Occurrence of Leptospira sp. in environmental water samples from Wind Cave, Bau,

Sarawak.

Irwin Emmanuel Ak Robin Jeli

Bachelor of Science with Honours

(Biotechnology Resource)

2013

Faculty of Resource Science and Technology

i

ACKNOWLEGDEMENT

Much appreciation goes to my respected supervisor, Prof. Dr. Kasing Apun and my co-

supervisor, Dr Lesley Maurice Bilung, who give me guidance, inspirations, and invaluable

support throughout this project. Your sacrifices, understanding and total care are very much

appreciated. May God continually bless you all!

My sincere thanks go to my dearest family; papa, mama, and my lovely sisters, Bella and Nini,

you are always my inspiration. Thank you for all the supports and prayers in every aspect of my

study. Especially to my parents who provides moral and financial supports to me in completing

this project. My deepest gratitude goes to my friends that I have known in Shalom Church and

CLC; Rizoh, Karyn, Eric, Ben, Joshua Baru, Haider, Mas, Gary, and many more for the

understanding, care and support in prayer. My appreciation also goes to all my coursemates and

UNIMAS friends; Delstein, Allysya, Ikwan, Nazriman, Hashim, Shafillah, Bam and others. I

sincerely thank you all for the love, friendship and care that we have shared. Also my thanks

goes to all Master students in the microbiology lab especially Yong Sy Foo for his help and

guidance in completing this project. Lastly, to all staffs of the Faculty of Resource Science and

Technology and the kind-hearted people of UNIMAS, I truly appreciated your presence.

I would like to thank God for the wisdom and strength that He gave me in the completion of this

project. I acknowledge His gift for this life and the promises that He made with me to help me in

my studies until now. Thank you so much God. You are my everything!

ii

DECLARATION

The work in this thesis, to the best of my knowledge and belief, original and my own work,

except as acknowledged in the text. I hereby declare that no portion of this thesis has been

submitted in support of an application for another degree of qualification of this or any other

university or institution of higher learning.

Irwin Emmanuel Ak Robin Jeli

Date:

iii

TABLE OF CONTENT

Acknowledgement ……………………………………………………………………………… I

Declaration ……………………………………………………………………………………… II

Table of Contents ………………………………………………………………………………. III

List of Abbreviations …………………………………………………………………………... IV

List of Tables and Figures ……………………………………………………………………… V

Abstract ………………………………………………………………………………………….. 1

1.0 Introduction ………………………………………………………………………………….. 2

2.0 Literature Review 2.1 Leptospira species …………………………………………………………………… 4 2.1.1 Morphology of Leptospira ………………………………………………… 4 2.1.2 Physiology, Metabolism and Growth of Leptospira ………………………. 5 2.2 The Genus of Leptospira ……………………………………………………………. 6 2.2.1 Serological Classification …………………………………………………. 6 2.2.2 Genotypic Classification …………………………………………………... 6 2.3 Molecular Biology of Leptospira …………………………………………………… 8 2.4 Epidemiology ………………………………………………………………………... 8 2.5 Ecology of Leptospira ………………………………………….………………...…. 9

2.6 Polymerase Chain Reaction (PCR) ……………………………………………….... 10

3.0 Materials and Methods 3.1 Sample Collection ………………………………………………………………….. 11 3.2 Culturing and Detection of Leptospira …………………………………………….. 11 3.3 Genomic DNA extraction for PCR ……………………………………………….... 12 3.4 PCR amplification of LipL32 gene ……………………………………………….... 13 3.5 Agarose Gel Electrophoresi ……………………………………………………...… 14

4.0 Results ………………………………………………………………………….…………... 15

5.0 Discussion ………………………………………………………………………………….. 20

6.0 Conclusion …………………………………………………………………………………. 23

References ……………………………………………………………………………………… 24

iv

LIST OF ABBREVIATIONS

oC - degree Celsius

sec - second

min - minute

ml - millilitre

m - micrometre

Bp - base pair

kb - kilo base pairs

% - percentage

ddH2O - double-distilled water

rpm - revolution per minute

DNA - Deoxyribonucleic Acid

PCR - Polymerase Chain Reaction

EMJH - Ellinghausen-McCullough as modified by Johnson and Harris medium

L.interrogans - Leptospira interrogans

L.biflexa - Leptospira biflexa

v

LIST OF TABLES

Table 1 - Genomic species of Leptospira and distribution of serogroups ……………….. 7

