RAPID COMMUNICATION

Oleanolic acid has similar effects as retinoic acid in inducingmouse embryonic stem cell 1B10 to differentiate towardsgerm cells

Qian Wan • Hua Lu • Yanli Deng • Junbei Xiang •

Limei Liang

Received: 22 July 2013 / Accepted: 18 October 2013 / Published online: 20 November 2013

� Japan Human Cell Society and Springer Japan 2013

Abstract This study investigated the effects of the

compound oleanolic acid (OA) in inducing mouse embry-

onic stem cells (MESC) to differentiate towards germ cells

(GC). MESC 1B10 was used as the model cell. 1B10 was

cultured, and embryoid bodies (EBs) were produced from

1B10. The EBs were allowed to attach to the bottoms of

culturing disks and grow. OA was added into the medium

to induce the EBs to differentiate. Retinoic acid (RA) was

used as the positive drug. After 72 h, total RNA was

extracted, cDNA was synthesized, and real-time fluores-

cence quantitative PCR was performed to measure the

transcriptional expression profiles of 11 reproduction-

related genes affected by OA and RA, respectively. When

the data were compared, it was found that OA up-regulated

the transcriptional levels of Oct-4, GDF-9, Stra8, Mvh,

ZP2, ZP3, Itga6, and TP2, and down-regulated transcrip-

tional levels of SCP3, ZP1, and Itgb1; RA up-regulated the

transcriptional levels of GDF-9, Stra8, Mvh, ZP2, ZP3,

Itga6, Itgb1, and TP2, and down-regulated the transcrip-

tional levels of Oct-4, SCP3, and ZP1. The data showed

that OA and RA had similar effects in inducing differen-

tiation of MESC towards GC.

Keywords Oleanolic acid � Mouse embryonic stem

cells � Induced differentiation � Reproduction-related

genes

Introduction

Ligustrum lucidum is a small evergreen tree growing to

10 m tall and broad. In China, this plant is known as Nu

Zhen Zi in Chinese and in the West as the ‘‘Wax Tree

Privet.’’ In traditional Chinese medicine, the berries are

used to treat ‘‘sexual weakness,’’ tinnitus (ringing in the

ears), and general fatigue, and to increase the body’s yin

[1]. Clinically, Ligustrum lucidum is used to treat human

infertility, but its mechanism is not clear.

Germ cell insufficiency is one important cause of human

infertility. Germ cells originate from stem cells, which are

multipotent cells that can be induced to differentiate into

many different kinds of cells, such as neural cells, myo-

cardial cells, germ cells, osteocytes, adipocytes, etc. Cur-

rently, in vitro-induced differentiation systems are widely

used to study the differentiation of stem cells. Various

inducers have been found to be able to induce differenti-

ation in vitro, such as PDGF, BMP2, BMP4, Activin A,

bFGF, Wnt3a, RA, FGF, DMSO, and TGF-b1 [2–6].

Because Ligustrum lucidum is used to treat human

infertility, research is needed to investigate its

Electronic supplementary material The online version of thisarticle (doi:10.1007/s13577-013-0084-5) contains supplementarymaterial, which is available to authorized users.

Q. Wan � J. Xiang

The Reproduction Laboratory of Traditional Chinese Medicine

and Western Medicine, The Second Affiliated Clinical Medical

School, Chengdu University of Traditional Chinese Medicine,

Chengdu 610041, Sichuan, China

Q. Wan � H. Lu � Y. Deng � J. Xiang � L. Liang

Sichuan Family Planning Research Institute, Chengdu 610041,

Sichuan, China

H. Lu (&)

The Second Affiliated Hospital, Chengdu University of

Traditional Chinese Medicine, Chengdu 610041, Sichuan, China

e-mail: kjclh@126.com

Y. Deng � L. Liang

The Affiliated Clinical Medical School, Chengdu University of

Traditional Chinese Medicine, Chengdu 610075, Sichuan, China

123

Human Cell (2014) 27:5–11

DOI 10.1007/s13577-013-0084-5

effectiveness, particularly whether it induces differentia-

tion of stem cells. Ligustrum lucidum’s chemical constit-

uents include pentacyclic triterpenoid, dammarane

pentacyclic triterpenoid, flavones, secoiridoids, phenolic

glucoside, and other components, such as polysaccharides,

amino acids, fatty acids, volatile components, pigments,

microelements, and so on [7]. This study’s strategy was to

investigate Ligustrum lucidum’s most important compo-

nent, oleanolic acid (OA).

