ORGANIZATION OF METHYLATED CHROMATIN IN THE KSHV LANA PROMOTER BY THE CTCF INSULATOR
By
MAYANK TALWAR
A DISSERTATION PRESENTED TO THE GRADUATE SCHOOL OF THE UNIVERSITY OF FLORIDA IN PARTIAL FULFILLMENT
OF THE REQUIREMENTS FOR THE DEGREE OF DOCTOR OF PHILOSOPHY
UNIVERSITY OF FLORIDA
2016
© 2016 Mayank Talwar
To my parents, sister, and brother-in-law for their unconditional love and support
4
ACKNOWLEDGMENTS
I am extremely thankful and grateful to my mentor Dr. Michael Kladde for giving
me and trusting me in such a challenging thesis project. Mike believed in my abilities
and taught me to think critically. I really admire his enthusiasm and work ethic. He is
always so passionate for science, research and developing new techniques with cutting-
edge technology. Mike has supported me throughout my five years in the lab and he
has always been understanding and generous towards me.
I am very grateful to all of my committee members: Dr. Michael Kilberg,
Dr. Thomas Yang, Dr. Steven Ghivizzani, and Dr. Rolf Renne, for all their comments,
suggestions and patience. I want to particularly thank Dr. Ghivizzani who was a co-
mentor early on in my graduate studies and showed so much confidence in my abilities
and always looked at the positive in every piece of data I showed him. I also want to
personally thank Dr. Renne for all of his support and feedback when I transitioned into
this project using KSHV as a model system. He understood that I was not a trained
virologist and he took the time to work with me one-one to teach me and give me proper
guidance and a different perspective.
There are no words to express how grateful I am to the members of the Kladde
lab. They have been an extended family to me for the last 5 years and we had so much
fun in the lab as well as outside the lab. I first want to thank Nancy Nabilsi who is the
‘superwoman’ of the Kladde lab. She is not just an amazing scientist that can juggle
multiple projects successfully but an amazing friend and person. She can solve any
problem and always has a positive attitude with a smile on her face. I next want to thank
Carolina Pardo, who first taught me MAPit and gave me help, guidance, and friendship
throughout my graduate studies. I also want to thank Russell Darst who helped me
5
tremendously early on with my project and was my biking and tennis buddy. Finally, I
want to thank Rosha Poudyal, who was a graduate student in lab. We succeeded and
struggled in the lab together but always made sure to have fun and celebrate all the
small successes. I would also thank members of Dr. Renne, Dr. Bungert and Dr. Lu labs
for all of their help and stimulating discussions. I would like to personally thank VJ, Mir,
Jared, Blanca and Tommy for all their help and friendship. I also want to thank all other
students that have come through the lab.
I finally would like to thank my family and friends back home in Pennsylvania. My
parents have given me so much love, encouragement and support. My sister and
brother-in-law have given me love and support as well. Without my family and friends, I
would not have had the ability to go so far in graduate school.
6
TABLE OF CONTENTS page
ACKNOWLEDGMENTS .................................................................................................. 4
LIST OF TABLES ............................................................................................................ 9
LIST OF FIGURES ........................................................................................................ 10
LIST OF ABBREVIATIONS ........................................................................................... 12
ABSTRACT ................................................................................................................... 16
CHAPTER
1 INTRODUCTION .................................................................................................... 18
Chromatin Structure ................................................................................................ 18
Nucleosomes and Nucleosome Positioning ............................................................ 18
Histone Tail Modifications ....................................................................................... 23
DNA Methylation ..................................................................................................... 25
CpG Islands ............................................................................................................ 26
Mechanism of DNA Methylation and DNA Methyltransferases ............................... 27
Gene Body (Intragenic) DNA Methylation ............................................................... 29
Propagation of DNA Methylation ............................................................................. 31
CTCF ...................................................................................................................... 33
CTCF and DNA Methylation ................................................................................... 35
The Gamma-herpesvirus KSHV ............................................................................. 37
Role of CTCF in Viruses ......................................................................................... 40
KSHV Epigenetics .................................................................................................. 41
2 ESTABLISHMENT OF DE NOVO METHYLATION IN THE LANA TRANSCRIBED REGION OF KSHV GENOME IN MULTIPLE KSHV-INFECTED CELL LINES ......................................................................................... 51
Introductory Remarks.............................................................................................. 51
Materials and Methods ............................................................................................ 54
Cell Lines and Culturing ................................................................................... 54
Production of Wild-type KSHV and De Novo Infection of Cells ........................ 55
DNA Methylation Analysis by Pyrosequencing ................................................. 56
Results .................................................................................................................... 58
A Pyrosequencing Amplicon to Target +1 Linker Downstream of Three Tandem CTCF Sites at LANA Promoter........................................................ 58
DNA Methylation Gradually Increases and at a Faster Rate within the KSHV LANA +1/+2 Nucleosome Linker in HEK293T than in SLK or TIVE Cells after KSHV Infection ...................................................................................... 59
Closing Remarks .................................................................................................... 60
7
3 GENERATING AND CHARACTERIZING MUTANT KSHV CONTAINING DISTRUPTIONS IN THE CTCF BINDING SITES AT THE LANA PROMOTER USING BACMID RECOMBINATION ...................................................................... 67
Introductory Remarks.............................................................................................. 67
Materials and Methods ............................................................................................ 71
Two-step Red-mediated Recombination Overview .......................................... 71
Primer Design for Replacement and Deletion of CTCF Binding Sites .............. 72
Generation of Targeting Fragment for First Red Recombination ...................... 73
Generating Electrocompetent GS1783 E. coli .................................................. 73
First Red Recombination .................................................................................. 74
Screening of First Red Recombinants .............................................................. 74
Second Red Recombination ............................................................................. 75
Assessment of Intact TRs ................................................................................. 75
Verification of Deletion or Insertion at the CTCF Binding Sites at LANA Promoter ....................................................................................................... 76
Cell Lines and Culturing ................................................................................... 76
Isolation of Wild-type (BAC16), CTCF Binding Site Deletion and Replacement KSHV Recombinant BAC for Transfection .............................. 77
Transient Transfection of HEK293T Cells ........................................................ 77
Isolation and Quantification of Recombinant Virus ........................................... 77
De Novo Infection of iSLK Cells ....................................................................... 78
Induction of Virus Using iSLK Cells .................................................................. 79
Chromatin Immunoprecipitation (ChIP) ............................................................ 79
RNA Isolation of KSHV-infected Cells for Gene Expression Analysis .............. 81
Western Blotting ............................................................................................... 81
Immunofluorescence ........................................................................................ 82
Results .................................................................................................................... 83
Closing Remarks .................................................................................................... 88
4 ABLATING CTCF BINDING AT THE LANA PROMOTER LEADS TO ENCROACHMENT OF DNA METHYLATION ON THE PROMOTER REGION ... 100
Introductory Remarks............................................................................................ 100
Histone H3K4 Methylation Inhibits DNA Methylation ...................................... 100
Gene Body Methylation and De Novo Methylation ......................................... 101
Spread of Histone Modifications at Insulators ................................................ 102
Material and Methods ........................................................................................... 104
MAPit Single-molecule Methylation Footprinting of KSHV-infected Cells ....... 104
Bisulfite Genomic Sequencing of Cells Infected with KSHV ........................... 105
454 Junior Amplicon Deep Sequencing and Analysis .................................... 107
Results .................................................................................................................. 108
Overview of 454 Amplicon Aligned Sequences .............................................. 108
Disrupting CTCF Binding at the LANA Promoter Leads to Disorganization of Nucleosomes and DNA Methylation in the Transcribed Region .................. 109
Loss of Insulator Occupancy by CTCF at the LANA Promoter Leads to Chromatin Accessibility of K14 Promoter .................................................... 110
8
Closing Remarks .................................................................................................. 112
Eliminating CTCF binding at the LANA promoter Leads to Disorganized Nucleosomes and DNA Methylation Spreading towards the Promoter ....... 113
Deletion of the CTCF Site Sequences at the LANA Promoter Leads to a Subpopulation of Molecules with Accessible vK14 Promoter ...................... 117
5 SUMMARY AND FUTURE DIRECTIONS ............................................................ 127
Identifying De Novo Methylation Enzymes and Substrates Responsible for DNA Methylation Accumulation on KSHV .................................................................. 129
The Effect of a Barrier Element at the LANA Promoter on the KSHV Transcriptome .................................................................................................... 131
Deconvoluting the Distribution and Spread of Chromatin Modifications................ 133
Potential Therapeutic Approach in Silencing LANA .............................................. 138
LIST OF REFERENCES ............................................................................................. 140
BIOGRAPHICAL SKETCH .......................................................................................... 161
9
LIST OF TABLES
Table page
2-1 Pyrosequencing primers for amplification and sequencing of the +1/+2 linker in the LANA transcribed region............................................................................... 63
3-1 BACmid recombination primer pair sequences ....................................................... 91
3-2 Gene expression qRT-PCR primer pair sequences ................................................ 91
3-3 ChIP q-PCR primer pair sequences ........................................................................ 92
4-1 MAPit analysis primer pair sequences .................................................................. 120
4-2 454 sequencing primer pair sequences for MAPit analysis ................................... 121
10
LIST OF FIGURES
Figure page
1-1 The role of epigenetics in modifying DNA and nucleosomes.. ................................ 45
1-2 DNA methylation at repetitive elements, promoters, and gene bodies in health and disease.. ...................................................................................................... 46
1-3 The insulator protein CTCF, its mode of action at the Igf2/H19 locus, and DNA binding motif.. ..................................................................................................... 47
1-4 Diagram of KSHV open reading frames, gene expression pattern, and KLAR.. ..... 48
1-5 Genome-wide histone modification and Pol II occupancy of KSHV in long-term latently infected BCBL-1 cells.. ........................................................................... 49
1-6 CTCF organizes arrays of well-positioned nucleosomes with DNA methylation restricted to linkers both genome-wide and at the KSHV latency-associated nuclear antigen (LANA) ORF.. ............................................................................ 50
2-1 Global DNA methylation patterns of latent KSHV genomes.. .................................. 64
2-2 Experimental overview to measure de novo methylation of KSHV post-infection in multiple cell lines using pyrosequencing.. ....................................................... 65
2-3 De novo methylation time course of KSHV LANA +1/+2 nucleosomal linker downstream of CTCF sites in three different KSHV-infected cell lines.. ............. 66
3-1 Bacterial artificial chromosome mutagenesis using two-step Red recombination.. ................................................................................................... 93
3-2 Stepwise construction of KSHV mutant BACs to eliminate CTCF binding at the LANA promoter.. ................................................................................................. 94
3-3 Pulse-field gel electrophoresis (PFGE) and sequencing of deletion and lexO replacement mutant clones................................................................................. 95
3-4 CTCF occupancy at LANA promoter in wild-type, deletion, and lexO replacement mutant used to infect either HEK293T or iSLK cells.. .................... 96
3-5 Quantification and verification of episomal persistence and LANA protein expression after eliminating CTCF binding at the LANA promoter.. ................... 97
3-6 Eliminating CTCF binding from the KSHV LANA promoter leads to significantly decreased amounts of extracellular virus particles after lytic reactivation of infected iSLK and HEK293T cells.. ..................................................................... 98
11
3-7 Gene expression analysis and histone modification occupancy in HEK293T cells infected with either wild-type or mutant KSHV.. .......................................... 99
4-1 Methyltransferase Accessibility Protocol for individual-templates (MAPit) overview for mapping endogenous DNA methylation and chromatin accessibility in mammalian nuclei.. ................................................................... 123
4-2 Distribution of aligned sequencing reads from 454 Junior sequencing.. ............... 124
4-3 CpG methylation and nucleosome positioning are disorganized when CTCF binding is eliminated from the LANA promoter.. ............................................... 125
4-4 Chromatin accessibility at the LANA promoter in wild-type and deletion CTCF binding sites mutant KSHV at 90 dpi.. .............................................................. 126
12
LIST OF ABBREVIATIONS
ADD
ADP
ATCC
ATP
BAC
BGS
CAGE
CGI
ATRX-DNMT3-DNMT3L domain
Adenosine Diphosphate
American Type Tissue Culture Collection
Adenosine Triphosphate
Bacterial Artificial Chromosome
Bisulfite Genomic Sequencing
Cap Analysis of Gene Expression
CpG Island
ChIP
CRISPR
Chromatin Immunoprecipitation
Clustered Regularly Interspaced Short Palindromic Repeats
CTCF
CTD
DMEM
DNA
DNMT
dNTP
DPI
DSIF
EBV
ERV
ESCs
FBS
GFP
HAT
CCCTC-binding Factor
Carboxy-terminal Domain
Dulbecco’s-modified Eagles Medium
Deoxyribonucleic Acid
DNA Methyltransferase
deoxyribonucleoside Triphosphate
Days Post Infection
DRB-sensitivity-inducing Factor
Epstein Barr Virus
Endogenous Retrovirus
Embryonic Stem Cells
Fetal Bovine Serum
Green Fluorescent Protein
Histone Acetyltransferase
13
HDAC
HEK293T
HMECs
HMT
HPI
ICR
KLAR
KSHV
LANA
LB
lexO
LTR
M.CviPI
MAPit
MBD
MBP
MCD
MeDIP
MID
miRNA
mRNA
MSRE
NCP
ncRNA
NELF
Histone Deacetylase
Human Embryonic Kidney 293T cells
Human Mammary Epithelial Cells
Histone Methyltransferase
Hour Post Infection
Imprinting Control Region
Kaposi's Latency-associated Region
Kaposi's Sarcoma-associated Herpesvirus
Latency-associated Nuclear Antigen
Luria Broth
Lex Operator sequence
Long Terminal Repeat
DNA Methyltransferase I from Chlorella Virus P
Methyltransferase Accessibility Protocol for individual templates
Methyl-CpG-binding Domain
Methyl-CpG-binding Protein
Multicentric Castleman’s Disease
Methylated DNA Immunoprecipitation
Multiplex Identifier
micro RNA
messenger RNA
Methylation-sensitive Restriction Enzyme
Nucleosome Core Particle
Non-coding RNA
Negative Elongation Factor
14
NOMe-seq
NFR
O.D.
ORF
PARP1
PBS
PcG
PCNA
PEL
PFEG
Pol II
P-TEFb
PWWP
qRT-PCR
RNA
RRBS
RTA
SAM
siRNA
TAE
TBE
TF
TIVE
TPA
TR
Nucleosome Occupancy and Methylome sequencing
Nucleosome-free Region
Optical Density
Open Reading Frame
Poly(ADP-ribose) Polymerase 1
Phosphate Buffered Saline
Polycomb Group proteins
Proliferating Cell Nuclear Antigen
Primary Effusion Lymphoma
Pulse-field Gel Electrophoresis
RNA Polymerase II
Positive Transcription Elongation Factor
Proline Tryptophan Tryptophan Proline domain
Quantitative Reverse Transcription Polymerase Chain Reaction
Ribonucleic Acid
Reduced Representation Bisulfite Sequencing
Replication and Transcription Activator
S-adenosyl-L-methionine
Small-interfering RNA
Tris-acetate-EDTA
Tris-borate-EDTA
Transcription Factor
Telomerase-immortalized human umbilical Vein Endothelial cells
Tetradecanoyl Phorbol Acetate
Terminal Repeat
15
tRNA
TSG
TSS
WT
transfer RNA
Tumor Suppressor Gene
Transcription Start Site
Wild Type
16
Abstract of Dissertation Presented to the Graduate School of the University of Florida in Partial Fulfillment of the Requirements for the Degree of Doctor of Philosophy
ORGANIZATION OF METHYLATED CHROMATIN IN THE KSHV LANA PROMOTER BY THE CTCF INSULATOR
By
Mayank Talwar
May 2016
Chair: Michael P. KladdeMajor: Medical Sciences – Biochemistry and Molecular Biology
DNA methylation is a repressive chromatin mark found across facultative and
constitutive heterochromatin as well as gene bodies. Once established by de novo DNA
methyltransferases (DNMTs 3A/B), this mark is maintained by DNMT1, which binds to
and preferentially methylates hemimethylated CG dinucleotides. Thus, establishment of
DNA methylation must be tightly regulated by DNMT3A/B. We have identified intense
CG methylation just downstream a cluster of three tandem CTCF binding sites in the
LANA ORF, a gene required to establish and maintain KSHV latency. Probing
chromatin with M.CviPI followed by bisulfite genomic sequencing (MAPit) profiles both
endogenous CG methylation and chromatin accessibility (GC methylation) along
individual molecules. We thereby determined that CG methylation was confined to
linkers between well-positioned nucleosomes in the viral LANA gene body. At chromatin
insulators, such as those with CTCF as a component, CG methylation was organized
and restricted to linker DNA and was not present at promoters in genome-wide
methylome analysis conducted by members of the Kladde laboratory and others. We
hypothesize that CTCF organizes arrays of optimally spaced nucleosomes to which de
novo DNMTs bind and preferentially methylate linker DNA. To test this hypothesis, I
17
used reverse genetic analysis of epigenetic regulation by mutagenesis via BACmid
recombineering to abolish CTCF binding at the LANA promoter. In Chapter 2, I showed
that DNA methylation gradually increases and at a faster rate within KSHV LANA +1/+2
nucleosomal linker after de novo KSHV infection in HEK293T than in iSLK or TIVE cells.
In Chapter 3, I used BACmid recombination to abolish CTCF binding to the LANA
promoter by deleting or replacing the CTCF binding sites with lexO sequences, which
resulted in decreased virus production and increased abundance of early lytic K14
transcript. In Chapter 4, I used MAPit over a de novo infection time course in HEK293T
cells to determine nucleosome positioning and endogenous DNA methylation at the
LANA promoter/ORF. Eliminating CTCF binding at the LANA promoter not only
disorganized nucleosome positioning, but endogenous DNA methylation from the gene
body encroached towards the LANA promoter and increased accessibility at the vK14
TSS. My findings show an essential role that CTCF binding at LANA has on chromatin
structure, lytic reactivation, and production of viral particles. These studies increase the
understanding of how chromatin structure governs de novo DNA methylation in KSHV
and may have relevance to how DNA methylation is established during development,
differentiation, and aberrant spread in cancer.
18
CHAPTER 1 INTRODUCTION
Chromatin Structure
Mammalian genomes are comprised of sequences of DNA that stretched out
would be about two meters in length if they were not tightly packed and organized as
chromatin. Chromatin is the full complement of proteins, approximately 50% histones
and 50% non-histone proteins, which interact with DNA in the cellular nucleus.
Traditionally, chromatin is divided into two microscopically distinguishable and
functionally different compartments, euchromatin and heterochromatin (reviewed in
Richards and Elgin, 2002). Whereas euchromatin is gene dense, largely open, and
replicates early, heterochromatin is densely packed, and contains genes that are
repressed (facultative heterochromatin) and a high number of repetitive elements
(constitutive heterochromatin). Changes in chromosome structure without alterations in
DNA sequence, also known as epigenetics, can contribute to regulation of gene
expression.
Nucleosomes and Nucleosome Positioning
A major constituent of chromatin is the nucleosome core particle (Kornberg and
Thomas, 1974; Oudet et al., 1975), consisting of 147 bp DNA wrapped about 1.7 turns
in a left-handed superhelix around a complex of two each of the core histone proteins
H2A, H2B, H3, and H4 (reviewed in Tessarz and Kouzarides, 2014). The nucleosome
core particle is one of the most thermodynamically stable protein-DNA complexes in
eukaryotic cells (Kouzarides, 2007; Li et al., 2007; Liotta and Petricoin, 2000). These
nucleosome structures are thought to have evolved as a DNA packing mechanism more
than a billion years ago and are present in virtually all eukaryotic organisms as well as
19
archaebacteria. Histones are ultra-conserved, highly basic proteins, which make ionic
interactions with the negatively charged DNA to form a highly stable complex mediated
by multiple DNA-protein contacts. Adjacent nucleosome cores are connected by linker
DNA, constituting long arrays of nucleosomes in the 10 nm fiber or “beads on a string”
structure (Oudet et al., 1975). A fifth canonical histone, H1, binds to linkers (20-80 bp)
and helps compact the basic chromosome fiber into higher-order structures such as the
more densely compacted 30 nm fiber. Genomic regions of characteristic folding status
reside in specific nuclear compartments (Ulianov et al., 2015).
Wrapping of DNA around histone octamers in nucleosomes prevents the
initiation of transcription by RNA polymerase II (Pol II) in vitro (Lorch et al., 1987) and
interferes with transcription in vivo (Han and Grunstein, 1988). The nucleosome serves
as a ubiquitous gene repressor, ensuring the inactivity of many thousands of eukaryotic
genes in the absence of transcription-activating factors (reviewed in Henikoff et al.,
2004). Upon transcription, individual histones and nucleosomes are believed to be
removed or displaced by elongating Pol II, as observed in vitro (Kireeva et al., 2005;
Kireeva et al., 2002), as well as in vivo (reviewed in Workman, 2006). Transcription
factors, Pol II and other complexes in the transcription machinery associate with TATA
elements in the core promoter DNA sequences, approximately 30-90 nucleotides
upstream of the transcriptional start site (TSS) within promoters (Adelman and Lis,
2012; Kwak and Lis, 2013). Pol II can then pause at this location by balancing between
pausing factors such as negative elongation factor (NELF), DRB-sensitivity-inducing
factor (DSIF), and the +1 nucleosome downstream of the TSS (Jonkers and Lis, 2015).
During elongation, elongation factors, such as positive transcription elongation factor-b
20
(P-TEFb), are recruited to Pol II to mediate release of the paused polymerase by
phosphorylating the pausing factors and serine-2 of the Pol II carboxy-terminal domain
(CTD). Histone octamers also appear to be rapidly redeposited onto DNA to reform
nucleosomes behind Pol II during elongation (Schwabish and Struhl, 2006).
Consistent with this connection to transcription, nucleosome turnover varies
across eukaryotic genomes, and is higher at regions of gene activity, in promoters, and
at Polycomb group (PcG) protein binding sites (Jin et al., 2009; Mito et al., 2007).
Genome-wide data have revealed that intergenic regions, in particular promoters, are
depleted of nucleosomes relative to genes (Bernstein et al., 2004; Schones et al.,
2008). In addition, functional transcription factor binding sites are predominantly
nucleosome-free in vivo (Bernstein et al., 2004). In yeast, most Pol II-transcribed genes
contain a DNase I hypersensitive, nucleosome-free region (NFR) of about 200 bp over
the TSS, flanked by two well-positioned nucleosomes, which are enriched in the histone
variant H2A.Z (Lee et al., 2007). Such occupancy levels from genome-wide profiling are
commonly interpreted as indicative of stably positioned nucleosomes.
It is not clear to what extent nucleosome positioning is determined directly by
sequence or by the action of gene regulatory complexes (Pugh, 2010). Unlike DNA
binding proteins, which bind to DNA in a highly sequence-specific manner,
nucleosomes do not contain sequence-specific contacts between protein functional
groups and specific atoms of the DNA bases (Luger et al., 1997). This sequence
flexibility is likely critical for nucleosome function and can explain why nucleosomes do
not typically reside at a single static position. However, across a population of cells,
some nucleosomes can be well positioned and occupy a finite range of base pairs
21
within a specific genomic region. By contrast, nucleosomes occupy many different
translational positions over sequences that do not support assembly of well-positioned
nucleosomes (Jiang and Pugh, 2009).
The preference of specific sequences to position nucleosomes and structurally
form nucleosomes can be determined by the ability of the DNA to bend and alter its
helical twist to facilitate wrapping around the histone octamer (Kaplan et al., 2009;
Widom, 2001). At the extremes of a spectrum, there are two broad classes of DNA
sequences when it comes to nucleosome positioning; sequences that favor nucleosome
formation and those that are excluded from nucleosomes. It is known that sequences
with AA or TT dinucleotides spaced at periodic 10 bp intervals favor nucleosome
formation. In contrast, sequences rich in poly deoxyadenosine tracts (dA•dT in runs of
10 to 20 bp or more) disfavor nucleosome assembly (Kaplan et al., 2009; Lee et al.,
2007; Miele et al., 2008; Satchwell et al., 1986; Segal and Widom, 2009; Valouev et al.,
2008; Widom, 2001; Yuan et al., 2005). Most of these sequence definitions are based
on the periodicity and properties of dinucleotides; however, longer DNA motifs have
also been shown to possess characteristics favorable to nucleosome formation
(Valouev et al., 2008). Previous studies have demonstrated that CTG and CAG
trinucleotide repeats regulate the positioning and organization of nucleosomes in the
myotonic dystrophy gene (Wang et al., 1994). Biophysical properties of DNA appear to
influence nucleosome positioning as well (Iyer and Struhl, 1995; Marini et al., 1982;
Travers and Klug, 1987), and genome-wide data argue that positioning is governed at
least partially by sequence (Segal, 2008; Zhang et al., 2011).
22
Some transcription factors, either alone or acting cooperatively, and Pol II have
been shown to be able to bind to DNA incorporated in nucleosomes (Adkins et al.,
2004; Workman and Kingston, 1992). Generally, the accessibility of the transcription
initiation and other protein complexes to DNA is controlled by: (i) ATP-dependent
nucleosome remodelers (reviewed in Hargreaves and Crabtree, 2011) and (ii) histone-
modifying enzymes. Histone chaperones (reviewed in Akey and Luger, 2003), acidic
proteins that usually bind histones that are not in a complex with DNA, are also
important for proper nucleosome assembly and for histone eviction in vivo (Adkins et al.,
2004). Additionally, the canonical histones have protein variants that can change the
overall nucleosome structure or thermodynamic stability of the nucleosome, resulting in
different compaction levels and regulatory functions (reviewed in Henikoff et al., 2004).
Histone variants, such as H2A.X, H2A.Z, and H3.3, have been shown to play important
roles in DNA repair, cell division, transcription regulation, and chromatin packaging.
DNA methylation may also play a role in nucleosome positioning. It is important
to consider that effects of DNA methylation on positioning nucleosomes can be either
direct or indirect. DNA methylation can directly affect nucleosome formation or can
indirectly affect nucleosome repositioning by regulating DNA binding factors (Bai and
Morozov, 2010). Biochemical studies have shown that the addition of a methyl group
(CH3) to carbon 5 of cytosines in DNA can negatively influence the flexibility of DNA and
hence affect its ability to be incorporated into nucleosomes (Diekmann, 1987;
Hagerman, 1990; Nathan and Crothers, 2002). Furthermore, the affinity of the histone
octamer towards methylated DNA has been shown to decrease in a sequence- and
methylation level-dependent manner, where CpG methylation expedites nucleosome
23
assembly to create higher-order chromatin structure (Davey et al., 1997; Davey et al.,
2004). It is important to realize that nucleosome positioning can also affect DNA
methylation patterns making attribution of causality difficult (Hinshelwood et al., 2009).
Histone Tail Modifications
Histone modifications present an additional level of epigenetic complexity, mainly
because several different residues in each histone tail (lysine (K), arginine (R),
threonine (T) and serine (S)) can be targets of various post-translational modifications
(Figure 1-1) (Jenuwein and Allis, 2001). The N-terminal tails of a histone octamer that
protrude from the globular domain of the nucleosome can undergo at least eight distinct
types of post-translational covalent modification (Kouzarides, 2007; Tan et al., 2011).
These modifications, including acetylation, methylation, phosphorylation, ubiquitination,
and ADP-ribosylation, allow for the regulation of contacts with the overlying DNA.
Adding to this complexity, several histone-modifying enzymes regulate the addition and
removal of different modifications onto specific residues. Therefore, histone post-
translational modifications affect DNA-histone interactions, histone-histone interactions,
and the interactions between histones and their regulatory factors.
A well-studied histone modification is acetylation, primarily of the histone H3 and
H4 tails. Acetylation of core histones has been linked to transcriptional activation, both
globally and gene specifically, as high levels of histone acetylation are detected at
transcriptionally active genes (Grunstein, 1997; Strahl and Allis, 2000). Transcriptionally
permissive acetylation in most species mainly occurs at lysines positioned at 9, 14, 18,
and 23 on the N-terminal tail of histone H3 and at lysine 16 on the N-terminus of histone
H4 (Shogren-Knaak et al., 2006). Acetylation functions by neutralizing the positive
charge on histones, loosening the interaction with the negatively charged
24
phosphodiester backbone of DNA. In addition, charge neutralization also weakens
interactions between neighboring nucleosomes, leading to an open chromatin structure
with the potential for transcription factors to bind DNA and facilitate gene transcription
(Shogren-Knaak et al., 2006). The enzymes involved in modifying nucleosomes in order
to open and close the chromatin are histone acetyltransferases (HATs) and histone
deacetylases (HDACs), respectfully (Vogelauer et al., 2000). HATs transfer acetyl
groups from acetyl CoA to lysine residues on histone tails, whereas HDACs remove
acetyl groups. Hyperacetylated histones localize to active gene promoters and
enhancers. In contrast, histone acetylation is maintained at low levels within gene
bodies to prevent cryptic promoters from becoming accessible and leading to
inappropriate transcription initiation (Kouzarides, 2000, 2007).