Table 2 - Summary of detection of LipL32 gene via PCR ……………………………….. 17

Table 3 - Summary of observation under dark field microscope ………………………… 18

LIST OF FIGURES

Figure 1 - Structure of a leptospires showing the surface layer (SL), outer membrane (OM),

cytoplasmic membrane (CM) and flagellum (F) with its insertion point (I) …… 5

Figure 2 - Observation under dark field microscope for water samples (sample C3) collected

from stream inside the cave……………………………………………………..... 15

Figure 3 - Observation under dark field microscope for water samples (sample C1) collected

from stagnant water inside the cave……………………………………………… 16

Figure 4 - Observation under dark field microscope for water samples (sample R3) collected

from outside the cave…………………………………………………………….. 16

Figure 5 - Agarose gel electrophoresis of PCR product shows detection of leptospires in

environmental water samples collected from Wind Cave, Bau…………………. 19

1

Occurrence of Leptospira sp. in environmental water samples from Wind Cave, Bau, Sarawak.

Irwin Emmanuel Ak Robin Jeli

Faculty of Resource Science and Technology UNIMAS

ABSTRACT

The genus Leptospira is composed of tightly coiled spirochetes that exist in two groups which are pathogenic strains

and saprophytic strains. The pathogenic strains caused Leptospirosis, the most widespread zoonotic disease which is

also known as the rat urine’s disease. The saprophytic strains are usually found on surface water meanwhile the

pathogenic strains requires animal host to survive. The aim of this research is determine the occurrence of

Leptospira sp. isolated from environmental water samples collected from Wind Cave, Bau. A total of 17 water

samples were collected from the sampling site. The samples were cultured in EMJH medium for 30 days and were

observed under dark field microscope for the presence of Leptospira. No observation of leptospires was detected.

Six samples were selected for comparison purposes. Further confirmation was done by utilizing polymerase chain

reaction targeting the LipL32 gene. The findings reported that LipL32 gene was successfully amplified by PCR in

three of the samples. Therefore, the use of PCR by targeting the LipL32 gene is more reliable compared to direct

observation under dark field microscope in detecting Leptopsira in environmental water.

Key words: Leptospira sp., lepstopsirosis, occurrences, environmental water samples, LipL32 gene

ABSTRAK

Genus Leptospira terdiri daripada Spirochetes yang bergelung ketat dan wujud dalam dua kumpulan iaitu

kumpulan patogenik dan saprofitik. Kumpulan patogenik menyebabkan Leptospirosis yang juga dikenali sebagai

penyakit kencing tikus. Kumpulan saprofitik ditemui pada permukaan air dan kumpulan patogenik memerlukan hos

haiwan untuk terus hidup. Tujuan kajian ini adalah untuk mengesan Leptospira sp. yang diasingkan daripada

sampel air diambil dari sekitar Gua Angin, Bau. Sebanyak 17 sampel air telah diambil dari tapak persampelan.

Sampel-sampel tersebut dikulturkan dalam medium EMJH selama 30 hari dan diperhatikan di bawah mikroskop

medan gelap untuk mengesan kehadiran Leptospira. Tiada pemerhatian leptospira dikesan. Enam sampel terdiri

telah dipilih untuk tujuan perbandingan. Pengesahan lanjut dilakukan dengan menggunakan PCR yang

mensasarkan gen LipL32. Hasil kajian melaporkan bahawa LipL32 gen telah berjaya dikesan oleh PCR dalam tiga

sampel. Oleh itu, penggunaan PCR dengan mensasarkan gen LipL32 adalah lebih dipercayai berbanding dengan

pemerhatian langsung di bawah mikroskop medan gelap dalam mengesan Leptopsira dalam air alam sekitar.

Kata kunci: Leptospira sp., leptospirosis, kejadian, sampel air, LipL32 gen.

2

1.0 INTRODUCTION

Leptospira genus are obligatory aerobic, tightly coiled bacteria which are motile with the aid

of two perisplamic flagella attached to either end of the body (Gillespie, 1994). These bacteria

can be found within their hosts which are usually small mammals such as rats and dogs. They

also can be found in rivers or ground contaminated with the urine or faeces of its host. There are

two types of species in Leptospira genus which are Leptospira interrogans and Leptospira

biflexa. The pathogenic strains of L. interrogans caused leptospirosis, the acute febrile disease in

humans (Galloway and Levett, 2008). Meanwhile, L. biflexa contain only the saprophytic strains.

