included in all theexperiments. After the initial denaturation step at 94 ∘C for 5min, PCR reaction was performed for 30 cycles. The cycleprofile for each gene and 18S amplification was 30 s at 94∘C, 30 s at the melting temperature of each primer, and 30s at 72 ∘C. A final extension cycle was performed at 72∘C for 5 min. The number of performed cycles was withinthe exponential phase of the amplification process. 25 𝜇l ofPCR products was separated on 2% agarose gel and stained

with GelRed𝑇𝑀 (Biotium, Hayward, CA, USA). The imagewas captured under a UV transilluminator. The intensityof amplified fragments and 18S bands was quantified bydensitometry using the ImageJ software (National Instituteof Health, WA). Gene expression levels were normalized tothose of 18S.

2.5. Statistical analysis. All images were analyzed andquantified by using ImageJ (Image Processing and Analysisin Java). All data were analyzed and plotted by using Graph-Pad Prism version 5.00 for Windows, (GraphPad Software,San Diego, CA, USA). All data are presented as arbitraryunits of fluorescence intensity/cell (mean ± S.E.M.). Forimmunofluorescence and RT-PCR studies, statistical analysisbetween comparable groups was performed with an ANOVAfollowed by a Bonferroni’s post test. A value of P< 0.05 wasconsidered statistically significant as stated in figure legends.

3. Results

3.1. Subcellular localization of PR in U373 cells . First, wedetermined the subcellular localization of total PR in humanastrocytoma cells by immunofluorescence. We observedthat PR was mainly located in the cytoplasm of U373cells independent of hormone treatment (Figures 1 and 2).Estradiol increased PR presence in the cytoplasm of U373cells that was reduced with P4 and/or RU486 treatmentsafter estradiol PR induction (Figures 1 and 2). Experimentsusing P4 or RU486 alone or combining both steroids withoutthe previous estradiol treatment were done; nevertheless, P4and RU486 downregulated PR cytoplasmic content in sucha manner that fluorescence quantification was not possible(data not shown).

3.2. Groups of genes regulated by P4, RU486, andP4+RU486 in U373 cells. After microarray analysis, geneswere organized into three groups based on the differenttreatments: P4, RU486, and P4+RU486 (SupplementaryTables). We found that regulated genes are encoded forproteins involved in metabolism, transport, cell cycle, prolif-eration, metastasis, apoptosis, processing of nucleic acids andproteins, adhesion, pathogenesis, immune response, dockingcomplexes, cytoskeleton, and membrane receptors. We alsofound genes encoding for siRNAs or for some products withno specific assigned function.

3.3. Validation by RT-PCR of genes regulated by P4, RU486,and P4+RU486. After the review of gene function and itsexchange rate ≥ 1.5 relative to vehicle, 10 genes were chosenfor microarray validation. The main criterion for choosingthese genes was the fact that they have been involved in can-cer development, and specifically in astrocytomas growth. Inthis regard, genes implicated in processes such as immuneresponse, transcription, cytoskeletal function, metabolism,


Table 1: Primers for PCR Analysis.

Gene Primer sequence Amplified fragmentGLIPR2 FW 5’- CCTGTGGGTGTATGTGCTTG -3’ 157 pbGLIPR2 RV 5’- CCCCAATCCAAATAATCGTG -3’IL7R FW 5’- CTGAGGCTCCTTTTGACCTG -3’ 159 pb*IL7R RV 5’- TCACATGCGTCCATTTGTTT -3’SREBF1 FW 5’- TGCATTTTCTGACACGCTTC -3’ 171 pb*SREBF1 RV 5’- CCAAGCTGTACAGGCTCTCC -3’IL18 FW 5’- GGAATTGTCTCCCAGTGCAT -3’ 177 pb*IL18 RV 5’- ACTGGTTCAGCAGCCATCTT -3’TGF𝛽2 FW 5’- TGCTTTGGCTTTCTGGTTCT -3’ 199 pbTGF𝛽2 RV 5’- TTTGTTTGTGGTGCAGTGGT -3’MAP1B FW 5’- AATCGAGAAGACCAGCCTGA -3’ 245 pbMAP1B RV 5’- AATCCGTTGAGCGGTGTAAC -3’ANLN FW 5’- ATGCAGTGTGGTGCACATTT -3’ 195 pbANLN RV 5’- AACCCAAACACTTTGGCAAG -3’HBG1 FW 5’- GCAAGAAGGTGCTGACTTCC -3’ 176 pb*HBG1 RV 5’- GAATTCTTTGCCGAAATGGA -3’STARD4 FW 5’- GGCGAGTTGCTAAGAAAACG -3’ 219 pb*STARD4 RV 5’- TGTAACGCATCACACAGCAA -3’AOC3 FW 5’- CAGGGGACACTGAACCTTGT -3’ 233 pbAOC3 RV 5’- CCTTTCCAGCTCAGCTATGG -3’18S FW 5’- CGCGGTTCTATTTTGTTGGT -3’ 219 pb18S RV 5’-AGTCGGCATCGTTTATGGTC -3’FW:FORWARD, RV:REVERSE,*Amplification of exon-exon union