Multiple lysine residues (sites 4, 9, 27, and 36) on tails of histones H3 and H4 are
preferred sites for methylation (Strahl et al., 1999). Additionally, these lysine residues
can harbor mono-, di-, or trimethylated states. Histone methyltransferases (HMTs)
catalyze the transfer of one, two, or three methyl groups to arginine and lysine residues
in histone proteins, using S-adenosyl-L-methionine (SAM) as a methyl donor cofactor
(Strahl et al., 1999). Promoter regions of active genes are marked with high levels of
histone acetylation and H3K4 methylation, whereas H3K27 methylation is enriched at
repressed genes. H3K4 trimethylation (H3K4me3) is significantly enriched at TSSs,
enhancers are marked by H3K4me1, and gene bodies and the 3' end of genes
accumulate H3K36 trimethylation (H3K36me3), which interact with elongating Pol II.
Trimethylation of H3K9 and H3K27 is correlated with transcriptional repression.
H3K27me3 levels are higher at silent promoters than at active promoters, and
25
H3K9me3 is more prevalent in gene bodies and constitutive heterochromatin (Barski et
al., 2007; Hahn et al., 2011). Recent studies have shown that H3K9me3 is associated
with transcription elongation downstream of active promoters as it decondenses the
chromatin in gene bodies (Kouzarides, 2007). This decondensation of open reading
frame chromatin can also lead to nonsense expression of RNAs due to the exposure of
cryptic promoters, allowing Pol II to bind to and transcribe inappropriate regions in the
genome. The recruitment of repressive chromatin-modifying enzymes, such as HDACs,
by H3K36me3 and H3K9me3 help mask these cryptic promoters and ensure
appropriate transcription at promoter regions (Li et al., 2007).
Previously, it was thought that H3K4me3 and H3K27me3 modifications were
opposite modifications relative to transcription regulation and are either strictly
permissive (H3K4me3) or repressive (H3K27me3) histone modifications, respectively.
However, it has been found that there are several gene promoters, particularly in
embryonic stem cells (ESCs) that regulate tissue-specific gene expression, where both
H3K4me3 and H3K27me3 modifications decorate the chromatin simultaneously. Genes
with such bivalent domains are often in a poised state that can be activated upon
particular stimuli or during differentiation (Bernstein et al., 2006). Histone modifications
regulate chromatin activity not only by altering DNA-histone interactions, but also by
providing a landscape with differentially modified domains that can be read by other
downstream protein modules to regulate gene expression.
DNA Methylation
A well-studied epigenetic characteristic in the regulation of transcription in
eukaryotes is the methylation of cytosines in CpG islands. Methyl-CpG-binding domain
proteins (MBDs) bind to these methylated sites and can inhibit transcription factors from
26
binding to the promoter region (Figure 1-2B) (Boyes and Bird, 1991; Fujita et al., 2000).
MBDs also have the ability to recruit enzymes that alter the local chromatin architecture
such as histone deacetylation enzymes that compact chromatin and result in eventual
gene silencing. DNA methyltransferases (DNMTs) are enzymes involved in catalyzing
DNA methylation at CpG sites. These enzymes include DNMT1, DNMT3A, and
DNMT3B, which will be described in further detail in the following sections.
CpG Islands
Mammalian genomes are globally depleted of cytosine-guanine dinucleotides
(CpG). This can be explained by the frequent occurrence of spontaneous hydrolytic
deamination of methylated cytosine to thymine (C to T transitions) and the subsequent
accumulation of these mutations in the genome during evolution (Bird, 1986). As a
result, based on the GC content of the human genome, only about 20% of the expected
amount of CpG dinucleotides is present in the human genome (Saxonov et al., 2006).
However, interspersed in this low CpG background, there are prominent CG-rich
regions, known as CpG islands. This region contains the C+G frequency that is closer to
that expected taking into account genomic GC content. CpG islands are known as
“islands” because they are located within stretches of DNA that have very high
frequencies of CpG sites. CpG islands occupy approximately 60-70% of human gene
promoters and range between 500 bp to a few kilobases in length, residing between
2 kb and +1 kb of the TSS at gene promoters (Sharma et al., 2010). Aberrantly
methylated CpG sites are often observed in these islands in diseases such as cancer,
which leads to changes in transcription states of tumor suppressor genes (TSGs). It has
recently been described that CpG island “shores” are also involved in epigenetic
27
transcriptional regulation. These “shores” refer to low C-G density regions located a few
kilobases from CpG islands, which are subjected to tissue-specific differential DNA
methylation (Irizarry et al., 2009). CpG shores may also influence alternative TSS usage
during transcription (Rauch et al., 2009).
Mechanism of DNA Methylation and DNA Methyltransferases
The specific site of the covalent addition of a methyl (CH3) group by DNA
methyltransferases (DNMT) in the mammalian genome occurs at the position of carbon
5 on the cytosine ring resulting in 5-methylcytosine (5-mC), which is nearly always
accompanied by a 3' guanine residue (Figure 1-1) (Lister et al., 2009). These methyl
groups protrude into the major groove of DNA and have the ability to inhibit transcription
by blocking the binding of transcription factors to DNA. DNMTs bind to DNA everting the
target nucleotide out of the double helix and transferring a methyl group from a slightly
positive cofactor universal methyl donor S-adenosyl-L-methionine (SAM). DNMTs are
widely conserved among eukaryotic species, and there are three major types used for
regulation and catalyzing DNA methylation. DNMT1 was the first mammalian DNMT
described and is also the most abundant DNMT. The enzyme is known as the
maintenance DNMT, because it has a preference for hemi-methylated DNA sites, which
maintains the DNA methylation pattern during chromosomal replication. DNMT1 has
been shown to possess de novo DNA methylation activity and to interact with DNA
polymerase proliferating cell nuclear antigen (PCNA), which localizes to replication forks
during S phase (Chuang et al., 1997; Goyal et al., 2006; Jeltsch, 2006; Pradhan et al.,
1999). DNMT1 interacts with the ubiquitin-like plant homeodomain and RING finger
domain-containing proteins 1 (UHRF1) which binds to and recruits DNMT1 to sites of
DNA hemimethylation during S phase replication, to maintain the epigenetic
28
modification after each round of cell division (Liu et al., 2013; Sharif et al., 2007; Zhang
et al., 2011). Dnmt1 knockout cells show that DNMT1 is responsible for the majority of
genomic DNA methylation and it is also essential for embryonic development (Li et al.,
1992). DNMT2 is another member of this protein family and shows weak DNA
methylation activity in vitro. Mutation of Dnmt2 in mouse cells leads to no significant
change in establishing DNA methylation patterning, suggesting that Dnmt2 has no role
in de novo methylation in mouse cells (Goll and Bestor, 2005). The role of DNMT2 is so
far unclear; however, it has been shown to have a role in tRNA methylation (Goll et al.,
2006).
DNMT3A and DNMT3B are referred to as de novo DNMTs as they establish
initial patterns of de novo CpG methylation following embryo implantation (Chen et al.,
2003; Okano et al., 1999). These de novo DNMTs are highly expressed in ESCs and
are less abundant in differentiated cells (Esteller, 2007). Both DNMT3A and DNMT3B
contain a PWWP (Pro-Trp-Trp-Pro) domain at their N-terminus. Both proteins also
contain a cysteine-rich zinc-binding ADD (ATRX-DNMT3-DNMT3L) domain in their N-
termini. The catalytic domain for both proteins is located in the C-terminal domain
(Cheng and Blumenthal, 2008). DNMT3A’s PWWP domain interacts with the
H3K36me3 histone modification that resides within gene bodies of actively transcribed
genes and facilitates DNA methylation (Dhayalan et al., 2010). In contrast, DNMT3A’s
ADD domain can interact with unmethylated lysine 4 on H3 tails (H3K4me0) and
methylate DNA (Li and Reinberg, 2011; Otani et al., 2009; Zhang et al., 2010). A fourth
protein in the DNMT family, called DNMT3-like (DNMT3L), is thought to enhance de
novo methylation through its interaction with DNMT3A and 3B; however, DNMT3L has
29
no catalytic domain and therefore has no known enzymatic activity (Bestor, 2000;
Cheng and Blumenthal, 2008). DNMT3L has been shown to directly interact with
DNMT3A and 3B in the nucleus to form a heterotetrameric complex (Chen and Riggs,
2005; Holz-Schietinger and Reich, 2010). DNMT3L, like DNMT3A and 3B, is only
expressed in ESCs and at much lower levels in differentiated cells (Aapola et al., 2004).
In mice, disruption of Dnmt3a and Dnmt3b in gametes from female mice is embryonic
lethal due to failure to establish maternal imprinting. Disruption of Dnmt3a and Dnmt3b
in male murine gametes results in meiotic defects during spermatogenesis and
reactivation of retrotransposons (Chen et al., 2003; Ooi et al., 2007).
Gene Body (Intragenic) DNA Methylation
Within the majority of mammalian species, DNA methylation can reside either at
promoters or within the body of genes (ORF; open reading frame), which can regulate
gene expression differently (Figure 1-2C). DNA methylation in promoter regions typically
negatively regulates gene expression, whereas DNA methylation in gene bodies
positively regulates gene expression (Jones and Wolffe, 1999). CpG density is low in
most gene bodies and these sites are methylated throughout the genome and contain
H3K36me3 histone marks.
In the flowering plant, Arabidopsis thaliana, gene body methylation is correlated
with actively transcribed genes (Cokus et al., 2008; Lister et al., 2008; Zhang et al.,
2006; Zilberman et al., 2007). However in plant protoplasts, gene body methylation can
correlate with inactive genes by interfering with transcription elongation, if the gene
body methylation is close to the 5' end of the gene (Hohn et al., 1996). Upon mutation of
MET1, a DNA methyltransferase in Arabidopsis, there is a genome-wide increase of
gene expression, especially at those genes that contained gene body DNA methylation
30
prior to depletion of MET1. This indicates a role of gene body methylation in repressing
gene expression of a subset of genes (Zilberman et al., 2007). In the Arabidopsis
genome, methylated intragenic regions correspond to regions of active elongation by
Pol II, while the promoter and 3' region of these genes are depleted of DNA methylation
and contain a high density of paused Pol II (Zilberman et al., 2007). Comparing the
gene body methylation status between the active and inactive human X chromosomes,
the active human X chromosome has considerably more gene body methylation than in
the inactive chromosome (Hellman and Chess, 2007). In cancer cell lines, weakly
expressed genes are linked to hypomethylated gene bodies (Shann et al., 2008). In
human B cells, highly expressed genes are linked to gene bodies containing
hypermethylated CpG sites (Rauch et al., 2009). These data suggest a positive link
between intragenic DNA methylation and gene transcription in mammals but a negative
link in some genes in plants.
The role of gene body methylation is still unclear, but it has been proposed that
hypermethylation in the bodies of genes may act to suppress aberrant or spurious
initiation of transcription from alternative promoters within active genes in Arabidopsis.
In mammalian genomes, gene body methylation allows for increased accuracy of
alternative-splicing and interfering with transcriptional elongation of Pol II (Zhang et al.,
2006; Zilberman et al., 2007). Recent studies have shown that transcription can be
initiated within gene bodies, although at much lower levels than it is initiated at gene
promoters as seen by Cap Analysis of Gene Expression (CAGE) (Carninci, 2006;
Maunakea et al., 2010). DNA methylation occurs more frequently over exons compared
to introns and may have a potential role in pre-mRNA splicing (Shukla et al., 2011). For
31
example, gene body methylation at exon 5 of the CD45 gene inhibits CTCF binding
leading to exon exclusion (Shukla et al., 2011). This inhibition is presumably because
DNA methylation within exons inhibits the binding of CTCF, however, when CTCF is
bound to unmethylated DNA within exons, the transcription elongation rate of Pol II is
reduced, which promotes exon inclusion. Other proposed models for DNA methylation
at non-promoter regions include DNA methylation protecting against transposable
elements (‘jumping genes’) and for genomic stability maintenance (Dodge et al., 2005;
Kato et al., 2003).
Propagation of DNA Methylation
The mechanisms by which DNA methylation propagates or spreads to include
larger domains of chromatin remain unclear. This dissertation aims to provide evidence
for how the distribution of DNA methylation is controlled in the context of CTCF and
nucleosome positioning in a latent DNA virus. In general, the encroachment of DNA
methylation onto a gene promoter leads to gene silencing via the recruitment of
chromatin-modifying factors. It was shown in S. pombe that the loss of a boundary
element separating heterochromatin from euchromatin causes spreading of the
heterochromatin into the neighboring euchromatin and leads to gene silencing (Grewal
and Jia, 2007). In X-chromosome inactivation, the spread of heterochromatin across
one of the two X-chromosomes in female cells, comes from a specific nucleation site to
facilitate gene dosage compensation (Boumil and Lee, 2001).
DNA methylation has a role in gene silencing and can protect the genome from
instability by silencing transposable elements (Figure 1-2A). Transposable elements are
DNA sequences, mostly non-coding DNA, which can change their position and location
within chromosomes. Recent evidence has emerged suggesting that DNA methylation
32
and other epigenetic mechanisms silence transposable elements and can lead to
epigenetic spreading upstream and downstream of each transposable element. Recent
work from Ahmed et al. (2011) showed evidence that transposable elements are
densely methylated (at CG, CHG, and CHH sites, where H = A, T, or C) in plant
genomes. This methylation requires small interfering RNAs (siRNAs) to help guide DNA
methylation by de novo methyltransferases (Ahmed et al., 2011). These authors also
showed that there is local spreading of DNA methylation from these siRNA-targeted
transposable elements, establishing higher levels of DNA methylation in regions
flanking the transposable elements (Ahmed et al., 2011).
It has also been shown previously that DNA methylation as well as histone
methylation can spread from one particular mouse endogenous retrovirus (ERV) to a
nearby gene promoter. However, the study performed by Robollo et al. (2012) showed
that the DNA methylation spreading from ERV copies towards active gene promoters is
rare and instead more often the euchromatin from active gene promoters spreads into
the ERV copies. In this study, they also showed that CTCF protects unmethylated
promoters from potential DNA methylation spreading, acting as a barrier element to
prevent spreading epigenetic factors (Rebollo et al., 2012). Another example of DNA
methylation spreading in nucleosome-free regions was shown at the p16INK4a TSG
promoter, which leads to silencing of the gene during proliferation as well as changes in
histone modifications (Hinshelwood et al., 2009).
So far, therefore, the data suggest that DNA methylation and other epigenetic
modifications are dynamic and can spread from one region of the genome into another;
however, the mechanisms governing the spreading have not yet been determined.
33
There is a possibility that DNA methylation is directly linked with chromatin remodeling
enzymes in mammalian cells. Chromatin remodelers such as SNF2 family members
use ATP hydrolysis to disrupt DNA-histone interactions, which allow for the sliding of
nucleosomes on the DNA. As chromatin remodelers allow for the movement of
nucleosomes, this can lead to DNMTs to target and deposit methylation at the linkers of
these newly organized nucleosomes. Therefore, there seems to be interplay between
histone modifications and chromatin remodeling that allows for DNA methylation to be
established and maintained.
CTCF
The CCCTC-binding factor, or CTCF, is a transcription factor that is ubiquitously
expressed, plays diverse roles in genome biology, and is highly conserved among
eukaryotes (except in yeast and plants). This site-specific DNA binding protein is
involved in diverse biological processes in chromatin function and nuclear structure,
including the regulation of gene expression, chromatin organization, insulation,
nucleosome phasing, higher-order chromatin architecture, nuclear
compartmentalization, the regulation of imprinted genes (Figure 1-3B), X-chromosome
inactivation, and other various epigenetic processes (Phillips and Corces, 2009). As
CTCF has so many roles and functions within the genome, it is known as the
‘multivariant protein.’ CTCF is a zinc (Zn) finger DNA binding protein that was first
discovered in the early 1990s as a transcriptional repressor at the c-myc gene in
chicken (Lobanenkov et al., 1990). Since then, our understanding of the many functions
of CTCF has grown enormously. The exact number of CTCF binding sites within the
human genome is not determined as of yet, but ChIP-seq studies in several different
cell lines have shown at least 26,000 locations where CTCF binds in the human
34
genome (Cuddapah et al., 2009; Jothi et al., 2008; Kim et al., 2007). Recent studies by
Chen and colleagues in 2012 showed that there might be more than 300,000 CTCF
binding sites in the human genome, where the occupancy depends on the cell type as
well as the differentiation status (Chen et al., 2012a). Based on genome-wide CTCF
occupancy data, CTCF binding in mammalian genomes is highly enriched within
intergenic regions (between genes; ~50%), approximately 10-12% of all CTCF binding
sites occur within proximal promoters, and ~40% bind to intragenic (within introns and
exons of genes) regions (Chen et al., 2012a).
The 82-kDa CTCF protein has eleven Zn fingers, where different combinations of
Zn fingers can bind specifically to multiple DNA sequences (Figure 1-3A). This diversity
in Zn finger binding to DNA has been shown by the use of several different assays such
as Zn finger deletion, methylation interference, and hypersensitivity to DNase I (Awad et
al., 1999; Burcin et al., 1997; Chau et al., 2006; Filippova et al., 1996; Filippova et al.,
2002; Kanduri et al., 2002; Klenova et al., 1993; Quitschke et al., 2000; Renda et al.,
2007). The binding of the Zn fingers to DNA has the ability to bend the DNA double-
helix into several different conformations which depends on the chromatin structure
surrounding the binding sites (Arnold et al., 1996). The in vivo CTCF binding footprint,
as mapped by protection against either DNase I (digital DNase I footprinting) or a GpC-
methylating DNMT (MAPit and/or NOMe-seq), or in ChIP-exo, a method for genome-
wide high-resolution localization of factor binding, is ~50-60 bp (Boyle et al., 2011; Darst
et al., 2013; Nakahashi et al., 2013; Rhee and Pugh, 2011). This footprint size is
consistent with four of the eleven Zn fingers binding strongly to a core 12 bp DNA
sequence common to most CTCF binding sites (Ohlsson et al., 2001). The favored
35
CTCF binding motif was first described as CGCG(T/G)GGTGGCAG (Figure 1-3C)
(Kanduri et al., 2000). Since then, genome-wide studies in several vertebrates and
invertebrates, including fruit flies, have identified this similar, characteristic CTCF
binding motif (Barski et al., 2007; Holohan et al., 2007; Kim et al., 2007).
The only known insulator-binding protein in vertebrates is CTCF, which is known
to have roles in enhancer blocking and to act as a chromatin barrier element (Maeda
and Karch, 2007; Wallace and Felsenfeld, 2007). As a barrier protein, CTCF is enriched
at regions where active and repressive histone modifications as well as DNA
methylation are separated into discrete domains on either side of a CTCF-occupied site
(Cuddapah et al., 2009). This barrier role of CTCF inhibits epigenetic marks in
repressive chromatin domains from impinging upon active chromatin domains, and
possibly vice versa. CTCF often localizes to histone-free regions containing accessible
DNA and is surrounded by an array of well-positioned nucleosomes that is enriched with
the histone variant H2A.Z (Fu et al., 2008; Kanduri et al., 2000). More recently, it has
been found that the linkers of each nucleosome in an array of phased nucleosomes are
preferentially methylated, suggesting that CTCF organizes domains of chromatin with
linker-restricted methylation (Figure 1-6A and 1-6B) (Darst et al., 2013; Kelly et al.,
2012). The mechanisms, however, are still unclear as to how and why the linkers
between phased nucleosomes are preferentially methylated nearby CTCF binding
elements. It is also unclear if CTCF plays a causative role in organizing such methylated
domains of chromatin.
CTCF and DNA Methylation
CTCF binding is predominantly found in hypomethylated and nucleosome-free
regions of the genome when compared by methylome and ChIP-seq genome-wide
36
studies in several cell lines (Mukhopadhyay et al., 2004). In general, CTCF binding is
methylation dependent; with the majority of CTCF binding occurring at unmethylated
regions and a small subset of bound targets mapping to low-methylated regions (LMRs)
(Feldmann et al., 2013). Some examples of genomic regions where CTCF binding is
methylation dependent are the c-myc gene insulator, the human retinoblastoma (Rb)
gene promoter, B-cell CLL/lymphoma 6 (BCL6), the IGF2/H19 imprinting control region
(ICR) (Figure 1-3B), the CDKN2A promoter, brain-derived neurotrophic factor (BDNF),
and the Epstein Barr virus (EBV) Q promoter (De La Rosa-Velazquez et al., 2007;
Fedoriw et al., 2004; Gombert and Krumm, 2009; Lai et al., 2010; Rodriguez et al.,
2010; Schoenherr et al., 2003; Tempera et al., 2011). At the imprinted IGF2/H19 locus,
the occupancy of CTCF at the ICR leads to maternal expression of the H19 gene. In
contrast, the absence of CTCF binding to the ICR leads to the transcription of the IGF2
gene (paternally expressed) (Bell and Felsenfeld, 2000). At the H19 promoter where the
ICR is located, there are seven known CTCF binding sites; however, only one of these
binding sites shows differential parent-of-origin methylation (Takai et al., 2001). Recent
genome-wide studies by Schübeler and colleagues showed that CTCF binding occurs
at regions of low DNA methylation in mouse embryonic stem cells (mESCs) and that
methylation increases in the surrounding regions of CTCF binding (Felle et al., 2011;
Stadler et al., 2011). A comparison of DNA methylation patterns obtained by Reduced
Representation Bisulfite Sequencing (RRBS) with genome-wide CTCF binding showed
that approximately 40% of CTCF-binding sites linked to differential DNA methylation in
19 human cell lines tested (Wang et al., 2012). CTCF also has a role in preventing DNA
methylation by interacting with poly(ADP-ribose) polymerase 1 (PARP1) and leading to
37
inhibition of DNMT1 activity (Zampieri et al., 2012). CTCF has the ability to activate
PARP1, which leads to the inactivation of DNMT1 by poly-ADP-ribosylation, therefore
maintaining unmethylated CpG sites to allow CTCF to bind to DNA (Guastafierro et al.,
2008; Zampieri et al., 2012).
The Gamma-herpesvirus KSHV
Kaposi’s sarcoma-associated herpesvirus (KSHV; human herpesvirus 8) is one
of seven known oncogenic double-stranded DNA viruses. It belongs to the gamma-
herpesviridae subfamily that is associated with causing tumors in their natural host,
particularly in immunocompromised individuals, such as in HIV-infected patients. In
1872, Moritz Kaposi, a Hungarian dermatologist first described Kaposi’s sarcoma (KS)
as lesions and multiple idiopathic sarcomas on the skin. KSHV is the etiological agent of
KS, primary effusion lymphoma (PEL), and multicentric Castleman’s disease (MCD)
(Boshoff et al., 1995; Cesarman et al., 1995a; Chang et al., 1994). KSHV has a double-
stranded DNA genome of 165-170 kb, and consists of about 140 kb of unique sequence
flanked by 20-35 kb of GC-rich terminal repeat (TR) sequences. The unique coding
regions in KSHV encode for more than 80 viral open-reading frames (vORFs), 12 micro-
RNAs (miRNAs), and several non-coding RNAs (ncRNAs) as well as antisense RNAs
(Figure 1-4A and 1-4B) (Renne et al., 1996a; Russo et al., 1996). Like other
herpesviruses, KSHV establishes a persistent infection that can alternate between a
latent and lytic phase of infection, exhibiting a specific gene expression pattern in each
phase. The KSHV genome is packed into an icosahedral capsid as a linear, double-
stranded molecule. Within KSHV viral particles, the genome has no detectable DNA
methylation or associated histones (Ballestas et al., 1999; Wu et al., 2000). Virions bind
to host lymphoid or epithelial cells via a number of different surface receptors and then
38
penetrate into the host cell cytoplasm. The virion capsid then travels to the nucleus
where it ejects the linear viral DNA through a nuclear pore. Within the host nucleus, the
viral DNA quickly circularizes by recombination within the TRs and subsequently
acquires cellular histones and DNA binding proteins (within hours). Viral genomes then
gradually accumulate de novo methylation (within months post infection). The viral
genomes persist in the nucleus as multicopy, closed-circular, extrachromosomal
genomes called episomes. The episomes are tethered to the host chromosomes via the
Latency Associated Nuclear Antigen (LANA) protein bound to the KSHV TRs (Krithivas
A 2002 JV). Chromatinization is vital for the episome to be protected from host innate
immune responses that sense and guard against foreign DNA and to allow for stable
replication and maintenance in dividing cells (Lieberman, 2013). During latency, a
limited number of latent transcripts in the Kaposi’s latency-associated region (KLAR),
including LANA, Kaposin, virus-encoded Cyclin D homolog (vCyclin), and viral Fas-
associated protein with death domain-like interleukin-1β-converting enzyme/caspase-8-
inhibition protein (vFLIP), are transcribed as an alternatively spliced RNA from a single
promoter, but no infectious viral particles are produced (Figure 1-4B). The lytic phase is
characterized by the replication of the viral genomes, and expression of more than 80
gene transcripts (Figure 1-4A) as immediate-early, early, and late genes (Wen and
Damania, 2010).
During latency, the LANA promoter facilitates the coordinated expression of the
KLAR transcripts, including all 12 viral microRNAs (miRNAs), at the latent TSS that is
positioned upstream of the lytic TSS (Figure 1-4B). The LANA lytic TSS is used to drive
LANA transcription in response to RTA, a viral immediate-early transactivator. The
39
LANA promoter is considered to be a bidirectional promoter, containing the TSS for
K14, an early gene transcribed during lytic reactivation, about 30 bp downstream of the
latent LANA TSS on the opposite strand. Both the lytic LANA and the K14 TSSs are
located within 300 bp of each other and are inactive during latency even though the
chromatin environment is open and contains high levels of H3K4me3 histone marks.
Currently, KSHV viral genome replication is thought to be required in cis for the
expression of late genes. Epigenetically silenced states, like DNA methylation of the
promoter region or higher-order chromatin structure, are altered during replication,
allowing for the transcription of late genes (Chang and Ganem, 2000). Lytic reactivation
of KSHV can be induced by treating latently infected cells with chemical compounds
such as inhibitors of HDACs (sodium butyrate) and inhibitors of DNA methylation (5-
aza-2'-deoxycytidine; 5-aza-dC), which affect chromatin regulatory factors and
chromatin structure. Furthermore, it has been demonstrated that LANA tethers KSHV
episomes to host chromosomes by binding nucleosomes through the H2A-H2B acidic
patch domain, using the nucleosomal surface as a docking platform and effecting
transcription (Barbera et al., 2006a; Barbera et al., 2006b). This suggests that chromatin
structure must be involved in the control of the viral gene expression (Chen et al., 2013;
Chen et al., 2001; Han et al., 2010).
During the transition from latent to lytic gene expression, one of the expressed
immediate-early lytic genes is RTA (ORF50) that encodes Replication and Transcription
Activator protein and functions as the latency to lytic reactivation ‘switch’. Expression of
RTA promotes the cascade of lytic gene expression and leads to the replication and
production of viral progeny (Guito and Lukac, 2012; Lan et al., 2004). RTA is also
40
known to bind indirectly to its own promoter and establish a positive feedback loop in
the viral lytic gene expression (Deng et al., 2000).
Role of CTCF in Viruses
CTCF exerts control of transcriptional activation and repression in several viruses
with double-stranded DNA genomes. CTCF also acts as a barrier or insulator to prevent
gene silencing by the spread of heterochromatin in DNA viruses, including EBV and in
the major latency transcript of the KSHV genome (which is discussed in detail in the
following sections) (Amelio et al., 2006; Li et al., 2008; Stedman et al., 2008). In KSHV,
CTCF has been shown to associate with 12-15 regions within the viral episome, with the
strongest binding and enrichment at an intergenic site between ORF73 (LANA) and
ORF K14, where CTCF demarcates the border between KLAR and the early lytic K14
gene (Li et al., 2014; Stedman et al., 2008).
Between the LANA ORF and the LANA TSSs, a cluster of three, tandemly
arranged CTCF-binding sites (all three contained within a 154 bp region) just
downstream of the latent and lytic TSSs of the major latency transcript (LANA) strongly
co-localizes with cohesin (Figure 1-6C, upper panel) (Stedman et al., 2008). CTCF and
cohesion strongly co-localize at several other viral and host chromosomal regions.
CTCF-cohesin binding supports loops or interactions that juxtapose regions otherwise
separated by long, linear distances, which are important for promoting gene expression
(Dorsett, 2011).
Lieberman and colleagues ablated CTCF binding to all three binding sites in
LANA through base substitutions, which resulted in increased steady-state levels of
latent transcripts. More specifically, higher abundance of the unspliced form of the
multicistronic LANA transcript was concomitant with derepression of the K14 promoter,
41
which drives expression of an early lytic gene transcribed from the antisense strand
(Kang et al., 2013; Kang et al., 2011; Stedman et al., 2008). Also, loss of CTCF binding
in the first intron of the latency transcript led to disruption of recruitment of cohesin,
increased Pol II occupancy to the LANA promoter, and increased total levels of latency
transcript (Kang et al., 2013). These results were also confirmed by siRNA-mediated
depletion of CTCF, which resulted in the increase of the early lytic genes such as K14
and ORF74 (Li et al., 2014). The LANA promoter is bidirectional; during latency the
promoter controls the transcription of ORF73, 72, and 71. During lytic reactivation, the
LANA promoter also transcribes a bicistronic transcript encoding the expression of K14
and ORF74/vGPCR (G protein-coupled receptor) on the opposite strand (Chiou et al.).
This global depletion of CTCF protein also resulted in an ~25-fold increase in virion
production in HEK293T cells. Together, these data suggest that CTCF is a host cell
restriction factor for KSHV lytic replication. CTCF also exhibits activity as a repressor of
lytic transcription, e.g., at the ORF50/RTA promoter (Chen et al., 2012b).
