+ All Categories
Home > Documents > Oncogene AEG-1 promotes glioma-induced …...Aug 17, 2011  · Sarkar); and the National Research...

Oncogene AEG-1 promotes glioma-induced …...Aug 17, 2011  · Sarkar); and the National Research...

Date post: 25-Sep-2020
Category:
Upload: others
View: 0 times
Download: 0 times
Share this document with a friend
31
1 Oncogene AEG-1 promotes glioma-induced neurodegeneration by increasing glutamate excitotoxicity Seok-Geun Lee 4 , Keetae Kim 1 , Timothy P. Kegelman 1 , Rupesh Dash 1 , Swadesh K. Das 1 , Jung Kyoung Choi 4 , Luni Emdad 1,2 , Eric L. Howlett 1,3 , Hyun Yong Jeon 1 , Zhao Zhong Su 1 , Byoung Kwon Yoo 1 , Devanand Sarkar 1,2,3 , Sung-Hoon Kim 4 , Dong-Chul Kang 5 , and Paul B. Fisher 1,2,3 1 Department of Human and Molecular Genetics, 2 VCU Institute of Molecular Medicine, 3 VCU Massey Cancer Center, Virginia Commonwealth University, School of Medicine, Richmond, Virginia; 4 Cancer Preventive Material Development Research Center, Institute of Oriental Medicine, College of Oriental Medicine, Kyung Hee University, Seoul, Republic of Korea; and 5 Ilsong Institute of Life Science, Hallym University, Anyang, Kyonggi-do, Republic of Korea Running Title: Role of AEG-1 in glioma-induced neurodegeneration Key Words: AEG-1; glioma; EAAT2; glutamate; glioma-induced neurodegeneration Financial Support: National Institutes of Health Grants R01 CA134721, P01 CA104177 and P01 NS31492, the Thelma Newmeyer Corman Endowment, the Samuel Waxman Cancer Research Foundation and the National Foundation for Cancer Research (to P.B. Fisher); the Goldhirsh Foundation for Brain Cancer Research, the Dana Foundation and the McDonnell Foundation (to D. Sarkar); and the National Research Foundation Basic Science Research Program (2010-0008219) (to S.G. Lee) and Medical Research Center Program (2011-0006220) (to S.G. Lee and S.H. Kim) of the Korean Ministry of Education, Science and Technology. Correspondence: Paul B. Fisher: [email protected] and Seok-Geun Lee: [email protected] Dr. Paul B. Fisher, Professor and Chair, Department of Human and Molecular Genetics, Director, VCU Institute of Molecular Medicine, Virginia Commonwealth University School of Medicine, Sanger Hall 11-015, 1101 East Marshall Street, Richmond, VA 23298, USA. Tel: 1-804-828-9632. Fax: 1-804-827-1124. Conflicts of Interest: No conflicts of interest disclosed. Research. on January 24, 2021. © 2011 American Association for Cancer cancerres.aacrjournals.org Downloaded from Author manuscripts have been peer reviewed and accepted for publication but have not yet been edited. Author Manuscript Published OnlineFirst on August 18, 2011; DOI: 10.1158/0008-5472.CAN-11-0782
Transcript
Page 1: Oncogene AEG-1 promotes glioma-induced …...Aug 17, 2011  · Sarkar); and the National Research Foundation Basic Science Research Program (2010-0008219) (to S.G. Lee) and Medical

1

Oncogene AEG-1 promotes glioma-induced neurodegeneration by increasing

glutamate excitotoxicity

Seok-Geun Lee4, Keetae Kim1, Timothy P. Kegelman1, Rupesh Dash1, Swadesh K. Das1, Jung

Kyoung Choi4, Luni Emdad1,2, Eric L. Howlett1,3, Hyun Yong Jeon1, Zhao Zhong Su1, Byoung

Kwon Yoo1, Devanand Sarkar1,2,3, Sung-Hoon Kim4, Dong-Chul Kang5, and Paul B. Fisher1,2,3

1Department of Human and Molecular Genetics, 2VCU Institute of Molecular Medicine, 3VCU Massey Cancer Center, Virginia Commonwealth University, School of Medicine, Richmond, Virginia; 4Cancer Preventive Material Development Research Center, Institute of Oriental Medicine, College of Oriental Medicine, Kyung Hee University, Seoul, Republic of Korea; and 5Ilsong Institute of Life Science, Hallym University, Anyang, Kyonggi-do, Republic of Korea

Running Title: Role of AEG-1 in glioma-induced neurodegeneration Key Words: AEG-1; glioma; EAAT2; glutamate; glioma-induced neurodegeneration Financial Support: National Institutes of Health Grants R01 CA134721, P01 CA104177 and P01 NS31492, the Thelma Newmeyer Corman Endowment, the Samuel Waxman Cancer Research Foundation and the National Foundation for Cancer Research (to P.B. Fisher); the Goldhirsh Foundation for Brain Cancer Research, the Dana Foundation and the McDonnell Foundation (to D. Sarkar); and the National Research Foundation Basic Science Research Program (2010-0008219) (to S.G. Lee) and Medical Research Center Program (2011-0006220) (to S.G. Lee and S.H. Kim) of the Korean Ministry of Education, Science and Technology. Correspondence: Paul B. Fisher: [email protected] and Seok-Geun Lee: [email protected]

Dr. Paul B. Fisher, Professor and Chair, Department of Human and Molecular Genetics, Director, VCU Institute of Molecular Medicine, Virginia Commonwealth University School of Medicine, Sanger Hall 11-015, 1101 East Marshall Street, Richmond, VA 23298, USA. Tel: 1-804-828-9632. Fax: 1-804-827-1124.

Conflicts of Interest: No conflicts of interest disclosed.

Research. on January 24, 2021. © 2011 American Association for Cancercancerres.aacrjournals.org Downloaded from

Author manuscripts have been peer reviewed and accepted for publication but have not yet been edited. Author Manuscript Published OnlineFirst on August 18, 2011; DOI: 10.1158/0008-5472.CAN-11-0782

Page 2: Oncogene AEG-1 promotes glioma-induced …...Aug 17, 2011  · Sarkar); and the National Research Foundation Basic Science Research Program (2010-0008219) (to S.G. Lee) and Medical

2

Abstract

Aggressive tumor growth, diffuse tissue invasion and neurodegeneration are hallmarks of malignant

glioma. Although glutamate excitotoxicity is considered to play a key role in glioma-induced

neurodegeneration, the mechanism(s) controlling this process is poorly understood. AEG-1 is an

oncogene overexpressed in multiple types of human cancers including >90% of brain tumors. AEG-1

also promotes gliomagenesis particularly in the context of tumor growth and invasion, two primary

characteristics of glioma. In the present study, we investigated the contribution of AEG-1 to glioma-

induced neurodegeneration. Pearson correlation coefficient analysis in normal brain tissues and

glioma patient samples indicated a strong negative correlation between expression of AEG-1 and a

primary glutamate transporter of astrocytes EAAT2. Gain and loss of function studies in normal

primary human fetal astrocytes and T98G glioblastoma multiforme cells revealed that AEG-1

repressed EAAT2 expression at a transcriptional level by inducing YY1 activity to inhibit CBP

function as a coactivator on the EAAT2 promoter. In addition, AEG-1-mediated EAAT2 repression

caused a reduction of glutamate uptake by glial cells, resulting in induction of neuronal cell death.

These findings were also confirmed in glioma patient samples demonstrating that AEG-1 expression

negatively correlated with NeuN expression. Taken together, our findings suggest that AEG-1

contributes to glioma-induced neurodegeneration, a hallmark of this fatal tumor, through regulation

of EAAT2 expression.

Research. on January 24, 2021. © 2011 American Association for Cancercancerres.aacrjournals.org Downloaded from

Author manuscripts have been peer reviewed and accepted for publication but have not yet been edited. Author Manuscript Published OnlineFirst on August 18, 2011; DOI: 10.1158/0008-5472.CAN-11-0782

Page 3: Oncogene AEG-1 promotes glioma-induced …...Aug 17, 2011  · Sarkar); and the National Research Foundation Basic Science Research Program (2010-0008219) (to S.G. Lee) and Medical

3

Introduction

Tumors of the central nervous system (CNS) are the most prevalent solid neoplasms of

childhood and the second leading cancer-related cause of death in adults between the ages of 20-39

years (1, 2). Gliomas, the most common brain tumors of the adult CNS, originate from

neuroepithelial tissue and are classified morphologically as astrocytic, oligodendroglial, ependymal

and choroid plexus tumors (2-4). Astrocytomas, composed predominantly of neoplastic astrocytes,

account for 80-85% of all gliomas and are staged as low grade (grade I) to high grade (grade IV)

according to nuclear atypia, mitotic activity, endothelial hyperplasia and necrosis (4). Glioblastoma

multiforme (grade IV astrocytoma; GBM) is an extremely aggressive, invasive and destructive

malignancy with 2-5 times faster proliferation rate than grade III tumors (2, 5). Extensive surgical

resection is not curative due to the highly invasive capacity of GBM cells into normal brain

parenchyma (3). Moreover, GBM is largely resistant to current treatments based on cytotoxic

approaches targeting replicating DNA, such as chemotherapy or radiotherapy (6-8). In addition to

uncontrolled proliferation and diffuse tissue invasion, neurodegeneration is another attribute of

malignant gliomas (2, 9-11).