transport, proliferation, adhesion, and pathogenesis werechosen. Pseudogenes were excluded, as well as genes whoseproducts were related to noncoding RNAs (including thosewhose names begin with ”SNOR” and ”ncRNA”). Theselected genes and their functions are shown in Table 2.

In order to validate the data obtained from microarrays(Figure 3A), gene expression was determined by RT-PCR.In all cases the results are derived from at least threeindependent experiments. For mRNA expression of GLIPR2and ANLN we did not detect significant changes afterP4 treatment; however, a significant increase with RU486treatment alone or combined with P4 was observed (Figures3B and 3H). In contrast, a significant decrease in SREBF1expression was produced by both treatments (Figure 3D).Regarding IL7R and HBG1 genes, we determined that P4did not regulate their expression, but P4 together with RU486significantly decreased it (Figures 3C and 3I). IL18 mRNAexpression did not change after any treatment (Figure 3E).TGF𝛽2 expression increased after all treatments as com-pared with vehicle (Figure 3F) whereas MAP1B expressiondecreased with all of them (3G). STARD4 expression wasincreased by the combined treatment of P4 + RU486 whileAOC3 gene expression was increased by P4 and P4 + RU486(Figures 3J and 3K).

The effects of the different treatments in the expressionof genes tested by microarray assay and RT-PCR in U373cells are summarized in Table 3. We observed that GLIPR2expression evaluated by microarrays entirely coincides withthat performed by RT-PCR. It is shown that, in severalgenes such as TGF𝛽2, AOC3, or MAP1B, there was onlyone coincidence in the change observed by microarraysand RT-PCR. In other cases such as IL18, the lack ofeffects produced by the treatments with RU486 was observedwith both methods. There was only one gene, HBG1, withno correlation observed between the results obtained bymicroarrays or RT-PCR (Table 3).

4. Discussion

Our study shows the cytoplasmic and nuclear distributionof PR after hormonal treatments and the regulation of thegene expression profile by P4 in U373 human astrocytomacells. We found that total PR was principally located in thecytoplasm. Estradiol increased the presence of PR in thecytoplasm as compared with vehicle, and the treatments withP4 and RU486 alone or combined diminished it comparedto estradiol. According to this result, in a previous workour group had demonstrated by western blot that the content


HOECHST PR

V

E

E+P

E+RU

E+P+RU

MERGE

Figure 1: PR localization in U373 human astrocytoma cells. PR was stained by indirect immunofluorescence using FITC (green) labeledsecondary antibody. Cells were treated with vehicle (V); 48 h with estradiol (E) (10 nM); E followed by progesterone (P) (10 nM) for24 h (E+P); E followed by RU486 (PR antagonist, 1 µM) for 24 h (E+RU); E followed by P+RU486 for 24 h (E+P+RU). Nuclei werecounterstained with HOECHST. A representative assay of five independent experiments is shown.

of both PR isoforms increased after estradiol treatment anddiminished with P4 in these cells [13]. In many cell types,PR expression is upregulated by estradiol at transcriptionallevel by estrogen-responsive elements located in the PRpromoter [22], while P4 induces phosphorylation of PRwhich marks it to be degraded by the proteasome pathwayresulting in PR downregulation [23]. RU486 antagonizes

progestins action by its binding with PR allowing dimer-ization and binding with DNAs hormone response elementsbut avoids transcription [25]. After RU486 binding, PR,phosphorylation can be induced and mark it to degradationby 26S proteasome even without transcriptional activation.Previously, a reduction of PR isoform expression at proteinlevel after RU486 administration has been reported in the