KSHV Epigenetics
During de novo infection and chromatinization of the KSHV genome, there is an
initial enrichment of activating histone marks (H3K4me3 and H3K27ac), which occurs
during the first 24 hr post-infection (hpi) (Toth et al., 2013). After 24 hpi and an initial
increase in gene expression of both latent and lytic transcripts, there is a global decline
of activating histone marks on KSHV episomes. This is then followed by recruitment of
Polycomb-group protein (PRC1 and PRC2) complexes and hence an increase in
repressive histone marks (H3K27me3 and H2AK119ub) at lytic gene promoters, which
leads to epigenetic silencing of lytic gene expression throughout the episome (Toth
2013). Since the virus resides as multicopy episomes within the nucleus, it is not fully
42
understood if subpopulations of episomes are decorated with Polycomb repressive
complexes resulting in a different set of active episomes that promote episomal
persistence. Kladde and colleagues are using several techniques centered on a
chromatin accessibility assay (MAPit) to deconvolute the presence of epigenetically
diverse subpopulations (Darst et al., 2013).
In episome-wide methylation studies, the promoter for latent gene expression,
LANA, was found to be unmethylated and free of repressive histone marks in several
lines of long-term latently infected PEL cells (Günther and Grundhoff, 2010). In contrast,
in this same study, the RTA promoter was methylated, suggesting that DNA methylation
may actively repress RTA during latency.
Remodeling of positioned nucleosomes at the TSS of RTA has been shown to be
a regulatory step in the transition from the latent to lytic state in the viral life cycle (Lu et
al., 2003). In episome-wide studies, the activating H3K4me3 and repressive H3K27me3
modifications are mutually exclusive on most of the latent KSHV genome (Figure 1-5),
whereas H3K9me3 has been shown to occupy only a few regions that primarily encode
late genes during lytic reactivation (Toth et al., 2010). However, the genomic regions
encoding for RTA and a few other genes have a bivalent chromatin domain with the
simultaneous presence of activating H3K4me3 and repressive H3K27me3 histone
marks (Figure 1-5). Under conditions of cellular stress, the repression of these poised
promoters can be alleviated, resulting in concomitantly decreased local levels of
H3K27me3, increased H3K4me3, and the expression of RTA leading to reactivation and
production of viral particles (Günther and Grundhoff, 2010; Toth et al., 2010). The
deposition of histone marks on the episome is not only region-specific but also specific
43
to the time within the life cycle of the virus. The mechanisms of this region-specific and
time-dependent deposition remain unclear, but it is likely that there is interplay between
host and viral factors contributing to this regulation.
The regulation of long-term KSHV latency can also be DNA methylation
dependent after persisting several months or years in a host cell (Günther and
Grundhoff, 2010). DNA methylation typically represses gene expression by methylating
CpG dinucleotides within the promoter regions. However, DNA methylation within the
KSHV genome occurs gradually after primary infection (Günther and Grundhoff, 2010)
and high levels of methylation were observed at 240 days post infection (dpi) in iSLK
cells and other related cell lines. This suggests that histone modifications, more so than
DNA methylation, regulate expression of viral genes during latency and lytic reactivation
of early infected cells. The role of DNA methylation in establishment and maintenance
of latency is still not well understood; however, it is known that DNA methylation is
absent at the promoters of actively transcribed latency genes (e.g., LANA) and is
present at several transcriptionally inactive regions on the KSHV genome in long-term
latently infected cells (Günther and Grundhoff, 2010).
To study the role of gene body methylation organization and spreading in respect
to CTCF binding, I have used the LANA promoter and ORF in KSHV as a model
system. KSHV is an oncogenic gamma-herpesvirus that establishes latency with the
ability to lytically reactivate under cellular stress. Following KSHV de novo infection, the
viral genome associates with histone proteins with post-translational modifications,
accumulates DNA methylation, and resides as multicopy episomes tethered to the host
chromosomes. Post-translational histone modifications of the KSHV genome have been
44
associated with the regulation of viral gene expression during both latency and lytic
replication. Genome-wide methylation analysis of latently infected cells has shown
domains with sub-saturating levels of DNA methylation, indicating the presence of
heterogeneous KSHV subpopulations.
This project elucidates the biological significance of linker-restricted methylation
neighboring a chromatin barrier element occupied by CTCF. Previous results (Darst et
al., 2013; Figure 1-6C, unpublished observations of Russell P. Darst and Irina Haecker
in the Kladde and Renne laboratories, respectively) observed linker-restricted
methylation in the gene body of LANA downstream of three tandem CTCF binding sites
in a long-term latently infected cell line (BCBL-1). The functional role of this organization
of chromatin in gene bodies may be to block transcription factor binding, to impede
cryptic transcription, to recruit methyl-CpG binding domains in complexes with HDACs,
or to allow higher-order chromatin folding. In addition, chromatin-bound de novo
methyltransferases could potentially block recruitment of chromatin remodelers. A
deeper understanding of de novo DNA methylation would help give mechanistic insights
into how insulators organize DNA methylation and prevent its aberrant spread onto
gene promoters in disease.
I hypothesized that CTCF organizes arrays of nucleosomes to which de novo
DNMTs bind and preferentially methylate linker DNA. By disrupting the binding of
CTCF, three possible outcomes of chromatin organization can be envisioned: 1) there
would be no change in gene body methylation organization and DNA methylation
remains exclusively in the linkers in the ORF nucleosome array; 2) gene body
methylation would encroach towards the LANA promoter; or 3) the euchromatin would
45
encroach towards the LANA ORF. My results show that disrupting the CTCF binding at
the LANA promoter leads to disorganized/random nucleosome positioning in the
ORF/promoter, thus eliminating linker-restricted methylation. This caused encroachment
of gene body methylation towards the promoter of LANA and possibly could lead to
silencing of LANA gene expression over time.
Figure 1-1. The role of epigenetics in modifying DNA and nucleosomes. Histone
octamers are proteins around which double-stranded DNA wraps to form nucleosomes for compaction of the genome into higher-order structure and regulation of gene expression. Histone modifications occur on specific residues on histone tails protruding from the nucleosome and these modifications include methylation, acetylation, and phosphorylation. DNA methylation specifically occurs at CpG sites where DNA methyltransferases (DNMTs) add a methyl group to the 5-carbon position on the cytosine base (Figure reproduced with permission from Dwivedi et al., 2011).
46
Figure 1-2. DNA methylation at repetitive elements, promoters, and gene bodies in
health and disease. DNA methylation has many roles across the genome and changes in DNA methylation patterns can lead to disease. A) DNA methylation at repetitive elements prevents translocations, genome instability, and transposition. B) Actively transcribed genes contain a hypomethylated CpG island to allow transcription factors to bind to accessible DNA and recruit RNA Pol II for transcription. On the other hand, hypermethylated promoters allow MBDs to bind to methylated CpGs and inhibit the transcription machinery from binding and initiating gene transcription. C) Gene body methylation helps prevent transcription factors from binding to cryptic promoters within the ORF and prevents spurious transcription initiation. The left side of each panel depicts the usual situation in non-diseased cells, whereas the right side is reflective of a common scenario in diseased cells (Figure reproduced with permission from Portela and Esteller, 2010).
47
Figure 1-3. The insulator protein CTCF, its mode of action at the Igf2/H19 locus, and
DNA binding motif. A) Structural model of CTCF (Figure reproduced with permission from Ohlsson et al., 2001). Depicted is the amino acid sequence of the DNA binding domain of the human CTCF protein, which is composed of ten C2H2-class zinc-fingers (ZFs 1-10) and one C2HC-class ZF (C-terminal ZF11). An SH3 motif is highlighted in red. Moreover, a domain for interaction with RNA polymerase II can be found at the C-terminus of CTCF. B) The role of CTCF at the imprinted Igf2/H19 locus. CTCF binds to the unmethylated imprinting control region (ICR) on the maternal allele and blocks long-range enhancer activity at the Igf2 promoter, allowing for expression of H19 (upper panel). In contrast, on the paternal allele, the ICR is methylated, blocking the binding of CTCF and allowing the downstream enhancers to express Igf2 (lower panel). (Figure derived from Wallace and Felsenfeld, 2007). C) Computationally derived CTCF DNA binding motif and consensus in vertebrates. (Figure reproduced with permission from Kim et al., 2007).
48
Figure 1-4. Diagram of KSHV open reading frames, gene expression pattern, and
KLAR. A) ORFs are numbered increasing from left to right. The KSHV genome is 140 kb of double-stranded DNA, which contains more than 80 ORFs and 12 viral miRNAs. KSHV-specific genes begin with the letter K and are numbered K1 to K15. Different classes of gene expression are indicated by colors (latent genes labeled black, immediate-early genes labeled in red, early genes labeled in green, and late genes labeled in blue). Asterisks represent genes expressed from spliced mRNAs. B) The KSHV latency-associated region (KLAR) is shown in an expanded view with the four major ORFs – ORF73/LANA, ORF72/v-Cyclin, ORF71/v-FLIP and ORFK12/Kaposins. The position of the 12 pre-miRNA cluster sequences is shown with a red line that is expressed from all four promoters within the KLAR. (Figure reproduced with permission from Yuan and Renne, 2009).
49
Figure 1-5. Genome-wide histone modification and Pol II occupancy of KSHV in long-
term latently infected BCBL-1 cells. Chromatin immunoprecipitation with antibodies specific for H3K4me3, H3K27me3, and Pol II (and non-specific IgG control) followed by Illumina next-generation sequencing were performed on cross-linked chromatin from BCBL-1 cells long-term infected with latent KSHV. Shown here are ChIP signals from the entire 140-kb KSHV genome. Low signal is evident for the IgG control, while peaks of H3K4me3 (activating histone mark) and H3K27me3 (repressive histone mark) are concentrated at latent promoters and lytic gene promoters, respectively. The RTA gene is highlighted with an orange box on left and shows ‘bivalent’ histone marks deposited at the promoter (containing both H3K4me3 and H3K27me3). Peaks of enrichment for RNA Pol II coincide with those for H3K4me3. CTCF binding is indicated with vertical dotted lines insulating the KLAR (rightmost orange box). Other CTCF binding sites in the genome are not shown. (Figure adapted and modified from Hu et al., 2014).
50
Figure 1-6. CTCF organizes arrays of well-positioned nucleosomes with DNA
methylation restricted to linkers both genome-wide and at the KSHV latency-associated nuclear antigen (LANA) ORF. A) Distributions of CpG methylation and CpG site density traced in black and blue, respectively, centered at CTCF sites (≥10 kb from nearest TSS) in mES cells (Stadler et al., 2011). B) Distribution around comparable CTCF sites as in A) but in IMR90 cells (human fetal lung fibroblasts) (Kim et al., 2007; Lister et al., 2009). C) Genomic features of the LANA promoter (top panel). TATA boxes, black triangles; TSSs, bent arrows; CTCF sites, black ellipses; and LANA coding region, white block arrow. Bottom panel shows the endogenous methylation (red trace) and chromatin accessibility (yellow trace) within the LANA promoter and ORF from a long-term, latently infected cell line (BCBL-1). (Unpublished data, courtesy of Russell P. Darst and Irina Haecker in the Kladde and Renne laboratories, respectively).
51
CHAPTER 2 ESTABLISHMENT OF DE NOVO METHYLATION IN THE LANA TRANSCRIBED
REGION OF KSHV GENOME IN MULTIPLE KSHV-INFECTED CELL LINES
Introductory Remarks
The establishment of DNA methylation is governed by de novo DNMTs and
occurs predominantly during early development and gametogenesis in mammalian
cells. De novo DNMTs include DNMT3A and 3B, which are responsible for setting
genomic DNA methylation patterns. During embryonic development, DNA methylation
patterns are established in a stepwise process that involves global demethylation
followed by de novo methylation shortly after implantation. Consistent with this, de novo
methylation activity is abundant in ESCs, embryonal carcinoma cells, early post-
implantation embryos, and developing germ cells. In contrast, de novo methylation
activity is greatly reduced in differentiated somatic cells. Newly established patterns of
methylation in embryogenesis and somatic cells are inherited and maintained in a clonal
fashion by DNMT1, also known as the maintenance DNMT.
Most CpG dinucleotides in the genomes of mammalian cells are methylated, and
facilitate regulation of general and cell-type specific gene expression. The same is true
for DNA viruses, but the roles and establishment of DNA methylation in DNA viruses are
different for each family of DNA viruses. The differences between DNA viruses will
certainly exist between actively replicating viral DNA and those viruses that integrate
into the host genome. The integration of adeno-, papilloma-, or polyomavirus DNA into
the host genome is essential for propagation of their genomes. However, these viruses
that integrate into the host genome become epigenetically silenced over time at different
rates depending on the region in which they integrate (Shalginskikh et al., 2013). In
contrast, the various roles of DNA methylation in non-integrating viruses during early
52
viral infections, establishment and maintenance of latency, and lytic reactivation remain
unclear. The methylation status of herpesvirus genomes during latent infections has
been most well studied; however, by comparison, much less is known about how DNA
methylation regulates reactivation of lytic DNA replication.
Studies of the gamma-herpesviruses KSHV and EBV indicate that methylation
has complex regulatory roles in the viral life cycle. The EBV genome is hypomethylated
during lytic infection, becomes highly methylated in latency, and then is demethylated
during lytic reactivation (Szyf et al., 1985). KSHV miRNAs, which are expressed during
latency, have been shown to contribute to KSHV latency by repressing RTA protein
expression and upregulating global levels of DNMTs and CpG methylation on the KSHV
and host genome (Lu et al., 2010). This study shows a functional role of de novo
DNMTs, where KSHV regulates the expression of DNMTs to methylate lytic gene
promoters and maintain latency in host cells.
Previously published (Darst et al., 2013) and unpublished (Figure 1-6C, courtesy
of Russell P. Darst and Irina Haecker) studies from the Kladde and Renne laboratories
discovered a chromatin domain with an intriguing organization: DNA methylation
confined to linkers within a nucleosome array adjacent to a CTCF-occupied insulator
within the KSHV LANA promoter and ORF. Since KSHV contains undetectable DNA
methylation in the virion and slowly accumulates DNA methylation after infection in the
nucleus, this viral system is a good model to study de novo DNA methylation
establishment and organization. I chose to investigate the roles of CTCF binding in both
organizing nucleosome arrays and insulating the LANA promoter from gene body DNA
methylation. The ability to monitor accumulation of DNA methylation on the initially
53
methylation-free genome after episome chromatinization also presents a unique
opportunity to discover the features of chromatin structure that accommodate de novo
methylation most rapidly. An additional powerful aspect of the KSHV system for
studying CTCF’s role in organizing DNA methylation is the ability to generate mutant
viruses using the bacterial artificial chromosome recombination (BACmid) system.
CpG methylation of viral DNA regulates viral gene transcription during long-term
latency. Epigenetic establishment of KSHV latency is poorly understood but it is
generally thought to be governed primarily by post-translational histone modifications
early on, within hours or days post infection (Günther et al., 2014; Toth et al., 2013).
Long-term latently infected KSHV episomes show global patterns of repressive DNA
methylation at regions transcribed during lytic reactivation, while KSHV in the virion and
at early times of infection lacks DNA methylation across the episome (Günther and
Grundhoff, 2010). Nevertheless, it is unclear at what rate DNA methylation accumulates
on the episome and if this rate varies among different host cell lines.
KSHV linear DNA is considered epigenetically naïve, i.e., no detectable DNA
methylation or histone occupancy in viral DNA in the virion upon infection (Günther and
Grundhoff, 2010). The stepwise epigenetic reprogramming of KSHV in the host cell
nucleus is thought to involve: i) transcription factor binding to DNA due to their
abundance in the nucleus prior to replication (Rattray and Muller, 2012), ii)
chromatinization of the episome into nucleosomes, iii) accumulation of activating
histone marks, and iv) global deposition of repressive histone marks, which
progressively stabilizes latent expression patterns and triggers the establishment of
DNA methylation to reinforce the latency program at late time points of infection.
54
My goal in this chapter was to measure the rate of accumulation of DNA
methylation in an accessible linker sequence in the KSHV LANA ORF following de novo
infection of different cell lines in order to identify a viable system for further studies. My
data show that de novo-infected TIVE and iSLK cells accumulated minimal DNA
methylation at day 150 post infection at the +1/+2 nucleosomal linker in the KSHV
LANA ORF. In contrast, HEK293T cells proved to be a good system, as DNA
methylation of this linker accumulated linearly and reached 35% methylation over the
same time period.
Materials and Methods
Cell Lines and Culturing
Accumulation of DNA methylation of the KSHV LANA promoter region was
measured following de novo infection of one endothelial cell line (TIVE, telomerase-
immortalized human umbilical vein endothelial) and two epithelial cell lines (SLK and
HEK293T). TIVE cells were established to study KSHV latency and tumorigenesis in
endothelial cells (An et al., 2006). SLK bears the initials of Dr. S. Leventon-Kriss, who
derived the human epithelial cell line from a gingival KS lesion of an HIV-negative
patient who received a kidney transplant (Siegal et al., 1990; Sturzl et al., 2013). SLK
epithelial cells support efficient KSHV infection and maintain tight control of KSHV
latency (Myoung and Ganem, 2011). Derived from SLK, iSLK cells harbor an integrated
doxycycline-inducible RTA transgene that drives lytic reactivation and production of
large amounts of infective KSHV virions. HEK293T cells are adherent epithelial cells
obtained from human embryonic kidney and express SV40 T-antigen.
As a positive control for KSHV episomes that are highly methylated due to long-
term latent infection, I used a well-established B-cell line, BCBL-1 (body cavity-based
55
lymphoma 1), derived from a primary effusion lymphoma (PEL) (Renne et al., 1996a).
BCBL-1 cells harbor a primarily latent infection, although 1-3% of cells undergo
spontaneous lytic reactivation. Lytic replication can also be induced further by treating
cells with the phorbol ester tetradecanoyl phorbol acetate (TPA) (Renne et al., 1996b).
HEK293T cells were obtained from the American Type Tissue Culture Collection
(ATCC). BCBL-1, SLK, and TIVE cells were obtained from Dr. Rolf Renne. KSHV-
infected cells were cultured under biosafety level 2 (BSL2) conditions. All cell lines were
cultured at 37°C in a humidified atmosphere of 5% CO2. BCBL-1 suspension cells were
cultured in RPMI 1640 medium supplemented with 10% (v/v) fetal bovine serum (FBS),
2 mM glutamine, 1 mM sodium pyruvate, 100 U/mL penicillin, and 100 µg/mL
streptomycin. Experiments with BCBL-1 cells were conducted with cells that had
undergone less than 20 passages. Typically, every 3 days when cells reached a density
of 1 x 106 cells/mL, they were sub-cultured to a density of 2 x 105 cells/mL. TIVE cells
were cultured in M199 medium (Fisher) supplemented with 15% (v/v) fetal calf serum
(FCS) and 5 mL of filtered endothelial cell growth factors. TIVE have a long doubling
time (36-48 hr) and were sub-cultured once a week or once every 10 days depending
on their confluency. SLK [or doxycycline-inducible RTA transgene SLK (iSLK)] and
HEK293T cell lines were maintained in Dulbecco’s-modified Eagles medium (DMEM)
supplemented with 10% (v/v) fetal bovine serum (FBS) and 1% (v/v) penicillin-
streptomycin (Invitrogen).
Production of Wild-type KSHV and De Novo Infection of Cells
The protocol for the production of KSHV virions and for de novo infection was
obtained from Plaisance-Bonstaff et al. (2014) and is partially paraphrased below. Wild-
type KSHV BACmid 16 (BAC16) DNA (obtained from Dr. Jae Jung's laboratory) was
56
isolated using the large-construct kit (Qiagen) according to the manufacturer’s
recommendations. HEK293T cells were transfected with 2 µg of KSHV BAC DNA using
TransIT-293 reagent (Mirus) according to the manufacturer’s instructions. Cells were
selected using 100 µg/mL of hygromycin B and were outgrown for 10-15 days.
Transfected cells that express green fluorescent protein (GFP) were monitored by
fluorescence microscopy daily. When the expanded cell population reached 100% GFP
positive, cells were co-cultured with iSLK cells (Myoung and Ganem, 2011) and lytic
induction was performed using 2 mM sodium butyrate. Cells were washed 4 days post
induction, and infected iSLK cells were selected using 1 µg/mL puromycin, 250 µg/mL
G418, and 1.2 mg/mL hygromycin B. Stable KSHV iSLK cells were outgrown in the
presence of 1 µg/mL doxycycline and 1 mM sodium butyrate. Virus was collected and
quantified 4 days after induction. Uninfected cells (HEK293T, TIVE, or SLK) were
infected with approximately 400 viral particles per cell with addition of 4 µg/mL
polybrene. Cells were washed and grown under selection with hygromycin B until all
cells were GFP positive.
DNA Methylation Analysis by Pyrosequencing
Total DNA was isolated every 30 dpi. Briefly, 1 x 106 cells were harvested by
trypsinization and lysed in cell lysis buffer (20 mM HEPES, pH 7.5, 70 mM NaCl, 0.25
mM EDTA, 0.5 mM EGTA, 0.5% (v/v) glycerol, 10 mM DTT, 0.25 mM PMSF, and 0.19%
(v/v) NP-40) at 4°C for 10 min. The prepared nuclei were then lysed by adding an equal
volume of 100 mM NaCl, 10 mM EDTA, pH 8.0 and 1% (w/v) SDS, 100 μg/mL
proteinase K was added, and the nucleic acids were incubated overnight at 50°C. Total
nucleic acids were isolated by extraction with phenol:chloroform:isoamyl alcohol
57
(25:24:1), concentrated by ethanol precipitation, and resuspended in 1 mM Tris-HCl, pH
8.0, 0.1 mM EDTA (i.e., 0.1 TE).
Sodium bisulfite conversion was performed using the Zymo kit (EZ DNA
Methylation-Gold™ Catalog #D5005) following manufacturer’s instructions and eluted in
20 μL 0.1 TE. Bisulfite-converted DNA (1 μl) was amplified using HotStar Taq® DNA
polymerase (Qiagen) and gene-specific primers (Table 2-1) in a 20 μl reaction (1x
Qiagen Coral PCR buffer, 200 μM dNTPs, 0.2 μM forward (MTO3182) and reverse
(MTO3204 biotinylated) primer and 2.5 U/reaction of HotStar Taq). Thermocycling
conditions included a 95°C incubation for 5 min followed by 49 cycles of 94°C for 45
sec, primer annealing for 45 sec at 72°C for 2 min, followed by a final extension at 72°C
for 10 min. PCR amplification of a single PCR reaction was confirmed by Tris-acetate-
EDTA agarose gel electrophoresis in the presence of 0.5 μg/ml ethidium bromide.
Amplified DNA (~5 μg) was purified with streptavidin-coated Sepharose beads
and subjected to pyrosequencing using a PyroMark ID instrument per the
manufacturer’s instructions. Pyrosequencing assays were tested for amplification bias
on a set of five standards containing mixtures in the ratios of 100:0, 75:25, 50:50, 25:75,
and 0:100 of wild-type BAC16 DNA isolated from E. coli (and hence unmethylated at
CpG sites) to methylated in vitro to completion by the CpG methyltransferase M.SssI.
These mixtures were supplemented with a mass of host cell genomic DNA to
approximate a KSHV copy number of 10. Primers used for pyrosequencing are listed in
Table 2-1.
58
Results
A Pyrosequencing Amplicon to Target +1 Linker Downstream of Three Tandem CTCF Sites at LANA Promoter
My goal was to measure the DNA methylation status in the LANA ORF (+1/+2
nucleosomal linker) to assess the rate of DNA methylation accumulation on the episome
post de novo infection with KSHV. Previously published and unpublished studies of
others in the Kladde and Renne laboratories determined that DNA methylation is highly
organized downstream of a cluster of three CTCF sites in the LANA transcribed region
(Darst et al., 2013). These results showed strong peaks of DNA methylation oscillating
approximately every 150 bp (size of nucleosome repeat) in the LANA ORF in BCBL-1
cells. However, these cells are long-term latently infected from a human patient that was
likely infected for many years prior to presentation of PEL and have subsequently been
cultured for many years. It is therefore not possible to assess how long it took for DNA
methylation to accumulate significantly over background at the LANA ORF.
A previous, published study used methylated DNA immunoprecipitation (MeDIP)
followed by high-resolution tiling microarray analysis to measure CpG methylation levels
over the KSHV genome in multiple cell lines, including BCBL-1, long-term infected SLK
(approximately 240 dpi), and short-term infected SLK (5 dpi) (Figure 2-1) (Günther and
Grundhoff, 2010). These data suggest that KSHV accumulates DNA methylation over
the course of many days or months following de novo infection. Slow accumulation of
DNA methylation on KSHV episomes may avoid inappropriate silencing of latency
genes and/or eventually reinforce the suppression of lytic genes during long-term
infection (Lu et al., 2010).
59
I wished to better define the time course of KSHV methylation in SLK cells and
determine if other cells lines supported more rapid accumulation of the modification,
which would facilitate further investigation of de novo methylation. To do so, methylation
in three different cell lines (iSLK, TIVE, and HEK293T) were tested over a 150-day time
course of KSHV infection (Figure 2-2A).
Pyrosequencing technology is a commonly used method for analysis of site-
specific DNA methylation (Figure 2-2B). Briefly, the method involves bisulfite
sequencing in a reaction containing DNA polymerase, ATP sulfurylase, luciferase, and
apyrase. For each mole of dNTP incorporated into the newly synthesized strand by
DNA polymerase, one mole of pyrophosphate (PPi) is released. The generated PPi is
converted to ATP by ATP sulfurylase, which drives the generation of light by luciferase
that is detected and displayed as a peak on a pyrogram. The primers used for
pyrosequencing assay are shown in Table 2-1. The pyrosequencing amplicon was
117 bp in size and contained 7 CpG sites in the linker of the +1/+2 nucleosomes (Figure
2-3A), which showed the first peak of methylation downstream of the three CTCF sites
(Figure 1-6C).
DNA Methylation Gradually Increases and at a Faster Rate within the KSHV LANA +1/+2 Nucleosome Linker in HEK293T than in SLK or TIVE Cells after KSHV Infection
Total genomic DNA from iSLK and TIVE cells infected with KSHV was obtained
at various time points after infection (generously supplied by Vaibhav Jain in
Dr. Renne’s laboratory). Total DNA from the KSHV-infected PEL line BCBL-1 was used
as a positive control for KSHV methylation, as nearly 100% methylation of each of the
seven CpG sites in the pyrosequencing amplicon was previously observed (Darst et al.,
2013). As a negative control, linear KSHV DNA purified from viral capsids, which
60
contains no detectable DNA methylation, was used. Data from control BCBL-1 cells
showed 100% methylation of only two (of seven) assayed CpG sites (Figure 2-3B).
HEK293T cells de novo infected with WT KSHV gradually accumulated DNA
methylation within the +1/+2 linker region. At 150 dpi, CpG site 4 exhibited the highest
level of methylation at 35% (Figure 2-3B). Figure 2-3C shows low levels of methylation
at the +1/+2 linker region in TIVE and iSLK cells de novo infected with WT KSHV.
These data suggest that iSLK and TIVE cells do not highly express de novo DNMTs to
establish methylation. Alternatively, iSLK and TIVE cells may express high levels of Tet
proteins that actively demethylate DNA through oxidation of 5-methylcytosine to 5-
hydroxy-methylcytosine (Pastor et al., 2011). Therefore, these data show that there is a
clear difference in how DNA methylation is established on KSHV in different cell lines.
Based on these pyrosequencing results, the KSHV-infected HEK293T cells needed to
be passaged for at least 150 dpi to measure adequate levels of DNA methylation. The
use of next-generation sequencing of bisulfite-converted amplicons will be used in
subsequent chapters to generate many sequenced molecules for clustering populations
of chromatin structures as well as offer statistical analysis.
Closing Remarks
KSHV displays strong host cell tropism towards lymphatic endothelial cells. B-cell
lines are the ideal host cell line for KSHV virions to establish and maintain long-term
latency in humans. Additionally, the infection of KSHV of these B-cell lines is associated
with two B cell-derived lymphoproliferative disorders, PEL (Cesarman et al., 1995a;
Cesarman et al., 1995b) and multicentric Castleman’s disease (MCD) (Soulier et al.,
1995). In PEL cells, such as BCBL-1, KSHV episomal DNA is detected in B-cell tumors
and these cells can be clonally expanded in cell culture. Cells derived from B-cell
61
tumors, can maintain KSHV episomes that are in latency, but lytic infection can be
induced by chemicals targeting the KSHV episome chromatin structure. Therefore,
KSHV infection in vivo is predominantly lymphotropic.
Even though PEL cells have contributed largely to the understanding of KSHV
biology, PEL cells cannot be used to study KSHV de novo infection and transformation
in respect to establishment of long-term latency. It is interesting to note that B cells can
be infected with KSHV virions in cell culture, but the de novo infection does not lead to
long-term episomal maintenance or cellular transformation (Bechtel et al., 2003).
However, EBV, another related gamma-herpesvirus, can transform B cells and
establish/maintain long-term latency. At this time, the differences between KSHV and
EBV in in vitro infection of B cells to maintain long-term latency are unknown.