The mechanisms of glioma-induced neurodegeneration are poorly understood, even though

excitotoxic levels of glutamate play a key role in this phenomenon (10, 11). Although glutamate is a

major neurotransmitter implicated in most aspects of normal brain functions, it is a potent neurotoxin

at high concentration, indicating that glutamate must be constantly removed for maintenance at a low

level (12, 13). The excitatory amino acid transporter 1 and 2 (EAAT1 and 2) predominantly

expressed on astrocytes are responsible for the clearance of excitotoxic levels of glutamate from

synapses, and an impaired glutamate uptake by glial cells causes widespread neurodegeneration and

Research. on January 24, 2021. © 2011 American Association for Cancercancerres.aacrjournals.org Downloaded from

Author manuscripts have been peer reviewed and accepted for publication but have not yet been edited. Author Manuscript Published OnlineFirst on August 18, 2011; DOI: 10.1158/0008-5472.CAN-11-0782

Page 4: Oncogene AEG-1 promotes glioma-induced …...Aug 17, 2011  · Sarkar); and the National Research Foundation Basic Science Research Program (2010-0008219) (to S.G. Lee) and Medical

4

lethal epilepsy (14-16). A number of studies also found that glioma cells release high levels of

glutamate, which cause neuronal cell death and promote malignant glioma progression (17-20).

Astrocyte Elevated Gene-1 (AEG-1) is a multifunctional oncogene overexpressed in a

variety of human cancers, even though it was originally isolated as a novel HIV-1- and TNF-α-

induced transcript from primary human fetal astrocytes (PHFA) (21, 22). As a target of Ras, AEG-1

activates multiple oncogenic signaling pathways including PI3K-Akt, MAPK, Wnt and NF-κB

involved in regulation of proliferation, invasion, chemoresistance, angiogenesis, and metastasis (21,

23-30). Especially in tumors of the CNS, such as neuroblastoma, GBM and oligodendroglioma,

AEG-1 showed higher expression compared to that in normal brain tissues (28, 30-32). Gain and loss

of function studies in glioma cells revealed crucial roles in proliferation and invasive ability of

glioma cells (28, 31). In addition, in vivo experiments using orthotopic glioma models confirmed the

role of AEG-1 in glioma progression (28, 31). Additionally, we observed an interesting inverse

correlation between expression levels of AEG-1 and EAAT2. AEG-1 expression is elevated

following HIV-1 and TNF-α treatment of astrocytes, whereas EAAT2 expression is downregulated

(22, 33-36). In the setting of glioma progression, AEG-1 gradually increases as astrocytes evolve

into malignant glioma while in parallel EAAT2 expression decreases (11, 17, 18, 28, 31, 32, 37).

Both HIV-1 infection and glioma progression are associated with neurodegenerative changes and

glutamate excitotoxicity is one of the predominant mechanisms mediating neurodegeneration. Based

on these considerations, we presently investigated the role of AEG-1 in glioma-induced

neurodegeneration with a focus on regulation of the glutamate transporter and its concomitant

control of glutamate levels.

Materials and Methods

Research. on January 24, 2021. © 2011 American Association for Cancercancerres.aacrjournals.org Downloaded from

Author manuscripts have been peer reviewed and accepted for publication but have not yet been edited. Author Manuscript Published OnlineFirst on August 18, 2011; DOI: 10.1158/0008-5472.CAN-11-0782

Page 5: Oncogene AEG-1 promotes glioma-induced …...Aug 17, 2011  · Sarkar); and the National Research Foundation Basic Science Research Program (2010-0008219) (to S.G. Lee) and Medical

5

Tissue array and immunostaining

Immunofluorescence analyses in human glioma tissue arrays (GL806) from Tissue Array

Networks were performed as previously described (28). Anti-AEG-1, anti-EAAT1 and anti-EAAT2

antibodies were described (34, 38) and anti-NeuN antibody was purchased from Millipore. Images

were captured with a confocal laser scanning microscope LSM multiphton 510 META (Zeiss), and

analyzed using ImageJ (NIH). For analyzing localization of AEG-1, PHFA cells seeded onto 4-well

chamber slides were transfected with pcDNA, AEG-1 or each AEG-1 deletion construct. Two days

later, the cells were fixed and immunostaining was performed with anti-HA antibody (Covance) as

described (27).

Cell lines

Normal PHFA (primary human fetal astrocytes), human glioma cell lines H4 (neuroglioma),

T98G (glioblastoma multiforme) and U251-MG (neuronal glioblastoma) cells were previously

described (26, 28). PC-12 (rat pheochromocytoma) cells were purchased from ATCC, and cultured

in DMEM with 5% FBS and 10% heat inactivated horse serum at 37°C. The NCsh (normal control

sh), AEG-1sh-2 and AEG-1sh-4 cell lines were established by transfection with control shRNA,

AEG-1 shRNA #2 and AEG-1 shRNA #4 expression plasmids (SA Biosciences: KH18459H) in

T98G cells, respectively, and selected with Hygromycin.

Recombinant adenovirus, siRNA and plasmids

Ad.vec and Ad.AEG-1 were previously described (26). Control and YY1 siRNAs were

purchased from Santa Cruz Biotech. The expression plasmids of AEG-1 and AEG-1 deletion mutants

Research. on January 24, 2021. © 2011 American Association for Cancercancerres.aacrjournals.org Downloaded from

Author manuscripts have been peer reviewed and accepted for publication but have not yet been edited. Author Manuscript Published OnlineFirst on August 18, 2011; DOI: 10.1158/0008-5472.CAN-11-0782

Page 6: Oncogene AEG-1 promotes glioma-induced …...Aug 17, 2011  · Sarkar); and the National Research Foundation Basic Science Research Program (2010-0008219) (to S.G. Lee) and Medical

6

tagged with HA were described (25). The N’ deletion mutants N1-N5 include amino acids 71-582,

101-582, 205-582, 232-582 and 262-582, respectively. The C’ deletion mutants C1-C4 include

amino acids 1-513, 1-404, 1-356 and 1-289, respectively. 5’ deletion mutants of the human EAAT2

promoter reporter (EAAT2Pro) constructs and NF-κB-Luc were previously described (25, 35, 38).

The EAAT2Pro-954mYY1 and EAAT2Prom-954mNFκB1 constructs were made using the

QuickChange Site-Directed Mutagenesis kit (Stratagene) in the context of the EAAT2Pro-954

construct. The sequences used for PCR primers include: EAAT2 Pro-954mYY1, 5’-

TCGGAGCCCCCGGAGCTCCCCGCCAAGCATTATCCCCGCG-3’, and EAAT2Prom-

954mNFκB1, 5’-TCGGA GCCCCCGGAGCTCAAAGCCAAGCGCCATCCCCGCG -3’. The

mutated sequences are underlined.

Western blotting and immunoprecipitation (IP) assays

Whole cell lysates were prepared, and co-immunoprecipitation and Western blotting was

performed as described (25, 38). The antibodies for YY1 (Santa Cruz Biotech), CBP (Abcam) and

EF1α (Upstate) were purchased. Whole cell lysates from human tissue samples were previously

described (28).

Northern blotting, real-time PCR (RT-PCR) and nuclear run-on assays

Total RNA was extracted using the RNeasy mini kit (Qiagen). RT-PCR was performed

using ABI 7900 Fast Real-Time PCR System and TaqMan Gene Expression Assays for individual

mRNAs (Applied Biosystems). The nuclei were extracted using NP40 lysis buffer, and nuclear run-

on assays were performed (38).