In addition, there are several hundred of serovars has been classified under both of these species.

More than 200 Leptospira interrogans serovars have been identified as pathogenic and over 60

as non-pathogenic, which are Leptospira biflexa (Jyothi et al., 2004). Leptospires can survive for

a long period of time in the environment under favourable condition (Ridzlan et al., 2010).

According to Levett (2001), leptospires can survive in warm, moist soil and in water for weeks to

months.

Leptospirosis or known as the Rat’s Urine Disease is a re-emerging infection in Malaysia.

Rat’s Urine disease is caused by the pathogenic strain of Leptsopira interrogans. Due to its

ability to infect a wide range of animals, mainly mammalian species, it is presumed to be the

most widespread zoonotic disease in the world (Gussenhoven et al., 1997) According to

Mohamed-Hassan (2012), rats are considered as one of the most important sources of

leptospirosis in Malaysia. Therefore, human can be infected through direct or indirect contact

with the infected rats’s urine. The survivability of pathogenic leptospires in the environment can

lead to a high incident of leptospirosis. For example, the Segama River was found to be the

primary source of infection that caused an outbreak of acute febrile illness among the athletes

3

participating in the Eco-Challenge located in Sabah (Sejvar et al., 2003). Another case of

leptospirosis in Malaysia involves the death of a trainee in the The National Service programme

at Terkok Camp in Sungai Siput (Shannon, 2012).

The factors affecting the occurrence of Leptospira in the environmental water are not fully

understood. This is due to limited understanding of their ecology in the environment. There are

possibilities of different occurrence of Leptopsira strains isolated from slow- moving water and

stagnant water. The prevalence of Leptospira strains isolated from each type of water samples

can be influenced by a few factors such as temperature and pH. In addition, in the present study

molecular technique based on PCR was be used to detect the leptopspiral DNA in the isolated

water samples.

To date, little information is still known on the distribution of Leptospira in the

environment. Thus the emphasis of this research project was to study the occurrence of

Leptospira collected from environmental water samples. The objectives of this study were to:

i. Determine the occurrence and distribution of Leptospira sp. isolated from the

environmental water samples collected from Wind Cave, Bau.

ii. Detect leptospiral DNA in the environmental water samples collected from Wind

Cave, Bau, by using molecular technique-based PCR.

4

2.0 LITERATURE REVIEW

2.1 Leptospira species

2.1.1 Morphology of Leptospira

The general characteristic of Leptospira are obligate aerobic, tightly coiled, 6-20 µm long and

0.1 µm wide with hooked ends. An earlier study conducted by Hovind-Hougen (1986), shows

the three major structural component of the Leptospira cell by using electron microscopy. The

three structural components are an outer envelope, two perisplasmic flagella or axial filaments

and a protoplasmic cylinder. Leptospires have a double membrane structure that consists of

cytoplasmic membrane and peptidoglycan cell wall which are overlain by an outer membrane

(Haake, 2000). Both cytoplasmic membrane and peptidoglycan cell wall are underneath the outer

envelope. The two perisplamic flagella which are attached to either end of the body are important

for the motility of leptospires (Gillespie, 1994). In addition, the structure of the flagellar proteins

is complex (Trueba et al., 1992). The protoplasmic cylinder is the cylindrical cell body of the

leptopspire which consist of cytoplasm component such as nuclear material and ribosomes

(Faine et al., 1999). Leptospires can only be observed under dark-field microscopy when

unstained. However, all leptospires are morphologically indistinguishable and can only differ in

their mode of living.

5

Figure 1: Structure of a leptospires showing the surface layer (SL), outer membrane (OM), cytoplasmic membrane (CM) and flagellum (F) with its insertion point (I). (Hovind-Hougen, 1986).

2.1.2 Physiology, Metabolism and Growth of Leptospira

According to Levett (2001), leptospires shows two different forms of movement; translational

and non-translational. These movements are associated with the movement of the perisplasmic

flagella. There are three possible ways of these flagella movement; central axis rotation, straight

end progressive movement and circular motion (Bharti et al., 2003). Leptospires can be stained

using carbol fuchsin counterstain (Levett, 2001). According to Bharti et al. (2003), leptospires

exhibit features of both Gram-positive and Gram-negative bacteria. However, its

lipopolysaccharide has the same composition of those found in other gram-negative bacteria but

has lower endotoxic activity (Levett, 2001). Growth of leptospires is often slow on primary

isolation. The oleic acid-albumin medium EMJH are the most widely used medium in culturing

leptospira. The leptospires have an optimum growth temperature of 28 to 30 oC and produce

both catalase and oxidase (Levett, 2001).