In vitro infection of cells in culture with KSHV virions can occur in multiple
different cell lines with different tissue origins. HEK293T cells have been used recently
to study KSHV de novo infection and episomal latency. A study performed by Renne
and colleagues in 1998 showed there are clear differences between BCBL-1 cells (long-
term latently infected cells) and de novo-infected HEK293T cells in viral transcription
pattern following TPA induction (Renne et al., 1998). It is possible that these differences
in viral transcription patterns could be due to HEK293T cells being of epithelial origin,
whereas BCBL-1 is of endothelial origin. KSHV virions could readily infect HEK293T
cells, suggesting that these cells possess either a cell surface receptor or entry
mechanism for KSHV infection. HEK293T cells also show the ability for KSHV infection,
which supports the entry of virions into an epithelial cell line and also shows
transcription of viral-specific genes. Even though KSHV infection in HEK293T cell is
62
less efficient compared to B cell infection, it is highly reproducible. Therefore, for these
reasons, I decided to include HEK293T cells among my possible cell lines to use to
study de novo methylation. Other labs in the KSHV biology field have also used
HEK293T cells in their studies, so I am confident that the use of this cell line will not be
controversial to interpreting my results.
My results show that HEK293T cells infected with KSHV virions establish DNA
methylation gradually in a linear fashion (Figure 2-3D), with an R2 value of 0.905 from
30 dpi to 150 dpi. However, iSLK and TIVE cells showed little to no accumulation of
DNA methylation compared to HEK293T cells. A possible reason for infection of
HEK293T cells leading to higher levels of linker DNA methylation than those observed
in iSLK or TIVE cells is that HEK293T cells are derived from a human embryonic kidney
and may have higher expression of DNMT3A and/or DNMT3B, the de novo
methyltransferases, or DNMT3L. The KSHV miRNA K12-4-5p, expressed during
latency, has also been shown to suppress RTA as well as upregulate DNMT3A activity
in HEK293T cells (Lu et al., 2010). Therefore, high levels of expression of this KSHV
miRNA in HEK293T cells than in TIVE or iSLK cells may explain the increased rate of
de novo methylation at the +1/+2 nucleosomal linker in HEK293T cells.
It is also interesting to note that, in the pyrosequencing amplicon, CpG sites 4
and 6 within the +1/+2 nucleosomal linker of KSHV LANA are more preferentially
methylated in the BCBL-1 control as well as in the infected HEK293T cells. These two
CpG sites are separated by 20 bp or approximately two helical turns of DNA, suggesting
efficient methylation of sites on the same face of the DNA helix as previously reported
(Cheng and Blumenthal, 2008; Chodavarapu et al., 2010). The well-positioned
63
nucleosomes downstream of the CTCF sites in BCBL-1 cells can possibly serve as
substrates for de novo DNMT binding, preferentially position the active site, and
methylate linker DNA. However, further biochemical experiments must be performed to
verify that CpG site 4 and 6 are preferentially methylated based on positioning within the
linker. Details regarding the types of experiments to perform will be explained in
Chapter 5 of this dissertation.
Table 2-1. Pyrosequencing primers for amplification and sequencing of the +1/+2 linker
in the LANA transcribed region
Gene Primer name Primer sequence (5' to 3')
vLANA +1/+2 linker
MTO3182seq (+) GGTATAGGtAAGGTGTGGGGTtt
MTO3183 (-) Biotin/aCCACCrCCTCCATAATTTTACTT MTO3204 (-) Biotin/AAACAaaTCTCCraAAAaATaTaACCTTaa seq = Sequencing primer used for pyrosequencing r nucleotide indicates A or G nucleotide (+) indicates forward primer (-) indicates reverse primer Lower case t denotes C to T transition that had initially paired with uracils (converted cytosines) during the first PCR extension
64
Figure 2-1. Global DNA methylation patterns of latent KSHV genomes. A 2010
publication by Günther and Grundhoff performed MeDIP (methylated DNA immunoprecipitation) followed by microarray of a long-term latently infected PEL cell line (BCBL-1; blue trace), epithelial-infected SLKp (240 dpi; red trace), SLK (5 dpi; orange trace), and in vitro CG-methylated BACmid (BacM; brown trace) control. Shown is the fraction of CpG methylation from one-half (70 kb) of the KSHV episome. Highlighted in a cyan rectangle is the LANA promoter and ORF (ORF73) enlarged at the bottom. (Figure adapted and modified from Günther and Grundhoff, 2010).
65
Figure 2-2. Experimental overview to measure de novo methylation of KSHV post-
infection in multiple cell lines using pyrosequencing. A) Schematic work flow of time course to measure DNA methylation every 30 dpi at the +1/+2 linker in the LANA ORF of wild-type KSHV using three different cell lines. B) Schematic of the principle of pyrosequencing analysis of single-stranded DNA templates by synthesizing complementary strands. Briefly, nucleotides are dispensed in a specific order by the pyrosequencing machine and covalently added to the primer annealed to the deaminated DNA template. Pyrophosphate (PPi) is released when a complementary nucleotide is incorporated. PPi is then converted to light in coupled enzyme-catalyzed reactions. The quantity of light emitted is proportional to the number of incorporated nucleotides. (Figure reproduced with permission from England and Pettersson, 2005).
66
Figure 2-3. De novo methylation time course of KSHV LANA +1/+2 nucleosomal linker downstream of CTCF sites in three different KSHV-infected cell lines. A) Landscape of the LANA ORF and pyrosequencing amplicon. Vertical tick marks indicate CpG sites and blue circles indicate the biotin tag. B) DNA methylation of +1/+2 LANA linker in HEK293T infected cells every 30 dpi up to 150 dpi. BCBL-1 plotted in blue as positive control. C) DNA methylation of +1/+2 LANA linker in iSLK (30 and 60 dpi) and TIVE (60 and 90 dpi) cells de novo infected with WT KSHV. D) Mean DNA methylation of pyrosequencing amplicon from each time point in each KSHV-infected cell line. R2 = 0.905 calculated for HEK293T cells and plotted with gray line.
67
CHAPTER 3 GENERATING AND CHARACTERIZING MUTANT KSHV CONTAINING
DISTRUPTIONS IN THE CTCF BINDING SITES AT THE LANA PROMOTER USING BACMID RECOMBINATION
Introductory Remarks
Insulators, such as those containing CTCF, are known to be chromatin boundary
elements that also position arrays of well-positioned nucleosomes. Recently, it has been
shown that the linkers between these well-positioned nucleosomes are methylated in
mES cells, IMR90 cells, GM12878 cells, and on the KSHV episome in BCBL-1 cells,
specifically at the LANA transcribed region (Darst et al., 2013; Kelly et al., 2012). There
is a cluster of three CTCF binding sites located between the LANA promoter and
translational start site, where the LANA promoter is void of DNA methylation and the
LANA ORF contains linker-restricted DNA methylation. It is known that CTCF, along
with cohesins, at the LANA promoter make looped contacts with other regions in the
KSHV episome, and is thought to protect the KLAR region from heterochromatin and
regulate KSHV latency (Kang et al., 2011; Stedman et al., 2008). The purpose of this
chapter is to determine the effect of CTCF binding on nucleosome positioning, linker-
restricted DNA methylation in the LANA ORF, and regulation of viral latency. To test the
effect of abolishing local CTCF binding at LANA promoter, I implemented BACmid
recombination techniques to create a deletion CTCF binding sites mutant (154 bp
deletion) and a mutant containing a replacement of each of the three CTCF sites with a
LexA operator (lexO) sequence.
Recombinant KSHV BACmids were constructed using the BACmid technology
(Tischer et al., 2006). This method is based on a BACmid carrying the entire KSHV
genome (Brulois et al., 2012). The BAC contains a bacterial F-plasmid origin of
68
replication as well as a selection marker (chloramphenicol resistance gene), thereby
allowing clonal propagation in E. coli. Mutations (deletion, insertion, or point mutation)
can be introduced into the KSHV genome-containing BACmid DNA by homologous
recombination in E. coli. Thereafter, positive recombinant BACmids carrying a modified
KSHV genome can be transfected into several different cell lines for the reconstitution of
infectious virus.
In early studies creating KSHV mutant viruses, the KSHV BAC36 BACmid was
used for recombination experiments. However, in a 2010 publication, it was determined
that the KSHV BAC36 contained a large duplication of the KSHV genome in its long
terminal repeats (LTR) (Yakushko et al., 2011). In order to obtain more accurate results,
Dr. Jae Jung’s laboratory generated another KSHV-containing BAC system (BAC16)
without duplications or deletions in the KSHV episome. Dr. Jae Jung’s laboratory kindly
provided the BAC16 to Dr. Rolf Renne’s lab, which was used for all the BACmid
recombination experiments. BAC16 was derived from JSC-1, a PEL cell line with a high
virus titer, and includes a pBelo45 backbone flanked by vIRF-1 and ORF57. This
backbone contains a GFP marker and a gene conferring hygromycin B resistance in
mammalian cells as well as chloramphenicol resistance for selection and an origin of
replication for BACmid propagation in E. coli. A two-step double recombination
technique was used to first delete 154 bp of KSHV DNA (three tandem CTCF sites and
the sequences between each site) in the wild-type BAC16 genetic background. The
deletion mutant was then used to create the lexO replacement mutant (in deletion
mutant BAC16 background), because the sequence homology and the lexO repeat
sequences would create problems during intermolecular recombination. The lexO
69
sequence used is an imperfect 20 bp palindrome with consensus LexA-binding
sequence (TACTGTATGAGCATACAGTA) and was strategically to replace each of the
three CTCF binding sites (Bi et al., 2004). In future studies (discussed in Chapter 5), the
prokaryotic LexA protein can be exogenously expressed in cells harboring KSHV with
the lexO sites. This would test the extent to which the LexA2-lexO interaction can serve
as a boundary/anti-nucleosome element, reconstitute barrier function, and organize
positioned nucleosomes in the absence CTCF. In addition, LexA binding protein is a
good system for making fusion proteins to regions of the CTCF protein to test if they are
necessary and/or sufficient to reestablish nucleosome positioning, DNA methylation,
etc.
A significant level of spontaneous KSHV lytic reactivation occurs in most existing
PEL cell lines (Renne et al., 1996a). Earlier, Dr. Renne and colleagues observed that
recombinant virus could not be produced from transfected HEK293T cells after thawing
from frozen stocks. Also, the amount of virus production decreases with time of
passaging the transfected HEK293T cells.
To circumvent these problems and generate large amounts of infectious virus,
iSLK cells, which contain a doxycycline-inducible RTA expression cassette, were
derived from the original epithelial SLK cells and provided by Don Ganem (Sturzl et al.,
2013). RTA, the major immediate-early lytic gene needed for reactivation, is the latent-
lytic switch encoded by ORF50. Ectopic expression of RTA leads to the induction of
cells latently infected with KSHV (Xu et al., 2005). Inducible RTA cells were produced
by transducing SLK endothelial cells with a RTA expression construct which is tightly
regulated by a promoter bearing a tet operator sequence (Siegal et al., 1990). Cells
70
were also transduced with tet-on transactivator, which can be activated by doxycycline.
iSLK cells have been also demonstrated to be a good model for studying maintenance
of KSHV latency. When virus is required in sizeable quantity, infected iSLK cells or a
frozen-thawed stock can be induced by addition of doxycycline and sodium butyrate.
Kladde and colleagues have previously published data showing that CTCF
organizes arrays of well-positioned nucleosomes with linker-restricted methylation in the
LANA transcribed region (Darst et al., 2013). It has also been shown that global
depletion of CTCF by siRNA or shRNA has resulted in spontaneous lytic reactivation of
KSHV (Li et al., 2014). In order to study the local chromatin architecture at the LANA
promoter, my strategy was to locally abolish CTCF binding at the LANA promoter by
using BACmid recombination. I first deleted the entire 154 bp CTCF binding sites
(deletion mutant) and then used this mutant BAC to create a lexO mutant, where lexO
sequences precisely replaced each of the three CTCF binding sites and retained the
wild-type sequences between the lexO sites. Since the lexO sites are imperfect
palindromic repeats and thus subject to intermolecular recombination during BACmid
recombination, it was vital to delete the 154 bp CTCF binding region prior to generating
the lexO-containing KSHV mutant. The lexO-containing replacement sequence was
synthesized by Genscript (1,288 bp total) and cloned into pUC57. The synthesized
sequence was strategically designed: 50 bp of upstream homology was placed
upstream of the three tandem lexO sequences followed by 40 bp of downstream
homology, then the kanamycin resistance gene (992 bp), and finally 50 bp of
downstream homology at the 3' end of the construct. This strategy was implemented to
71
correctly recombine out the kanamycin cassette after the second Red recombination
and insert the lexO sites to replace the deleted CTCF binding sites.
Materials and Methods
Two-step Red-mediated Recombination Overview
The two-step Red-mediated recombination protocol was developed by Dr. Jae
Jung’s laboratory at the University of Southern California (Tischer et al., 2006). E. coli
GS1783 cells were used to facilitate two rounds of homologous recombination. This
strain contains the temperature-inducible Red recombination enzymes (required for first
intermolecular and second intramolecular recombination) and an arabinose-inducible I-
SceI restriction enzyme (required for generating the double-strand break for the second
intramolecular recombination).
In the first round of recombination, the region of the LANA promoter containing
the three CTCF binding sites was targeted initially for replacement and then the
replacement sequence was deleted. Deletion primers (Table 3-1; ultramers ordered
from IDT) to amplify the kanamycin-selectable marker (from pEP-KanS) were designed
with sequences flanking the CTCF binding sites. The resultant targeting fragment was
designed to replace the region containing the three CTCF binding sites with the
kanamycin-selectable marker via intermolecular homologous recombination when Red
expression was induced at 42°C. Clones were screened for kanamycin cassette
insertion, and the quality of BAC terminal repeats (TRs) was determined by the
presence of the 30 kb fragment on the pulse-field gel electrophoresis (PFGE) after NheI
digestion.
For the second round of recombination, clones containing both the kanamycin
cassette and intact TRs were selected. Clones were grown in LB-chloramphenicol
72
media and arabinose was added to induce the expression of the I-SceI restriction
enzyme, which creates a double-strand break at the insertion site of the kanamycin
cassette to linearize the BACmid. This linearized BACmid is then used as the substrate
for intramolecular homologous recombination resulting in excision of the kanamycin
marker. Clones were further selected for chloramphenicol resistance and kanamycin
sensitivity to screen for removal of the marker cassette. Finally, the clones were verified
for deletion of the 154 bp region by PCR and the quality of intact BAC TRs was
analyzed by PFGE.
Primer Design for Replacement and Deletion of CTCF Binding Sites
Deletion primers (Table 3-1) were designed with sequences to replace the region
containing the three tandem CTCF binding sites at the LANA promoter, followed by
deletion of the replacement insertion. The forward primer contained homology
sequences 40 bp upstream of the site of deletion or insertion (lexO sequences) and
20 bp of homology downstream of the site of deletion. At the 3' end of the primer, 20 bp
corresponding to the kanamycin cassette were added for a primer of 80 bp total in
length. The reverse primer was similar except that it contained 20 bp of homology
sequence upstream of the CTCF binding deletion site followed by 40 bp of homology
sequence corresponding to the region downstream of the insertion or deletion site. The
targeting fragment generated using deletion primers contain a duplication of 20 bp both
upstream and downstream of the three CTCF binding sites at both ends of the
fragment. Upon linearization of KSHV BACmid with arabinose-inducible I-SceI,
substrates for second Red-mediated intramolecular homologous recombination would
be generated for the excision of the kanamycin marker.
73
Generation of Targeting Fragment for First Red Recombination
PCR was carried out using Phusion high-fidelity polymerase (NEB) according to
manufacturer’s instructions except for the following changes. No dimethyl sulfoxide was
added to the PCR reaction, only 1 ng of pEP-KanS template was used per 50 µL of
PCR reaction, and only 20 cycles of PCR were conducted to minimize the possibility of
mutation. The primers used in this reaction were obtained from IDT and designed
according to the procedure explained in the previous section (Table 3-1). To amplify the
fragment containing the three lexO sequences and kanamycin cassette (synthesized by
Genscript), primers were designed to amplify only the synthesized sequence for inter-
molecular recombination. Three 50-µL PCR reactions were pooled together and 3 µL of
DpnI restriction enzyme were added for 2 hr at 37°C to digest the template plasmid. The
PCR product was electrophoresed on a 1% (w/v) agarose TAE (Tris-acetate-EDTA) gel
and purified using a Qiagen gel purification kit.
Generating Electrocompetent GS1783 E. coli
A 2-mL overnight culture of E. coli strain GS1783 containing KSHV BAC16 was
inoculated into 40 mL LB-chloramphenicol (15 µg/mL) in a sterile 250 mL flask. Bacteria
were grown at 220 rpm at 30°C until reaching an optical density (O.D.) of 0.5. Induction
of Red expression was carried out by shaking the flask vigorously in a 42°C water-bath
for 10 min. Immediately after the 10 min incubation, the culture flask was placed on ice
for 10 min. The culture was transferred with ice-cold pipettes into 15 mL ice-cold culture
tubes and centrifuged at 3000 x g at 4°C for 5 min. Cells were then washed three times
with sterile, ice-cold ddH2O (double-distilled water). At the end of the last wash, cells
were resuspended in the water remaining in the tubes. These electrocompetent cells
74
were then used for electroporation of the targeting fragment to achieve the first Red
recombination.
First Red Recombination
Gel-purified targeting fragment (100 ng) was mixed with 40 µL of
electrocompetent GS1783 E. coli in a pre-chilled 1 mm cuvette by tapping the tube.
Electroporation was performed using a Bio-Rad gene pulser XCell apparatus at settings
of 1.5 kV, 25 µF, and 200 Ω. The time constant of the pulse was observed in the range
of 3.5 to 4.5 to achieve successful electroporation. 250 µL of SOC media was added to
the cuvette after the pulse and cells were recovered from the pulse shock in an
Eppendorf tube at 30°C at 220 rpm for 1 hr. After recovery, 200 µL of the cells were
spread on LB-kanamycin plates and incubated at 30°C for 24 hr.
Screening of First Red Recombinants
Positive integrants from the first Red recombination, with either correctly targeted
replacement of the CTCF sites region with the kanamycin cassette alone or with
insertion of the lexO3 fragment plus kanamycin cassette, were identified using colony
PCR. The lengths of intact TRs were also confirmed using PFGE. Colonies from the
first Red recombination were grown overnight in 5 mL LB-kanamycin to verify insertion
of the kanamycin marker. Overnight mini-cultures were also streaked on kanamycin
plates to prepare the master plate. BAC DNAs were isolated using Qiagen mini-prep kit
as per the manufacturer’s instructions. Colony PCRs to determine insertion of the
kanamycin cassette were performed with Taq DNA polymerase according to the
manufacturer’s instructions using primers in Table 3-1. PCR products were analyzed by
electrophoresis on a 1% (w/v) agarose TAE gel to visualize the length of the
amplification product to confirm the insertion of targeting fragment.
75
Second Red Recombination
Three kanamycin-resistant clones from the first Red recombination plate that
contained intact TRs were grown in an overnight LB culture containing kanamycin. Two
milliliters of the overnight culture were inoculated in 40 mL of LB-chloramphenicol media
and grown at 30°C at 220 rpm. When the culture reached an O.D. of 0.5, arabinose was
added to a final concentration of 2% (w/v) and cells were further grown for 45 min at
30°C with 220 rpm shaking to induce I-SceI expression. I-SceI restriction enzyme was
used to linearize the KSHV BAC16 at the site of the kanamycin cassette insertion by
creating a double-strand break. Induction of Red recombinase enzymes was performed
by shaking the cell culture vigorously in a 42°C water bath for 10 min. This was followed
by 2-hr growth at 30°C to facilitate intramolecular homologous recombination, leading to
excision of the kanamycin cassette. After the 2-hr incubation, a series of 10-fold
dilutions were plated on LB plates containing 15 µg/mL chloramphenicol and 1% (w/v)
arabinose and incubated at 30°C for 24-48 hr.
Assessment of Intact TRs
Purified, recombinant KSHV BAC DNA was digested with NheI restriction
enzyme for at least 2 hr at 37°C and subsequently analyzed by PFGE. To prepare the
PFGE gel, 1% (w/v) megabase agarose was dissolved in 0.5x TBE (Tris-borate-EDTA)
buffer and electrophoresed in 0.5x TBE at 8°C for 16 hr at a maximum voltage of 6 V.
The quality of the TRs was determined by comparing digestion patterns of mutant BAC
clones with that of WT BAC16. Clones that contained kanamycin cassette insertion,
intact terminal repeats, and a similar banding pattern to that of the wild-type BAC were
chosen for second Red recombination. After the second Red recombination, another
76
analysis of intact TRs was performed to verify that the TR was not recombined out of
the BAC.
Verification of Deletion or Insertion at the CTCF Binding Sites at LANA Promoter
Clones from the second Red recombination were replica plated on LB agar
plates supplemented with 1% (w/v) arabinose along with chloramphenicol or kanamycin.
Clonal BAC DNA was isolated from cells that were chloramphenicol resistant but
kanamycin sensitive. PCR was performed using verification primers in Table 3-1 and
the products were electrophoresed on a 1% (w/v) TAE agarose gel to verify deletion of
the 154 bp CTCF binding sites region or insertion of the 154 bp region containing three,
tandem lexO sites. PCR products of the correct size were gel purified and further
verified by Sanger sequencing. Sanger sequencing alignment spanning the entire
deleted or inserted region is shown in Figure 3-3. All clones showed the expected
sequence.
Cell Lines and Culturing
HEK293T cells (obtained from ATCC) were freshly thawed from a liquid nitrogen
frozen stock and maintained in complete-DMEM (DMEM medium supplemented with
10% (v/v) FBS and 1% (w/v) penicillin/streptomycin). Cells were grown at 37°C in a 5%
CO2 incubator. Cells were sub-cultured every three days by first trypsinizing them with
1 mL 0.25% (w/v) trypsin-EDTA and diluting the cells 10-fold with fresh complete-
DMEM. All transfected and infected HEK293T cells were grown under 100 µg/mL
hygromycin B selection. iSLK cells were maintained in complete DMEM mediu,
(supplemented with 10% (v/v) FBS and 1% (w/v) penicillin/streptomycin) with 100 µg/mL
of both G418 and puromycin. Infected iSLK cells were propagated under additional
selection of 1.2 mg/mL hygromycin B.
77
Isolation of Wild-type (BAC16), CTCF Binding Site Deletion and Replacement KSHV Recombinant BAC for Transfection
Glycerol stocks of KSHV BAC clones harboring deletion (154 bp) of the CTCF
binding site region at the LANA promoter or replacement (154 bp with three, tandem
lexO sites) were thawed and inoculated in 500 mL LB-chloramphenicol overnight. BAC
DNA was prepared using the Qiagen large-construct kit (Catalog #12462) according to
manufacturer’s instructions.
Transient Transfection of HEK293T Cells
HEK293T cells were plated in 6-well plates at the cell density of 3 x 105 cells in a
total of 2 mL DMEM complete media. Cells were incubated in the 5% CO2 incubator at
37°C for 24 hr prior to transfection. Transfection was performed using 293 Mirus-IT
according to manufacturer’s instruction. Briefly, 3 µL of Mirus Trans-IT reagent was
mixed with 200 µL of serum-free DMEM and incubated at room temperature for 20 min.
3 µg of purified KSHV BAC DNA was added to the mixture, mixed and incubated at 30
minutes at room temperature. Then 200 µL of the transfection reaction mixture was
added drop wise to each well. The plate was then incubated for 24-48 hr in a 5% CO2
incubator at 37°C. After 24-48 hr post-transfection, cells were observed for GFP
expression under fluorescence microscopy to determine transfection efficiency. Once
BAC DNA was transfected into HEK293T cells, as confirmed by GFP expression,
100 µg/mL of hygromycin B was added to select for BAC transfected cells.
Isolation and Quantification of Recombinant Virus
Filtrate media containing wild-type or recombinant virus was pipetted drop-wise
on top of 25% (w/v) sucrose cushion and subjected to ultracentrifugation at 110,000 x g
for 1 hr at 4°C. Pellets containing virus were resuspended in 1% of the original filtrate
78
volume using serum-free DMEM to make the virus stock that was stored at -80°C. of
Recombinant virus (25 µL) was used to isolate DNA for further quantification using
DNAzole® according to manufacturer’s instructions. Viral DNA was resuspended in
25 µL of ddH2O and 1 µL was used per qPCR reaction. Real-time qPCR (qPCR) was
performed using five, 10-fold serial dilutions of pcDNA3.1-ORF73 plasmid as standards
along with primers specific for the 5' of the LANA (ORF73) transcribed region. qPCR
was performed using Fast SYBR Green according to the manufacturer’s
recommendations (Applied Biosystems). Viral genome copy number was determined by
comparing the threshold cycle (Ct) of sample DNA to the plasmid standard curve.
De Novo Infection of iSLK Cells
iSLK cells were seeded at 100,000 cells in 500 µL DMEM-complete media into
24-well plates 14-16 hr prior to infection. Virus stock (500 µL) obtained from transfected
HEK293T cells was added to cells along with 4 µg/mL of polybrene. Polybrene is a
small, positively charged polymer that increases efficiency of viral infection by
neutralizing surface charges on the cell. Cells were incubated with virus for 12 hr, then
extracellular virus was removed and fresh media was added. Cells were screened for
GFP expression 24 hr post infection. Infected iSLK cells were then incubated and
monitored for several days post infection. Cells were washed with phosphate buffered
saline (PBS), dislodged from the plate surface by trypsinization, and transferred to
6-well plates in the presence of 1.2 mg/mL of hygromycin B to select for infected cells.
Cells were allowed to recover from selection, expanded in number, and frozen cell
stocks were made and stored in liquid nitrogen.
79
Induction of Virus Using iSLK Cells
Once infected iSLK cells reached 80-90% confluency in 15 cm plates, enveloped
virus production was induced by adding 1 µg/mL doxycycline (to induce RTA
expression) and 1 mM sodium butyrate, a HDAC inhibitor. Virus was harvested 4 days
post induction from cell culture media using a 0.45 µM filter followed by ultra-
centrifugation (110,000 x g for 1 hr) on a 25% (w/v) sucrose cushion and quantified by
real-time qPCR.
Chromatin Immunoprecipitation (ChIP)
The purpose of immunoprecipitation of CTCF protein in cross-linked chromatin
was to determine if the mutations of the LANA CTCF binding sites, both their deletion
and replacement, ablated CTCF occupancy. Briefly, KSHV-infected cells were fixed in
PBS with 1% (v/v) formaldehyde for 10 min. The reaction was stopped by the addition of
glycine to 0.125 M final. Cross-linked cells were then washed in ice-cold 1x PBS twice
and collected. Cell pellets were resuspended in Farnham cell lysis buffer (5 mM PIPES
pH 8.0, 85 mM KCl, 0.5% (v/v) NP-40 (filter 0.22 micron filter) with protease inhibitor
cocktail at 1 mL for every 107 cells and incubated on ice for at least 10 min with gentle
vortexing every 2 min. The nuclei pellet was resuspended in sonication (RIPA) buffer
(1% (v/v) NP-40, 0.5% (v/v) sodium deoxycholate, 0.7% (w/v) SDS in 1x PBS filtered
0.22 micron filter unit) with freshly added protease inhibitor cocktail. Chromatin was then
sonicated to fragments of mean length of 200 to 400 bp using a Diagenode Bioruptor
according to the manufacturer’s protocol and as empirically optimized. Depending on
the cell line, sonication parameters ranged from 25 cycles to 40 cycles at 30 sec on/30
sec off on the medium intensity setting. The sonicated samples were then diluted in
ChIP buffer (0.01% (w/v) SDS, 1% (v/v) Triton X-100, 1 mM EDTA, 20 mM Tris, pH 8.0,
80
and 150 mM NaCl) and incubated with antibodies (e.g., rabbit anti-CTCF from Cell
Signaling #3418, mouse anti-H3K27me3 Millipore, mouse anti-histone H3 Abcam,
mouse anti-H3K4me Abcam and anti-IgG from Abcam) overnight at 4°C with gentle
rotation. An aliquot of 100% input sample was kept at 4°C and processed with the other
immunoprecipitates on the next day. Then immunoprecipitated samples were incubated
with either protein A/G-coated agarose (Santa Cruz) or magnetic beads (Pierce) that
were blocked with BSA and washed with ChIP buffer. The immunoprecipitates
conjugated to beads were then subjected to a series of washes to remove nonspecific
binding material. The three washes included (in order): Low Salt buffer (0.1% (w/v)
SDS, 1% (v/v) Triton X-100, 2 mM EDTA, 20 mM Tris-HCl, pH 8.0, and 150 mM NaCl)
wash, High Salt buffer (0.1% (w/v) SDS, 1% (v/v) Triton X-100, 2 mM EDTA, 20 mM
Tris-HCl, pH 8.0, 500 mM NaCl) wash, LiCl buffer (0.25 M LiCl, 1% (v/v) NP-40, 1%
(v/v) sodium deoxycholate, 1 mM EDTA, and 10 mM Tris-HCl, pH 8.0) wash, and two
1 TE washes. The chromatin bound to the beads was then eluted off the beads with
Elution buffer (0.1 M NaHCO3, 1% (w/v) SDS) at 65°C for 1 hr with shaking at 300 rpm.
Cross-links in the eluted chromatin were reversed with 0.2 M NaCl, proteinase K and
RNase A treatment overnight at 65°C. After reversal of cross-links, DNA samples were
purified using the Qiagen PCR purification kit and the enrichment of specific genomic
regions were determined by real-time qPCR. PCR data were normalized to input values
and final results represent percentage of input chromatin and error bars indicate
standard deviation from triplicate experiments.