OA is a pentacyclic triterpenoid compound in dissoci-

ation form or combinational glucoside form [8]. It has

hepatoprotection, antifungal, anti-inflammation, and other

characteristics, and is currently mostly used as a medicine

to treat liver disease [9].

For this study, OA was chosen as the inducer in research

on induced differentiation of stem cells. RA was chosen as

the positive drug. RA is a derivative of Vitamin A and has

already been found able to induce mouse embryonic stem

cells to differentiate towards germ cells. Specifically, RA

stimulates the expression of Stra8, which is the marker

event after the intervention of stem cells with RA [10].

There are many kinds of stem cells, including various

adult stem cells and embryonic stem cells, of which there are

many different cell lines. In this research, mouse embryonic

stem cell 1B10 was chosen as the experimental subject

because there have been many reports of the effectiveness of

RA used mouse embryonic stem cells [11–13], and several

articles have been published about 1B10 [14, 15], while

1B10 is available and studied extensively in this laboratory.

In this study, 1B10 was treated by OA, the cellular

morphological changes were studied microscopically, and

the transcriptional expression profiles for 11 reproduction-

related genes were analyzed. This study contributes to the

literature by helping to clarify the mechanism by which

Ligustrum lucidum aids in treating human infertility.

Materials and methods

MESC 1B10 and stem cell culturing

The MESC 1B10 was a gift from Prof. Cong Liu of

Sichuan University. Feeder cells were the mouse embry-

onic fibroblast cell NIH3T3. The culturing medium for the

NIH3T3 contained DMEM (with 2 mmol/L L-glu and

4.5 g/L glucose) (Hali, China), 10 % FBS (Sigma, USA),

100 U/mL penicillin, and 0.1 mg/mL streptomycin (Gibco,

USA). The culturing medium for 1B10 contained: DMEM

(with 2 mmol/L ***L-glu and 4.5 g/L glucose) (Hali,

China), 17 % FBS (Sigma, USA), 100 U/mL penicillin,

and 0.1 mg/mL streptomycin (Gibco), 0.1 mmol/L NEAA

(Gibco), 0.1 mmol/L b-mercaptoethanol (Gibco), 1000 U/

mL LIF (Millipore, USA).

The NIH3T3 was cultured until 90 % confluence.

Mitomycin C was added to the final concentration of

10 lg/mL. The culture was treated in a cell incubator for

3 h and washed with PBS 5 times. Culturing medium for

1B10 was added to the wells and 1B10 was inoculated into

them. The culturing medium was changed every day until

the stem cell clones formed (4–7 days).

EB formation and growth after attaching

The differentiation medium for EB had the same recipe as the

culturing medium for 1B10 except it lacked LIF. To facilitate

EB formation, trypsin solution (Gibco) was added to digest

the stem cell 1B10 culture. After 3 min digestion, detached

cells were softly blown up and down to separate them. To

separate 1B10 and NIH3T3, the mixture was incubated

quietly in a cell incubator for 30 min. Then, the supernatant

culture was collected and placed into a plate with an ultra-

low attachment bottom surface (Corning, USA). After 24 h,

EBs formed. After an additional 24 h, they were collected.

Induced differentiation with OA intervention

The collected EBs were placed on a plate with a normal

attachment bottom. EBs attached and began to grow within

24 h. After 24 h, OA, RA, and DMSO were added to the

cultures. RA was the positive drug, while DMSO was the

negative control because the OA and RA were prepared

with DMSO. The final concentrations of OA and RA were

both 3 lg/mL, and the final concentration of DMSO in 3

samples was 0.1 %. Microscopy images were made 72 h

after the intervention to compare the cellular morphologi-

cal changes.

qPCR analysis

All RNAs were extracted 72 h after the intervention, using

Tri Reagent (Molecular Research Center, USA). The cDNAs

were synthesized from the extracted RNAs with a Revertaid

H Minus First Strand cDNA Synthesis Kit (Fermentas,

USA). qPCR analyses were performed for cDNAs with iQ

Sybr Green Supermix (Bio-Rad, USA). qPCR measured 11

reproduction-related genes. Table 1 lists their names and

primer sequences. b-Actin was chosen as the reference gene.

qPCR analysis

Statistic analysis

SPSS 13.0 software was used to perform statistic analysis.