Research. on January 24, 2021. © 2011 American Association for Cancercancerres.aacrjournals.org Downloaded from

Author manuscripts have been peer reviewed and accepted for publication but have not yet been edited. Author Manuscript Published OnlineFirst on August 18, 2011; DOI: 10.1158/0008-5472.CAN-11-0782

Page 7: Oncogene AEG-1 promotes glioma-induced …...Aug 17, 2011  · Sarkar); and the National Research Foundation Basic Science Research Program (2010-0008219) (to S.G. Lee) and Medical

7

Transient transfection and luciferase assays

Cells were plated in 24-well plates, infected with Ad.vec or Ad.AEG-1, and transfected with

the indicated plasmids and renilla luciferase plasmid (Promega) together with 20 nM of control or

YY1 siRNA using LipofecAMINE 2000 (Invitrogen), and luciferase activities were measured using

a Dual-Luciferase Reporter Assay Kit (Promega). Firefly luciferase activity was normalized by

renilla luciferase activity.

Electrophoretic mobility shift assays (EMSA)

EMSA was performed as described (38). The sequences of oligonucleotide used as probe

include: 5’-CGCCAAGCGCCATCCCCGCG-3’. The YY1 binding site is underlined. The mutant

oligonucleotide: 5’-CGCCAAGCATTATCCCCGCG-3’. The mutated sequences are in bold type.

Chromatin immunoprecipitation (ChIP) assays

ChIP assays were performed using ChIP-IT kit (Active Motif). The primers for the human

EAAT2 promoter used are as following: Sense: 5’-ATCGCTCTCTCGGGGAAGCCA-3’,

antisense: 5’-TAAGCCCTTTAGCGCCTCAA-3’.

Glutamate uptake assays

Assays to determine glutamate uptake were performed as described (38).

Cell viability assays

Cells were treated with 1% heat inactivated horse serum containing 100 μM of glutamate

for ≤ 10 min, and the conditioned media were collected. PC-12 cells (1×104 cells/well) were seeded

Research. on January 24, 2021. © 2011 American Association for Cancercancerres.aacrjournals.org Downloaded from

Author manuscripts have been peer reviewed and accepted for publication but have not yet been edited. Author Manuscript Published OnlineFirst on August 18, 2011; DOI: 10.1158/0008-5472.CAN-11-0782

Page 8: Oncogene AEG-1 promotes glioma-induced …...Aug 17, 2011  · Sarkar); and the National Research Foundation Basic Science Research Program (2010-0008219) (to S.G. Lee) and Medical

8

in 24-well plates, and treated with neuronal differentiation media (DMEM with 1% heat inactivated

horse serum supplemented 1 mM di-butyryl cAMP: Sigma and 50 ng/ml of NGF: Promega) for 3-6

days. Then the PC-12-derived neuron cells were treated with conditioned media for 1 day. Cell

viability was measured by MTT assay (24).

Statistical analysis

Data were presented as mean ± SEM and analyzed for statistical significance using the

unpaired Student’s t-test. Pearson correlation coefficient (r) analysis was used to compare gene

expressions between two genes.

Results

AEG-1 expression negatively correlates with EAAT2 expression and the number of neuronal

cells in glioma patients. To examine a possible correlation between the expression of AEG-1 and

EAAT2 in glioma, we first performed immunofluorescence staining of AEG-1 and EAAT2 in glioma

patient samples using a Tissue Array containing 35 cases of glioma and 5 normal brain tissues in

duplicate (Fig. 1A-C). Specificity of anti-AEG-1 and anti-EAAT2 antibodies for immunostaining

was confirmed by competition with each immunogen (Supplementary Fig. 1). While expression of

AEG-1 greatly increased in glioma patient samples compared to that in normal brains, EAAT2

significantly decreased (Fig. 1A and C). A scatter plot and Pearson correlation coefficient analysis

revealed a strong negative correlation (r = -0.725) between expression of AEG-1 and EAAT2 (Fig.

1B). However, analyzing expression patterns of EAAT1 another glial glutamate transporter indicated

almost no difference between glioma and normal brain tissues and little correlation between

Research. on January 24, 2021. © 2011 American Association for Cancercancerres.aacrjournals.org Downloaded from

Author manuscripts have been peer reviewed and accepted for publication but have not yet been edited. Author Manuscript Published OnlineFirst on August 18, 2011; DOI: 10.1158/0008-5472.CAN-11-0782

Page 9: Oncogene AEG-1 promotes glioma-induced …...Aug 17, 2011  · Sarkar); and the National Research Foundation Basic Science Research Program (2010-0008219) (to S.G. Lee) and Medical

9

expressions of AEG-1 and EAAT1 (Supplementary Fig. 2A-C). These results were also confirmed in

GBM patient samples compared to normal brain tissues by Western blotting analysis (Fig. 1D).

These results indicate an inverse correlation between expressions of AEG-1 and EAAT2, but not

EAAT1 in glioma. Dysregulation of EAAT2 causes glutamate excitotoxicity, which is implicated in

various types of neurodegenerative diseases and glioma-induced neurodegeneration (10-14, 17-20,

37). Accordingly, we further quantified and compared the expression of AEG-1 and EAAT2 with

NeuN, a neuron specific marker in glioma patient samples. NeuN expression was decreased in

glioma samples compared to normal cerebrum tissues, and a scatter plot of the data and Pearson

correlation coefficient analysis showed a strong positive correlation (r = 0.798) between expression

of EAAT2 and NeuN (Fig. 1E and F). Furthermore, the comparison analysis revealed a strong

negative correlation (r = -0.649) between expression of AEG-1 and NeuN (Fig. 1G), indicating that

glioma patient samples with higher levels of AEG-1 have fewer neurons. These observations and the

negative correlation between AEG-1 and EAAT2 expression (Fig. 1B) together with previous studies

showing that AEG-1 has the ability to regulate promoter activity of its target gene (21, 25, 31, 34)

suggested that AEG-1 in glioma might negatively regulate EAAT2 expression and glutamate uptake,

thereby causing neuronal cell death in patients with glioma.

AEG-1 represses expression of EAAT2. To determine if AEG-1 could repress EAAT2 expression,

we first confirmed the negative relationship between expression of AEG-1 and EAAT2 in PHFA and

human glioma cell lines (Fig. 2A). Then, we analyzed PHFA cells infected with Ad.vec or Ad.AEG-

1. As shown in Fig. 2B (left panel), overexpression of AEG-1 significantly reduced EAAT2

expression in PHFA. In addition, EAAT2 mRNA was strongly reduced by AEG-1 (Fig. 2B, center

panel). This reduction in EAAT2 mRNA expression resulted from decreased transcription as

Research. on January 24, 2021. © 2011 American Association for Cancercancerres.aacrjournals.org Downloaded from

Author manuscripts have been peer reviewed and accepted for publication but have not yet been edited. Author Manuscript Published OnlineFirst on August 18, 2011; DOI: 10.1158/0008-5472.CAN-11-0782

Page 10: Oncogene AEG-1 promotes glioma-induced …...Aug 17, 2011  · Sarkar); and the National Research Foundation Basic Science Research Program (2010-0008219) (to S.G. Lee) and Medical

10

confirmed using nuclear run-on assays (Fig. 2B, right panel). These observations document that

AEG-1 negatively regulates EAAT2 expression at a transcriptional level. To further confirm the

negative regulation of EAAT2 by AEG-1 in glioma, we cloned AEG-1 knockdown glioma cell lines

(NCsh, AEG-1sh-2 and AEG-1sh-4) by stable transfection with a control, AEG-1 shRNA-2 or AEG-

1 shRNA-4 plasmid in T98G cells, a highly aggressive glioma cell line with high levels of AEG-1

and low levels of EAAT2 (as shown in Fig. 2A). Real-time PCR and Western blotting analyses

verified AEG-1 knockdown in the clones. AEG-1 knockdown increased EAAT2 expression (Fig.

2C) and recovery of AEG-1 expression in the knockdown cells reduced EAAT2 expression

(Supplementary Fig. 3), confirming that AEG-1 is a negative regulator of EAAT2. In addition, to

investigate the role of AEG-1 in regulating the EAAT2 promoter, an EAAT2 promoter-reporter

plasmid (EAAT2Pro-Luc) was transiently transfected into Ad.vec- or Ad.AEG-1-infected PHFA

cells. AEG-1 potently induced NF-κB activity as previously shown (25) (Supplementary Fig. 4),

whereas it repressed EAAT2 promoter activity (Fig. 2D). Taken together these results demonstrate

that AEG-1 negatively regulates EAAT2 expression at a transcriptional level.