81
RNA Isolation of KSHV-infected Cells for Gene Expression Analysis
Total RNA from 3-5 x 106 cells was extracted using TRIzol Reagent (Ambion)
according to the manufacturer’s instructions, purified using chloroform phase
separation, and analyzed by agarose gel electrophoresis to verify purity and integrity of
ribosomal RNA. Final concentrations of total RNA were obtained using a NanoDrop
spectrophotometer. RNA (3 µg RNA total in 100 µL) was treated with RNase-free
DNase-I (New England Biolabs) for 30 min at 37°C. The reaction was then incubated at
75°C for 10 min and stored at -80°C. Reactions for cDNA synthesis were carried out
with 1.5 μg of total RNA and oligo dT primers using TaqMan® reverse transcription
reagents (Applied Biosystems) with the accompanying Superscript III (Invitrogen)
reverse transcriptase. Control reactions with no added reverse transcriptase cDNA
reactions were performed for each sample. SYBR green master mix (Applied
Biosystems) was used for qRT-PCR using a Step One real-time thermocycler.
Concentrations of each sample were calculated using a standard curve for
quantification. Expression values for each gene analyzed were normalized to
glyceraldehyde-3-phosphate (GAPDH) and β-actin transcript levels.
Western Blotting
Isolation of protein from KSHV-infected and/or uninfected cell lines were
prepared using cell lysis RIPA buffer. Briefly, cells (~1 x 106) were collected by
trypsinization and centrifuged at 1,000 x g for 5 min. Supernatants were aspirated and
the cell pellet was washed with ice-cold PBS twice to remove any residual FBS. Cells
were then lysed by resuspending the cell pellet in 100 µL RIPA lysis buffer [1% (v/v)
Triton X-100, 150 mM NaCl, 25 mM Tris, pH 7.5, 1 mM glycerol phosphate, 1 mM
sodium fluoride, and 1x Complete Mini Protease Inhibitor Cocktail (Roche Applied
82
Science)] as previously described (Nabilsi et al., 2009). Cells were passively lysed for
1 hr 4°C (on ice) and lysates were then centrifuged for 10 min at 14,000 x g at 4°C to
pellet insoluble protein/debris. Supernatants were saved, quantified by Bradford assay,
and denatured by boiling for 5 min in SDS-PAGE sample buffer (50 mM Tris-HCl,
2% (w/v) SDS, 0.1% (w/v) bromophenol blue, 10% (v/v) glycerol, and 5% (v/v)
β-mercaptoethanol). Protein samples (40 μg) were then resolved by SDS-PAGE, and
electrophoretically transferred to PVDF membranes using iBlot (Invitrogen) according to
manufacturer’s instructions. Membranes were blocked with 5% (w/v) non-fat milk in
TBS-T (Tris-buffered saline, 0.1% (v/v) Tween 20) at room temperature for 1 hr, then
incubated overnight at 4°C with primary antibodies specific for β-actin (Millipore) and
LANA (kind gift from Dr. Rolf Renne laboratory). Membranes were then washed three
times with TBS-T and incubated with species-specific horseradish peroxidase (HRP)-
conjugated secondary antibodies in 5% (w/v) non-fat milk in TBS-T for 1 hr at room
temperature. Detection of immunoreactive bands was visualized by using enhanced
chemiluminescence (ECL; GE Healthcare Life Sciences) and autoradiography.
Immunofluorescence
HEK293T and iSLK cells infected with KSHV were grown on cover slips placed in
24-well plates. To measure immunofluorescence, cells were washed in the 24-well
plates with PBS and then fixed onto the cover slips with fixation buffer (1% (v/v)
formaldehyde in PBS) for 15 min at room temperature. After washing the fixed cells
twice with PBS, 0.2% (v/v) Triton X-100 (diluted with PBS) was added to each well and
incubated on ice for 15 min. Cells were washed twice with PBS. PBS was then removed
and the cells were incubated with 200 µL of human serum anti-LANA antibody (diluted
1:3,000) for 1 hr at room temperature. Subsequently, cells were washed twice with PBS.
83
Secondary antibody (Alexa fluorophore 594-conjugated goat anti-human) was added at
1:3000 dilution in PBS (500 µL/well) and incubated for 45 min in the dark at room
temperature. The cells were washed twice with PBS and the cover slips were mounted
onto a microscope (slide face down) on two-three drops of Fluoromount G. Slides were
stored at 4°C in a slide folder for long-term storage.
Results
To facilitate the study of the role CTCF binding to the LANA promoter has on the
organization of both nucleosomes and DNA methylation, I constructed two different
recombinant KSHV BACmids (154 bp deletion and lexO replacement mutants) in the
BAC16 background and generated infectious virus from these BACmids. The deletion
mutant KSHV included a complete 154 bp deletion of the region containing three
tandem CTCF binding sites at the LANA promoter, whereas the lexO mutant contains
precise substitution of each of the three CTCF binding sites with lexO sequences. A
modified version of the BACmid recombination protocol of Tisher et al. (2006) was used
to create a markerless CTCF deletion or replacement mutant within BAC16 as
illustrated in Figure 3-1. The overall strategy to delete and replace the region bearing
the three LANA CTCF sites is outlined in Figure 3-2. The kanamycin targeting fragment
was successfully generated and size verified by agarose gel electrophoresis. The gel-
purified targeting fragment was delivered into freshly prepared electrocompetent WT
KSHV BAC16 in E. coli GS1783 cells. More than a hundred clones were observed on
the LB-kanamycin plate 24 hr post electroporation. Kanamycin resistance was conferred
due to the intermolecular homologous recombination between the targeting fragment
and WT KSHV BAC16. While all the screened clones had the kanamycin cassette
insertion in their respective BACs as a result of intermolecular recombination (Figure 3-
84
3), only clones #3, 5, 8, and 9 had intact TRs when compared to WT BAC16 (Figure 3-
3). TRs of clones #1, 2, 4, 6, 9, and 10 were either degraded or lost during the
intermolecular recombination as judged by the absence of the 30 kb fragment. Clones
#3 and 8 with intact TRs were selected for a second round of Red recombination. These
clones were subjected to PCR amplification across the deletion (of 154 bp) and site of
insertion (lexO sites) and evaluated by Sanger sequencing (Figure 3-3C, 3-3F) for the
precise deletion junction and desired insertion sequence.
The wild-type, CTCF binding deletion mutant, and lexO replacement mutant
BACmids were each separately transfected into HEK293T cells. After selection with
hygromycin, BACmid-containing HEK293T cells were induced with sodium butyrate, a
histone deacetylase (HDAC) inhibitor, and TPA, a phorbol ester that activates protein
kinase C. These cells were co-cultured with iSLK cells, which contain a doxycycline-
inducible RTA transgene that has the ability to drive high-level production of infectious
progeny virions. These virions allow further study and characterization of how the
elimination of CTCF binding at the LANA promoter affects local chromatin structure and
maintenance of latency.
After producing purified progeny virions, I then established clonal HEK293T cells
that were stably and latently infected with either WT or mutant KSHV. The lexO sites
contained a few nucleotides of homology with the wild-type CTCF binding sites (Figure
3-3F, asterisks below lexO sequences), which makes it important to assess the CTCF
binding in the mutants. After approximately 30 dpi, KSHV-infected cells were isolated for
ChIP analysis using an antibody specific for CTCF to test if CTCF no longer binds to the
LANA promoter in the mutant viruses. Figure 3-4 shows that CTCF does not occupy the
85
LANA promoter in either the deletion mutant or lexO replacement mutant stably infected
in HEK293T or iSLK cells. WT KSHV was used as a positive control and ORF34 was
used as a negative control region for CTCF binding.
Following infection of HEK293T cells and iSLKs with WT and mutant KSHV,
analysis of copy number and LANA expression were performed to assess how the loss
of CTCF binding affects episomal persistence and LANA expression. Figure 3-5A
shows similar WT and mutant episome copy numbers per cell in HEK293T and iSLK.
BCBL-1 cells were used as a positive control (expected copy number between 30-80
episomes per cell). HEK293T copy number quantification was measured from two
different infections of the same clone (conducted 30 days apart). Figure 3-5B shows the
similar immunofluorescence of LANA protein or "speckles" in iSLK cells infected with
wild-type, deletion mutant, and lexO mutant. LANA speckles form red foci in the
immunofluorescence images where each focus represents an episome. There is no
observable difference in LANA speckle formation between cells infected with wild-type
or mutant KSHV. Similar results were shown in infected HEK293T cells (data not
shown). Finally, Figure 3-5C shows an immunoblot of LANA protein expression in
infected HEK293T and iSLK cells. Cell infected with either mutant virus show
comparable expression of LANA protein as WT, indicating that mutating the CTCF
binding sites in the LANA promoter does not affect LANA protein expression.
Previous results from the Lieberman laboratory showed that eliminating CTCF
binding at the LANA promoter leads to a 10-fold decrease in extracellular virus following
lytic reactivation (Kang et al., 2011). However, they used a different BACmid construct
(BAC36) and introduced point mutations within the binding sites to eliminate CTCF
86
binding. Figure 3-6A shows quantification of extracellular virus particles following lytic
reactivation of iSLK cells infected with wild-type or mutant KSHV. When eliminating
CTCF binding at the LANA promoter, there is a significant reduction in the amount of
extracellular virus particles produced. The deletion mutant and lexO mutant produced
80- and 200-fold less extracellular virions (normalized to uninduced cells) compared to
WT. Figure 3-6B illustrates the quantification of extracellular virus following suboptimal
lytic reactivation by 2 mM sodium butyrate in HEK293T cells that were infected with
wild-type and mutant virus clones. Clones from each mutant virus display substantial
decreases in the amount of progeny virions produced following suboptimal lytic
reactivation when eliminating CTCF binding to the LANA promoter. These differences
could be the result of loss of CTCF binding to the LANA promoter negatively impacting
viral particle production by disorganizing known loop formation in episomes. Even
though the number of progeny virions decreased in the mutants following lytic
reactivation, the virions themselves were infectious. In order to proceed with infecting
HEK293T cells with enough infectious virions, viral particles needed to be isolated from
multiple lytic reactivation experiments and pooled to elevate viral titer.
Further characterization of the mutant KSHV-infected HEK293T cell lines was
performed to examine the role how loss of CTCF binding affects viral gene expression
and local chromatin structure. Figure 3-7A displays gene expression analysis of LANA,
RTA, and K14 in the wild-type and both viruses mutated for the CTCF binding sites. The
results indicate that there is variability in both LANA and RTA expression between the
deletion mutant and lexO replacement mutant as well as between independent clones
87
(clone #1 compared to clones #2 and #3) from each mutant. However, both mutants
(clone #1 only) show a consistent two-fold increase in K14 gene expression.
Figure 3-7B shows the histone modifications at the LANA promoter in KSHV that
is wild-type or harbors the deletion or lexO mutant. All KSHV-infected cell lines display
high occupancy of H3K4 trimethylation but variable levels of H3K27 trimethylation,
which is consistent with the variability in gene expression shown in Figure 3-7A. Figure
3-7C illustrates the gene expression of LANA, RTA, and K14 in three different
independent lexO replacement mutant clones used to infected HEK293T cells. Clones
#2 and #3 show a similar pattern of gene expression and low levels of all three
transcripts when normalized to wild-type expression levels. These data show that there
is gene expression variability between lexO replacement mutant clones and further
analysis needs be performed in order to deconvolute these differences. These results
showed that there are clear differences between lexO mutant clone #1 and clones #2
and #3 at 60 dpi. These three independent lexO replacement mutant clones were
isolated at 60 dpi in order to eliminate the variable of time of infection. Clones #2 and #3
show similar repression of all three transcripts, but clone #1 shows that LANA and K14
transcripts are derepressed. Figure 3-7D demonstrates the enrichment of unmodified
and modified histone H3 at the LANA and RTA promoters in wild-type and lexO mutant
clones infected in HEK293T cells. I expected there to be high levels of H3K4
trimethylated and low levels of H3K27 trimethylated histone occupancy at the LANA
promoter. These data show H3K27 trimethylated histone occupancy at the LANA
promoter has variable occupancy between the three lexO clones which could be due to
the initial chromatinization of the episome and establishment of latency. However,
88
occupancy of unmodified histone H3 and H3K27me3 at the RTA promoter shows no
significant changes (Figure 3-7D, lower panel). These results suggest that loss of CTCF
binding by LexA binding site replacement affects the chromatin structure locally (at
LANA promoter) rather than globally (at a distant, unlinked locus, i.e., RTA) on the
episome.
Closing Remarks
The ability to construct genetic mutations in the KSHV genome using BACmid
recombination is a powerful technique to characterize the 140 kb virus for analysis of
gene expression, progeny virus production, and epigenetic changes related to gene
regulation and chromatin structure. Two-step Red-mediated recombination using the
BAC16 construct is a very efficient and reliable way to make pinpoint mutations,
deletions, or insertions in the KSHV genome. Since depleting CTCF by siRNA or
genetic knockout results in cell death in cell culture because CTCF is an essential
protein for gene regulation and other processes, it was important to manipulate the
CTCF binding sites at the LANA promoter. After generating the mutant KSHV clones
that carry either a deletion of the region containing the three LANA CTCF sites or
precise replacement of three CTCF sites with lexO sequences, the co-culturing method
was used to generate infectious viral particles to infect HEK293T cells for all studies.
The mutant viruses were characterized for preliminary analysis of virus
production, gene expression, transcription factor occupancy, and histone modification
occupancy. Through BACmid recombination, I was able to successfully abolish CTCF
binding to the LANA promoter in both the deletion mutant and lexO mutant virus. In a
previous publication, Lieberman and colleagues generated point mutations within each
of the three CTCF binding sites to eliminate CTCF binding to the LANA promoter using
89
BAC36 containing KSHV, which is known to have a large duplication in the TRs (Kang
et al., 2011).
The BAC-containing KSHV that I used was BAC16, which does not have
insertions within the TRs. I also observed a reduction in RTA expression, similar to
Lieberman’s group. Their results showed a derepression of latent genes (LANA), loss of
immediate-early lytic gene expression (RTA), a decrease in KSHV intracellular copy
number, and a decrease in production of extracellular virions (Kang et al., 2011). I,
however, observed that LANA expression remains the same or slightly increases in my
mutant viruses as well as no significant changes in intracellular copy number between
wild-type and mutant episomes. The deletion mutant virus and lexO-containing virus
showed greater than 100-fold and 50-fold decrease in extracellular virions, respectively,
after induction of an RTA transgene and sodium butyrate (Figure 3-6A). This dramatic
decrease in extracellular virions compared to wild-type suggests that binding of CTCF to
the LANA promoter is essential for robust production of virion progeny. CTCF has an
essential role in genome organization and in forming loops within the episome, and the
loss of the loop between ORF73 and ORF50 may contribute to the 100-fold decrease in
extracellular virions. The lexO-containing mutants showed a 1.5-fold increase in LANA
transcript, while the deletion mutant exhibited a two-fold decrease (Figure 3-7A).
The consequence that eliminating CTCF binding to the LANA promoter had on
the steady-state levels of three viral transcripts (LANA, RTA, and K14) under conditions
of suboptimal lytic reactivation in the presence of the histone deacetylase inhibitor
sodium butyrate was tested. In the uninduced KSHV-infected cell lines, I found that
there was a trend toward repression of both LANA and RTA, which encodes the master
90
lytic regulator, observed in cells infected with clone #1 where the CTCF binding region
was either deleted or replaced. In contrast, both mutated clones showed derepression
of K14, an early gene that overlaps with and is transcribed in the opposite direction from
the LANA latent TSS. In cells where lytic reactivation was induced with 2 mM sodium
butyrate, LANA and RTA expression were reproducibly decreased by CTCF binding site
mutations as compared to wild type. I noted that these results appeared to be
dependent on the total time that the cells had been infected and passaged in culture.
For example, there was no effect on LANA transcript levels in long-term infected
induced cells, whereas cells that were infected for a much shorter time period had
reduced LANA expression. To control for this variable, I designed an experiment where
cells that were infected with wild-type or mutated KSHV have been infected for 60 days.
This experiment will determine if there are long-term epigenetic changes or if the
recombinant KSHV BACmid clones are epigenetically different. It is unclear why there
are such differences in gene expression between independent clones and/or infections.
The full genomes of these clones will ultimately need to be sequenced to determine if
there are genetic mutations elsewhere in the virus that led to the observed variations in
gene expression. However, these changes in gene expression may instead be due to
epigenetic modifications.
91
Table 3-1. BACmid recombination primer pair sequences
Primer set Primer name Primer sequence (5' to 3')
Deletion mutant Ultramers (deletion-kanamycin) to delete 154 bp in LANA promoter
MTO3139 (+) GGA GGC GGT GGC AGT ATA TTC ACA TTA TGC AAT ACC CGT AGC CGC CAG CAA ATT TAA GTC AGG ATG ACG ACG ATA AGT AGG G
MTO3140 () CCT GGC AGG TGA GCC ACC AGG ACT TAA ATT TGC TGG CGG CTA CGG GTA TTG CAT AAT GTG AAC CAA TTA ACC AAT TCT GAT TAG
lexO mutant (LexA-kanamycin)
MTO3188 (+) GTA AAA TTA TGG AGG CGG TGG C
MTO3194 () ACC TTG TTT ACC TGG CAG GTG
Deletion/insertion verification at LANA promoter
MTO3151 (+) TCT GGT CTG ACA ACC AAA GT
MTO3152 () CTT GCC TAG GTA GCA TCC AT (+) Forward primer
() Reverse primer
Table 3-2. Gene expression qRT-PCR primer pair sequences
Gene Primer name Primer sequence (5' to 3')
vLANA RPO3202 (+) GCGCCCTTAACGAGAGGAAGTT RPO3203 () TTCCTTCGCGGTTGTAGATG
vRTA MTO3061 (+) CACAAAAATGGCGCAAGATGA MTO3062 () TGGTAGAGTTGGGCCTTCAGTT
vK14 MTO3299 (+) GGTGATTGTTGCTGTGGTGC MTO3300 () GTTACTGCCAGACCCACGTT
GAPDH RPO3385 (+) CCCCTGGCCAAGGTCATCCA RPO3386 () ACAGCCTTGGCAGCGCCAGT
(+) Forward primer
() Reverse primer
92
Table 3-3. ChIP q-PCR primer pair sequences
Genomic region Primer name Primer sequence (5' to 3')
LANA -0.5 kb1 MTO3053 (+) GTTTATAAGTCAGCCGGACCAA
MTO3054 () GATATAACTCCGCCCTCCACTA
RTA -1.4 kb1 MTO3153 (+) TGAGGTCTATTTCCCACGACA
MTO3154 () ACAGCTCCGACGATGAGTATG
LANA CTCF sites MTO2791 (+) CCGTAGTGACCACAAGGGGGA MTO2792 () TGGCCATCGGCGGTATTGCAG
ORF342 MTO2797 (+) CCTGAACAGCTTCCTCTTGGTT
MTO2798 () GGCCACTGCAGATTG
1(Toth et al., 2010)
2(Kang et al., 2011)
(+) Forward primer
() Reverse primer
93
Figure 3-1. Bacterial artificial chromosome mutagenesis using two-step Red
recombination. A) Forward primer with sequence homology upstream (blue) of site of insertion/deletion (red) and homology downstream (yellow) of site insertion/deletion with the 3' end of forward primer specific for the kanamycin resistance cassette in pEP-KanS. The same applies for the reverse primer (reverse complement). The kanamycin resistance gene was amplified using designed ultramer oligonucleotides. The PCR product was purified and digested with DpnI to digest template pEP-KanS. B) Linear recombinant DNA was transformed into E. coli strain GS1783 by electroporation. GS1783 cells contain KSHV BAC16 as well as the inducible proteins responsible for homologous recombination. Mutagenesis of BAC16 in GS1783 cells as described in Brulois et al. (2012) includes: i) electroporation of linear DNA that has homology to BAC16 and contains the kanamycin resistance gene for intermolecular recombination; ii) induction of I-SceI enzyme expression with 1% (w/v) L-arabinose to create a double-strand break in the kanamycin gene; iii) induction Red proteins by heat shock to allow for intramolecular recombination to cleave the kanamycin resistance cassette; and iv) recircularization of the mutant BAC DNA. (Figure adapted from Brulois et al., 2012).
94
Figure 3-2. Stepwise construction of KSHV mutant BACs to eliminate CTCF binding at
the LANA promoter. First, the region comprising three-tandem CTCF sites in the LANA promoter in wild-type KSHV BAC16 was substituted by intermolecular recombination with a kanamycin resistance gene flanked by homology sequences (red). Then, a double-stranded break was created within the kanamycin resistance gene to remove the cassette by intramolecular recombination to generate a 154 bp deletion of the region encompassing the three CTCF binding sites. This deletion mutant was then used to substitute the three CTCF sites with three lexO sequences. The DNA sequence containing three-tandem lexO sequences was followed by the kanamycin resistance gene and both of these segments were flanked by homology sequences (red) for precise insertion at the deletion site at the LANA promoter. Then, a double-stranded break was created within the kanamycin cassette to remove it by intramolecular recombination to generate the lexO replacement KSHV mutant BAC.
95
Figure 3-3. Pulse-field gel electrophoresis (PFGE) and sequencing of deletion and lexO replacement mutant clones. A) PFGE of first Red recombination of deletion mutant clones. Intact terminal repeats (TR) migrate as a band at about 30 kb. Clones 3 and 8 were used for the second Red-mediated recombination. B) PFGE of second Red recombination of deletion mutant clones. C) Sequencing of the CTCF binding sites at the LANA promoter in wild-type and of the deletion junction in clones 3, 4, 5, and 6. Red highlighted boxes indicate CTCF binding sites in wild-type. D) PFGE of first Red recombination of lexO replacement mutant clones. Clones 3 and 6 were used for second Red-mediated recombination. E) PFGE of second Red recombination of lexO replacement mutant clones. F) Sequencing of the wild-type region containing the three LANA CTCF sites and the substitution region bearing three lexO sites in all seven second Red clones. Red highlighted box indicates CTCF binding sites in wild type. Green highlighted boxes indicate lexO sites. Asterisks below the nucleotides indicate homology amongst all clones and wild-type.
96
Figure 3-4. CTCF occupancy at LANA promoter in wild-type, deletion, and lexO
replacement mutant used to infect either HEK293T or iSLK cells. A) Diagram of the LANA promoter including the three-tandem CTCF binding sites and LANA ORF. Triangles, TATA boxes; ellipses, CTCF sites; bent arrows, lytic and latent TSSs; and red arrows, qPCR primers used for ChIP-qPCR. B) ChIP-qPCR of CTCF occupancy at the LANA promoter or ORF34 region as negative control of CTCF occupancy (from Kang et al. 2011). Note: y-axis is broken to enable visualization of the low, residual levels of CTCF occupancy in the mutants.
97
Figure 3-5. Quantification and verification of episomal persistence and LANA protein
expression after eliminating CTCF binding at the LANA promoter. A) Quantification of episomal copies per cell in either HEK293T or iSLK cells infected (inf) with WT or mutant KSHV. B) Immunofluorescence of LANA protein "speckles" in iSLK cells infected with WT or the indicated mutant KSHV. C) Immunoblot of LANA protein expression in either HEK293T or iSLK cells infected with WT or the indicated mutant KSHV.
98
Figure 3-6. Eliminating CTCF binding from the KSHV LANA promoter leads to
significantly decreased amounts of extracellular virus particles after lytic reactivation of infected iSLK and HEK293T cells. A) Extracellular virus particle production in iSLK cells following doxycycline induction of a non-viral, integrated copy of RTA leads to reduced number of extracellular virus in mutant virus. B) Extracellular virus particle production in HEK293T cells following suboptimal lytic reactivation (2 mM sodium butyrate) leads to reduced production of extracellular virus in multiple mutant KSVH clones. ‘U’ denotes uninduced and ‘I’ denotes induced.
99
Figure 3-7. Gene expression analysis and histone modification occupancy in HEK293T
cells infected with either wild-type or mutant KSHV. A) Gene expression analysis of viral transcripts (LANA, RTA and K14) in HEK293T cells infected with WT, deletion or lexO replacement mutant. B) Histone modification occupancy at the LANA promoter in the same cells as shown in panel A. C) Gene expression analysis of viral transcripts (LANA, RTA, and K14) in HEK293T cells infected for 60 dpi with either WT or lexO replacement mutant KSHV clones. D) Histone modification occupancy at the LANA and RTA promoter in the same cells as shown in panel C.
100
CHAPTER 4 ABLATING CTCF BINDING AT THE LANA PROMOTER LEADS TO
ENCROACHMENT OF DNA METHYLATION ON THE PROMOTER REGION
Introductory Remarks
There is an interplay between DNA methylation and histone modifications within
the context of chromatin. DNA methylation, along with post-translational modifications of
histones, functions to regulate gene expression and/or chromatin dynamics. In
mammalian cells, histone tails acetylated at position H3K9 and trimethylated at position
H3K4 correlate with active transcription, while trimethylated H3K27 residues are
enriched at promoters of repressed genes (Barski et al., 2007). At insulator sites
demarcating heterochromatin and euchromatin, all three states of H3K4 methylation are
highly enriched. In contrast, at enhancer regions, only monomethylation and
trimethylation of H3K4 are enriched (Barski et al., 2007).
Histone H3K4 Methylation Inhibits DNA Methylation
Actively transcribed genes contain nucleosomes that are decorated with H3K4
trimethylation around the TSS, which allows for transcription factors to access DNA for
transcription. H3K4 trimethylation and DNA methylation are inversely correlated,
suggesting that H3K4 trimethylation is a DNA methylation blocking histone modification
(Weber et al., 2007). A reason as to why H3K4 trimethylation can block de novo
methylation comes from the structure of DNMT3L which contains an ADD domain that
interacts with the unmethylated lysine residing at position 4 on the histone H3 N-
terminal tail. DNMT3L is then blocked from binding to the H3 tail when H3K4 is
methylated (Ooi et al., 2007). The ability for DNMT3L to be blocked by a trimethylated
H3K4 chromatin mark but not to a non-methylated H3K4 mark suggests that
methylation of H3K4 plays a role in blocking de novo DNA methylation (Ooi et al., 2007;
101
Otani et al., 2009). X-ray crystallography and structural modeling have shown that the
C-terminal region of DNMT3L forms a heterotetrameric structure with the C-terminal
region of DNMT3A or 3B, which may enhance DNMT3A/B activity by stabilizing the
active site conformation or by preventing DNMT3 protein aggregates (Jia et al., 2007;
Kareta et al., 2006). As DNMT3L expression is limited to germ cells and embryonic
stem cells, and DNMT3A/B are expressed at other cell stages and in other cell types,
the implication is that the DNMT3A/3L heterotetramer provides most of the de novo
methylation activity during early developmental stages. However, DNMT3A/B can
oligomerize to form homodimers and/or homotetramers that can bind to nucleosomes to
preferentially methylate linker DNA (Holz-Schietinger et al., 2011).
Gene Body Methylation and De Novo Methylation
Recent literature has documented a connection between H3K36 trimethylation,
catalyzed by the enzyme SETD2, and de novo methylation in gene bodies (Edmunds et
al., 2008; Rose and Klose, 2014). SETD2 associates with the C-terminal domain of the
elongating RNA Pol II and is targeted to gene bodies of actively transcribed genes (Sun
et al., 2005). The co-localization of H3K36 trimethylation and DNA methylation in exons
regulates the splice machinery (Brown et al., 2012) and also correlates with local
depletion of acetylated histones (Lorincz et al., 2004). Other data show that DNA
methylation strongly correlates with transcriptional activity within gene bodies in mouse
oocytes, further supporting an association between DNA methylation and H3K36
trimethylation at gene bodies of actively transcribed genes (Kobayashi et al., 2012).
This correlation between DNA methylation and H3K36 trimethylation overlapping in
gene bodies suggests that mechanisms might exist whereby H3K36 trimethylation
recruits DNMT3A or 3B to gene bodies of actively transcribed genes, or vice versa. In
102
support of this concept, DNMT3A and 3B contain a histone-binding domain called a
PWWP domain, which preferentially binds to trimethylated H3K36 histone tails
(Dhayalan et al., 2010).
Spread of Histone Modifications at Insulators
Chromatin insulators separate euchromatic domains from heterochromatic
domains to ensure the proper regulation of gene expression. CTCF is a known
chromatin insulator factor that is found between these domain regions across genomes
and species. CTCF has many roles in genome organization, including organizing arrays
of well-positioned nucleosomes and preventing the spread of post-translationally
modified histones from one domain to another. For example, depletion of CTCF globally
in the Drosophila genome results in only a small change of H3K27 trimethylation
spreading from heterochromatin domain to euchromatin domain (Schwartz et al., 2012).
This small change in H3K27 trimethylation spreading in Drosophila could be due to
most CTCF sites having functions other than a chromatin barrier or due to redundancy
with other insulator factors or other domains, such as NFRs, that can prevent the
spread of modified histones. In Drosophila, when CTCF is depleted locally, there is a
spread of the active domain into a flanking sequence as measured by the reduction of
H3K27 trimethylation levels (Essafi et al., 2011; Van Bortle et al., 2012).