For comparison of data among groups, an independent-

samples t test was used. P \ 0.05 was considered to be

statistically significant.

6 Q. Wan et al.

123

Results

EMSC 1B10 grew normally above the feeder cell

NIH3T3

To maintain the potency of EMSC 1B10, NIH3T3 cells was

used as feeder cells. Figure 1 shows the representative growth

picture for EMSC 1B10. Clones with ‘‘bird’s nest’’ shapes can

be seen clearly, similar to those reported previously.

EBs formed in wells with ultra-low attachment bottoms

Detached, separated MESC 1B10 was placed on a plate

with an ultra-low attachment bottom, and the plate was

further cultured in a cell incubator. EBs formed after 24 h.

Figure 2 shows the representative growth picture for EBs

from EMSC 1B10. Bodies with spheroid structures could

be observed clearly, similar to those reported previously.

Attached EBs treated with OA, RA, DMSO had similar

morphologies

Embryoid bodies was placed in wells with normal attach-

ment bottom. After 24 h, EBs attached, and then OA, RA,

or DMSO was added to each well. After 72 h, images were

taken to compare cellular morphology after the interven-

tion. Figure 3 demonstrates that the cellular morphologies

were similar for all three kinds of interventions.

Expression profiles of 11 reproduction-related genes

were similar for RA and OA

Eleven reproduction-related genes were chosen as experi-

mental objects: Oct-4, GDF-9, Stra8, SCP3, Mvh, ZP1,

ZP2, ZP3, Itga6, Itgb1, and TP2. Oct-4 is important to

maintaining the multipotency of stem cells, and too little or

Table 1 Names and sequences

of the primers for 11

reproduction-related genes

No. Name Direction Sequence

1 Oct-4 Forward CGGAAGAGAAAGCGAACTAGCA

Backward TGATTGGCGATGTGAGTGATC

2 GDF-9 Forward CAGACCCCTGGTCCTTGCT

Backward TGGAGTCAGGCTGCAGCTTA

3 Stra8 Forward TGCCACCTGCAACTCAGAAA

Backward CTGGTTCCTGGTTTAATGGAGTGT

4 SCP3 Forward ATCTGGGAAGCCACCTTTGG

Backward CTGGAGCCTTTTCATCAGCAA

5 Mvh Forward CAAAGGAACAACGCCAAACC

Backward TTGCCCAACAGCGACAAAC

6 ZP1 Forward TCGAGCCTGGCTTTGAATACA

Backward CAAACCGGTTCCCAAATTCAT

7 ZP2 Forward CTCTCTTCACTCAAGCTGACCTTCT

Backward AAACCCATCCTGTGCACACA

8 ZP3 Forward CCGGGTGTCCGTGGATAC

Backward CGAGGGTCGTGGAGTAGGAA

9 Itga6 Forward GACATGAAGTCCGCGCATCT

Backward TGCCACCCATCTGCATT

10 Itgb1 Forward TCCAAATAAGGAGTCTGAAACCATT

Backward GGATGCCATGGCTTTGACA

11 TP2 Forward CATCCGTGCACTCTCGACACT

Backward CCTCCTGACGGCCTTTCTCT

12 b-Actin Forward TGGCATCCATGAAACTACATTCA

Backward TGCCTGGGTACATGGTGGTA

Fig. 1 Representative growth picture for MESC 1B10, in which

‘‘bird’s nest’’-shaped clones are obvious. Scale bar 100 lm

Oleanolic acid has similar effects as retinoic acid 7

123

too much Oct-4 will cause differentiation [16, 17]. GDF-9

is the early marker gene for differentiation toward female

germ cells [18]. Stra8 is the early marker gene for differ-

entiation toward male germ cells [19]. SCP3 is the early

marker gene for meiosis [20]. Mvh is the early marker gene

for differentiation toward female and male germ cells [21].