YY-1 is responsible for AEG-1-mediated EAAT2 repression. To determine the mechanism(s) by

which AEG-1 regulates transcription of EAAT2, a series of 5’ deletion-mutants of the EAAT2

promoter-reporter construct were transfected into Ad.vec- or Ad.AEG-1-infected PHFA cells. Serial

deletions from -964 to -37 showed a similar pattern of AEG-1-mediated repression in promoter

activity (Fig. 3A). These results suggest that transcription factors binding to the -37/+43 region are

capable of regulating a reduction of EAAT2 promoter activity in response to AEG-1. Accordingly,

we analyzed the -37/+44 region of the EAAT2 promoter using Transcription Element Search System

(www.cbil.upenn.edu/cgi-bin/tess) to identify putative transcription factor binding sites potentially

Research. on January 24, 2021. © 2011 American Association for Cancercancerres.aacrjournals.org Downloaded from

Author manuscripts have been peer reviewed and accepted for publication but have not yet been edited. Author Manuscript Published OnlineFirst on August 18, 2011; DOI: 10.1158/0008-5472.CAN-11-0782

Page 11: Oncogene AEG-1 promotes glioma-induced …...Aug 17, 2011  · Sarkar); and the National Research Foundation Basic Science Research Program (2010-0008219) (to S.G. Lee) and Medical

11

responsible for AEG-1-mediated repression. This analysis located two putative transcription factor

binding sites, YY1 and NF-κB1, which are well-known transcription factors that function as

activators or repressors, depending on cellular binding context of a target promoter and the presence

of other transcription factor binding sites in the promoter (39, 40). In order to determine which

transcription factor was responsible for EAAT2 promoter repression, we engineered two mutant

EAAT2 promoter-reporter plasmids containing a site-directed mutation of the putative YY1 or NF-

κB binding site in the -954 EAAT2 promoter construct (mYY1 and m NF-κB). These constructs were

transfected into PHFA cells, and each promoter activity was compared with that of the wild type

plasmid -954EAAT2Pro-Luc. As shown in Fig. 3B, mutation in the YY1 binding site abolished the

EAAT2 promoter response to AEG-1, while mutation in the NF-κB site had no effect. These

experiments indicate that YY1 is responsible for AEG-1-mediated EAAT2 promoter repression. To

further clarify the role of YY1, we performed EMSA using a 20-bp double-stranded probe

containing the YY1 binding site of the EAAT2 promoter. As shown in Fig. 3C (lane 2 and 3), the

intensity of a DNA-protein complex was significantly higher in Ad.AEG-1-infected PHFA nuclear

extracts in comparison with Ad.vec-infected PHFA nuclear extracts. To further characterize this

nucleoprotein complex, competition assays were performed using an unlabeled probe or a mutant

probe containing mutations in the YY1 binding site. As shown in Fig. 3C the cold probe (lane 4)

completely competed the DNA-protein complex, whereas the mutant probe (lane 5) had little effect

on complex formation. In addition, supershift experiments with an anti-YY1 antibody resulted in a

retarded mobility of the complex, while a control IgG did not (Fig. 3C, lane 6 and 7). In addition,

YY1 siRNA inhibited the AEG-1-mediated EAAT2 promoter repression (Fig. 3D). These results

were also confirmed by Western blot analysis using PHFA cell lysates treated with Ad.AEG-1 and

Research. on January 24, 2021. © 2011 American Association for Cancercancerres.aacrjournals.org Downloaded from

Author manuscripts have been peer reviewed and accepted for publication but have not yet been edited. Author Manuscript Published OnlineFirst on August 18, 2011; DOI: 10.1158/0008-5472.CAN-11-0782

Page 12: Oncogene AEG-1 promotes glioma-induced …...Aug 17, 2011  · Sarkar); and the National Research Foundation Basic Science Research Program (2010-0008219) (to S.G. Lee) and Medical

12

YY1 siRNA (Fig. 3E). In total, these results indicate that AEG-1 increases YY1 binding to the

EAAT2 promoter, which is responsible for AEG-1-mediated repression of EAAT2 expression.

AEG-1 directly interacts with YY-1 and CBP. AEG-1 physically interacts with a coactivator,

cyclic AMP-responsive element binding protein (CREB)-binding protein (CBP), and YY1

interaction with CBP is one mechanism by which YY1 negatively or positively regulates gene

expression (25, 39). Based on this consideration, we hypothesized that AEG-1 might play a role as a

bridge between YY1 and CBP on the EAAT2 promoter, causing YY1 to function as a negative

regulator of EAAT2 expression by inhibiting CBP. To examine this possibility we first established if

these proteins directly physically interact with each other by immunoprecipitation assays using

Ad.vec- or Ad.AEG-1-infected PHFA cell lysates. As shown in Fig. 4A, anti-HA, anti-YY1 and anti-

CBP antibodies effectively immunoprecipitated YY1 and CBP, AEG-1 and CBP, and AEG-1 and

YY1, respectively. To clarify if these associations occur on the EAAT2 promoter, PHFA cells were

infected with Ad.vec or Ad.AEG-1, and ChIP assays were performed using either control IgG or anti-

HA, anti-YY1, or anti-CBP antibodies. While only CBP associated with the EAAT2 promoter in

Ad.vec-infected PHFA cells, all three proteins AEG-1, YY1 and CBP as a complex bound to the

EAAT2 promoter in Ad.AEG-1-infected PHFA cells (Fig. 4B). These results were further confirmed

in T98G glioma cells highly expressing AEG-1. AEG-1, YY1 and CBP in NCsh cells bound to the

EAAT2 promoter as a complex, but AEG-1 knockdown in these cells abolished AEG-1 as well as

YY1 association with the EAAT2 promoter (Fig. 4B). These data indicate that AEG-1 increases YY1

binding to the EAAT2 promoter, and suggest that AEG-1 might function as a bridge molecule

between YY1 and CBP and the basal transcription machinery, thus facilitating YY1 inhibition of

CBP function as a co-activator on the EAAT2 promoter.

Research. on January 24, 2021. © 2011 American Association for Cancercancerres.aacrjournals.org Downloaded from

Author manuscripts have been peer reviewed and accepted for publication but have not yet been edited. Author Manuscript Published OnlineFirst on August 18, 2011; DOI: 10.1158/0008-5472.CAN-11-0782

Page 13: Oncogene AEG-1 promotes glioma-induced …...Aug 17, 2011  · Sarkar); and the National Research Foundation Basic Science Research Program (2010-0008219) (to S.G. Lee) and Medical

13

To further clarify these interactions, we analyzed which domain of AEG-1 was responsible

for the interactions using AEG-1 deletion constructs. As shown in Fig. 4C, all C’ deletion mutants

associated with both YY1 and CBP as did wild type AEG-1. However, only the N1 construct among

the N’ deletion mutants interacted with YY1, and none of the N’ deletion constructs physically

interacted with CBP (Fig. 4C), suggesting that each region, amino acids 1-70 and 71-100 of AEG-1

is responsible for interaction with CBP and YY1, respectively. We next examined if these

interactions would be crucial for AEG-1-mediated EAAT2 repression. As shown in Fig. 4D, as

expected only wild type AEG-1 repressed the EAAT2 promoter activity while none of N’ deletion

constructs induced repression. Intriguingly, all of the C’ deletion mutants failed to modify EAAT2

promoter activity (Fig. 4D). A recent study suggested that the predominant nuclear localization

signal of AEG-1 is located at the end region of the C terminus (amino acids 546-582) (41), which is

missing in all of the C’ deletion mutants we analyzed. We also confirmed that AEG-1 and the N1

mutant were located in the nucleus, but the C1 mutant that did not contain the nuclear localization

signal was in the cytoplasm (Fig. 4E). Specificity of anti-HA antibody for immunostaining was

confirmed by competition with HA peptide (Supplementary Fig. 5). Taken together, these results

indicate that interactions among AEG-1, YY1 and CBP are crucial for AEG-1-mediated EAAT2

repression.