6

2.2 The Genus of Leptospira

Leptospira genus is tightly coiled spirochetes that belong to the leptospiraceae family.

Leptospira exist in two groups depending to their modes of living which are the pathogenic

parasitic and the free-living saprophytes. For examples, the pathogenic parasitic include

Leptospira interrogans and the saprophytes include Leptospira biflexa. Leptospira interrogans

was named by Stimson, a scientist that discovered clumps of spirochetes with hooked ends in the

kidney of a patient who died of yellow fever (Stimson, 1907). There are two ways of classifying

the leptospires; serological and genotypic classification.

2.2.1 Serological Classification

The first ways is the classical classification which based on serological characteristic. Based on

this classification, leptospires can be divided into the pathogenic strain Leptospira interrogans

and the saprophytic strain Leptospira biflexa. According to Levett (2001), L.biflexa can be

differentiated from L.interrogans by its ability to grow at 13oC and in the presence of 8-

azaguanine and by the failure of L.biflexa to form spherical cells in 1 M NaCl. Based on

serological analysis, there are around 200 studied serovars (Lim et al., 2011). More than 200

Leptospira interrogans serovars have been identified as pathogenic and over 60 as non-

pathogenic, which are Leptospira biflexa (Jyothi et al., 2004). There are varieties of serological

test have been used to identify serovars. The two common methods used are microscopic

agglutination test (MAT) and enzyme-linked immunosorbent assay (ELISA).

2.2.2 Genotypic Classification

The second method is by genotypic classification. All serovars of both L.biflexa and

L.interrogans are included in this classification. Genotypic classification of Leptospira is based

7

on DNA relatedness and DNA hybridisation. DNA hybridization studies led to the definition of

10 genomospecies of Leptospira which is defined as being at least 70% DNA related (Levett,

2001). Multilocus enzyme electrophoresis data provide supports for genotypic classification, but,

recent studies suggest that further revisions for the taxonomic are needed (Levett, 2001).

Table 1: Genomic species of Leptospira and distribution of serogroups (Levett, 2001).

Genomic species Serogroup L. alexanderi Canicola, Icterohaemorrhagiae, Javanica, Lyme, Manhao, Panama,

Shermani, Tarassovi

L. biflexa Andamana, Semaranga L. borpetersenii Australis, Autumnalis, Ballum, Bataviae, Celledoni, Hebdomadis,

Javanica, Mini, Pyrogenes, Sejroe, Tarassovi

L. fainei Hurstbridge L. inadai Canicola, Icterohaemorrhagiae, Javanica, Lyme, Manhao, Panama,

Shermani, Tarassovi

L. interrogans Australis, Autumnalis, Bataviae, Canicola, Djasiman, Grippotyphosa, Hebdomadis, Icterohaemorrhagiae, Louisiana, Mini, Pomona, Pyrogenes, Ranarum, Sarmin, Sejroe

L. kirscheri Australis, Autumnalis, Bataviae, Canicola, Cynopteri, Djasiman, Grippotyphosa, Hebdomadis, Icterohaemorrhagiae, Pomona

L. meyeri Javanica, Mini, Ranarum, Sejroe, Semaranga L. noguchii Australis, Autumnalis, Bataviae, Djasiman, Louisiana, Panama,

Ponoma, Pyrogenes, Shermani, Tarassovi

L. santarosai Autumnalis, Bataviae, Cynopteri, Grippotyphosa, Hebdomadis, Javanica, Mini, Pomona, Pyrogenes, Sarmin, Sejroe, Shermani, Tarassovi

L. wolbachii Codice L. weilii Celledoni, Hebdomadis, Icterohaemorrhagiae, Javanica, Manhao,

Mini, Pyrogenes, Sarmin, Sejroe, Tarassovi

8

2.3 Molecular Biology of Leptospira

Leptopsires are phylogenetically related to other spirochetes. According to Bharti et al. (2003),

the leptospiral genome is more than four times the number predicted for the other sequenced

spirochetes, namely Treponema spp and Borrelia spp. This information indicates that Leptospira

are able to live within diverse environments; in animal host or freely in the environment. The

entire sequence of leptospiral genome has already been established (Ren et al., 2003). It is

approximately 5000 kb in size and comprised of two sections, a 4400-kb chromosome and a

smaller 350-kb chromosome. Techniques for genetic manipulation of leptospires have been

developed to aid in the studies of pathogenesis, virulence factors and basic cell biological studies

of the organism. (Levett, 2001; Bharti et al., 2003). Understanding of the Leptopira genomes

will give an insight of the pathogenesis of the bacteria. Many leptospiral genes have been cloned

and analysed such as rRNA, outer membrane proteins and lipopolysaccharides (Bharti et al.,