ZP1, ZP2, and ZP3 are marker genes for the formation of

oocytes [22]. Itga6, Itgb1, and TP2 are marker genes for

the formation of sperm cells [23, 24].

The 11 reproduction-related genes were studied for OA,

RA, and DMSO. The data for OA and RA were compared

with data for DMSO. Tables 2 and 3 show the comparisons.

Table 2 shows that OA up-regulated the transcriptional

levels of Oct-4, GDF-9, Stra8, Mvh, ZP2, ZP3, Itga6, and

TP2, and down-regulated transcriptional levels of SCP3,

ZP1, and Itgb1, and the differences for GDF-9, Stra8, Mvh,

ZP2, ZP3, and TP2 were significant (P = 0.0001, 0.0005,

0.0026, 0.0247, 0.0263, and 0.0142, respectively). Table 3

shows that RA up-regulated the transcriptional levels of

GDF-9, Stra8, Mvh, ZP2, ZP3, Itga6, Itgb, and TP2, and

down-regulated the transcriptional levels of Oct-4, SCP3,

and ZP1. Differences for Oct-4, GDF-9, Stra8, SCP3, ZP2,

and TP2 were significant (P = 0.0001, 0.0006, 0.0000,

0.0000, 0.0012, and 0.0287, respectively). These results

show that OA and RA have similar effects on MESC 1B10.

Discussion

This research aimed to explain the mechanism of Ligu-

strum lucidum as a treatment for human infertility. The

major effective component of Ligustrum lucidum, OA, was

investigated with regard to differentiation of stem cells. It

was found that OA had similar effects as RA on the

reproduction-related genes of MESC 1B10.

Retinoic acid is widely used as an inducer for stem cells

differentiation. After intervention with RA, Stra8 will be

up-regulated, which is the marker event for RA [19]. In this

research, RA was the positive drug. The data for OA were

compared with data for RA.

Fig. 2 Representative picture for the formation of EBs from MESC

1B10, in which bodies with spheroid structures are obvious. Scale bar

100 lm

Fig. 3 Representative images of the attached EBs from MESC 1B10

under three kinds of intervention. a OA, b RA, c DMSO. Scale bar

100 lm

8 Q. Wan et al.

123

The results show that both OA and RA up-regulated

GDF-9, Stra8, Mvh, ZP2, ZP3, Itga6, and TP2, which

demonstrates that both OA and RA have the potential to

induce differentiation toward both kinds of germ cells. In

addition, the results show that both OA and RA down-

regulated SCP3 and ZP1, which demonstrates that neither

OA nor RA initiated meiosis during 72 h of intervention.

Finally, the results show that only 2 of the 11 profiles differ

between OA and RA. These are Oct-4 and Itgb1. This

could be explained by the fact that differentiation was

initiated by up-regulation of Oct-4 by OA and down-reg-

ulation of Oct-4 by RA.

Because OA and RA showed significant effects on several

of the reproduction-related genes, this raises the question of

why cellular morphologies for the three kinds of intervention

were not significantly different. The reason is that the time

span of the intervention was short (72 h) compared to pre-

viously reported studies. For example, Geijsen et al. [11]

treated MESC with RA for 7 days before SSEA1? sorting

cells by flow cytometry. Nayernia et al. [12] treated MESC

with RA for 10 days before sorting. Charles et al. [25] treated

human-sourced stem cells with RA for 10 days before sort-

ing. In these studies, stem cells were subjected to flow

cytometry sorting after 7 or 10 days of intervention with RA,

and morphological changes of the treated stem cells were not

shown in the published studies. They may have taken longer

than 7 or 10 days. Therefore, further investigation into

morphological changes of treated MESC is planned in this

laboratory and will be performed in the near future.

Oleanolic acid has an isomer, ursolic acid (UA), which

is also a pentacyclic triterpenoid compound. The difference

between OA and UA is just the difference in the position of

one methyl group: OA has two methyl groups on C20,

while UA has one methyl group on C19 and one on C20

(Fig. S1). It has been reported that either OA or UA can

induce differentiation of F9 teratocarcinoma stem cells

[26]. It has also been reported that dexamethasone (Dex),

which is a glucocorticoid hormone that has a structure

similar to OA and UA (Fig. S2), can similarly affect F9

teratocarcinoma stem cells [26].