In human HeLa cells, more than 700 domain boundaries display CTCF binding
(Cuddapah et al., 2009). However, there are many more CTCF sites that have a clear
role in separating heterochromatin from euchromatin. Aberrant localization of
heterochromatin leading to tumor suppressor gene silencing is a common feature of
human cancer cells. Lack of CTCF binding has been characterized at many cell
proliferation suppressor genes (e.g., Rb, ARF, BRCA1, p53, and p16) that are
103
frequently epigenetically silenced in cancer. An example of gene silencing due to
spreading of epigenetic domains was shown at the TSG p16INK4A promoter (where
CTCF does not bind) in post-selection HMECs (human mammary epithelial cells)
(Hinshelwood et al., 2009). In this system, nucleosomes first slide over the TSS and
then DNA methylation expands from the linkers to silence the gene. This is followed by
higher-order chromatin compaction due to H3K9 methylation and hypermethylation of
the gene promoter. Therefore, there are data supporting the mobilization of histone
marks and DNA methylation from one type of chromatin domain to another when CTCF
binding is eliminated from insulator sites or at a non-insulator TSG promoter during
progression of breast cancer. However, the mechanism(s) by which CTCF organizes
and separates domains of chromatin that contain methylated DNA and thus prevents
the mis-localization of histone methylation are understudied and remain elusive. In
addition, the mechanism(s) by which methylation of histones and DNA aberrantly
nucleates and/or spreads is ill defined.
This chapter focuses on the main goal of the dissertation, which is addressing
how the insulator protein CTCF organizes chromatin structure (nucleosome positioning
and DNA methylation) at the LANA locus in KSHV. The main approach has involved
construction of KSHV mutants that have either a deletion or replacement of the three
CTCF binding sites located at the LANA locus. Thus, the arrangement of the
nucleosomes and organization of DNA methylation will give great insight into the DNMT
nucleosome substrate. Also, these experiments will test the extent to which the
organization of nucleosomes is affected when the boundary element has been
removed. It is unknown how different domains of chromatin marks will compete with
104
each other and how this will effect on the chromatin structure at both the LANA
promoter and ORF. These data show, for the first time, that both nucleosomes and DNA
methylation become disorganized after removal of a viral barrier element.
Material and Methods
MAPit Single-molecule Methylation Footprinting of KSHV-infected Cells
The purpose of exogenously methylating accessible GC dinucleotides is to map
accessibility of DNA in chromatin, nucleosome positioning, and transcription factor
binding. M.CviPI is the GC methyltransferase used to exogenously methylate accessible
(i.e., not by protein or histone) GpC dinucleotides. The methylation status can then be
determined by bisulfite genomic sequencing (BGS).
Methyltransferase accessibility protocol for individual templates (MAPit;
schematic shown in Figure 4-1) was obtained from Darst et al. (2013) as partially
paraphrased below (Darst et al., 2010; Darst et al., 2012; Pardo et al., 2011). Long-term
latently infected KSHV cell line (BCBL-1) or adherent HEK293T and iSLK cells were
harvested at a density of 3 × 105 cells/mL, washed twice with ice-cold PBS, and
resuspended at 106 cells/mL in cold PBS. Four to five million cells were stored as pellet
at 80°C for RNA extraction. For each MAPit experiment, 106 BCBL-1 cells were
pelleted and resuspended in 100 µl cold Buffer A (10 mM HEPES-KOH, pH 7.5, 2 mM
MgCl2, 10 mM KCl, 2 mM DTT, and 0.2 mM PMSF). Cells were then incubated on ice
for 10 min to release nuclei by hypotonic lysis, vortexed for 10 sec at medium velocity,
and centrifuged for 10 sec at 16,000 × g. Nuclei were subsequently washed twice with
500 µL cell resuspension buffer (20 mM HEPES-KOH, pH 7.5, 70 mM NaCl, 0.25 mM
EDTA, 0.5 mM EGTA, 0.5% (v/v) glycerol, 10 mM DTT, and 0.25 mM PMSF) and
105
resuspended in 90 µL methylation buffer (cell resuspension buffer with 160 µM S-
adenosyl-L-methionine) (Darst et al., 2013).
HEK293T or iSLK cells infected with KSHV were harvested at 80% confluency,
washed twice with ice cold PBS, and resuspended at 106 cells/mL in cold PBS. Cells
were then pelleted (3 × 106 cells for each MAPit assay) and washed once in 500 µL cell
resuspension buffer. Cells were lysed in 170.5 µl cell lysis buffer (cell resuspension
buffer with 0.25% (v/v) Nonidet P-40) for 10 min on ice and nuclei were pelleted at
1,000 × g for 5 min at 4°C. Nuclei were finally washed twice with 500 µL cell
resuspension buffer and resuspended in 90 µL methylation buffer.
To methylate accessible GC dinucleotides, 60 units of recombinant M.CviPI-MBP
fusion enzyme (New England Biolabs, hereafter M.CviPI) was added per 106 nuclei,
which was then incubated at 37°C for 15 min. A 0 U M.CviPI control reaction was also
performed to gauge endogenous GC methylation. Methylation reactions were then
blocked by the addition of an equal volume of 1% (w/v) sodium dodecyl sulfate (SDS),
100 mM NaCl, 10 mM EDTA and incubated overnight at 50°C with 100 µg/mL
proteinase K to denature all proteins bound to DNA. DNA was then phenol-extracted
(partitioned with an equal volume phenol:chloroform:isoamyl alcohol 25:24:1) and
ethanol-precipitated.
Bisulfite Genomic Sequencing of Cells Infected with KSHV
BGS provides a methylation readout of every cytosine along a DNA region of
interest. The protocol to bisulfite convert genomic DNA was obtained from Darst et al.
(2010) and is briefly paraphrased in five steps: 1) DNA denaturated to single-
strandedness is 2) incubated with bisulfite at high temperature, 3) bisulfite is removed
by desalting, 4) alkaline pH removes sulfonyl adducts from uracil, and 5) desulfonation
106
solution is removed. Although there are several commercially available kits for
deamination of genomic DNA, I used both the “homebrew” method, which generally
provides more effective deamination, as well as the commercial kits.
In the “homebrew” method, 2 µg genomic DNA were denatured for 5 min at 95°C
in 0.3 N NaOH, then incubated for 6 hr at 50°C in absence of light in a saturated
metabisulfite solution as previously described (Darst et al., 2010). Bisulfite-converted
DNA was then desulfonated (using the Zymo EZ methylation-Gold kit) and concentrated
in 20 µL 0.1x TE with a commercial kit (Zymo Research; catalog no. D5026). In the
commercial kit method, the Zymo EZ methylation-Gold kit (Catalog # D5005) was used
and followed by manufacturing instructions to deaminate genomic DNA (Darst et al.,
2010).
Target loci were then amplified from 20-100 ng bisulfite converted-DNA with
3 units HotStar Taq (Qiagen) and 250 nM 454 sequencing-tailed primers (Table 3-2) in
100 mM Tris-EDTA, pH 8.0, 50 mM KCl, 3 mM MgCl2 (1x Qiagen Coral buffer), and
200 µM of each dNTP. PCR amplification of loci of interest (e.g., 5' LANA or 3' LANA
amplicon) were performed in 2-3 separate reactions and then pooled together for gel
extraction/purification to minimize stochastic variation in PCR amplification. Cycling
conditions were: 5 min at 95°C, followed by 40 cycles of 1 min at 95°C, 1 min at 56-
60°C (optimized for each primer pair), 3 min at 72°C, and then a final extension of 5 min
at 72°C.
PCR-amplified DNA was separated from unincorporated primers and primer-
dimer by gel electrophoresis. DNA products were then excised and purified from the gel
using Qiagen gel extraction kit (Catalog # 28704) and eluted in 15 µL of 0.1x TE. PCR
107
products were then quantified and stored at -20°C until ready for library preparation and
deep sequencing.
454 Junior Amplicon Deep Sequencing and Analysis
Purified PCR products (containing 454 adaptors) were mixed in equal molar
concentrations. Since the 3' LANA_short amplicon (450 or 600 bp) was shorter than the
5' LANA amplicon (650 or 800 bp), double the concentration of 5' LANA amplicon was
added to the final mixture. Since 454 sequencing has an emulsion PCR step before
sequencing, smaller fragments tend to predominate and become over-represented.
Therefore, to minimize over-representation of the 3' LANA_short amplicons, I doubled
the amount of added 5' LANA amplicons in the sequencing library. The amplicon library
was then concentrated to at least 8 ng/µL with a total concentration of at least 600 ng
(minimum requirements for the 454 Junior sequencing facility). The sample library
concentration and distribution of amplicon size was then confirmed using Qubit analysis
(Figure 4-2B).
Data were processed using the Kladde laboratory custom Python code
developed by Dr. Russell Darst and modified by Dr. Alberto Riva. Raw data sequences
were divided by multiplex identifier (MID), using FASTools
(http://genome.ufl.edu/rivalab/fastools/), then aligned to reference library [3' LANA or 5'
LANA amplicon (WT, deletion mutant, or lexO mutant)]. The alignment was first based
on size of the amplicon, i.e., deletion mutant amplicons were aligned first because these
amplicons were 154 bp shorter than the wild-type and lexO amplicons. The alignment
was verified by analyzing the junction sequence
(ATTATGNAATANNNGTAGNNGNNAGCAAATTTAAG, where Cs were changed to N to
accommodate bisulfite conversion) at the region of the deletion. Then the remaining
108
amplicons were aligned based on the three tandem lexO sequences
(ANTGTATGAGNATANAGTAT) or the WT CTCF binding site sequences (site 1,
GTGANNANAAGGGGGAGNT; site 2, ATGGNNANAGGATGTAGAT; or site 3,
ATGGNNANNAGATGGNANGNG). The quality of the alignments was visually verified
by checking the FASTA files for the lexO-containing sites or WT CTCF sites. To limit
bias in the alignment, cytosine residues in both the reads and reference sequences
were all converted to thymine in silico before alignment. After restoring the cytosine
information, sequences were scored for percent deamination of HCH (non-CG or
non-GC). Sequences with <95% conversion of HCH to HTH were discarded. Also, all
GCG sites were removed from analysis, since the 0 U M.CviPI control was not
sequenced to measure background DNA methylation. FASTA files were then uploaded
to the MethylMapper online program (http://genome.ufl.edu/methyl) to generate
MethylMapper images.
Results
Overview of 454 Amplicon Aligned Sequences
As shown in Figure 4-2A, I designed amplicons for 454 next-generation
sequencing (5' LANA and 3' LANA_short) spanning the LANA promoter and 5' end of
the ORF (both containing the insulator site) to assay methylation over time following
de novo infection of HEK293T cells with either WT or mutant KSHV. Aligned
sequencing reads were over-represented for amplicons from the deletion mutant
relative to those obtained for the WT and lexO amplicons (Figure 4-2C-D). This was due
to the deletion mutant amplicons being 154 bp smaller than the WT and lexO
amplicons. In addition, the deletion removes a barrier of DNA polymerase to synthesize
109
a new strand across the repeated CTCF and lexO sequences during the emulsion PCR
step.
Disrupting CTCF Binding at the LANA Promoter Leads to Disorganization of Nucleosomes and DNA Methylation in the Transcribed Region
The precise substitution of each of the three tandem CTCF sites with lexO sites
or deleting the 154-bp CTCF binding site region altogether leads to ablation of CTCF
binding at the LANA promoter in both mutants of KSHV (Figure 3-4). Both of these
mutant viruses were used to study the role CTCF plays in organizing nucleosomes and
DNA methylation. Previous data from the Kladde laboratory showed that, in long-term,
latently infected PEL cells, CTCF binds to KSHV episomes at the LANA promoter and
organizes arrays of nucleosomes with DNA methylation confined to the linkers in the
transcribed region (Figure 1-6C; Darst et al., 2013). Based on pyrosequencing results
(see Figure 2-3B), in order to obtain detectable levels of DNA methylation above
background in KSHV, I needed to infect HEK293T cells and passage them for at least
150 dpi.
In WT KSHV (BAC16) at 210 dpi (Figure 4-3A, top left panel), footprints
corresponding to two positioned nucleosomes and CTCF were evidenced by
inaccessibility of GpC sites to M.CviPI (Figure 4-3A, top right panel). These data also
show positioned nucleosomes +1 and +2 are separated by an accessible linker. With
respect to DNA methylation, more accumulated in the +2/+3 nucleosomal linker than in
the +1/+2 linker (Figure 4-3A, top left panel). Methylation of these two linkers to similarly
high levels in Figure 1-6C and additional deep sequencing results (not shown) indicate
that the +2/+3 linker was methylated more rapidly than the +1/+2 linker.
110
Upon replacement of all three CTCF binding sites with lexO sequences, DNA
methylation was not restricted to the same positions as seen in wild-type KSHV (Figure
4-3A, bottom left panel). Instead, the DNA methylation propagated towards, but did not
reach, the LANA promoter. Chromatin accessibility in the lexO replacement mutant
KSHV at 210 dpi (Figure 4-3A, bottom right panel) showed a highly disorganized
distribution of accessibility, with no clear footprints that could be ascribed to well-
positioned nucleosomes across all sequenced reads. Figure 4-3B shows the averaged
amount of DNA methylation and chromatin accessibility at each CG and GC site,
respectively, in wild-type and lexO mutant KSHV at 210 dpi. These data clearly indicate
that nucleosome positioning and DNA methylation are disorganized downstream and
across the lexO sites in the mutant.
Loss of Insulator Occupancy by CTCF at the LANA Promoter Leads to Chromatin Accessibility of K14 Promoter
I next analyzed the consequences of deletion of the 154 bp region encompassing
the three CTCF sites. I generated stably infected HEK293T cells with the deletion
mutant virus and the lexO replacement mutant virus and passaged the cells for at least
150 dpi. The LANA promoter region (5' LANA amplicon) contains no detectable CpG
methylation at all time points after infection (data not shown), consistent with the known
methylation profiles of actively transcribed genes and the MeDIP analysis in Figure 2-1
(Günther and Grundhoff, 2010). The chromatin accessibility profile of the 5' LANA
amplicon shown in Figure 4-4 contains both the latent and lytic TSSs as well as the
three tandem CTCF sites (in wild-type KSHV). Note that the deletion mutant retains the
latent and lytic TSSs. Figure 4-4 shows the chromatin accessibility at 90 dpi, the time
point for which the most sequencing reads were obtained from both wild-type KSHV and
111
the deletion mutant (Figure 4-2D). To my disappointment, I received very few of the
5' LANA amplicon reads from the lexO replacement mutant cell lines as shown in
Figure 4-2C (bottom plot). Consistent with previous results in BCBL-1, I observed
footprints due to CTCF binding and an open chromatin structure or nucleosome-free
region just upstream of the latent TSS in WT KSHV at 90 dpi (Figure 4-4A) (Darst et al.,
2013). However, I also observed a lower fraction of reads that were completely
inaccessible compared to BCBL-1 cells in which almost 50% of molecules were
inaccessible (Darst et al., 2013). As was observed in Darst et al., I also detected an
inaccessible region between the latent TSS and CTCF sites that is the approximate size
of two closely packed nucleosomes.
In the deletion mutant, I discovered four different classes of chromatin structure
based on GpC accessibility to M.CviPI (Figure 4-4B). Cluster i contains the majority of
molecules and has an open chromatin structure at the latent TSS consistent with active
LANA expression, which is similar to the WT and BCBL-1 chromatin accessibility profile.
Cluster ii comprises a class of molecules that is completely inaccessible. A small subset
of molecules, in cluster iii, includes accessibility upstream of the K14 TSS, which is
transcribed from the opposite strand. These molecules might contribute to the two-fold
higher expression of the early vK14 gene (shown in Chapter 3, Figure 3-7A). Cluster iv
encompasses an even smaller subset of molecules that are completely accessible. This
configuration likely corresponds to sequencing reads derived from cells undergoing
spontaneous lytic replication and hence are not associated with core histones. It has
been shown that disassembly of viral histones is concurrent with HSV viral DNA
replication during lytic reactivation (Oh and Fraser, 2008; Toth et al., 2010).
112
Figure 4-4C shows a plot of average endogenous (CG) DNA methylation and
average exogenous (GC) methylation (chromatin accessibility) in the wild-type and
deletion mutant KSHV at 90 dpi along the LANA promoter and downstream of the CTCF
sites. These data clearly show that nucleosome positioning and DNA methylation are
disorganized downstream of the deletion site of CTCF binding in the deletion mutant
KSHV as well as minor differences in chromatin accessibility at the LANA latent TSS.
However, it is interesting to note that the methylation at the +2/+3 nucleosomal linker in
both WT and mutant virus contain equivalent levels of DNA methylation (Figure 4-3).
Closing Remarks
To address how CTCF organizes chromatin structure (nucleosome positioning
and DNA methylation), I performed three independent MAPit time courses on cells
infected with wild-type KSHV or virus containing deletion of the 154 bp region
encompassing the three CTCF sites or virus containing lexO sequences replacing the
three CTCF binding sites. Three independent clones from both the deletion and
replacement recombinant KSHV were used to infect HEK293T cells to address any
significant genetic and/or epigenetic variations between recombinant clones.
I have previously showed that these genetic manipulations ablated CTCF binding
to the LANA latency region (Figure 3-4). It should be noted that these experiments
require extensive amounts of cell culturing, because HEK293T cells grow quickly with a
doubling time of 16-20 hr and must be passaged every 2 to 3 days to avoid cell death
from overgrowth. Preliminary data (not shown) suggest that chromatin probing with
M.CviPI displays protection against a methylation-sensitive restriction enzyme followed
by qPCR (MSRE-qPCR); analysis of 7 to 10 cloned molecules suggests that ablation of
CTCF binding may cause loss of nucleosome-free regions at the LANA latent TSS from
113
an increased fraction of sequenced viral copies as a function of time in culture.
Confirmation of these results requires additional amplicon deep sequencing to achieve
higher read coverage of the WT and lexO-containing amplicons to verify that the reads
representing the closed chromatin conformation are still under-represented. I also
revealed that it was difficult to obtain the PCR products needed to perform deep
sequencing due to repetition of the three CTCF binding sites in wild-type KSHV and the
imperfect palindromic lexO sequences in the replacement mutant virus.
Eliminating CTCF binding at the LANA promoter Leads to Disorganized Nucleosomes and DNA Methylation Spreading towards the Promoter
I set out to determine the role of the insulator protein CTCF in organizing a
chromatin domain of positioned nucleosomes with linker-restricted methylation within
the transcribed region of the LANA gene in KSHV. The overall objective of this
dissertation is to determine how deletion and/or replacement of the CTCF binding sites
affects the chromatin organization locally around the LANA promoter. So far, I have
mutated KSHV at the LANA locus using BACmid recombineering, deleting a 154 bp
region encompassing the three tandem CTCF binding sites or by precisely replacing
each CTCF binding site with lexO sequences.
It is known that the KSHV envelope virus encapsulates linear viral double-
stranded DNA with no detectable core histones or DNA methylation. After infection, the
KSHV genome circularizes in the host nucleus, associates with histones (within hours),
and becomes methylated at CpG sites (within months). Two independent de novo
infection time courses of HEK293T cells with two different clones of each construct were
conducted. The goal was to determine how de novo methylation is established and
maintained in KSHV, both the WT virus and one containing mutated CTCF binding sites
114
at LANA. Cell were harvested and MAPit performed every 30 days for 210 dpi (at the
time of writing this dissertation).
Analysis of the obtained sequencing reads provided the following conclusions.
Clear footprints were observed over the CTCF sites in all WT molecules at all time
points between 30 and 210 dpi, and accessibility of the linker joining the +1 and +2
nucleosomes downstream of the insulators to M.CviPI was observed. However, our
laboratory recently showed that almost half of sequenced reads (molecules) from
BCBL-1 cells were highly inaccessible (Darst et al., 2013). Methylation was not detected
in the WT construct at 30 dpi and methylation accumulated linearly up to 210 dpi.
However, DNA methylation accumulated more in the +2/+3 nucleosomal linker than at
the +1/+2 nucleosomal linker, which is located closer to the CTCF sites and LANA
promoter, which is known to contain high levels of histone H3K4 trimethylation that
inhibits DNA methylation.
Substitution of the CTCF sites with lexO sites ablated the CTCF footprints,
consistent with loss of CTCF binding by ChIP (Figure 3-4), and the nucleosomes
became disorganized across the analyzed region (Figure 4-3). Some methylation was
detected in the +1/+2 nucleosomal linker in the lexO construct even at 30 dpi and,
strikingly, this methylation spread upstream as far as the lexO binding sites but not
beyond. Strikingly, methylation at the +2/+3 nucleosomal linker reached the same level
(80%) in both the wild-type and lexO mutants at 210 dpi (Figure 4-3B). If loss of CTCF
binding indeed led to disorganization of both nucleosomes and DNA methylation, then
the lexO mutant should not have such a predominant peak of methylation at the +2/+3
nucleosomal linker, unless the sequence where this nucleosome occupies is a strong
115
nucleosome positioning sequence. To test this possibility, this putative nucleosome
positioning sequence will need to be mutated. Additional assessment of chromatin
structure needs to be conducted farther downstream into the gene body.
These data suggest that a major function of CTCF is to organize positioned
nucleosomes so as to restrict methylation from spreading toward an actively transcribed
promoter. Despite the spread of methylation toward the promoter; however, no
decrease or significant change in LANA expression was observed by qRT-PCR of the
transcript or by immunofluorescence staining of the LANA protein. Consistent with these
results, methylation was not observed to encroach on the transcription start sites (TSS)
in the LANA promoter at 210 dpi. It is possible that it would do so at later time points of
infection or in analogy to patients infected for many years with KSHV. If gene body
methylation encroaches onto the LANA promoter, this would be expected to lead to
epigenetic silencing of LANA and indefinite latency leading to loss of episomal
persistence. This, in turn, could lead to a possible therapeutic outcome for individuals
who are latently infected with KSHV – suppression of the virus by epigenetic silencing of
a major latency gene.
Drawing conclusions based on the comparison of WT and the mutant KSHV with
deleted CTCF sites is more complicated. This is due to three variables in the deletion
mutant virus: 1) deletion of the CTCF sites leads to randomization of nucleosome
positioning; 2) sequences occupied by the positioned nucleosome array in the WT virus
are shifted 154 bp closer to the LANA promoter; and 3) loss of the boundary between
the chromatin domains, i.e., histone modifications at the gene body and LANA
promoter.
116
An important remaining issue is how loss of CTCF barrier function may have
affected the distribution of histone modifications at the LANA promoter, which, in turn,
would affect the pattern of DNA methylation. For instance, significantly lower
methylation of the +1/+2 linker than the +2/+3 linker in both WT and CTCF mutant
KSHV (plots in Figures 4-3B, upper and 4-4C, upper) is consistent with the former being
closer to the LANA TSSs. Like most Pol II TSSs, those in the LANA promoter have
abundant levels of methylation-inhibiting H3K4 trimethylation (Günther and Grundhoff,
2010; Hu et al., 2014). Interestingly, compared to WT, the CTCF mutant has higher
levels of methylation at every CpG from +750 to +450 bp downstream of the LANA
latent TSS. These data suggest less spread of H3K4 trimethylation into the LANA ORF
in the deletion mutant. Thus, it is possible that H3K4 trimethylation has not encroached
on LANA ORF in CTCF sites deletion mutant. However, CTCF itself may lead to the
targeting of its own constellation of histone marks.
Nevertheless, it is clear that the methylation levels are higher at every CpG site
in the mutant compared with WT from 450-750 bp downstream of the LANA latent
transcription start site. This suggests that the histone modifications associated with the
gene body have supplanted active histone H3K4 trimethylation. On the other hand, if
H3K4 trimethylation does not spread as far into the gene body in the mutant as it does
in the WT episome, then why is the prominent peak of methylation at +750 from the
latent TSS in the deletion mutant lower than the methylation peak at +900 in WT KSHV?
I hypothesize that the increased number of nucleosome positions in the deletion mutant
leads to no specific sequence being localized at a higher frequency in a linker. Given
117
that nucleosomes block endogenous DNMTs from accessing DNA, overall methylation
levels would thus be expected to be attenuated.
The WT structure of linker-restricted methylation suggests, but does not
establish, that any sequence within a linker would be methylated, i.e., there is nothing
special about any linker per se. However, the test of this would be to substitute the
sequence of one or more linkers for an unrelated sequence. The linker connecting the
+1/+2 nucleosomes in WT KSHV does not have a methylation peak but there is a strong
peak of methylation at the +2/+3 linker. However, it could be that this linker does have
an inherent capacity to target methylation that has not been overridden by being closer
to the LANA promoter.
The unchanged methylation level at +750 bp downstream of the latent TSS in the
deletion mutant relative to the ‘comparable’ same sequence at +900 bp downstream of
latent TSS in the WT is due to the increased randomization of nucleosome positioning
in the deletion mutant. If a nucleosome in the deletion mutant occupies the sequence
that is normally a linker in WT, then there would be a decrease in methylation observed
in the mutant. This would explain the low peak of methylation in the deletion mutant that
is about 150 bp downstream of the sharp peak of methylation and a slightly higher peak
of methylation occurring closer to the promoter.
Deletion of the CTCF Site Sequences at the LANA Promoter Leads to a Subpopulation of Molecules with Accessible vK14 Promoter
When analyzing the LANA promoter (5' LANA amplicon) following 454
sequencing, there was an over-representation of the deletion mutant amplicon. At 90
dpi, I was able to analyze more than 40 wild-type molecules and more than 200 deletion
mutant molecules, while there were only a few lexO mutant amplicons (Figure 4-2C).
118
When analyzing the 5' LANA chromatin architecture in wild-type KSHV stably infected in
HEK293T cells, the LANA promoter lacked the presence of DNA methylation,
footprinted CTCF occupancy, and there was chromatin accessibility just upstream of the
latent TSS in all the molecules and at all time points. While the deletion mutant had a
chromatin accessibility profile showing four independent classes of chromatin
accessibility, the most interesting and unique class of molecules that I observed was a
subpopulation of molecules that showed chromatin accessibility positioned just
upstream of the K14 TSS on the opposite strand. The K14/vGPCR promoter directs
transcription initiation 32 bp downstream of the latent TSS on the opposite strand in the
opposite orientation (Staudt and Dittmer, 2006). K14 is an early lytic gene that is
transcribed early on among the cascade of genes expressed during lytic reactivation.
The K14 promoter Pol II synthesizes a K14/vGPCR bicistronic transcript that is a
predominant messenger for vGPCR (G protein-coupled receptor), which is related to
interleukin-8 (IL-8) receptor or a CXC chemokine receptor (Cesarman et al., 1996). The
5' end of the transcript also encodes, K14, a viral signaling molecule that has sequence
homology to cellular OX2. K14 encodes a glycosylated protein that is expressed on the
surface of KSHV-infected cells during viral lytic replication, and targets myeloid-lineage
cells (Chung et al., 2002). This subpopulation of molecules may directly reflect the two-
fold increase in gene expression of K14 shown in Chapter 3 (Figure 3-7A). This class of
accessible molecules in chromatin has not been seen before and could be directly
related to loss of CTCF binding at the LANA promoter. This subpopulation of molecules
could not have been identified if it was not for the sequencing depth that I obtained from
454 sequencing and the power of the single-molecule approach that MAPit provides. In
119
order to make direct conclusions that loss of CTCF binding directly correlates to this
subpopulation of accessible K14 TSS molecules, it would need to be confirmed that this
chromatin structure is not observed in wild-type virus by sequencing more of the wild-
type amplicons.
It is interesting, however, that I measured a two-fold increase in expression of an
early lytic gene; however, reduced production of extracellular virions was observed in
infected cells subjected to lytic reactivation. Even though there is an increase in K14
transcripts when CTCF is not bound, other genes in the pathway of lytic reactivation
might be perturbed, leading to dramatic decreases in progeny virions compared to wild-
type. Further experiments to elucidate the kinetics of lytic gene expression need to be
conducted in these mutants to assess the lytic genes that are affected by the loss of
CTCF binding to the LANA promoter.
Data in this chapter show for the first time that loss of CTCF binding at insulator
sites leads to disorganization of nucleosomes and spread of DNA methylation towards,
but not invading, another chromatin domain. This was shown at one specific gene
promoter in KSHV by locally eliminating CTCF binding at the LANA promoter. Since
DNA methylation slowly accumulates onto KSHV after infection, I observed a gradual
increase of DNA methylation over the 210 dpi time course. Loss of CTCF binding also
affected the chromatin accessibly of another gene promoter, allowing for increased
accessibility slightly upstream of the TSS of K14 on the opposite strand, which
coincides with the two-fold increase in K14 gene expression (Figure 3-7A).