AEG-1 promotes glioma-induced neurodegeneration by blocking EAAT2 function. EAAT2 is

the predominant glial glutamate transporter in the brain and it functions to remove glutamate from

the synapse to prevent excitotoxicity. Dysregulation of EAAT2 causes glutamate excitotoxicity,

which is implicated in various types of neurodegenerative diseases and glioma-induced

neurodegeneration (10-14, 17-20, 37). In addition, we found a negative correlation between AEG-1

Research. on January 24, 2021. © 2011 American Association for Cancercancerres.aacrjournals.org Downloaded from

Author manuscripts have been peer reviewed and accepted for publication but have not yet been edited. Author Manuscript Published OnlineFirst on August 18, 2011; DOI: 10.1158/0008-5472.CAN-11-0782

Page 14: Oncogene AEG-1 promotes glioma-induced …...Aug 17, 2011  · Sarkar); and the National Research Foundation Basic Science Research Program (2010-0008219) (to S.G. Lee) and Medical

14

expression and both EAAT2 and NeuN expression in glioma patients (Fig. 1). For these reasons, we

hypothesized and investigated if AEG-1-mediated EAAT2 repression is essential for glioma-induced

neurodegeneration. We first measured glutamate uptake in PHFA cells infected with Ad.vec or

Ad.AEG-1 to determine the functional significance of AEG-1-mediated EAAT2 repression in

astrocytes. As shown in Fig. 5A, AEG-1 decreased glutamate uptake in PHFA cells, suggesting that

the AEG-1-mediated EAAT2 repression impairs glutamate uptake of astrocytes. In addition, AEG-1

knockdown in T98G cells increased the glutamate uptake in these cells (Fig. 5C). Expression of

AEG-1 and EAAT2 in each gain of function and loss of function study was confirmed by Western

blotting (Supplementary Fig. 6). These results indicate that AEG-1 causes glutamate excitotoxicity.

To examine if decreased uptake of glutamate causes neuronal cell death, we cultured PC-12-

differentiated rat neuronal cells in conditioned media prepared from Ad.vec- or Ad.AEG-1-infected

PHFA cells treated with glutamate. The conditioned media from Ad.vec-infected PHFA cells

containing intact glial glutamate transporters did not cause neuronal cell death. In contrast, the

conditioned media from Ad.AEG-1-infected cells induced severe neuronal cell death (Fig. 5B).

Furthermore, AEG-1 knockdown in glioma cells inhibited glutamate-induced neuronal cell death

(Fig. 5D). However, these conditioned media from glioma cells and AEG-1-overexpressing PHFA

cells had no cytotoxic effect on PHFA cells (Supplementary Fig. 7), indicating that this glutamate

excitotoxicity causes cell death of neurons, but not astrocytes. Considered with results obtained with

patient samples shown in Fig. 1, these observations indicate that AEG-1 represses EAAT2

expression and glutamate uptake, thereby causing neuronal cell death in glioma patients. These

provocative findings highlight a novel mechanism by which gliomas induce neurodegeneration as

summarized in Fig. 6.

Research. on January 24, 2021. © 2011 American Association for Cancercancerres.aacrjournals.org Downloaded from

Author manuscripts have been peer reviewed and accepted for publication but have not yet been edited. Author Manuscript Published OnlineFirst on August 18, 2011; DOI: 10.1158/0008-5472.CAN-11-0782

Page 15: Oncogene AEG-1 promotes glioma-induced …...Aug 17, 2011  · Sarkar); and the National Research Foundation Basic Science Research Program (2010-0008219) (to S.G. Lee) and Medical

15

Discussion

Brain tumors induce pathogenic changes by rapidly proliferating and invading surrounding normal

tissues and by promoting neuronal cell death through glutamate excitotoxicity (10). Consequently, a

primary therapeutic focus to limit brain tumor-induced damage is by inhibiting cancer cell

proliferation and invasion, and potentially altering defects in glutamate homeostasis. To achieve

these objectives requires an enhanced understanding of the genetic and epigenetic changes that

promote development, progression and pathogenesis of brain cancers. Previous studies have

documented that AEG-1 plays crucial roles in malignant glioma progression and its expression level

significantly correlates with clinicopathologic stages of glioma (28, 31). In the present study, we

report that AEG-1 expression also significantly correlates with reduction of EAAT2 expression and

neuronal cells in glioma patient samples. In addition, AEG-1 overexpression in glioma impairs

glutamate uptake by reducing EAAT2 expression, a primary glutamate transporter, culminating in

glioma-induced neurodegeneration. These newer data combined with previous studies suggest that

AEG-1 is involved in the majority of features of glioma progression, i.e., rapid tumor growth,

destructive invasion of surrounding normal brain tissue and glioma-induced neurodegeneration.

Accordingly, we hypothesize that AEG-1 could be a primary regulator of glioma progression and

thus could be a potential therapeutic target for this fatal disease. Developing pharmacological agents

and/or small molecule drugs that target AEG-1 for extinction would be predicted to delimit the

pathogenesis and toxicity of glioma. Additionally, restoring glutamate transporter function in glioma

might also provide a means of reducing neuronal damage in patients with malignant glioma,

particularly when combined with inhibition of AEG-1.

Research. on January 24, 2021. © 2011 American Association for Cancercancerres.aacrjournals.org Downloaded from

Author manuscripts have been peer reviewed and accepted for publication but have not yet been edited. Author Manuscript Published OnlineFirst on August 18, 2011; DOI: 10.1158/0008-5472.CAN-11-0782

Page 16: Oncogene AEG-1 promotes glioma-induced …...Aug 17, 2011  · Sarkar); and the National Research Foundation Basic Science Research Program (2010-0008219) (to S.G. Lee) and Medical

16

Gliomas release glutamate at levels that are neurotoxic (10, 11, 17, 20). Clearance of

extracellular glutamate is markedly impaired in glioma cells compared with that in normal astrocytes

mainly due to a loss of the predominant astroglial glutamate transporter EAAT2 (10, 16). This

glutamate release also promotes growth of malignant gliomas (20). We previously reported that

TNF-α induces AEG-1 expression, and AEG-1 functions as a coactivator for NF-κB by its direct

interaction with p65 (22, 25, 33). However, TNF-α reduces EAAT2 expression in an NF-κB-

dependent manner (35, 42). These results suggest that NF-κB might be a signaling pathway in AEG-

1-mediated EAAT2 repression. However, we now demonstrate that AEG-1 employs YY1 to repress

EAAT2 expression. TNF-α-mediated NF-κB repression is not a general phenomenon in all contexts,

since it can also function as a positive regulator of NF-κB expression, and this process is poorly

understood. We previously observed that TNF-α preferentially recruits N-myc to the EAAT2

promoter resulting in a repression of NF-κB-mediated EAAT2 promoter activation, suggesting a

mechanism by which TNF-α overcomes intrinsic NF-κB-mediated activation through a pathway not

involving the direct inhibition of NF-κB (42). Instead, we now show that AEG-1 recruits YY1 to the

EAAT2 promoter resulting in reduction of EAAT2 expression. A previous report showed that AEG-1

acts as a bridge molecule facilitating interaction among NF-κB, CBP and the basal transcriptional

machinery, and therefore functions as a coactivator, resulting in induction of NF-κB-dependent

genes (25). In the present study, we document that AEG-1 plays a critical role as a link between YY1

and CBP on the EAAT2 promoter, causing YY1 to function as a negative regulator of EAAT2

expression by inhibiting CBP. These results indicate that interactions among AEG-1, YY1 and CBP

are crucial for AEG-1-mediated EAAT2 repression, and also suggest that AEG-1 functions in the

nucleus as a bona fide transcriptional cofactor.

Research. on January 24, 2021. © 2011 American Association for Cancercancerres.aacrjournals.org Downloaded from

Author manuscripts have been peer reviewed and accepted for publication but have not yet been edited. Author Manuscript Published OnlineFirst on August 18, 2011; DOI: 10.1158/0008-5472.CAN-11-0782

Page 17: Oncogene AEG-1 promotes glioma-induced …...Aug 17, 2011  · Sarkar); and the National Research Foundation Basic Science Research Program (2010-0008219) (to S.G. Lee) and Medical

17

Excitotoxicity caused by impaired glutamate uptake by glial cells has been implicated in

various neurodegenerative conditions such as ischemia, stroke, epilepsy, amyotrophic lateral

sclerosis and HIV-associated dementia (41), and also in psychiatric disorders like depression and

schizophrenia, as well as in certain forms of pain (12, 14-16). Although most studies of AEG-1 have

focused on its functions in tumor progression, AEG-1 was originally isolated as a HIV-1-inducible

gene (22, 33), suggesting its possible role in HIV-associated dementia. A recent genome-wide

association study implicated AEG-1 in migraine (43). In addition, here we document that AEG-1

reduces expression of EAAT2 in astrocytes, causing neuronal cell death, suggesting that AEG-1

might also play crucial roles in neurodegenerative diseases, not only in glioma-induced

neurodegeneration. We have also observed that AEG-1 expression is negatively correlated with

EAAT2 expression and neuronal cell survival in a transient focal ischemia animal model

(unpublished data), suggesting its role in ischemia related with EAAT2 and glutamate excitotoxicity.