2003). For examples, the LipL32 genes of Leptospira interrogans are used as indicator or primer

in PCR-based DNA sequencing technique for detecting Leptospira in patients (Ram et al., 2011).

Distinct DNA profiles generated by a molecular technique known as pulsed-field gel

electrophoresis (PFGE) allowed a more accurate and efficient identification of the leptopspires.

2.4 Epidemiology

Leptospirosis is the infectious disease caused by the pathogenic strain of Leptospira interrogans.

It is presumed to be the most widespread and important zoonotic disease in the world

(Gussenhoven et al., 1997). This is because leptospirosis can infect a wide range of animals,

mainly mammalian species. Leptospirosis involves infected domestic animals and wildlife

9

where human can be infected through direct or indirect contact with their urine. In humans, the

usual portal of entry is through abrasions or cuts in the skin or via the conjunctiva. Most

leptospirosis infection occurs higher in warm climate countries than in temperate countries.

Leptospirosis symptoms range from fever to respiratory difficulties, and in a more severe

conditions, jaundice, renal failure and meningitis.

The treatment of leptospirosis depends on the severity and duration of symptoms at the time of

presentation. Vaccination has been introduced but its effect is limited because its only can

produce immunity towards homologous serovars or antigenically similar serovars only (Levett,

2001). Based on a study conducted by Naigowit et al. (2007), leptospirosis has become a major

public health problem in Thailand where the annual number of reported cases has been

increasing since 1996. Leptospirosis also becomes a public health concern in Malaysia. An

outbreak of acute febrile illness was reported among the athletes participating in the Eco-

Challenge located in Sabah, and the Segama River was found to be the primary source of

infection (Sejvar et al., 2000). Another 46 cases were identified in an outbreak in Kampung

Kabatu, Beaufort, Sabah, which was associated with swimming in a creek near an oil palm

plantation (Kaoay et al., 2004). Recent case of leptospirosis involves the death of a trainee in The

National Service programme at Terkok camp in Sungai Siput (Shannon, 2012).

2.5 Ecology of Leptospira

Leptospires can be found in variety of places depending to their modes of living. The saprophytic

leptospires such as L. biflexa can be found in the environment such as surface waters and do not

requires hosts because they only feed on organic matter in water. However, the pathogenic

10

leptopsires need a host for survival and reproduction. The natural carriers for various pathogenic

serovars are rodents and domestic animals such as dogs, pigs and cattles (Priya et al., 2007).

Rodents are the main source of spirochetes that are transmitted to humans. The bacteria are

maintained in nature by chronic infection of the renal tubules of maintenance hosts which will be

shed via urine into the environment and survive under suitable moist conditions (Monahan et al.,

2008). Leptopsires grows optimally in fresh water, damp soil or mud in temperatures of between

28oC and 30oC. The ecology of leptospirosis is complex due to the interaction between humans,

animal reservoirs, leptospires and the environment they coexist (Lau et al., 2010). For example,

heavy rainfall and flooding increase the risk of leptospirosis by bringing bacteria and their

animal host into closer contact with humans.

2.6 Polymerase Chain Reaction (PCR)

Polymerase Chain Reaction (PCR) is a molecular technique which amplifies a single sequence of

DNA or more which will generate magnitudes of copies of the targeted sequences. The

sensitivity and specificity of a PCR assay is dependent on target genes, primer sequences, PCR

techniques, DNA extraction protocols and PCR product detection methods (Yamamoto, 2002).

The technique depend on thermal cycling which consist of cycles of repeated heating and cooling

of the reaction for DNA melting and enzymatic replication of the DNA. There are many type of

PCR. For examples, Multiplex PCR, RT-PCR, Hot start PCR, Nested PCR, Quantitative PCR

and many more. PCR are often used for detecting bacteria from environmental samples due to its

sensitivity. PCR methods for detection of Leptospira in different fresh clinical specimens are

sensitive, specific and rapid (Letocart et al., 1997). PCR also can be used to detect leptospiral

DNA in bovine urine (Baquero et al., 2010).