120
Table 4-1. MAPit analysis primer pair sequences
Gene Primer name Primer sequence (5' to 3')
5' LANA RDO1956 (a2)1 GTtTGAtAAttAAAGTAAAATTATGGAGG
RDO2814 (a1)1 CCACCCAAaaTAATaAAATaAAaAa
3' LANA_short RDO2636 (a2)1 GAtAtAGGATGGGATGGAGGGA
MTO3002 (a1) ACCCACTTTAACCTTATTTACCT
1Darst et al., 2013.
a2, deamination forward primer. Lower case t denotes C to T transition a1, deamination reverse primer. Lower case a denotes G to A transition
121
Table 4-2. 454 sequencing primer pair sequences for MAPit analysis
Amplicon name 454 primer sequence (5' to 3')
5'LANA_MID1 CGTATCGCCTCCCTCGCGCCATCAGACGAGTGCGTGTtTGAtAAttAAAGTAAAATTATGGAGG
5'LANA_MID2 CGTATCGCCTCCCTCGCGCCATCAGACGCTCGACAGTtTGAtAAttAAAGTAAAATTATGGAGG
5'LANA_MID3 CGTATCGCCTCCCTCGCGCCATCAGAGACGCACTCGTtTGAtAAttAAAGTAAAATTATGGAGG
5'LANA_MID4 CGTATCGCCTCCCTCGCGCCATCAGAGCACTGTAGGTtTGAtAAttAAAGTAAAATTATGGAGG
5'LANA_MID5 CGTATCGCCTCCCTCGCGCCATCAGATCAGACACGGTtTGAtAAttAAAGTAAAATTATGGAGG
5'LANA_MID6 CGTATCGCCTCCCTCGCGCCATCAGATATCGCGAGGTtTGAtAAttAAAGTAAAATTATGGAGG
5'LANA_MID7 CGTATCGCCTCCCTCGCGCCATCAGCGTGTCTCTAGTtTGAtAAttAAAGTAAAATTATGGAGG
5'LANA_MID8 CGTATCGCCTCCCTCGCGCCATCAGCTCGCGTGTCGTtTGAtAAttAAAGTAAAATTATGGAGG
5'LANA_MID9 CGTATCGCCTCCCTCGCGCCATCAGTAGTATCAGCGTtTGAtAAttAAAGTAAAATTATGGAGG
5'LANA_MID10 CGTATCGCCTCCCTCGCGCCATCAGTCTCTATGCGGTtTGAtAAttAAAGTAAAATTATGGAGG
5'LANA_MID11 CGTATCGCCTCCCTCGCGCCATCAGTGATACGTCTGTtTGAtAAttAAAGTAAAATTATGGAGG
5'LANA_MID12 CGTATCGCCTCCCTCGCGCCATCAGTACTGAGCTAGTtTGAtAAttAAAGTAAAATTATGGAGG
5'LANA_MID13 CGTATCGCCTCCCTCGCGCCATCAGCATAGTAGTGGTtTGAtAAttAAAGTAAAATTATGGAGG
5'LANA_MID14 CGTATCGCCTCCCTCGCGCCATCAGCGAGAGATACGTtTGAtAAttAAAGTAAAATTATGGAGG
5'LANA_MID15 CGTATCGCCTCCCTCGCGCCATCAGATACGACGTAGTtTGAtAAttAAAGTAAAATTATGGAGG
5'LANA_MID16 CGTATCGCCTCCCTCGCGCCATCAGTCACGTACTAGTtTGAtAAttAAAGTAAAATTATGGAGG
5'LANA_MID17 CGTATCGCCTCCCTCGCGCCATCAGCGTCTAGTACGTtTGAtAAttAAAGTAAAATTATGGAGG
5'LANA_MID42 CGTATCGCCTCCCTCGCGCCATCAGTCGATCACGTGTtTGAtAAttAAAGTAAAATTATGGAGG
5'LANA_primerB
CTATGCGCCTTGCCAGCCCGCTCAGCCACCCAAaaTAATaAAATaAAaAa
3'LANA_MID1 CGTATCGCCTCCCTCGCGCCATCAGACGAGTGCGTGAtAtAGGATGGGATGGAGGGA
3'LANA_MID2 CGTATCGCCTCCCTCGCGCCATCAGACGCTCGACAGAtAtAGGATGGGATGGAGGGA
122
Table 4-2. Continued
Amplicon name 454 primer sequence (5' to 3')
3'LANA_MID3 CGTATCGCCTCCCTCGCGCCATCAGAGACGCACTCGAtAtAGGATGGGATGGAGGGA
3'LANA_MID4 CGTATCGCCTCCCTCGCGCCATCAGAGCACTGTAGGAtAtAGGATGGGATGGAGGGA
3'LANA_MID5 CGTATCGCCTCCCTCGCGCCATCAGATCAGACACGGAtAtAGGATGGGATGGAGGGA
3'LANA_MID6 CGTATCGCCTCCCTCGCGCCATCAGATATCGCGAGGAtAtAGGATGGGATGGAGGGA
3'LANA_MID7 CGTATCGCCTCCCTCGCGCCATCAGCGTGTCTCTAGAtAtAGGATGGGATGGAGGGA
3'LANA_MID8 CGTATCGCCTCCCTCGCGCCATCAGCTCGCGTGTCGAtAtAGGATGGGATGGAGGGA
3'LANA_MID9 CGTATCGCCTCCCTCGCGCCATCGTAGTATCAGCGAtAtAGGATGGGATGGAGGGA
3'LANA_MID10 CGTATCGCCTCCCTCGCGCCATCAGTCTCTATGCGGAtAtAGGATGGGATGGAGGGA
3'LANA_MID11 CGTATCGCCTCCCTCGCGCCATCAGTGATACGTCTGAtAtAGGATGGGATGGAGGGA
3'LANA_MID12 CGTATCGCCTCCCTCGCGCCATCAGTACTGAGCTAGAtAtAGGATGGGATGGAGGGA
3'LANA_MID13 CGTATCGCCTCCCTCGCGCCATCAGCATAGTAGTGGAtAtAGGATGGGATGGAGGGA
3'LANA_MID14 CGTATCGCCTCCCTCGCGCCATCAGCGAGAGATACGAtAtAGGATGGGATGGAGGGA
3'LANA_MID15 CGTATCGCCTCCCTCGCGCCATCAGATACGACGTAGAtAtAGGATGGGATGGAGGGA
3'LANA_MID16 CGTATCGCCTCCCTCGCGCCATCAGTCACGTACTAGAtAtAGGATGGGATGGAGGGA
3'LANA_MID17 CGTATCGCCTCCCTCGCGCCATCAGCGTCTAGTACGAtAtAGGATGGGATGGAGGGA
3'LANA_MID18 CGTATCGCCTCCCTCGCGCCATCAGTCGATCACGTGAtAtAGGATGGGATGGAGGGA
3'LANAshort_primerB CTATGCGCCTTGCCAGCCCGCTCAGACCCACTTTAACCTTATTTACCT
Underlined nucleotides indicate 454 specific adapter sequences Bold nucleotides indicate multiplex identifiers (MIDs or ‘barcodes’) Gene specific sequence at 3' end of 454 primer a2, deamination forward primer. Lower case t denotes C to T transition a1, deamination reverse primer. Lower case a denotes G to A transition
123
Figure 4-1. Methyltransferase Accessibility Protocol for individual-templates (MAPit)
overview for mapping endogenous DNA methylation and chromatin accessibility in mammalian nuclei. Isolated nuclei are probed with the DNA methyltransferase M.CviPI, which methylates cytosines at accessible GpC dinucleotides that are not within a nucleosome or occupied by proteins. After purification, DNA is subjected to bisulfite conversion, whereby unmethylated cytosine (C) is converted to uracil (U) and methylated C resists bisulfite conversion under the conditions employed. During the PCR step, U converts to thymine (T) and methylated C becomes C, allowing for the assessment of the methylation status of every C residue in the DNA molecule. To obtain a single-molecule readout of both endogenous CpG methylation and chromatin accessibility, PCR products are cloned and sequenced or analyzed by next-generation sequencing. Sequences are processed using a sequence alignment program (MethylMapper: http://genome.ufl.edu/methyl/) that represents the methylation/accessibility pattern of each molecule. In the map, each horizontal line represents a single, sequenced DNA molecule and each vertical line represents a CpG or GpC site, with red (m5CG) and yellow (G-m5C) representing the location of methylation sites in each molecule. (Figure adapted and modified from Pardo et al., 2011).
124
Figure 4-2. Distribution of aligned sequencing reads from 454 Junior sequencing.
A) Amplicons designed and prepared at the LANA promoter for 454 sequencing. B) Qubit 454 amplicon library concentration quantification and amplicon length distribution. C) Total read distribution after aligning reads. 80% of total reads mapped to the 3' LANA_short amplicon. The deletion mutant amplicon was more than 80% represented in both 5' LANA and 3' LANA_short amplicons. D) Read distribution based on multiplex identifier (MID) and time point.
125
Figure 4-3. CpG methylation and nucleosome positioning are disorganized when CTCF
binding is eliminated from the LANA promoter. A) MethylMapper images for the 3' LANA short amplicon from WT (top panel; 58 reads) and lexO (bottom panel; 46 reads) KSHV infecting HEK293T cells for 210 dpi. Endogenous methylation (left; red) and chromatin accessiblity (right; yellow). B) 3' LANA short amplicon averaged DNA methylation of WT (dotted line) and lexO (solid line) KSHV-infected HEK293T cells at 210 dpi. Endogenous methylation (red) and chromatin accessibility (yellow). Figures drawn to scale with genomic landmarks above each image. Size of a nucleosome is represented as a blue oval.
126
Figure 4-4. Chromatin accessibility at the LANA promoter in wild-type and deletion
CTCF binding sites mutant KSHV at 90 dpi. A) HEK293T cells infected with WT KSHV for 90 days (47 reads) shows chromatin accessibility upstream of latent TSS and footprints of CTCF. B) KSHV mutant with deleted CTCF binding sites at 90 dpi (274 reads) shows four classes of molecules that differ in chromatin accessibility: class I (green bracket), accessible molecules upstream of latent TSS; class ii (black bracket), inaccessible; class iii (orange bracket), accessible upstream of K14 TSS; and class iv (red bracket); completely accessible lytic molecules. C) Averaged DNA methylation in wild-type (dotted line) and CTCF binding site deletion mutant (solid line) at 90 dpi. Shown are the LANA promoter and downstream of CTCF deletion junction site (red triangle). Endogenous methylation (red) and chromatin accessibility (yellow). Figures drawn to scale with genomic landmarks above each image. Size of a nucleosome is represented as a blue oval.
127
CHAPTER 5 SUMMARY AND FUTURE DIRECTIONS
Epigenetic regulation is crucial for the proper orchestration of chromatin structure
and gene expression in non-diseased cells. It is widely accepted that the different layers
of epigenetic regulation (DNA methylation, histone modifications, and nucleosome
positioning) act in concert to exercise control of gene expression. In the last 10 to 15
years, as technology has advanced, there has been an increase in epigenetic
investigation that has resulted in the cataloguing of patterns of DNA methylation,
histone modifications, and DNA methylation in normal and disease states. While many
strides have been made, a detailed mechanistic understanding of how the various
layers of epigenetic regulation influence each other and are functionally coordinated to
elicit and maintain cell-, tissue-, viral- and host-specific expression programs has not
emerged.
The experiments described in this dissertation set out to determine if the insulator
binding protein CTCF, which binds to the promoter of the LANA gene of the KSHV
genome, plays a role in the organization of nucleosomes and DNA methylation as well
as in transcription, maintaining latency, and lytic replication. This was assessed first by
determining the rate of DNA methylation establishment on the KSHV episome when
infected into three different cell lines. It was determined that, when infecting HEK293T
cells with WT KSHV, that the rate of methylation accumulation was detected faster at
the LANA transcribed region than in other KSHV-infected cell lines (iSLK or TIVE).
Therefore, a timetable of ≥150 dpi was required in order to detect significant amounts of
methylation above background.
128
Next, the CTCF binding sites at the LANA promoter were either deleted or
replaced (with LexA binding sequences) to determine how CTCF affects viral
transcription, lytic replication, and chromatin structure. Elimination of CTCF binding to
the LANA promoter led to no significant changes in LANA expression, a decrease in
RTA expression, and a two-fold increase in K14 expression (transcribed on the opposite
strand and the opposite direction from LANA). These results indicate that CTCF binding
to the LANA promoter affects the gene regulation locally at the KLAR but does not elicit
dramatic changes in lytic gene expression. Loss of CTCF occupancy at the LANA
promoter leads to significantly less virus production in iSLK virus-producing cells,
indicating the looping function of CTCF may have a role in aiding efficient generation of
progeny virions.
Chromatin structure is altered when the insulator element is not bound by CTCF.
More specifically, nucleosomes downstream of the CTCF sites become disorganized,
leading to the propagation of DNA methylation upstream towards the promoter. CTCF
has many roles in the nucleus; therefore, one role of CTCF is to prevent the aberrant
spread of DNA methylation to silence gene promoters. The promoter chromatin
structure is also changed when CTCF is not bound, leading to a subpopulation of
molecules in which the K14 TSS is accessible. These observed classes of molecules
with differential chromatin accessibility indicate that, upon infection, CTCF binding at the
LANA promoter regulates the chromatin landscape at the LANA TSSs, repressing the
early lytic K14 gene and exerting modest regulation of LANA expression. CTCF can
form interactions with other regions on the episome as well as separate chromatin
domains.
129
CTCF binding creates an actively transcribed KLAR loop interacting with the 3'
end of the K12 gene. When this loop is disrupted by loss of CTCF binding to the LANA
promoter, the K14 promoter then becomes accessible to transcription factors for gene
transcription. Since it is known from my data that nucleosomes become disorganized as
a result of CTCF not binding to the LANA promoter, this can then lead to different
populations of chromatin accessibility at the LANA promoter. CTCF serves as an
‘organizing center’ and a ‘master latency regulator’ in KSHV, so when CTCF is not
bound, different subpopulations emerge that can be correlated to differential gene
expression patterns at the bidirectional promoter.
Identifying De Novo Methylation Enzymes and Substrates Responsible for DNA Methylation Accumulation on KSHV
Herein, this study determined the approximate time needed to accumulate DNA
methylation for subsequent experiments involving cell lines infected with WT and mutant
KSHV. These studies showed that little to no DNA methylation had accumulated on
KSHV episomes in SLK cells at 5 dpi. In contrast, MeDIP data showed that significant
DNA methylation had accumulated at 240 dpi across the entire episome, which
exhibited a pattern similar to that observed in latently infected BCBL-1 cells (Günther
and Grundhoff, 2010). In the field of KSHV biology, it has been established that DNA
methylation may have no significant role in early establishment of latency and may
possibly have a role in long-term latency of the virus. Therefore, DNA methylation
establishment of the episome has not been studied in great detail and a timetable and
rate for accumulation of methylation was not known. The KSHV region I initially focused
my studies to measure DNA methylation was the +1/+2 nucleosomal linker (containing 7
CpG sites) downstream of the three tandem CTCF binding sites in the LANA ORF.
130
Using pyrosequencing, it was determined that HEK293T cells infected with WT KSHV
linearly accumulated DNA methylation (Figure 2-3D). More specifically, 35%
methylation was reached at 150 dpi in the +1/+2 linker (CpG site 4) and 80%
methylation at 210 dpi in the +2/+3 nucleosomal linker as assayed by pyrosequencing
(Figure 2-3B) and BGS (Figure 4-3A), respectively. The +1/+2 linker showed 100% DNA
methylation in BCBL-1 cells, a long-term latently infected cell line at two CpG sites (site
4 and 6). I also measured the DNA methylation over a similar time course using two
other KSHV-infected cell lines, iSLK and TIVE. The TIVE cell line is a more biologically
relevant endothelial host cell line for KSHV, which has been extensively characterized
(An et al., 2006). While the SLK cell line was thought to have been of endothelial origin,
a recent study determined that the cell line is not of endothelial origin and is
indistinguishable from the epithelial clear-cell renal-cell carcinoma cell line Caki-1
(Sturzl et al., 2013). However, these two cell lines did not show a similar rate of DNA
methylation accumulation as shown in HEK293T cells, but rather amassed minimal
DNA methylation.
Further experiments can be conducted to determine why HEK293T cells have
the ability to de novo methylate KSHV episomes at a faster rate than iSLK or TIVE cells.
It is first important to determine the expression levels of DNMTs, both DNMT1 and de
novo DNMTs, by gene expression and western blot analyses. It is also important to
measure any changes in DNMT expression after KSHV infection, to determine any
influence KSHV infection may have on the expression and regulation of host DNMTs.
Once it is determined which DNMTs are expressed in these cell lines, it is important to
determine which DNMT is most involved in methylating the KSHV genome. Thus,
131
knockdown or CRISPR gene-knockout experiments will need to be performed to
determine the key enzymes involved in methylating the episome. Also, it would be
valuable to determine if over-expressing DNMTs in various cell lines leads to faster
methylation of the virus. Once the enzymes that are responsible for DNA methylation
accumulation on the virus are identified, additional biochemical experiments are needed
to precisely identify their substrate. DNMT3A has been shown at low resolution to
preferentially methylate a reconstituted dinucleosome with 46 bp of linker DNA
(Takeshima et al., 2008). Defining the molecular substrates for de novo methylation is
expected to yield mechanistic insights into how insulators organize DNA methylation
and prevent its aberrant spread in disease. These studies are also expected to provide
further testable models for how DNA methylation is established during fundamental life
processes, such as development and differentiation.
The Effect of a Barrier Element at the LANA Promoter on the KSHV Transcriptome
In this dissertation, I described a strategy to create a genetic recombinant KSHV
where the CTCF sites at the LANA promoter are either deleted (154 bp deletion) or
replaced with three tandem LexA binding sites. Disruption of CTCF binding at the LANA
promoter deregulated viral gene expression after suboptimal induction of lytic
reactivation with sodium butyrate and diminished the amount of extracellular viral
particles produced after induction of an RTA transgene in iSLK cells. These results
showed similarities and differences to a 2011 study performed by the Lieberman
laboratory (Kang et al., 2011), where point mutations were made within the CTCF sites
to impede CTCF binding. They observed that mutant virus yielded 10-fold less
extracellular viral particles than wild-type when lytic reactivation was induced by TPA
and sodium butyrate. I observed a similar trend in reduced amounts of extracellular viral
132
particles, but to a greater magnitude (Figure 3-6A). However, they observed that LANA
transcript levels were elevated 2-3 fold in the mutant virus compared to wild-type. I
measured that there was either no change or slight increase in LANA transcripts and
LANA protein (Figure 3-5C and 3-7A). They also measured other transcript levels
including RTA and K14, which were reduced by 2-3 fold. I observed a reduction in RTA
transcripts but measured a two-fold increase in K14 mRNA that is transcribed on the
opposite strand and shares a promoter with LANA (Figure 3-7A), although it has its own
TATA box element. There are, however, some concerns regarding the KSHV-containing
BAC that Lieberman and colleagues used for their experiments. They used the KSHV
BAC36 construct that has been shown to contain a large duplication of the KSHV
genome in its TRs (Yakushko et al., 2011). Also, these experiments were conducted by
transfecting the mutated BACmids into HEK293T cells, whereas I performed all of my
studies by viral infection.
Herpesviruses coordinate opposing biphasic patterns of latent and lytic gene
expression, and contribute to both positive and negative regulation of viral and host
genes. In KSHV, the expression of latent transcripts in the KLAR (LANA and v-miRNAs)
have been shown to suppress lytic reactivation by inhibiting RTA expression, which
promotes lytic reactivation and coordinated transcription of lytic gene expression (Lu et
al., 2010; Matsumura et al., 2005). In gamma-herpesviruses, there is a small
percentage (<3%) of episomes that undergo lytic reactivation, which is responsible for
maintaining the viral genome copy number and episome persistence in a latently
infected cell (Gründhoff and Ganem, 2004). Thus, maintenance of viral episomes in
133
latently infected cells may require the regulation of both latent and lytic genes in a tightly
regulated, coordinated fashion that may involve CTCF binding to the LANA promoter.
Future experiments to investigate the role of CTCF binding to the LANA promoter
on gene expression during latency and lytic reactivation still need to be conducted. It is
unknown how CTCF binding at the LANA promoter influences global viral gene
expression, because we and others have only focused on a few major viral genes.
Currently in the literature, studies have been performed by globally depleting CTCF then
assessing the viral gene expression, which leads to lytic reactivation of KSHV (Li et al.,
2014). It would be advantageous to perform RNA-seq of HEK293T cells infected with
wild-type and mutated KSHV viruses. These data will be valuable to show how the
CTCF binding at the LANA promoter affects viral transcription either locally (KLAR) or
globally.
Deconvoluting the Distribution and Spread of Chromatin Modifications
Cytosine methylation alters the chemistry of the major groove of DNA, which
impacts local chromatin architecture (Bird and Wolffe, 1999). DNA methylation can
inhibit CTCF binding to DNA. CTCF has unusual properties that can dramatically
influence local chromatin architecture through the formation of higher-order structures,
regulating gene expression and preventing the intermixing of chromatin domains
(Splinter et al., 2006). This suggests that CTCF insulators have a dual role in enhancer
blocking as well as preventing the spread of epigenetic marks and therefore protects
nearby active promoters from epigenetic silencing. CTCF locally depletes nucleosomes
at its binding sites, and flanking nucleosomes are marked with active histone
modifications (Herold et al., 2012). It has been proposed that the active histone
modifications may prevent the spreading of repressive histone modifications, such as
134
H3K27 trimethylation, from one side of the insulator to the other (Cuddapah et al., 2009;
Gaszner and Felsenfeld, 2006). When CTCF itself is depleted, nucleosome density is
increased at CTCF binding sites and these nucleosomes are decorated with repressive
histone marks that can spread into an active chromatin domain (Herold et al., 2012). In
a 2014 study, CTCF was depleted and the spreading of histone marks was examined
as well as gene expression of three actively transcribed genes. Their conclusion was
that depleting CTCF led to repression of three genes (ATP8B2, EXT2, and OAS1) and
accumulation of H3K27 trimethylation marks (Weth et al., 2014). In Chapter 4, I showed
that local elimination of CTCF binding by mutation of the LANA promoter leads to gene
body methylation advancing towards, but not into, the promoter.
The propagation of DNA methylation from the LANA transcribed region upstream
towards the promoter when CTCF is not bound is a direct result of the nucleosomes
being disorganized. CTCF is known to organize arrays of well-positioned nucleosomes
and it has also been shown by the Kladde laboratory and others that nucleosomal
linkers are methylated (Darst et al., 2013; Fu et al., 2008; Kelly et al., 2012). This leads
to a model where the organized and well-positioned nucleosomes are substrates for
DNMTs to bind to and methylate linker DNA. When nucleosomes are disorganized by
the absence of CTCF binding, as shown in Figure 4-3A, the DNA methylation is no
longer restricted to one linker location and hence encroaches upstream due to the
randomness of the nucleosome positioning. However, at 210 dpi, the DNA methylation
has not yet reached the latent and lytic TSSs of the LANA promoter. A possible
explanation for why the DNA methylation has not yet encroached on the promoter is
because of the presence of active H3K4 trimethylation marks. It is known that H3K4
135
trimethylation can inhibit DNMT binding and thus decrease DNA methylation (Rose and
Klose, 2014). Therefore, there is opposition between H3K4 trimethylated histones at the
promoter and methylated chromatin in the open reading frame of LANA. The
euchromatin at the promoter has a role in protecting the LANA promoter from aberrant
spread of DNA methylation from the transcribed region. The spread of histone
methylation can be assessed by performing ChIP for H3K4 trimethylation, H3K27
trimethylation, H3K36 trimethylation, histone H3, and the histone variant H3.3 in
HEK293T cells infected with either wild-type or lexO mutant KSHV. A primer walk along
the LANA promoter and ORF would determine the distribution of histone modifications
when CTCF is not bound.
The 454 sequencing data that were generated for my analysis contained more
sequencing reads for the deletion mutant than for either wild-type or lexO mutant. The
next step is to design primers that are equal in length and avoid the CTCF or lexO sites.
This is possible because my data cleanly determined that CTCF binds to the LANA
promoter in WT episomes but not to lexO-containing episomes. This will allow for more
robust PCR amplification of the wild-type and lexO mutants, because the previous
primers resulted in low efficiency of generating PCR products as it is difficult to amplify
across the imperfect lexO palindromes. Additionally, it is important to produce another
sequencing library to generate more reads from a few more time points, including a later
time point to measure how far the DNA methylation has spread into the LANA promoter.
Amplicons from an additional lexO mutant clone should also be examined to determine
if any differences in chromatin accessibility and DNA methylation are observed. This is
especially important as my gene expression and histone modification data show there
136
are clear differences between clones (Figure 3-7C and 3-6D). Also, a control locus
needs to be added to the sequencing library to assess the M.CviPI probing efficiency,
e.g., the well-studied, open MLH1 promoter.
When analyzing the LANA promoter in wild-type and mutant KSHV over the time
course, I observed that the LANA promoter lacks detectable DNA methylation. In the
deletion mutant virus, I observed four different clusters of chromatin accessibility. The
majority of the molecules in the deletion mutant were identical to the wild-type
molecules, with chromatin accessibility contained at and slightly upstream of the latent
TSS. The next most abundant class of molecules obtained from the deletion mutant was
molecules that were completely inaccessible. Such molecules are thought to be
decorated by PRC2 complexes and are epigenetically silent episomes. To test if these
inaccessible molecules are indeed decorated with PRC2 complexes, one could utilize
MAPit probing followed by ChIP (MAPit-ChIP) to isolate and evaluate the chromatin
structure of molecules that are occupied with PRC2 complexes. A less abundant class
of molecules, which has not been previously identified, shows a chromatin accessibility
profile where the K14 TSS is accessible. In order to determine if these molecules were
indeed transcribing K14 on the opposite strand, a new technique needs to be developed
that includes MAPit followed by strand-specific enrichment of RNA Pol II specifically
transcribing the K14 sequences.
Future directions for this project are to further understand the role of CTCF as a
boundary element in respect to nucleosome positioning and organization of DNA
methylation. Expressing the prokaryotic LexA binding protein in cells infected with the
KSHV lexO replacement mutant would determine the extent to which a heterologous
137
DNA-binding protein can establish a boundary in chromatin. The binding of LexA protein
could potentially serve as a sufficient physical boundary element at the LANA promoter
that organizes nucleosomes and DNA methylation. It is known that LexA homodimers
binding to ≥3 lexO sites can block the propagation of transcriptionally silenced
chromatin in a budding yeast system (Bi et al., 2004). On the other hand, if these
experiments show that LexA binding is not sufficient to disrupt nucleosomes in human
cells, then other nucleosome exclusion sequences can be used as nucleosome
disruption sequences and potential silent chromatin barriers. Such potential nucleosome
exclusion sequences include (CCGNN)n ( n = G, C, A, or T) and poly(dA-dT) tracts (Bi
et al., 2004).
As it has been shown by multiple laboratories in the KSHV field that post-
translational modifications of histones, not DNA methylation, control early establishment
of latency, it would be interesting to determine how the chromatin structure is organized
on the episome very early on after de novo infection. The KSHV genome is linear and
contains no detectable histones or DNA methylation prior to infection inside the capsid.
Upon infection into the host cell nucleus, the KSHV genome quickly circularizes and
accumulates histones to assemble nucleosomes. Histone modifications are then quickly
altered, within hours and days, reprogramming from euchromatic to a heterochromatic
episomes to establish latency within the host cell. It would be interesting to visualize the
deposition of histones and transcription factors on the episome during the early
transition from a euchromatic episome to heterochromatin (latent) episome at the LANA
promoter and other KSHV loci.
138
In summary, the experiments described in this dissertation provide evidence that
CTCF organizes arrays of well-positioned nucleosomes with DNA methylation restricted
to linkers at the KSHV LANA ORF. This suggests that CTCF acts as a barrier element
to protect the LANA promoter from DNA methylation, which could otherwise
epigenetically silence the most important region for episomal persistence. When CTCF
is not bound to the LANA promoter, nucleosomes are disorganized in the open reading
frame and DNA methylation advances towards the LANA promoter. However, the DNA
methylation did not reach the TSSs. This can be accounted for by the high occupancy of
H3K4 trimethylation at the promoter, which blocks DNMT binding (Rose and Klose,
2014).
Potential Therapeutic Approach in Silencing LANA
In addition to the local mutagenesis studies described in this dissertation to
disrupt CTCF binding at the LANA promoter to measure changes in chromatin structure,
these recombinant mutants could facilitate the study of herpesvirus pathogenesis (Glass
et al., 2009; Schmeisser and Weir, 2007). Based on my data, the spreading of gene
body methylation from the KSHV LANA ORF towards the promoter can serve as a
potential therapeutic strategy to silence the LANA gene. At the latest time of 210 dpi
assayed, gene body methylation has not reached the LANA promoter; however, it is
possible that the promoter will eventually become hypermethylated after long-term
passaging in culture. KSHV requires constant expression of LANA, from only a few
episomes in each cell based on chromatin accessibility profiling in BCBL-1 cells, which
is essential for establishing and maintaining latency (Darst et al., 2013; Grundhoff and
Ganem, 2004). LANA protein is also critical for the replication of KSHV in that it recruits
host cellular replication proteins, tethers episomes to host chromosomes, and assists in
139
segregation of replicated genomes to individual daughter cells during cell division
(Uppal et al., 2014). Silencing this ‘master regulator’ for KSHV latency in vivo by
targeting the three tandem CTCF sites at the LANA promoter can lead to two potential
therapeutic outcomes: 1) low viral progeny production; and 2) silencing of LANA by
aberrant mobilization of gene body methylation into the LANA promoter. In vivo site-
directed mutagenesis could also be accomplished by CRISPR/Cas9 genome editing
(Savic and Schwank). From my data, I measured at least 100-fold less extracellular
virion production after induction of lytic reactivation. Immunocompromised individuals
who are latently infected with recombinant virus that contain mutations within the CTCF
binding sites at LANA, would produce less virion particles and therefore would be less
likely to infect more cells than wild-type virus. In addition, individuals latently infected
with this recombinant virus may eventually contain episomes where LANA is
epigenetically silent by the propagation of gene body methylation towards and onto the
promoter. This silencing of LANA over a period of time could result in epigenetically
‘dead’ KSHV by the inability to express LANA.