In this context, our present studies are focused on developing a conditional transgenic animal model

to express AEG-1 specifically in astrocytes using the GFAP and nestin promoters, which would be

beneficial in more precisely defining AEG-1 functions in astrocytes for examining in vivo brain

tumor development/progression as well as for neurodegeneration/glioma-induced neurodegeneration.

Considering the assortment of effects of AEG-1 in the context of brain tumors, such as GBM, this

gene provides a viable target not only for delimiting the direct pathogenesis of brain tumors, but also

for reducing the indirect toxicity to neurons promoted by defects in glutamate transport observed in

GBM. Further studies are warranted and are currently in progress to test these possibilities and to

develop improved therapies for GBM and methods for ameliorating its pathogenesis.

Acknowledgments

Research. on January 24, 2021. © 2011 American Association for Cancercancerres.aacrjournals.org Downloaded from

Author manuscripts have been peer reviewed and accepted for publication but have not yet been edited. Author Manuscript Published OnlineFirst on August 18, 2011; DOI: 10.1158/0008-5472.CAN-11-0782

Page 18: Oncogene AEG-1 promotes glioma-induced …...Aug 17, 2011  · Sarkar); and the National Research Foundation Basic Science Research Program (2010-0008219) (to S.G. Lee) and Medical

18

We thank Professor David J. Volsky (Molecular Virology Division, St. Luke’s-Roosevelt

Hospital Center, Columbia University, New York) for providing primary human fetal astrocytes. D.

Sarkar is the Harrison Endowed Scholar in the VCU Massey Cancer Center. P.B. Fisher holds the

Thelma Newmeyer Corman Endowed Chair in Cancer Research at the VCU Massey Cancer Center

and is a SWCRF Investigator.

Research. on January 24, 2021. © 2011 American Association for Cancercancerres.aacrjournals.org Downloaded from

Author manuscripts have been peer reviewed and accepted for publication but have not yet been edited. Author Manuscript Published OnlineFirst on August 18, 2011; DOI: 10.1158/0008-5472.CAN-11-0782

Page 19: Oncogene AEG-1 promotes glioma-induced …...Aug 17, 2011  · Sarkar); and the National Research Foundation Basic Science Research Program (2010-0008219) (to S.G. Lee) and Medical

19

References

1. Jemal A, Siegel R, Xu J, Ward E. Cancer statistics, 2010. CA Cancer J Clin. 2010;60:277-300. 2. DeAngelis LM. Brain tumors. N Engl J Med. 2001;344:114-23. 3. Nakada M, Nakada S, Demuth T, Tran NL, Hoelzinger DB, Berens ME. Molecular targets of glioma invasion. Cell Mol Life Sci. 2007;64:458-78. 4. Kleihues P, Louis DN, Scheithauer BW, Rorke LB, Reifenberger G, Burger PC, et al. The WHO classification of tumors of the nervous system. J Neuropathol Exp Neurol. 2002;61:215-25; discussion 26-9. 5. Rao JS. Molecular mechanisms of glioma invasiveness: the role of proteases. Nat Rev Cancer. 2003;3:489-501. 6. Brandes AA, Turazzi S, Basso U, Pasetto LM, Guglielmi B, Volpin L, et al. A multidrug combination designed for reversing resistance to BCNU in glioblastoma multiforme. Neurology. 2002;58:1759-64. 7. Hofer S, Herrmann R. Chemotherapy for malignant brain tumors of astrocytic and oligodendroglial lineage. J Cancer Res Clin Oncol. 2001;127:91-5. 8. Kappelle AC, Postma TJ, Taphoorn MJ, Groeneveld GJ, van den Bent MJ, van Groeningen CJ, et al. PCV chemotherapy for recurrent glioblastoma multiforme. Neurology. 2001;56:118-20. 9. Maher EA, Furnari FB, Bachoo RM, Rowitch DH, Louis DN, Cavenee WK, et al. Malignant glioma: genetics and biology of a grave matter. Genes Dev. 2001;15:1311-33. 10. Rothstein JD. Paving new pathways. Nat Med. 2002;8:938-40. 11. Sontheimer H. A role for glutamate in growth and invasion of primary brain tumors. J Neurochem. 2008;105:287-95. 12. Anderson CM, Swanson RA. Astrocyte glutamate transport: review of properties, regulation, and physiological functions. Glia. 2000;32:1-14. 13. Headley PM, Grillner S. Excitatory amino acids and synaptic transmission: the evidence for a physiological function. Trends Pharmacol Sci. 1990;11:205-11. 14. Bunch L, Erichsen MN, Jensen AA. Excitatory amino acid transporters as potential drug targets. Expert Opin Ther Targets. 2009;13:719-31. 15. Kim K, Lee SG, Kegelman TP, Su ZZ, Das SK, Dash R, et al. Role of excitatory amino acid transporter-2 (EAAT2) and glutamate in neurodegeneration: Opportunities for developing novel therapeutics. J Cell Physiol. 2011; in press. 16. Rothstein JD, Patel S, Regan MR, Haenggeli C, Huang YH, Bergles DE, et al. Beta-lactam antibiotics offer neuroprotection by increasing glutamate transporter expression. Nature. 2005;433:73-7. 17. Ye ZC, Sontheimer H. Glioma cells release excitotoxic concentrations of glutamate. Cancer Res. 1999;59:4383-91. 18. Ye ZC, Rothstein JD, Sontheimer H. Compromised glutamate transport in human glioma cells: reduction-mislocalization of sodium-dependent glutamate transporters and enhanced activity of cystine-glutamate exchange. J Neurosci. 1999;19:10767-77. 19. Marcus HJ, Carpenter KL, Price SJ, Hutchinson PJ. In vivo assessment of high-grade glioma biochemistry using microdialysis: a study of energy-related molecules, growth factors and cytokines. J Neurooncol. 2010;97:11-23.

Research. on January 24, 2021. © 2011 American Association for Cancercancerres.aacrjournals.org Downloaded from

Author manuscripts have been peer reviewed and accepted for publication but have not yet been edited. Author Manuscript Published OnlineFirst on August 18, 2011; DOI: 10.1158/0008-5472.CAN-11-0782

Page 20: Oncogene AEG-1 promotes glioma-induced …...Aug 17, 2011  · Sarkar); and the National Research Foundation Basic Science Research Program (2010-0008219) (to S.G. Lee) and Medical

20

20. Takano T, Lin JH, Arcuino G, Gao Q, Yang J, Nedergaard M. Glutamate release promotes growth of malignant gliomas. Nat Med. 2001;7:1010-5. 21. Sarkar D, Emdad L, Lee SG, Yoo BK, Su ZZ, Fisher PB. Astrocyte elevated gene-1: far more than just a gene regulated in astrocytes. Cancer Res. 2009;69:8529-35. 22. Su ZZ, Kang DC, Chen Y, Pekarskaya O, Chao W, Volsky DJ, et al. Identification and cloning of human astrocyte genes displaying elevated expression after infection with HIV-1 or exposure to HIV-1 envelope glycoprotein by rapid subtraction hybridization, RaSH. Oncogene. 2002;21:3592-602. 23. Lee SG, Su ZZ, Emdad L, Sarkar D, Fisher PB. Astrocyte elevated gene-1 (AEG-1) is a target gene of oncogenic Ha-ras requiring phosphatidylinositol 3-kinase and c-Myc. Proc Natl Acad Sci U S A. 2006;103:17390-5. 24. Lee SG, Su ZZ, Emdad L, Sarkar D, Franke TF, Fisher PB. Astrocyte elevated gene-1 activates cell survival pathways through PI3K-Akt signaling. Oncogene. 2008;27:1114-21. 25. Sarkar D, Park ES, Emdad L, Lee SG, Su ZZ, Fisher PB. Molecular basis of nuclear factor-kappaB activation by astrocyte elevated gene-1. Cancer Res. 2008;68:1478-84. 26. Emdad L, Lee SG, Su ZZ, Jeon HY, Boukerche H, Sarkar D, et al. Astrocyte elevated gene-1 (AEG-1) functions as an oncogene and regulates angiogenesis. Proc Natl Acad Sci U S A. 2009;106:21300-5. 27. Yoo BK, Chen D, Su ZZ, Gredler R, Yoo J, Shah K, et al. Molecular mechanism of chemoresistance by astrocyte elevated gene-1. Cancer Res. 2010;70:3249-58. 28. Emdad L, Sarkar D, Lee SG, Su ZZ, Yoo BK, Dash R, et al. Astrocyte elevated gene-1: a novel target for human glioma therapy. Mol Cancer Ther. 2010;9:79-88. 29. Yoo BK, Emdad L, Su ZZ, Villanueva A, Chiang DY, Mukhopadhyay ND, et al. Astrocyte elevated gene-1 regulates hepatocellular carcinoma development and progression. J Clin Invest. 2009;119:465-77. 30. Lee SG, Jeon HY, Su ZZ, Richards JE, Vozhilla N, Sarkar D, et al. Astrocyte elevated gene-1 contributes to the pathogenesis of neuroblastoma. Oncogene. 2009;28:2476-84. 31. Liu L, Wu J, Ying Z, Chen B, Han A, Liang Y, et al. Astrocyte elevated gene-1 upregulates matrix metalloproteinase-9 and induces human glioma invasion. Cancer Res. 2010;70:3750-9. 32. Xia Z, Zhang N, Jin H, Yu Z, Xu G, Huang Z. Clinical significance of astrocyte elevated gene-1 expression in human oligodendrogliomas. Clin Neurol Neurosurg. 2010;112:413-9. 33. Su ZZ, Chen Y, Kang DC, Chao W, Simm M, Volsky DJ, et al. Customized rapid subtraction hybridization (RaSH) gene microarrays identify overlapping expression changes in human fetal astrocytes resulting from human immunodeficiency virus-1 infection or tumor necrosis factor-alpha treatment. Gene. 2003;306:67-78. 34. Kang DC, Su ZZ, Sarkar D, Emdad L, Volsky DJ, Fisher PB. Cloning and characterization of HIV-1-inducible astrocyte elevated gene-1, AEG-1. Gene. 2005;353:8-15. 35. Su ZZ, Leszczyniecka M, Kang DC, Sarkar D, Chao W, Volsky DJ, et al. Insights into glutamate transport regulation in human astrocytes: cloning of the promoter for excitatory amino acid transporter 2 (EAAT2). Proc Natl Acad Sci U S A. 2003;100:1955-60. 36. Wang Z, Trillo-Pazos G, Kim SY, Canki M, Morgello S, Sharer LR, et al. Effects of human immunodeficiency virus type 1 on astrocyte gene expression and function: potential role in neuropathogenesis. J Neurovirol. 2004;10 Suppl 1:25-32. 37. de Groot JF, Liu TJ, Fuller G, Yung WK. The excitatory amino acid transporter-2 induces apoptosis and decreases glioma growth in vitro and in vivo. Cancer Res. 2005;65:1934-40.