11

3.0 MATERIALS AND METHODS

3.1 Sample Collection

The fieldwork sampling was conducted on 28 January 2013 at Wind Cave, Bau. This location

was chosen because of the higher possibility of detecting Leptospira due to the abundance of its

animal host such as bats and rats. Water samples were collected from stagnant water and slow-

moving water (streams) using sterile 50 ml Falcon tubes and directly kept inside the container to

preserve the sample (Ridzlan et al., 2010). A total of 17 water samples were collected during the

fieldwork and 1 sample was taken per sampling site. Fourteen water samples were collected

outside the cave. The samples comprised of 2 samples from stagnant water and 12 samples from

the river beside the cave. The stagnant water was located near the river. The samples were taken

at 5 main points in the river. Each point consists of 3 locations which were at both river bed and

at the centre of the river. Meanwhile only 3 samples were collected inside the cave which

comprised of a sample from small streams and 2 samples from stagnant water. The small

amounts of samples were collected due to safety reasons such as slippery surfaces and

unreachable places in the cave.

3.2 Culturing and Detection of Leptospira

The methods for culturing and detection of Leptospira are based on Ridzlan et al. (2010). The

water samples (50 ml each) were passed through sterile 0.22 µm pore size membrane filter and 2

ml of the filtrate from each sample was inoculated into the modified EMJH medium. The EMJH

medium was prepared a day before the fieldwork sampling. The EMJH medium was prepared by

mixing EMJH medium powder (0.575 g) with distilled water (225 ml). The mixture then was

12

autoclaved. The EMJH medium was also mixed with Leptospira enrichment media (50 ml) to

enhance the growth of the Leptospira. The cultures were then incubated aerobically in the dark at

room temperature for 30 days. Later, the cultures were observed at 40x magnification under a

dark-field microscope (Olympus Compound Microscope BX51) after 30 days. Leptospires have

a hook-like end, thin and motile. However, leptopsires were not detected in all of the samples.

Six samples comprised of 3 samples each from outside and inside the cave were chosen for

comparison purposes. These samples were subjected to further confirmation via molecular

method, PCR.

3.3 Genomic DNA Extraction for PCR

Six samples were chosen for genomic extraction for PCR. These 6 samples consist of 3 samples

each from outside and inside the cave were for comparison purposes. The genomic DNA

extraction methods were based on the QIAamp DNA Mini and Blood Mini Handbook (2012).

The extraction was done by using an extraction kit (QIAamp DNA Mini kit). Firstly, 1 ml of the

bacterial culture was pipetted into a 1.5 ml microcentrifuge tube. The sample was then

centrifuged for 5 min at 7500 rpm. The supernatant was discarded and 200 µL of buffer AL and

20 µL of Proteinase K were added to the pellet. The mixtures were incubated for 10 min at 60oC.

Secondly, 200 µL of ethanol (100%) was added to the mixture and it was mixed by pulse-

vortexing for 15 sec. Next, the mixture was carefully applied to the QIAamp Mini spin column

(in a 2 ml collection tube) and the cap was closed. The column was then centrifuged for 1 min at

8000 rpm. The column was placed in a new 2 ml collection tube and the tube containing the

filtrate was discarded. Next, 500 µL of buffer AW1 was added to the column and the cap was

closed. The column was then centrifuged for 1 min at 8000 rpm. The column was placed in a

13

new 2 ml collection tube and the tube containing the filtrate was discarded. After that, 500 µL of

buffer AW2 was added to the column and cap was closed. The column was then centrifuged for

1 min at 8000 rpm. Subsequently, the column was placed in a clean 2 ml collection tube and

centrifuged for 3 min at 8000 rpm. Next, the column was transferred to a new 1.5

microcentrifuge tube. After that, 200 µL of buffer AE was added to the column. Subsequently,

the column was incubated at room temperature for 1 min. After that, the column was centrifuged

for 1 min at 8000 rpm. Finally, the sample was stored in ice (at 4oC) for the next step which is

PCR.