U373 PR

Cytoplasm

Nuclei

1.2

0.6

0.0

*

*

*

* *

V V E E

E+

P

E+

P

E+

RU

E+

RU

E+

P+

RU

E+

P+

RU

Av

era

ge

Flu

ore

sce

nce

/ce

ll

Arb

ita

ry u

nit

s

Figure 2: PR expression in U373 human astrocytoma cells. Immunofluorescence images were quantified and analyzed as described inMaterials and Methods. Vehicle (V); 48 h with estradiol (E) (10 nM); E followed by progesterone (P) (10 nM) for 24 h (E+P); E followedby RU486 (1 µM) for 24 h (E+RU); E followed by P+RU486 for 24 h (E+P+RU). Results are expressed as mean ± SEM; n=5. **P<0.05vs all groups; *P<0.05 vs the other groups except V in cytoplasm.

Table 2: Selected genes validated by RT-PCR.

Gene Name FunctionGLIPR2 Glioma pathogenesis- related 2 The product of this gene increases the activation of fibroblasts and induces

epithelial mesenchymal transition (Baxter et al., 2007).IL7R Interleukin 7 receptor High levels of this receptor correlate with tumor aggressiveness in breast cancer

(Al- Rawi et al., 2004).SREBF1 Sterol regulatory element binding

transcription factorIt has been found to be involved in signaling pathways related to cancer (Shao andEspenshade, 2012).

IL18 Interleukin 18 This cytokine is involved in carcinogenesis and it is secreted by tumor cells, e.g.,kidney (Sözen et al., 2004) and prostate cancer (Binay Lebel et al., 2003).

TGF𝛽2 Transforming growth factor 𝛽-2 Disruption of this gene function has been implicated in a variety of cancers (Buckand Knabbe, 2006; Nilsson EE, Skinner MK, 2002; Steiner, 1995 )

MAP1B Microtubule-associated protein 1B This gene encodes a protein that belongs to the microtubule-associated proteinfamily, which are involved in microtubule assembly. (Riederer, 2007).

ANLN Anillin, actin binding protein Alterations in this gene have been linked to oral cancer. Its upregulation is acommon feature in the carcinogenic process of lung tissue (Suzuki et al., 2005).

HBG1 Hemoglobin, gamma A This gene product is part of the fetal hemoglobin. It has been reported that sometherapies directed to differentiate malignant cells result in the synthesis of fetalhemoglobin (Patrinos et al, 2005; Kieslich et al, 2003).

STARD4 STAR-related lipid transfer(START) domain containing

The level of expression of this gene has been linked to the endoplasmic reticulumstress (Yamada et al., 2006).

AOC3 Amine oxidase, copper It has been associated with migration and metastasis in cancers such as colorectal,prostate, andmelanoma (Jalkanen and Salmi, 2007; Toiyama, et al, 2009;. Ekblomet al, 1999. Forster-Horváth et al, 2004).


RU

Figure 3: Validation by RT-PCR of genes regulated by P4, RU486, and P4+RU486. Total RNA of U373 cells treated during 12 h withvehicle (V) (0.02% cyclodextrin), P4 (10 nM), RU486 (RU 1 µM), or P4 + RU was used for RT-PCR assays. PCR products were separatedon 2% agarose gel, stained with gel red, and detected with UV light (upper panels). Densitometric analysis of different mRNAs expressionwas corrected by using data of 18S mRNA values. A) Heat Map of microarrays, B) GLIPR2, C) IL7R, D) SREBF1, E) IL18, F) TGF𝛽2, G)MAP1B, H) ANLN, I) HBG1, J) STARD4, and K) AOC3. Results are expressed as mean ± SEM n=3. *P<0.05 vs vehicle (V).


Table 3: Effects of P4 and RU486 on the expression of genes tested by Microarrays and validated by RT-PCR in U373 cells.

Gene P 4 MicroarrayP 4+RU

RU P 4 RT-PCRP 4+RU

RU

GLIPR2 - Increase Increase - Increase IncreaseTGFb2 - Increase - Increase Increase IncreaseAOC3 Increase - - Increase Increase -HBG1 Increase - Increase - Decrease -IL7R - Decrease - - Decrease -IL18 Decrease - - - - -MAP1B - Decrease - Decrease Decrease DecreaseANLN - Decrease - - Increase IncreaseSREBF1 - - Decrease - Decrease DecreaseSTARD4 - Decrease Decrease - Increase -

preoptic area, uterus, ovary, and breast cancer cell lines [26–28].