Research. on January 24, 2021. © 2011 American Association for Cancercancerres.aacrjournals.org Downloaded from

Author manuscripts have been peer reviewed and accepted for publication but have not yet been edited. Author Manuscript Published OnlineFirst on August 18, 2011; DOI: 10.1158/0008-5472.CAN-11-0782

Page 21: Oncogene AEG-1 promotes glioma-induced …...Aug 17, 2011  · Sarkar); and the National Research Foundation Basic Science Research Program (2010-0008219) (to S.G. Lee) and Medical

21

38. Lee SG, Su ZZ, Emdad L, Gupta P, Sarkar D, Borjabad A, et al. Mechanism of ceftriaxone induction of excitatory amino acid transporter-2 expression and glutamate uptake in primary human astrocytes. J Biol Chem. 2008;283:13116-23. 39. Wang CC, Chen JJ, Yang PC. Multifunctional transcription factor YY1: a therapeutic target in human cancer? Expert Opin Ther Targets. 2006;10:253-66. 40. Vallabhapurapu S, Karin M. Regulation and function of NF-kappaB transcription factors in the immune system. Annu Rev Immunol. 2009;27:693-733. 41. Thirkettle HJ, Girling J, Warren AY, Mills IG, Sahadevan K, Leung H, et al. LYRIC/AEG-1 is targeted to different subcellular compartments by ubiquitinylation and intrinsic nuclear localization signals. Clin Cancer Res. 2009;15:3003-13. 42. Sitcheran R, Gupta P, Fisher PB, Baldwin AS. Positive and negative regulation of EAAT2 by NF-kappaB: a role for N-myc in TNFalpha-controlled repression. EMBO J. 2005;24:510-20. 43. Anttila V, Stefansson H, Kallela M, Todt U, Terwindt GM, Calafato MS, et al. Genome-wide association study of migraine implicates a common susceptibility variant on 8q22.1. Nat Genet. 2010;42:869-73.

Research. on January 24, 2021. © 2011 American Association for Cancercancerres.aacrjournals.org Downloaded from

Author manuscripts have been peer reviewed and accepted for publication but have not yet been edited. Author Manuscript Published OnlineFirst on August 18, 2011; DOI: 10.1158/0008-5472.CAN-11-0782

Page 22: Oncogene AEG-1 promotes glioma-induced …...Aug 17, 2011  · Sarkar); and the National Research Foundation Basic Science Research Program (2010-0008219) (to S.G. Lee) and Medical

22

Figure legends

Figure 1. Correlation among expression of AEG-1, EAAT2 and NeuN in glioma patient samples. A,

Comparison of AEG-1 and EAAT2 expression in glioma patient samples compared to NC. B,

Correlation between AEG-1 and EAAT2 expression. C, Expression of AEG-1, EAAT2 and NeuN.

Scale bar: 100 μm. D, Expression of AEG-1, EAAT1 and EAAT2 in 3 NB and 6 GBM patient

samples. E, Quantification and comparison of NeuN expression in glioma patient samples compared

to NC. F and G, Correlation between NeuN and AEG-1 (F) or EAAT2 (G) expression analyzed using

a scatter plot. Data in graphs present mean ± S.D. *, P < 0.01 vs NC. NC, normal cerebrum tissues;

NB normal brain tissues; GBM, glioblastoma multiforme.

Figure 2. AEG-1 represses EAAT2 expression. A, AEG-1 and EAAT2 expression in various cell

lines. B, PHFA cells were infected with 20 moi of Ad.vec or Ad.AEG-1 and Western blot was

performed with the indicated antibodies, and EF1α served as an internal control (left). Using total

RNAs from the infected cells Northern blotting assays were conducted, and the levels of GAPDH

mRNA served as a control (center). Nuclear Run-on assays with nuclei from infected cells were

performed, and the transcription rate of GAPDH was used as a control (right). C, Real time-PCR

analysis of AEG-1 and EAAT2 mRNA expression in NCsh (normal control sh), AEG-1sh-2 or AEG-

1sh-4 cells (left). *, P < 0.01 vs NCsh. Cell lysates from NCsh, AEG-1sh-2 and AEG-1sh-4 were

immunoblotted with the indicated antibodies (right). D, Ad.vec- or Ad.AEG-1-infected PHFA cells

were transfected with EAAT2Pro-Luc. Transient transfection and luciferase assays were performed

at least three times in triplicate. Data: fold-normalized activity relative to that of Ad-vec-infected

PHFA taken as 1. *, P < 0.01 vs Ad.vec.

Research. on January 24, 2021. © 2011 American Association for Cancercancerres.aacrjournals.org Downloaded from

Author manuscripts have been peer reviewed and accepted for publication but have not yet been edited. Author Manuscript Published OnlineFirst on August 18, 2011; DOI: 10.1158/0008-5472.CAN-11-0782

Page 23: Oncogene AEG-1 promotes glioma-induced …...Aug 17, 2011  · Sarkar); and the National Research Foundation Basic Science Research Program (2010-0008219) (to S.G. Lee) and Medical

23

Figure 3. YY1 is responsible for AEG-1-mediated EAAT2 repression. A, Ad.vec- or Ad.AEG-1-

infected PHFA cells were transfected with each deletion EAAT2 promoter-reporter construct. Data:

fold-normalized activity relative to that of the -954 EAAT2Pro-Luc in Ad-vec-infected PHFA taken

as 1. B, The infected PHFA cells were transfected with EAAT2Pro-954, mNFκB1 or mYY1. Data:

fold-normalized activity relative to that of the -954 EAAT2Pro-Luc in Ad-vec-infected PHFA taken

as 1. C, Nuclear extracts from the infected PHFA cells were mixed with the probe containing the

YY1 site of EAAT2 promoter in the following order: 1, no extracts; 2, Ad.vec; 3, Ad.AEG-1; 4,

Ad.AEG-1 + cold wild probe (100×); 5, Ad.AEG-1 + unlabeled mutant probe containing mutated

YY1 site (100×); 6, Ad.AEG-1 + anti-YY-1 antibody; 7, Ad.AEG-1 + control IgG. D, The infected

cells were cotransfected with EAAT2-Luc and control or YY1 siRNA. Data: fold normalized activity

relative to that of Ad-vec-infected and control siRNA-transected PHFA taken as 1. E, The infected

and transfected PHFA cell lysates were immunoblotted with the indicated antibodies. All transient

transfection and luciferase assays were performed at least three times in triplicate. Data in graphs

present mean ± SEM. *, P < 0.01 vs Ad.vec.