3.4 PCR amplification of LipL32 gene

The primer used in the amplification of LipL32 gene which encodes the outer membrane

lipoprotein LipL32 was used based on a study conducted by Ahmed et al. (2006). The forward

and the reverse primer of LipL32 used are shown below;

Forward primer: 5’ ATCTCCGTTGCACTCTTTGC 3’

Reverse primer: 5’ ACCATCATCATCATCGTCCA 3’

The PCR amplification method was based on Vital-Brazil et al. (2010). The PCR amplification

was performed in a final reaction volume of 25 µL. All reactions contained 12.5 µL of PCR

Master Mix (QIAGEN), 2 µL of the primer, 6 µL of DNA and 4.5 µL of ddH2O. PCR

amplification was performed using the following conditions: one denaturation cycle at 95oC for 5

14

min, 35 cycles of denaturation at 95oC for 1 min, annealing at 55oC for 30 sec and extension at

72oC for 1 min and a final extension at 72oC for 7 min.

3.5 Agarose Gel Electrophoresis

The amplified product undergoes gel electrophoresis on a 2% agarose gel. The agarose gel was

stained with ethidium bromide. The gel was then observed under UV light. The size of the DNA

band was estimated using a 100-bp ladder. The negative control used was only consisted of

DNA-free ddH2O.

15

4.0 RESULTS

All of the total 17 samples collected did not showed the presence of Leptospira when observed

under a dark field microscope. This was due to no observation of main morphology of

Leptospira sp. such as hook-like end, thin and motility. Since all of these characteristics did not

illustrated during the observation, the cultures are assumed as negative as shown in Figures 2 to

4. Six samples comprised of 3 samples each from outside and inside the cave were chosen for

comparison purposes and further confirmation test.

Figure 2. Observation under dark field microscope for water samples (sample C3) collected from stream inside the cave. No spiral-shaped organisms were observed.

16

Figure 3. Observation under dark field microscope for water samples (sample C1) collected from stagnant water inside the cave. No spiral-shaped organisms were observed.

Figure 4. Observation under dark field microscope for water samples (sample R3) collected from outside the cave. No spiral-shaped organisms were observed.

17

The samples were then subjected to molecular techniques which is PCR for further confirmation.

The primer used in the PCR is specifically to amplify the LipL32 gene which can be found in the

outer membrane of leptospires. Six samples were chosen for PCR analysis for the purposes of

further confirmation. These six samples comprises of the 3 samples from inside the cave which

were sample C1, C2 and C3 and another three samples collected outside of the cave which were

sample R1, R3 and R12 as shown in Table 2. These 6 samples were chosen to compare the

occurrence of Leptospira inside and outside the cave. Figure 5 displays the agarose gel

electrophoresis of PCR product of the 6 chosen samples. Based on Figure 5, only samples

collected from inside the cave showed DNA band. The size of the DNA bands is estimated using

a 100 bp ladder. The size of the PCR product shown in lane 4, 5 and 6 are estimated at around

400 to 500 bp. In addition, the negative control only consists of DNA-free ddH2O (lane 7). Table

3 shows the summary of observation made under dark field microscope.

Table 2. Summary of detection of LipL32 gene via PCR.

No Sample No Source Detection of LipL32 gene using PCR

1 C1 Inside cave; stagnant water Positive 2 C2 Inside cave; stagnant water Positive 3 C4 Inside cave; small stream Positive 4 R1 Outside cave; stagnant water

near the river Negative

5 R3 Outside cave; in river (near river bed).

Negative

6 R12 Outside cave; in river (near river bed).

Negative

18

Table 3. Summary of observation under dark field microscope.

No Sample No. Source Morphological observation

(under dark field microscope)

1 C1 Inside cave; stagnant

water None

2 C2 Inside cave; stagnant water

None

3 C3 Inside cave; small stream None 4 R1 Outside cave; stagnant

water near the river None

5 R2 Outside cave; stagnant water near the river

None

6 R3 (Point 1) Outside cave; in river (near river bed).

None

7 R4 Outside cave; in river (centre)

None

8 R5 Outside cave; in river (near opposite river bed)

None

9 R6 (Point 2) Outside cave; in river (near river bed).

None

10 R7 Outside cave; in river (centre)

None

11 R8 Outside cave; in river (near opposite river bed)

None

12 R9 (Point 3) Outside cave; in river (near river bed).

None

13 R10 Outside cave; in river (centre)

None

14 R11 Outside cave; in river (near opposite river bed)

None

15 R12 (Point 4) Outside cave; in river (near river bed).

None

16 R13 Outside cave; in river (centre)

None

17 R14 Outside cave; in river (near opposite river bed)

None