In nuclei we did not find significant changes in PRcontent with any treatment. In T47D breast cancer cells PRnuclear translocation occurred at 1h after progestin or RU486treatment [29, 30]. In order to determine if this hormone orRU486 induces nuclear translocation in U373 cells we needfurther investigation at shorter times.

The results obtained using microarrays showed that at 12h P4 regulates, positively or negatively, the expression ofvarious genes, many of which are involved in immunologicalprocesses, proliferation, adhesion, and metabolism that mayhave an important role in the development of tumors.This agrees with the fact that malignant tumors includingastrocytomas have a complex process in which the expressionof various genes is modified to allow the tumor cells to haveoxygen supply and nutrients, escape to the immune system,and have the ability to migrate and invade [31–33]. Thegeneswhose expressionwas altered by P4 treatment observedin this work are also modified by this hormone in othertypes of cancer and/or other pathological conditions [34–36];however, we also determined the effect of these hormonesover other genes that have not been reported before.

GLIPR2 encodes a protein still poorly studied and itsfunction is not well characterized [37, 38]; found in manyglioma cell lines and in vitro studies, this protein caninduce epithelial mesenchymal transition (essential in cel-lular plasticity during development) and cancer progression[37, 39]. IL7R is a gene whose product has a critical rolein the development, differentiation, growth, and activation oflymphoid cells [40] and has been associated with decreasedimmune response responsible for preventing the developmentof tumor in high grade gliomas of evolution [41].

AOC3 gene was only modified by P4; its product is aprotein which catalyzes the oxidation of amines to aldehydesbut also it has been involved in cell migration and extrava-sation induced by inflammatory processes [42]. It should benoted that this regulation seems to be through a nonclassical

mechanism since the effect of P4 was not blocked by RU486.This regulation could occur through membrane PR [43].

Interestingly, it was observed for some genes such asGLIPR2, ANLN, and SREBF1 that RU486 treatment orcotreatment with P4 + RU486 regulates its expressionwithout P4 effects. RU486 is a type II antagonist whichpromotes PR dimerization and allows binding of the dimersto DNA. It has been shown that RU486-bound PR-A:PR-A dimers are transcriptionally silent, whereas RU486-boundPR-B:PR-B dimers can activate transcription. RU486-boundPR-A:PR-B dimers act to distinctly inhibit transcriptionalactivation, and it is the activity that is commonly observed inP4 responsive cells [44, 45]. It is important to mention that inU373 cells PR-B content is three times higher than that of PR-A [21, 46] which could lead to an increased formation of PR-B:PR-B dimers and an activation of transcriptional activityupon RU486 treatment.

It should be noted that U373 cells are not being distributedby ATCC anymore, since a sequencing study demonstratedsimilarities between U-373 and the glioblastoma cell line,U-251 [47]. However, both cell lines have characteristics ofaggressive astrocytomas.

Authors’ Contribution

Aliesha González-Arenas and Alejandro Cabrera-Wroomanequally contributed to this work.

References

[1] C. Guerra-Araiza, O. Villamar-Cruz, A. González-Arenas,R. Chavira, and I. Camacho-Arroyo, Changes in progestronereceptor isoforms content in the rat brain during the oestrouscycle and after oestradiol and progesterone treatments, Journalof Neuroendocrinology, 15, no. 10, 984–990, (2003).

[2] I. Camacho-Arroyo, A. González-Arenas, and G. González-Morán, Ontogenic variations in the content and distribution ofprogesterone receptor isoforms in the reproductive tract and


brain of chicks, Comparative Biochemistry and Physiology -A Molecular and Integrative Physiology, 146, no. 4, 644–652,(2007).

[3] R. D. Brinton, R. F. Thompson, M. R. Foy, M. Baudry, J.Wang, C. E. Finch, T. E. Morgan, C. J. Pike, W. J. Mack, F.Z. Stanczyk, and J. Nilsen, Progesterone receptors: Form andfunction in brain, Frontiers in Neuroendocrinology, 29, no. 2,313–339, (2008).