Figure 4. AEG-1 interacts with CBP and YY-1 on the EAAT2 promoter. A, The Ad.vec (V)- or

Ad.AEG-1 (A)-infected PHFA cell lysates were used for immunoprecipitation analysis using anti-

HA, anti-YY1 or anti-CBP antibody and the same antibodies for immunoblotting. B, The nuclear

pellet containing chromatin isolated from the infected PHFA cells, NCsh and AEG-1sh-2 cells were

immunoprecipitated with control IgG, anti-AEG-1, anti-YY1 or anti-CBP antibody, and then the

eluted DNAs were subjected to PCR. C, PHFA cells were transfected with control vector (pcDNA),

full length AEG-1 or each AEG-1 deletion expression construct as indicated. The cell lysates were

Research. on January 24, 2021. © 2011 American Association for Cancercancerres.aacrjournals.org Downloaded from

Author manuscripts have been peer reviewed and accepted for publication but have not yet been edited. Author Manuscript Published OnlineFirst on August 18, 2011; DOI: 10.1158/0008-5472.CAN-11-0782

Page 24: Oncogene AEG-1 promotes glioma-induced …...Aug 17, 2011  · Sarkar); and the National Research Foundation Basic Science Research Program (2010-0008219) (to S.G. Lee) and Medical

24

immunoprecipitated and immunoblotted as indicated. D, PHFA cells were cotransfected with

EAAT2-Luc and each AEG-1 deletion mutant. Data (mean ± SEM): fold-normalized activity relative

to that of PHFA cells transfected with pcDNA (denoted as -) taken as 1. *, P < 0.01 vs pcDNA. E,

PHFA cells were transfected as indicated. The AEG-1 (HA) and DAPI staining were evaluated by

confocal microscopy. Scale bar: 20 μm. V: Ad.vec; A: Ad.AEG-1.

Figure 5. AEG-1 induces neuronal cell death via inhibiting glutamate uptake in glial cells. A,

Glutamate uptake levels (pmol/mg protein/min) were measured in Ad.vec- or Ad.AEG-1-infected

PHFA cells. *, P < 0.01 vs Ad.vec. B, The differentiated PC-12 rat neuron cells were treated with

conditioned media prepared from Ad.vec- or Ad.AEG-1-infected PHFA cells following treatment

with 100 μM glutamate. One day later MTT assays were performed. C. Glutamate uptake levels

(pmol/mg protein/min) were measured in NCsh and AEG-1sh cells. *, P < 0.01 vs NCsh. D, The

differentiated PC-12 neuron cells were treated with conditioned media prepared from NCsh and

AEG-1sh cells following treatment with 100 μM glutamate. One day later MTT assays were

performed. *, P < 0.01 in MTT assays (B and D) vs Mock-treated cells.

Figure 6. Potential molecular mechanism by which EAAT2 reduction mediated by AEG-1 promotes

neurodegeneration in human glioma. A, In normal astrocytes, EAAT2 functions as a primary

glutamate transporter. B, In glioma cells, increased AEG-1 negatively regulates EAAT2 expression

and induces glutamate excitotoxicity and neuronal cell death.

Research. on January 24, 2021. © 2011 American Association for Cancercancerres.aacrjournals.org Downloaded from

Author manuscripts have been peer reviewed and accepted for publication but have not yet been edited. Author Manuscript Published OnlineFirst on August 18, 2011; DOI: 10.1158/0008-5472.CAN-11-0782

Page 25: Oncogene AEG-1 promotes glioma-induced …...Aug 17, 2011  · Sarkar); and the National Research Foundation Basic Science Research Program (2010-0008219) (to S.G. Lee) and Medical

Research. on January 24, 2021. © 2011 American Association for Cancercancerres.aacrjournals.org Downloaded from

Author manuscripts have been peer reviewed and accepted for publication but have not yet been edited. Author Manuscript Published OnlineFirst on August 18, 2011; DOI: 10.1158/0008-5472.CAN-11-0782

Page 26: Oncogene AEG-1 promotes glioma-induced …...Aug 17, 2011  · Sarkar); and the National Research Foundation Basic Science Research Program (2010-0008219) (to S.G. Lee) and Medical

Research. on January 24, 2021. © 2011 American Association for Cancercancerres.aacrjournals.org Downloaded from

Author manuscripts have been peer reviewed and accepted for publication but have not yet been edited. Author Manuscript Published OnlineFirst on August 18, 2011; DOI: 10.1158/0008-5472.CAN-11-0782

Page 27: Oncogene AEG-1 promotes glioma-induced …...Aug 17, 2011  · Sarkar); and the National Research Foundation Basic Science Research Program (2010-0008219) (to S.G. Lee) and Medical

Research. on January 24, 2021. © 2011 American Association for Cancercancerres.aacrjournals.org Downloaded from

Author manuscripts have been peer reviewed and accepted for publication but have not yet been edited. Author Manuscript Published OnlineFirst on August 18, 2011; DOI: 10.1158/0008-5472.CAN-11-0782

Page 28: Oncogene AEG-1 promotes glioma-induced …...Aug 17, 2011  · Sarkar); and the National Research Foundation Basic Science Research Program (2010-0008219) (to S.G. Lee) and Medical

Research. on January 24, 2021. © 2011 American Association for Cancercancerres.aacrjournals.org Downloaded from

Author manuscripts have been peer reviewed and accepted for publication but have not yet been edited. Author Manuscript Published OnlineFirst on August 18, 2011; DOI: 10.1158/0008-5472.CAN-11-0782

Page 29: Oncogene AEG-1 promotes glioma-induced …...Aug 17, 2011  · Sarkar); and the National Research Foundation Basic Science Research Program (2010-0008219) (to S.G. Lee) and Medical

Research. on January 24, 2021. © 2011 American Association for Cancercancerres.aacrjournals.org Downloaded from

Author manuscripts have been peer reviewed and accepted for publication but have not yet been edited. Author Manuscript Published OnlineFirst on August 18, 2011; DOI: 10.1158/0008-5472.CAN-11-0782

Page 30: Oncogene AEG-1 promotes glioma-induced …...Aug 17, 2011  · Sarkar); and the National Research Foundation Basic Science Research Program (2010-0008219) (to S.G. Lee) and Medical

neuronneuronA B

Neurotoxicity

GlutamateGlutamate

EAAT2AEG-1

EAAT2

EAAT2 Promoter

EAAT2 Promoter

Research.

on January 24, 2021. © 2011 A

merican A

ssociation for Cancer

cancerres.aacrjournals.org D

ownloaded from

Author m

anuscripts have been peer reviewed and accepted for publication but have not yet been edited.

Author M

anuscript Published O

nlineFirst on A

ugust 18, 2011; DO

I: 10.1158/0008-5472.CA

N-11-0782

Page 31: Oncogene AEG-1 promotes glioma-induced …...Aug 17, 2011  · Sarkar); and the National Research Foundation Basic Science Research Program (2010-0008219) (to S.G. Lee) and Medical

Published OnlineFirst August 18, 2011.Cancer Res   Seok-Geun Lee, Keetae Kim, Timothy P. Kegelman, et al.   increasing glutamate excitotoxicityAEG-1 promotes glioma-induced neurodegeneration by

  Updated version

  10.1158/0008-5472.CAN-11-0782doi:

Access the most recent version of this article at:

  Material

Supplementary

  http://cancerres.aacrjournals.org/content/suppl/2011/08/18/0008-5472.CAN-11-0782.DC1

Access the most recent supplemental material at:

  Manuscript

Authoredited. Author manuscripts have been peer reviewed and accepted for publication but have not yet been

   

   

   

  E-mail alerts related to this article or journal.Sign up to receive free email-alerts

  Subscriptions

Reprints and

  [email protected] at

To order reprints of this article or to subscribe to the journal, contact the AACR Publications

  Permissions

  Rightslink site. Click on "Request Permissions" which will take you to the Copyright Clearance Center's (CCC)

.http://cancerres.aacrjournals.org/content/early/2011/08/17/0008-5472.CAN-11-0782To request permission to re-use all or part of this article, use this link

Research. on January 24, 2021. © 2011 American Association for Cancercancerres.aacrjournals.org Downloaded from

Author manuscripts have been peer reviewed and accepted for publication but have not yet been edited. Author Manuscript Published OnlineFirst on August 18, 2011; DOI: 10.1158/0008-5472.CAN-11-0782


Recommended