Table 2 Expression profiles for

11 reproduction-related genes

by OA

Significant values (P\0.05) are

in bold

Gene Group P value

OA DMSO Change (%)

Oct-4 3.0889 ± 0.4795 2.3737 ± 0.0758 :30.13 0.0632

GDF-9 22.5830 ± 2.0411 2.1883 ± 0.2130 :931.99 0.0001

Stra8 16.3228 ± 2.4206 1.7945 ± 0.2094 :809.61 0.0005

SCP3 3.0570 ± 0.1982 3.3377 ± 0.0807 ;8.41 0.0855

Mvh 18.3440 ± 2.1665 9.2369 ± 0.9278 :98.59 0.0026

ZP1 15.9257 ± 19.9502 20.4144 ± 29.8493 ;21.99 0.8392

ZP2 9.5953 ± 4.1864 1.0578 ± 0.4885 :807.13 0.0247

ZP3 1.9637 ± 0.2023 1.2510 ± 0.2962 :56.97 0.0263

Itga6 1.4038 ± 0.2981 1.2441 ± 0.2874 :12.84 0.5406

Itgb1 3.4867 ± 1.1924 4.1941 ± 0.5466 ;16.86 0.4032

TP2 55.4255 ± 21.6067 3.5394 ± 0.2824 :1465.96 0.0142

Table 3 Expression profiles for

11 reproduction-related genes

by RA

Significant values (P\0.05) are

in bold

Gene Group P value

RA DMSO Change (%)

Oct-4 1.2278 ± 0.1150 2.3737 ± 0.0758 ;48.27 0.0001

GDF-9 5.3588 ± 0.5214 2.1883 ± 0.2130 :144.88 0.0006

Stra8 33.1100 ± 0.4792 1.7945 ± 0.2094 :1745.10 0.0000

SCP3 0.5909 ± 0.2290 3.3377 ± 0.0807 ;82.30 0.0000

Mvh 17.1968 ± 5.3729 9.2369 ± 0.9278 :86.18 0.06476

ZP1 0.3293 ± 0.3186 20.4144 ± 29.8493 ;83.87 0.3791

ZP2 3.8224 ± 0.3214 1.0578 ± 0.4885 :261.37 0.0012

ZP3 2.1799 ± 0.5568 1.2510 ± 0.2962 :74.24 0.2647

Itga6 1.5353 ± 0.2626 1.2441 ± 0.2874 :23.41 0.2647

Itgb1 4.2499 ± 0.9060 4.1941 ± 0.5466 :1.33 0.9315

TP2 4.2092 ± 0.2016 3.5394 ± 0.2824 :18.92 0.0287

Oleanolic acid has similar effects as retinoic acid 9

123

Given this, an investigation into the effects of UA and

Dex on MESC 1B10 was performed, and the results

demonstrated several points. UA up-regulated Stra8

(P = 0.0030) and Mvh. UA down-regulated Oct-4, GDF-9,

SCP3, ZP1, ZP2, ZP3, Itga6, and Itgb1 (P = 0.0039,

0.0070, 0.0141, 0.0242, 0.0177, 0.0012, 0.0137, and

0.0128, respectively) and TP2 (Table S1). Dex up-regu-

lated TP2 (P = 0.0437), Oct-4, GDF-9, Mvh, ZP1, and

ZP3, and down-regulated Itgb1 (P = 0.0499), Stra8, SCP3,

ZP2, and Itga6 (Table S2). From these results, it appears

that UA and Dex do not have effects similar to OA on

MESC 1B10. Although OA and UA have similar struc-

tures, differences exist. For example, Wang et al. [27]

found that the inhibitory effect of OA on cytochrome P450

is stronger than that of UA.