[4] W. L. Kraus, M. M. Montano, and B. S. Katzenellenbogen,Cloning of the rat progesterone receptor gene 5’-region andidentification of two functionally distinct promoters,MolecularEndocrinology, 7, no. 12, 1603–1616, (1993).

[5] P. H. Giangrande and D. P. Mcdonnell, The A and B isoformsof the human progesterone receptor: Two functionally differenttranscription factors encoded by a single gene, Recent Progressin Hormone Research, 54, 291–314, (1999).

[6] P. Kastner, A. Krust, B. Turcotte, U. Stropp, L. Tora, H.Gronemeyer, and P. Chambon, Two distinct estrogen-regulatedpromoters generate transcripts encoding the two functionallydifferent human progesterone receptor forms A and B, EMBOJournal, 9, no. 5, 1603–1614, (1990).

[7] C. Bozzetti, R. Camisa, R. Nizzoli, L. Manotti, A. Guazzi, N.Naldi, S. Mazza, V. Nizzoli, and G. Cocconi, Estrogen andprogesterone receptors in human meningiomas: Biochemicaland immunocytochemical evaluation, Surgical Neurology, 43,no. 3, 230–234, (1995).

[8] I. Camacho-Arroyo, G. González-Agüero, A. Gamboa-Domínguez, M. A. Cerbón, and R. Ondarza, Progesteronereceptor isoforms expression pattern in human chordomas,Journal of Neuro-Oncology, 49, no. 1, 1–7, (2000).

[9] R. S. Carroll, J. Zhang, K. Dashner, M. Sar, P. M. Black, andC. Raffel, Steroid hormone receptors in astrocytic neoplasms,Neurosurgery, 37, no. 3, 496–504, (1995).

[10] J. Honegger, C. Renner, R. Fahlbusch, and E. F. Adams,Progesterone receptor gene expression in craniopharyngiomasand evidence for biological activity, Neurosurgery, 41, no. 6,1359–1364, (1997).

[11] A. Omulecka, W. Papierz, A. Nawrocka-Kunecka, and I. Lewy-Trenda, Immunohistochemical expression of progesterone andestrogen receptors in meningiomas, Folia Neuropathologica,44, no. 2, 111–115, (2006).

[12] G. González-Agüero, R. Ondarza, A. Gamboa-Domínguez,M. A. Cerbón, and I. Camacho-Arroyo, Progesterone receptorisoforms expression pattern in human astrocytomas, BrainResearch Bulletin, 56, no. 1, 43–48, (2001).

[13] E. Cabrera-Muñoz, A. González-Arenas, M. Saqui-Salces, J.Camacho, F. Larrea, R. García-Becerra, and I. Camacho-Arroyo, Regulation of progesterone receptor isoforms contentin human astrocytoma cell lines, Journal of Steroid Biochem-istry and Molecular Biology, 113, no. 1-2, 80–84, (2009).

[14] D. Friedmann-Morvinski, E. A. Bushong, E. Ke, Y. Soda,T. Marumoto, O. Singer, M. H. Ellisman, and I. M. Verma,Dedifferentiation of neurons and astrocytes by oncogenes caninduce gliomas in mice, Science, 338, no. 6110, 1080–1084,(2012).

[15] S. Alcantara Llaguno, J. Chen, C. Kwon, E. L. Jackson, Y. Li,D. K. Burns, A. Alvarez-Buylla, and L. F. Parada, MalignantAstrocytomas Originate from Neural Stem/Progenitor Cells ina Somatic Tumor Suppressor Mouse Model, Cancer Cell, 15,no. 1, 45–56, (2009).

[16] L. Cheng, S. Bao, and J. N. Rich, Potential therapeuticimplications of cancer stem cells in glioblastoma, BiochemicalPharmacology, 80, no. 5, 654–665, (2010).

[17] D. L. Schonberg, D. Lubelski, T. E.Miller, and J. N. Rich, Braintumor stem cells: Molecular characteristics and their impact ontherapy, Molecular Aspects of Medicine, (2013).

[18] D. Cho, S. Lin, W. Yang, H. Lee, D. Hsu, H. Lin, C. Chen,C. Liu, W. Lee, and L. Ho, Targeting cancer stem cells fortreatment of glioblastoma multiforme, Cell Transplantation,22, no. 4, 731–739, (2013).

[19] J. T. Huse, H. S. Phillips, and C. W. Brennan, Molecularsubclassification of diffuse gliomas: Seeing order in the chaos,GLIA, 59, no. 8, 1190–1199, (2011).