There exist several other lines of MESCs, making it of

interest to investigate whether OA has similar effects on

other lines. MESC D3 (ATCC No.: CRL-1934) was obtained

and tested. The results demonstrated several points. OA, RA,

and DMSO have similar effects on morphologic changes of

attached EBs from MESC D3 (Fig. S3). OA up-regulated

Oct-4, GDF-9, SCP3, Mvh, ZP3, Itga6, and Itgb1

(P = 0.0001, 0.0002, 0.0250, 0.0029, 0.0219, 0.0092, and

0.0028, respectively), ZP1, and TP2. OA down-regulated

Stra8 (P = 0.0010) and ZP2 (Table S3). RA significantly

up-regulated only Stra8 (P = 0.0004) and down-regulated

the rest of the marker genes (Table S4). On the one hand,

these results show that OA shows similar effects on the

marker genes of MESC D3 as it does on those of MESC

1B10, except for the effect on Stra8. From this, it can be

concluded that OA has the effect on MESC D3 of inducing

differentiation toward germ cells. On the other hand, except

for the typical effect on Stra8, RA shows very different

effects on the marker genes of MESC D3, and it can be

concluded that RA does not have the effect on MESC D3 of

inducing differentiation toward germ cells. The results for

OA on MESC D3 are exciting, and further investigations are

planned in this laboratory. The results for RA on MESC D3

are disappointing and may be due to characteristic differ-

ences between MESC 1B10 and MESC D3. Further study in

this area is called for.

In conclusion, the current study shows that OA and RA

have similar effects on differentiation of MESC 1B10

toward germ cells. Because OA is the major component of

Ligustrum lucidum, the results help to explain the mecha-

nism of Ligustrum lucidum’s mechanism in treating

human infertility. As mentioned above, further research is

continuing.

Acknowledgments We sincerely thank Madam Peng Wenzhen of

Sichuan University for the cultured cells and the cell culturing. The

National Program on Key Basic Research Project of China (973

Program, No. 2010Cb530403) and Experimental Technology

Program of Chengdu University of Traditional Chinese Medicine

(No. 063003) supported this work.

Conflict of interest We declare that we have no financial and

personal relationships with other people or organizations that can

inappropriately influence our work. There is no professional or other

personal interest of any nature or kind in any product, service and/or

company that could be construed as influencing the position presented

in, or the review of, the manuscript entitled, ‘‘Oleanolic acid has

similar effect as retinoic acid to induce mouse embryonic stem cell

1B10 to differentiate towards germ cells’’.

References

1. http://en.wikipedia.org/wiki/Ligustrum_lucidum. Accessed 15

Sept 2013.

2. Johe KK, Hazel TG, Muller T, Dugich-Djordjevic MM, McKay RD.

Single factors direct the differentiation of stem cells from the fetal

and adult central nervous system. Genes Dev. 1996;10:3129–40.

3. Kristiina R, Mari PM, Katriina AS. Cardiac differentiation of

pluripotent stem cells. Stem Cells Int. 2011;2011:1–12.

4. Marques-Mari AI, Lacham-Kaplan O, Medrano JV, Pellicer A,

Simon C. Differentiation of germ cells and gametes from stem

cells. Hum Reprod Update. 2009;15:379–90.

5. Heino TJ, Hentunen TA. Differentiation of osteoblasts and

osteocytes from mesenchymal stem cells. Curr Stem Cell Res

Ther. 2008;3:131–45.

6. Scott MA, Nguyen VT, Levi B, James AW. Current methods of

adipogenic differentiation of mesenchymal stem cells. Stem Cells

Dev. 2011;20:1793–804.

7. Huang X, Yin Z, Ye W, Shen W. Chemical constituents from

fruits of Ligustrum lucidum. Zhongguo Zhong Yao Za Zhi.

2010;35:861–4.

8. Perez-Camino MC, Cert A. Quantitative determination of

hydroxyl pentacyclic triterpene acids in vegetable oils. J Agric

Food Chem. 1999;47:1558–62.

9. Zhang SY, Li Z. Progress in oleanolic acid research. Food Fer-

ment Technol. 2010;46:20–4.

10. http://www.ncbi.nlm.nih.gov/gene/20899. Accessed 14 Sept 2013.

11. Geijsen N, Horoschak M, Kim K, Gribnau J, Eggan K, Daley GQ.

Derivation of embryonic germ cells and male gametes from

embryonic stem cells. Nature. 2004;427:148–54.

12. Nayernia K, Nolte J, Michelmann HW, Lee JH, Rathsack K,

Drusenheimer N, et al. In vitro-differentiated embryonic stem

cells give rise to male gametes that can generate offspring mice.

Dev Cell. 2006;11:125–32.

13. Guan K, Chang H, Rolletschek A, Wobus AM. Embryonic stem

cell-derived neurogenesis. Retinoic acid induction and lineage

selection of neuronal cells. Cell Tissue Res. 2001;305:171–6.

14. Boonen M, Vogel P, Platt KA, Dahms N, Kornfeld S. Mice

lacking mannose 6-phosphate uncovering enzyme activity have a

milder phenotype than mice deficient for N-acetylglucosamine-1-

phosphotransferase activity. Mol Biol Cell. 2009;20:4381–9.

15. Xu HL, Balakrishnan K, Malaterre J, Beasley M, Yan YQ, Essers

J, et al. Rad21-Cohesin haploinsufficiency impedes DNA repair

and enhances gastrointestinal radiosensitivity in mice. PLoS

ONE. 2010;5:1–15.

16. Boyer LA, Lee TI, Cole MF, Johnstone SE, Levine SS, Zucker

JP, et al. Core transcriptional regulatory circuitry in human

embryonic stem cells. Cell. 2005;122:947–56.

17. Niwa H, Miyazaki J, Smith AG. Quantitative expression of Oct-3/

4 defines differentiation, dedifferentiation or self-renewal of ES

cells. Nat Genet. 2000;24:372–6.

10 Q. Wan et al.

123

18. Dong J, Albertini DF, Nishimori K, Kumar TR, Lu N, Matzuk

MM. Growth differentiation factor-9 is required during early

ovarian folliculogenesis. Nature. 1996;383:531–5.

19. Anderson EL, Baltus AE, Roepers-Gajadien HL, Hassold TJ, de

Rooij DG, van Pelt AM, et al. Stra8 and its inducer, retinoic acid,

regulate meiotic initiation in both spermatogenesis and oogenesis

in mice. Proc Natl Acad Sci USA. 2008;105:14976–80.

20. Yuan L, Liu JG, Zhao J, Brundell E, Daneholt B, Hoog C. The

murine SCP3 gene is required for synaptonemal complex assem-

bly, chromosome synapsis, and male fertility. Mol Cell. 2000;5:

73–83.

21. Toyooka Y, Tsunekawa N, Akasu R, Noce T. Embryonic stem

cells can form germ cells in vitro. Proc Natl Acad Sci USA.

2003;100:11457–62.

22. Hinsch KD, Hinsch E. The zona pellucida ‘receptors’ ZP1, ZP2

and ZP3. Andrologia. 1999;31:320–2.

23. Sa R, Miranda C, Carvalho F, Barros A, Sousa M. Expression of

stem cell markers: OCT4, KIT, ITGA6, and ITGB1 in the male

germinal epithelium. Syst Biol Reprod Med. 2013 (Epub ahead of

print).

24. Zhao M, Shirley CR, Yu YE, Mohapatra B, Zhang Y, Unni E,

et al. Targeted disruption of the transition protein 2 gene affects

sperm chromatin structure and reduces fertility in mice. Mol Cell

Biol. 2001;21:7243–55.

25. Charles AE IV, Bart TP, Megan MM, Jennifer MB, Hanna V,

Brian PH, et al. Direct differentiation of human pluripotent stem

cells into haploid spermatogenic cells. Cell Rep. 2012;2:1–7.

26. Lee HY, Chung HY, Kim KH, Lee JJ, Kim KW. Induction of

differentiation in the cultured F9 teratocarcinoma stem cells by

triterpene acids. J Cancer Res Clin. 1994;120:513–8.

27. Wang YP, Dong RH, Liu ZY, Hu Y, Liu GY. Inhibitory effect of

oleanolic acid and ursolic acid isomers on cytochrome P450.

Chin J Drug Appl Monit. 2012;9(201–3):210.

Oleanolic acid has similar effects as retinoic acid 11

123