[20] C. Daumas-Duport, B. Scheithauer, J. O’Fallon, and P. Kelly,Grading of astrocytomas: A simple and reproducible method,Cancer, 62, no. 10, 2152–2165, (1988).

[21] G. González-Agüero, A. A. Gutiérrez, D. González-Espinosa,J. D. Solano, R. Morales, A. González-Arenas, E. Cabrera-Muñoz, and I. Camacho-Arroyo, Progesterone effects on cellgrowth of U373 and D54 human astrocytoma cell lines,Endocrine, 32, no. 2, 129–135, (2007).

[22] C. Guerra-Araiza and I. Camacho-Arroyo, Progesterone recep-tor isoforms: Function and regulation, Revista de InvestigacionClinica, 52, no. 6, 686–691, (2000).

[23] C. A. Lange, T. Shen, and K. B. Horwitz, Phosphorylationof human progesterone receptors at serine-294 by mitogen-activated protein kinase signals their degradation by the 26Sproteasome, Proceedings of the National Academy of Sciencesof the United States of America, 97, no. 3, 1032–1037, (2000).

[24] O. T. Hernández-Hernández, T. K. González-García, and I.Camacho-Arroyo, Progesterone receptor and SRC-1 participatein the regulation of VEGF, EGFR and Cyclin D1 expression inhuman astrocytoma cell lines, Journal of Steroid Biochemistryand Molecular Biology, 132, no. 1-2, 127–134, (2012).

[25] F. Cadepond, A. Ulmann, and E.-E. Baulieu, RU486 (mifepri-stone): Mechanisms of action and clinical uses, Annual Reviewof Medicine, 48, 129–156, (1997).

[26] G. E. Carrillo-Martínez, P. Gómora-Arrati, A. González-Arenas, G. Roldán-Roldán, O. González-Flores, and I.Camacho-Arroyo, Effects of RU486 in the expression ofprogesterone receptor isoforms in the hypothalamus and thepreoptic area of the rat during postpartum estrus, NeuroscienceLetters, 504, no. 2, 127–130, (2011).

[27] X. Fang, S. Wong, and B. F. Mitchell, Effects of RU486 onestrogen, progesterone, oxytocin, and their receptors in the ratuterus during late gestation, Endocrinology, 138, no. 7, 2763–2768, (1997).

[28] L. D. Read, C. E. Snider, J. S. Miller, G. L. Greene, andB. S. Katzenellenbogen, Ligand-modulated regulation of pro-gesterone receptor messenger ribonucleic acid and protein inhuman breast cancer cell lines, Molecular Endocrinology, 2,no. 3, 263–271, (1988).

[29] L. Tseng and H. H. Zhu, Regulation of progesterone receptormessenger ribonucleic acid by progestin in human endometrialstromal cells, Biology of Reproduction, 57, no. 6, 1360–1366,(1997).

[30] L. K. Pierson-Mullany and C. A. Lange, Phosphorylation ofprogesterone receptor serine 400 mediates ligand-independenttranscriptional activity in response to activation of cyclin-dependent protein kinase 2, Molecular and Cellular Biology,24, no. 24, 10542–10557, (2004).


[31] R. Weinstain, J. Kanter, B. Friedman, L. G. Ellies, M. E. Baker,and R. Y. Tsien, Fluorescent ligand for human progesteronereceptor imaging in live cells, Bioconjugate Chemistry, 24, no.5, 766–771, (2013).

[32] I. Kareva and P. Hahnfeldt, The emerging ”Hallmarks” ofmetabolic reprogramming and immune evasion: Distinct orlinked? Cancer Research, 73, no. 9, 2737–2742, (2013).

[33] M. Nakada, S. Nakada, T. Demuth, N. L. Tran, D. B.Hoelzinger, and M. E. Berens, Molecular targets of gliomainvasion, Cellular and Molecular Life Sciences, 64, no. 4, 458–478, (2007).

[34] P. Friedl and K. Wolf, Tumour-cell invasion and migration:Diversity and escape mechanisms, Nature Reviews Cancer, 3,no. 5, 362–374, (2003).

[35] R. H. Paulssen, B. Moe, H. Grønaas, and A. Ørbo, Geneexpression in endometrial cancer cells (Ishikawa) after shorttime high dose exposure to progesterone, Steroids, 73, no. 1,116–128, (2008).

[36] C. A. Lapp, M. E. Thomas, and J. B. Lewis, Modulation by pro-gesterone of interleukin-6 production by gingival fibroblasts.,Journal of Periodontology, 66, no. 4, 279–284, (1995).

[37] J. Fan, Y. Shimizu, J. Chan, A. Wilkinson, A. Ito, P. Tontonoz,E. Dullaghan, L. A. M. Galea, T. Pfeifer, and C. L. Wellington,Hormonal modulators of glial ABCA1 and apoE levels, TheJournal of Lipid Research, 54, no. 2, 3139–3150, (2013).

[38] R. M. Baxter, T. P. Crowell, J. A. George, M. E. Getman, andH. Gardner, The plant pathogenesis related protein GLIPR-2 ishighly expressed in fibrotic kidney and promotes epithelial tomesenchymal transition in vitro,Matrix Biology, 26, no. 1, 20–29, (2007).

[39] M. R. Groves, A. Kühn, A. Hendricks, S. Radke, R. L.Serrano, J. B. Helms, and I. Sinning, Crystallization of a Golgi-associated PR-1-related protein (GAPR-1) that localizes tolipid-enriched microdomains, Acta Crystallographica SectionD: Biological Crystallography, 60, no. 4, 730–732, (2004).

[40] B. D. Craene and G. Berx, Regulatory networks definingEMT during cancer initiation and progression, Nature ReviewsCancer, 13, no. 2, 97–110, (2013).

[41] M. A. A. Al-Rawi, K. Rmali, G. Watkins, R. E. Mansel, andW. G. Jiang, Aberrant expression of interleukin-7 (IL-7) and itssignalling complex in human breast cancer, European Journalof Cancer, 40, no. 4, 494–502, (2004).

[42] H. Ardon, B. Verbinnen, W. Maes, T. Beez, S. Van Gool,and S. De Vleeschouwer, Technical advancement in regulatoryT cell isolation and characterization using CD127 expressionin patients with malignant glioma treated with autologousdendritic cell vaccination, Journal of Immunological Methods,352, no. 1-2, 169–173, (2010).

[43] S. Jalkanen and M. Salmi, VAP-1 and CD73, endothelial cellsurface enzymes in leukocyte extravasation, Arteriosclerosis,Thrombosis, and Vascular Biology, 28, no. 1, 18–26, (2008).

[44] M. Singh, C. Su, and S. Ng, Non-genomic mechanisms ofprogesterone action in the brain, Frontiers in Neuroscience, 7,p. 159, (2013).

[45] C. A. Sartorius, S. D. Groshong, L. A. Miller, R. L. Powell, L.Tung, G. S. Takimoto, and K. B. Horwitz, New T47D breastcancer cell lines for the independent study of progesteroneB- and A-receptors: Only antiprogestin-occupied B-receptorsare switched to transcriptional agonists by cAMP, CancerResearch, 54, no. 14, 3868–3877, (1994).

[46] Z. Liu, D. Auboeuf, J. Wong, J. D. Chen, S. Y. Tsai, M. Tsai,and B. W. O’Malley, Coactivator/corepressor ratios modulate

PR-mediated transcription by the selective receptor modulatorRU486, Proceedings of the National Academy of Sciences ofthe United States of America, 99, no. 12, 7940–7944, (2002).

[47] V. Hansberg-Pastor, A. González-Arenas, M. A. Peña-Ortiz,E. García-Gómez, M. Rodríguez-Dorantes, and I. Camacho-Arroyo, The role of DNA methylation and histone acetylationin the regulation of progesterone receptor isoforms expressionin human astrocytoma cell lines, Steroids, 78, no. 5, 500–507,(2013).

[48] N. Ishii, D. Maier, A. Merlo, M. Tada, Y. Sawamura, A.Diserens, and E. G. VanMeir, Frequent Co-alterations of TP53,p16/CDKN2A, p14(ARF), PTEN tumor suppressor genes inhuman glioma cell lines, Brain Pathology, 9, no. 3, 469–479,(1999).

Date post:	31-Dec-2020
Category:	Documents
Upload:	others
View:	2 times
Download:	0 times

Nuclear Receptor Research: Contributions from Latin America · Contents Nuclear Receptor Research:...

Documents