Using KSHV as a model system to study and understand mechanisms in
epigenetic regulation, genome organization, and chromatin structure can be related and
carried over to mechanisms in the human genome. Since KSHV is a double-stranded,
circular, DNA virus, the genomic features, organization and regulation of genes are
comparable to aspects in the human genome. Therefore, mechanisms of how CTCF
organizes nucleosomes and DNA methylation in KSHV can inform how CTCF organizes
and prevents the spread of chromatin domains in human genomes.
140
LIST OF REFERENCES
Aapola, U., Maenpaa, K., Kaipia, A., and Peterson, P. (2004). Epigenetic modifications affect Dnmt3L expression. Biochem J 380, 705-713.
Adelman, K., and Lis, J.T. (2012). Promoter-proximal pausing of RNA polymerase II: emerging roles in metazoans. Nat Rev Genet 13, 720-731.
Adkins, M.W., Howar, S.R., and Tyler, J.K. (2004). Chromatin disassembly mediated by the histone chaperone Asf1 is essential for transcriptional activation of the yeast PHO5 and PHO8 genes. Mol Cell 14, 657-666.
Ahmed, I., Sarazin, A., Bowler, C., Colot, V., and Quesneville, H. (2011). Genome-wide evidence for local DNA methylation spreading from small RNA-targeted sequences in Arabidopsis. Nucleic Acids Res 39, 6919-6931.
Akey, C.W., and Luger, K. (2003). Histone chaperones and nucleosome assembly. Curr Opin Struct Biol 13, 6-14.
Amelio, A.L., McAnany, P.K., and Bloom, D.C. (2006). A chromatin insulator-like element in the herpes simplex virus type 1 latency-associated transcript region binds CCCTC-binding factor and displays enhancer-blocking and silencing activities. J Virol 80, 2358-2368.
An, F.Q., Folarin, H.M., Compitello, N., Roth, J., Gerson, S.L., McCrae, K.R., Fakhari, F.D., Dittmer, D.P., and Renne, R. (2006). Long-term-infected telomerase-immortalized endothelial cells: a model for Kaposi's sarcoma-associated herpesvirus latency in vitro and in vivo. J Virol 80, 4833-4846.
Arnold, R., Burcin, M., Kaiser, B., Muller, M., and Renkawitz, R. (1996). DNA bending by the silencer protein NeP1 is modulated by TR and RXR. Nucleic Acids Res 24, 2640-2647.
Awad, T.A., Bigler, J., Ulmer, J.E., Hu, Y.J., Moore, J.M., Lutz, M., Neiman, P.E., Collins, S.J., Renkawitz, R., Lobanenkov, V.V., and Filippova, G. N. (1999). Negative transcriptional regulation mediated by thyroid hormone response element 144 requires binding of the multivalent factor CTCF to a novel target DNA sequence. J Biol Chem 274, 27092-27098.
Bai, L., and Morozov, A.V. (2010). Gene regulation by nucleosome positioning. Trends Genet 26, 476-483.
Ballestas, M.E., Chatis, P.A., and Kaye, K.M. (1999). Efficient persistence of extrachromosomal KSHV DNA mediated by latency-associated nuclear antigen. Science 284, 641-644.
141
Barbera, A.J., Chodaparambil, J.V., Kelley-Clarke, B., Joukov, V., Walter, J.C., Luger, K., and Kaye, K.M. (2006a). The nucleosomal surface as a docking station for Kaposi's sarcoma herpesvirus LANA. Science 311, 856-861.
Barbera, A.J., Chodaparambil, J.V., Kelley-Clarke, B., Luger, K., and Kaye, K.M. (2006b). Kaposi's sarcoma-associated herpesvirus LANA hitches a ride on the chromosome. Cell Cycle 5, 1048-1052.
Barski, A., Cuddapah, S., Cui, K., Roh, T.Y., Schones, D.E., Wang, Z., Wei, G., Chepelev, I., and Zhao, K. (2007). High-resolution profiling of histone methylations in the human genome. Cell 129, 823-837.
Bechtel, J.T., Liang, Y., Hvidding, J., and Ganem, D. (2003). Host range of Kaposi's sarcoma-associated herpesvirus in cultured cells. J Virol 77, 6474-6481.
Bell, A.C., and Felsenfeld, G. (2000). Methylation of a CTCF-dependent boundary controls imprinted expression of the Igf2 gene. Nature 405, 482-485.
Bernstein, B.E., Liu, C.L., Humphrey, E.L., Perlstein, E.O., and Schreiber, S.L. (2004). Global nucleosome occupancy in yeast. Genome Biol 5, R62.
Bernstein, B. E., Mikkelsen, T. S., Xie, X., Kamal, M., Huebert, D. J., Cuff, J., Fry, B., Meissner, A., Wernig, M., Plath, K., Jaenisch, R., Wagschal, A., Feil, R., Schreiber, S. L., and Lander, E. S. (2006). A bivalent chromatin structure marks key developmental genes in embryonic stem cells. Cell 125, 315-326.
Bestor, T.H. (2000). The DNA methyltransferases of mammals. Hum Mol Genet 9, 2395-2402.
Bi, X., Yu, Q., Sandmeier, J.J., and Zou, Y. (2004). Formation of boundaries of transcriptionally silent chromatin by nucleosome-excluding structures. Mol Cell Biol 24, 2118-2131.
Bird, A.P. (1986). CpG-rich islands and the function of DNA methylation. Nature 321, 209-213.
Bird, A.P., and Wolffe, A.P. (1999). Methylation-induced repression−belts, braces, and chromatin. Cell 99, 451-454.
Boshoff, C., Schulz, T.F., Kennedy, M.M., Graham, A.K., Fisher, C., Thomas, A., McGee, J.O., Weiss, R.A., and O'Leary, J.J. (1995). Kaposi's sarcoma-associated herpesvirus infects endothelial and spindle cells. Nat Med 1, 1274-1278.
Boumil, R.M., and Lee, J.T. (2001). Forty years of decoding the silence in X-chromosome inactivation. Hum Mol Genet 10, 2225-2232.
142
Boyes, J., and Bird, A. (1991). DNA methylation inhibits transcription indirectly via a methyl-CpG binding protein. Cell 64, 1123-1134.
Boyle, A.P., Song, L., Lee, B.K., London, D., Keefe, D., Birney, E., Iyer, V.R., Crawford, G.E., and Furey, T.S. (2011). High-resolution genome-wide in vivo footprinting of diverse transcription factors in human cells. Genome Res 21, 456-464.
Brown, S.J., Stoilov, P., and Xing, Y. (2012). Chromatin and epigenetic regulation of pre-mRNA processing. Hum Mol Genet 21, R90-96.
Brulois, K. F., Chang, H., Lee, A. S., Ensser, A., Wong, L. Y., Toth, Z., Lee, S. H., Lee, H. R., Myoung, J., Ganem, D., Oh, T. K., Kim, J. F., Gao, S. J., and Jung, J. U. (2012). Construction and manipulation of a new Kaposi's sarcoma-associated herpesvirus bacterial artificial chromosome clone. J Virol 86, 9708-9720.
Burcin, M., Arnold, R., Lutz, M., Kaiser, B., Runge, D., Lottspeich, F., Filippova, G.N., Lobanenkov, V.V., and Renkawitz, R. (1997). Negative protein 1, which is required for function of the chicken lysozyme gene silencer in conjunction with hormone receptors, is identical to the multivalent zinc finger repressor CTCF. Mol Cell Biol 17, 1281-1288.
Carninci, P. (2006). Tagging mammalian transcription complexity. Trends Genet 22, 501-510.
Cesarman, E., Chang, Y., Moore, P.S., Said, J.W., and Knowles, D.M. (1995a). Kaposi's sarcoma-associated herpesvirus-like DNA sequences in AIDS-related body-cavity-based lymphomas. N Engl J Med 332, 1186-1191.
Cesarman, E., Moore, P.S., Rao, P.H., Inghirami, G., Knowles, D.M., and Chang, Y. (1995b). In vitro establishment and characterization of two acquired immunodeficiency syndrome-related lymphoma cell lines (BC-1 and BC-2) containing Kaposi's sarcoma-associated herpesvirus-like (KSHV) DNA sequences. Blood 86, 2708-2714.
Cesarman, E., Nador, R.G., Bai, F., Bohenzky, R.A., Russo, J.J., Moore, P.S., Chang, Y., and Knowles, D.M. (1996). Kaposi's sarcoma-associated herpesvirus contains G protein-coupled receptor and cyclin D homologs which are expressed in Kaposi's sarcoma and malignant lymphoma. J Virol 70, 8218-8223.
Chang, J., and Ganem, D. (2000). On the control of late gene expression in Kaposi's sarcoma-associated herpesvirus (human herpesvirus-8). J Gen Virol 81, 2039-2047.
Chang, Y., Cesarman, E., Pessin, M.S., Lee, F., Culpepper, J., Knowles, D.M., and Moore, P.S. (1994). Identification of herpesvirus-like DNA sequences in AIDS-associated Kaposi's sarcoma. Science 266, 1865-1869.
143
Chau, C.M., Zhang, X.Y., McMahon, S.B., and Lieberman, P.M. (2006). Regulation of Epstein-Barr virus latency type by the chromatin boundary factor CTCF. J Virol 80, 5723-5732.
Chen, H., Tian, Y., Shu, W., Bo, X., and Wang, S. (2012a). Comprehensive identification and annotation of cell type-specific and ubiquitous CTCF-binding sites in the human genome. PLoS One 7, e41374.
Chen, H.S., Lu, F., and Lieberman, P.M. (2013). Epigenetic regulation of EBV and KSHV latency. Curr Opin Virol 3, 251-259.
Chen, H.S., Wikramasinghe, P., Showe, L., and Lieberman, P.M. (2012b). Cohesins repress Kaposi's sarcoma-associated herpesvirus immediate early gene transcription during latency. J Virol 86, 9454-9464.
Chen, J., Ueda, K., Sakakibara, S., Okuno, T., Parravicini, C., Corbellino, M., and Yamanishi, K. (2001). Activation of latent Kaposi's sarcoma-associated herpesvirus by demethylation of the promoter of the lytic transactivator. Proc Natl Acad Sci USA 98, 4119-4124.
Chen, T., Ueda, Y., Dodge, J.E., Wang, Z., and Li, E. (2003). Establishment and maintenance of genomic methylation patterns in mouse embryonic stem cells by Dnmt3a and Dnmt3b. Mol Cell Biol 23, 5594-5605.
Chen, Z.X., and Riggs, A.D. (2005). Maintenance and regulation of DNA methylation patterns in mammals. Biochem Cell Biol 83, 438-448.
Cheng, X., and Blumenthal, R.M. (2008). Mammalian DNA methyltransferases: a structural perspective. Structure 16, 341-350.
Chiou, C.J., Poole, L.J., Kim, P.S., Ciufo, D.M., Cannon, J.S., ap Rhys, C.M., Alcendor, D.J., Zong, J.C., Ambinder, R.F., and Hayward, G.S. (2002). Patterns of gene expression and a transactivation function exhibited by the vGCR (ORF74) chemokine receptor protein of Kaposi's sarcoma-associated herpesvirus. J Virol 76, 3421-3439.
Chodavarapu, R. K., Feng, S., Bernatavichute, Y. V., Chen, P. Y., Stroud, H., Yu, Y., Hetzel, J. A., Kuo, F., Kim, J., Cokus, S. J., Casero, D., Bernal, M., Huijser, P., Clark, A. T., Kramer, U., Merchant, S. S., Zhang, X., Jacobsen, S. E., and Pellegrini, M. (2010). Relationship between nucleosome positioning and DNA methylation. Nature 466, 388-392.
Chuang, L.S., Ian, H.I., Koh, T.W., Ng, H.H., Xu, G., and Li, B.F. (1997). Human DNA-(cytosine-5) methyltransferase-PCNA complex as a target for p21WAF1. Science 277, 1996-2000.
144
Chung, Y.H., Means, R.E., Choi, J.K., Lee, B.S., and Jung, J.U. (2002). Kaposi's sarcoma-associated herpesvirus OX2 glycoprotein activates myeloid-lineage cells to induce inflammatory cytokine production. J Virol 76, 4688-4698.
Cokus, S.J., Feng, S., Zhang, X., Chen, Z., Merriman, B., Haudenschild, C.D., Pradhan, S., Nelson, S.F., Pellegrini, M., and Jacobsen, S.E. (2008). Shotgun bisulphite sequencing of the Arabidopsis genome reveals DNA methylation patterning. Nature 452, 215-219.
Cuddapah, S., Jothi, R., Schones, D.E., Roh, T.Y., Cui, K., and Zhao, K. (2009). Global analysis of the insulator binding protein CTCF in chromatin barrier regions reveals demarcation of active and repressive domains. Genome Res 19, 24-32.
Darst, R.P., Haecker, I., Pardo, C.E., Renne, R., and Kladde, M.P. (2013). Epigenetic diversity of Kaposi's sarcoma-associated herpesvirus. Nucleic Acids Res 41, 2993-3009.
Darst, R.P., Pardo, C.E., Ai, L., Brown, K.D., and Kladde, M.P. (2010). Bisulfite sequencing of DNA. Curr Protoc Mol Biol Chapter 7, Unit 7.9.1-7.9.16.
Davey, C., Pennings, S., and Allan, J. (1997). CpG methylation remodels chromatin structure in vitro. J Mol Biol 267, 276-288.
Davey, C.S., Pennings, S., Reilly, C., Meehan, R.R., and Allan, J. (2004). A determining influence for CpG dinucleotides on nucleosome positioning in vitro. Nucleic Acids Res 32, 4322-4331.
De La Rosa-Velazquez, I.A., Rincon-Arano, H., Benitez-Bribiesca, L., and Recillas-Targa, F. (2007). Epigenetic regulation of the human retinoblastoma tumor suppressor gene promoter by CTCF. Cancer Res 67, 2577-2585.
Deng, H., Young, A., and Sun, R. (2000). Auto-activation of the Rta gene of human herpesvirus-8/Kaposi's sarcoma-associated herpesvirus. J Gen Virol 81, 3043-3048.
Dhayalan, A., Rajavelu, A., Rathert, P., Tamas, R., Jurkowska, R.Z., Ragozin, S., and Jeltsch, A. (2010). The Dnmt3a PWWP domain reads histone 3 lysine 36 trimethylation and guides DNA methylation. J Biol Chem 285, 26114-26120.
Diekmann, S. (1987). DNA methylation can enhance or induce DNA curvature. EMBO J 6, 4213-4217.
Dodge, J.E., Okano, M., Dick, F., Tsujimoto, N., Chen, T., Wang, S., Ueda, Y., Dyson, N., and Li, E. (2005). Inactivation of Dnmt3b in mouse embryonic fibroblasts results in DNA hypomethylation, chromosomal instability, and spontaneous immortalization. J Biol Chem 280, 17986-17991.
145
Dorsett, D. (2011). Cohesin: genomic insights into controlling gene transcription and development. Curr Opin Genet Dev 21, 199-206.
Dwivedi, R.S., Herman, J.G., McCaffrey, T.A., and Raj, D.S. (2011). Beyond genetics: epigenetic code in chronic kidney disease. Kidney Int 79, 23-32.
Edmunds, J.W., Mahadevan, L.C., and Clayton, A.L. (2008). Dynamic histone H3 methylation during gene induction: HYPB/Setd2 mediates all H3K36 trimethylation. EMBO J 27, 406-420.
England, R., and Pettersson, M. (2005). Pyro Q-CpG™: quantitative analysis of methylation in multiple CpG sites by Pyrosequencing®. Nature Methods 2, 1-2.
Essafi, A., Webb, A., Berry, R. L., Slight, J., Burn, S. F., Spraggon, L., Velecela, V., Martinez-Estrada, O. M., Wiltshire, J. H., Roberts, S. G., Brownstein, D., Davies, J. A., Hastie, N. D., and Hohenstein, P. (2011). A Wt1-controlled chromatin switching mechanism underpins tissue-specific Wnt4 activation and repression. Dev Cell 21, 559-574.
Esteller, M. (2007). Epigenetic gene silencing in cancer: the DNA hypermethylome. Hum Mol Genet 16 Spec No 1, R50-59.
Fedoriw, A.M., Stein, P., Svoboda, P., Schultz, R.M., and Bartolomei, M.S. (2004). Transgenic RNAi reveals essential function for CTCF in H19 gene imprinting. Science 303, 238-240.
Feldmann, A., Ivanek, R., Murr, R., Gaidatzis, D., Burger, L., and Schübeler, D. (2013). Transcription factor occupancy can mediate active turnover of DNA methylation at regulatory regions. PLoS Genet 9, e1003994.
Felle, M., Hoffmeister, H., Rothammer, J., Fuchs, A., Exler, J.H., and Langst, G. (2011). Nucleosomes protect DNA from DNA methylation in vivo and in vitro. Nucleic Acids Res 39, 6956-6969.
Filippova, G.N., Fagerlie, S., Klenova, E.M., Myers, C., Dehner, Y., Goodwin, G., Neiman, P.E., Collins, S.J., and Lobanenkov, V.V. (1996). An exceptionally conserved transcriptional repressor, CTCF, employs different combinations of zinc fingers to bind diverged promoter sequences of avian and mammalian c-myc oncogenes. Mol Cell Biol 16, 2802-2813.
Filippova, G. N., Qi, C. F., Ulmer, J. E., Moore, J. M., Ward, M. D., Hu, Y. J., Loukinov, D. I., Pugacheva, E. M., Klenova, E. M., Grundy, P. E., Feinberg, A. P., Cleton-Jansen, A. M., Moerland, E. W., Cornelisse, C. J., Suzuki, H., Komiya, A., Lindblom, A., Dorion-Bonnet, F., Neiman, P. E., Morse, H. C., 3rd, Collins, S. J., and Lobanenkov, V. V. (2002). Tumor-associated zinc finger mutations in the CTCF transcription factor selectively alter its DNA-binding specificity. Cancer Res 62, 48-52.
146
Fu, Y.T., Sinha, M., Peterson, C.L., and Weng, Z.P. (2008). The insulator binding protein CTCF positions 20 nucleosomes around its binding sites across the Human Genome. PLoS Genet 4.
Fujita, N., Shimotake, N., Ohki, I., Chiba, T., Saya, H., Shirakawa, M., and Nakao, M. (2000). Mechanism of transcriptional regulation by methyl-CpG binding protein MBD1. Mol Cell Biol 20, 5107-5118.
Gaszner, M., and Felsenfeld, G. (2006). Insulators: exploiting transcriptional and epigenetic mechanisms. Nat Rev Genet 7, 703-713.
Glass, M., Busche, A., Wagner, K., Messerle, M., and Borst, E.M. (2009). Conditional and reversible disruption of essential herpesvirus proteins. Nature Methods 6, 577-579.
Godde, J.S., Kass, S.U., Hirst, M.C., and Wolffe, A.P. (1996). Nucleosome assembly on methylated CGG triplet repeats in the fragile X mental retardation gene 1 promoter. J Biol Chem 271, 24325-24328.
Goll, M.G., and Bestor, T.H. (2005). Eukaryotic cytosine methyltransferases. Ann Rev Biochem 74, 481-514.
Goll, M.G., Kirpekar, F., Maggert, K.A., Yoder, J.A., Hsieh, C.L., Zhang, X., Golic, K.G., Jacobsen, S.E., and Bestor, T.H. (2006). Methylation of tRNAAsp by the DNA methyltransferase homolog Dnmt2. Science 311, 395-398.
Gombert, W.M., and Krumm, A. (2009). Targeted deletion of multiple CTCF-binding elements in the human C-MYC gene reveals a requirement for CTCF in C-MYC expression. PLoS One 4, e6109.
Goyal, R., Reinhardt, R., and Jeltsch, A. (2006). Accuracy of DNA methylation pattern preservation by the Dnmt1 methyltransferase. Nucleic Acids Res 34, 1182-1188.
Grewal, S.I., and Jia, S. (2007). Heterochromatin revisited. Nat Rev Genet 8, 35-46.
Grundhoff, A., and Ganem, D. (2004). Inefficient establishment of KSHV latency suggests an additional role for continued lytic replication in Kaposi sarcoma pathogenesis. J Clin Invest 113, 124-136.
Grunstein, M. (1997). Histone acetylation in chromatin structure and transcription. Nature 389, 349-352.
Guastafierro, T., Cecchinelli, B., Zampieri, M., Reale, A., Riggio, G., Sthandier, O., Zupi, G., Calabrese, L., and Caiafa, P. (2008). CCCTC-binding factor activates PARP-1 affecting DNA methylation machinery. J Biol Chem 283, 21873-21880.
147
Guito, J., and Lukac, D.M. (2012). KSHV Rta promoter specification and viral reactivation. Front Microbiol 3, 30.
Günther, T., and Grundhoff, A. (2010). The epigenetic landscape of latent Kaposi sarcoma-associated herpesvirus genomes. PLoS Pathog 6, e1000935.
Günther, T., Schreiner, S., Dobner, T., Tessmer, U., and Grundhoff, A. (2014). Influence of ND10 components on epigenetic determinants of early KSHV latency establishment. PLoS Pathog 10, e1004274.
Hagerman, P. (1990). Pyrimidine 5-methyl groups influence the magnitude of DNA curvature. Biochem 29, 1980-1983.
Hahn, M.A., Wu, X., Li, A.X., Hahn, T., and Pfeifer, G.P. (2011). Relationship between gene body DNA methylation and intragenic H3K9me3 and H3K36me3 chromatin marks. PLoS One 6, e18844.
Han, M., and Grunstein, M. (1988). Nucleosome loss activates yeast downstream promoters in vivo. Cell 55, 1137-1145.
Han, S.J., Hu, J., Pierce, B., Weng, Z., and Renne, R. (2010). Mutational analysis of the latency-associated nuclear antigen DNA-binding domain of Kaposi's sarcoma-associated herpesvirus reveals structural conservation among gammaherpesvirus origin-binding proteins. J Gen Virol 91, 2203-2215.
Hargreaves, D.C., and Crabtree, G.R. (2011). ATP-dependent chromatin remodeling: genetics, genomics and mechanisms. Cell Res 21, 396-420.
Hellman, A., and Chess, A. (2007). Gene body-specific methylation on the active X chromosome. Science 315, 1141-1143.
Henikoff, S., Furuyama, T., and Ahmad, K. (2004). Histone variants, nucleosome assembly and epigenetic inheritance. Trends Genet 20, 320-326.
Herold, M., Bartkuhn, M., and Renkawitz, R. (2012). CTCF: insights into insulator function during development. Development 139, 1045-1057.
Hinshelwood, R.A., Melki, J.R., Huschtscha, L.I., Paul, C., Song, J.Z., Stirzaker, C., Reddel, R.R., and Clark, S.J. (2009). Aberrant de novo methylation of the p16INK4A CpG island is initiated post gene silencing in association with chromatin remodelling and mimics nucleosome positioning. Hum Mol Genet 18, 3098-3109.
Hohn, T., Corsten, S., Rieke, S., Müller, M., and Rothnie, H. (1996). Methylation of coding region alone inhibits gene expression in plant protoplasts. Proc Natl Acad Sci USA 93, 8334-8339.
148
Holohan, E.E., Kwong, C., Adryan, B., Bartkuhn, M., Herold, M., Renkawitz, R., Russell, S., and White, R. (2007). CTCF genomic binding sites in Drosophila and the organisation of the bithorax complex. PLoS Genet 3, e112.
Holz-Schietinger, C., Matje, D.M., Harrison, M.F., and Reich, N.O. (2011). Oligomerization of DNMT3A controls the mechanism of de novo DNA methylation. J Biol Chem 286, 41479-41488.
Holz-Schietinger, C., and Reich, N.O. (2010). The inherent processivity of the human de novo methyltransferase 3A (DNMT3A) is enhanced by DNMT3L. J Biol Chem 285, 29091-29100.
Hu, J., Yang, Y., Turner, P.C., Jain, V., McIntyre, L.M., and Renne, R. (2014). LANA binds to multiple active viral and cellular promoters and associates with the H3K4methyltransferase hSET1 complex. PLoS Pathog 10, e1004240.
Irizarry, R. A., Ladd-Acosta, C., Wen, B., Wu, Z., Montano, C., Onyango, P., Cui, H., Gabo, K., Rongione, M., Webster, M., Ji, H., Potash, J. B., Sabunciyan, S., and Feinberg, A. P. (2009). The human colon cancer methylome shows similar hypo- and hypermethylation at conserved tissue-specific CpG island shores. Nat Genet 41, 178-186.
Iyer, V., and Struhl, K. (1995). Poly(dA:dT), a ubiquitous promoter element that stimulates transcription via its intrinsic DNA structure. EMBO J 14, 2570-2579.
Jeltsch, A. (2006). On the enzymatic properties of Dnmt1: specificity, processivity, mechanism of linear diffusion and allosteric regulation of the enzyme. Epigenetics 1, 63-66.
Jenuwein, T., and Allis, C.D. (2001). Translating the histone code. Science 293, 1074-1080.
Jia, D., Jurkowska, R.Z., Zhang, X., Jeltsch, A., and Cheng, X. (2007). Structure of Dnmt3a bound to Dnmt3L suggests a model for de novo DNA methylation. Nature 449, 248-251.
Jiang, C., and Pugh, B.F. (2009). Nucleosome positioning and gene regulation: advances through genomics. Nat Rev Genet 10, 161-172.
Jin, B., Yao, B., Li, J.L., Fields, C.R., Delmas, A.L., Liu, C., and Robertson, K.D. (2009). DNMT1 and DNMT3B modulate distinct polycomb-mediated histone modifications in colon cancer. Cancer Res 69, 7412-7421.
Jones, P.L., and Wolffe, A.P. (1999). Relationships between chromatin organization and DNA methylation in determining gene expression. Semin Cancer Biol 9, 339-347.
149
Jonkers, I., and Lis, J.T. (2015). Getting up to speed with transcription elongation by RNA polymerase II. Nat Rev Mol Cell Biol 16, 167-177.
Jothi, R., Cuddapah, S., Barski, A., Cui, K., and Zhao, K. (2008). Genome-wide identification of in vivo protein-DNA binding sites from ChIP-seq data. Nucleic Acids Res 36, 5221-5231.
Kanduri, C., Pant, V., Loukinov, D., Pugacheva, E., Qi, C.F., Wolffe, A., Ohlsson, R., and Lobanenkov, V.V. (2000). Functional association of CTCF with the insulator upstream of the H19 gene is parent of origin-specific and methylation-sensitive. Curr Biol 10, 853-856.
Kanduri, M., Kanduri, C., Mariano, P., Vostrov, A.A., Quitschke, W., Lobanenkov, V., and Ohlsson, R. (2002). Multiple nucleosome positioning sites regulate the CTCF-mediated insulator function of the H19 imprinting control region. Mol Cell Biol 22, 3339-3344.
Kang, H., Cho, H., Sung, G.H., and Lieberman, P.M. (2013). CTCF regulates Kaposi's sarcoma-associated herpesvirus latency transcription by nucleosome displacement and RNA polymerase programming. J Virol 87, 1789-1799.
Kang, H., Wiedmer, A., Yuan, Y., Robertson, E., and Lieberman, P.M. (2011). Coordination of KSHV latent and lytic gene control by CTCF-cohesin mediated chromosome conformation. PLoS Pathog 7, e1002140.
Kaplan, N., Moore, I. K., Fondufe-Mittendorf, Y., Gossett, A. J., Tillo, D., Field, Y., LeProust, E. M., Hughes, T. R., Lieb, J. D., Widom, J., and Segal, E. (2009). The DNA-encoded nucleosome organization of a eukaryotic genome. Nature 458, 362-366.
Kareta, M.S., Botello, Z.M., Ennis, J.J., Chou, C., and Chedin, F. (2006). Reconstitution and mechanism of the stimulation of de novo methylation by human DNMT3L. J Biol Chem 281, 25893-25902.
Kato, M., Miura, A., Bender, J., Jacobsen, S.E., and Kakutani, T. (2003). Role of CG and non-CG methylation in immobilization of transposons in Arabidopsis. Curr Biol 13, 421-426.
Kelly, T.K., Liu, Y., Lay, F.D., Liang, G., Berman, B.P., and Jones, P.A. (2012). Genome-wide mapping of nucleosome positioning and DNA methylation within individual DNA molecules. Genome Res 22, 2497-2506.
Kim, T.H., Abdullaev, Z.K., Smith, A.D., Ching, K.A., Loukinov, D.I., Green, R.D., Zhang, M.Q., Lobanenkov, V.V., and Ren, B. (2007). Analysis of the vertebrate insulator protein CTCF-binding sites in the human genome. Cell 128, 1231-1245.
150
Kireeva, M.L., Hancock, B., Cremona, G.H., Walter, W., Studitsky, V.M., and Kashlev, M. (2005). Nature of the nucleosomal barrier to RNA polymerase II. Mol Cell 18, 97-108.
Kireeva, M.L., Walter, W., Tchernajenko, V., Bondarenko, V., Kashlev, M., and Studitsky, V.M. (2002). Nucleosome remodeling induced by RNA polymerase II: loss of the H2A/H2B dimer during transcription. Mol Cell 9, 541-552.
Klenova, E.M., Nicolas, R.H., Paterson, H.F., Carne, A.F., Heath, C.M., Goodwin, G.H., Neiman, P.E., and Lobanenkov, V.V. (1993). CTCF, a conserved nuclear factor required for optimal transcriptional activity of the chicken c-myc gene, is an 11-Zn-finger protein differentially expressed in multiple forms. Mol Cell Biol 13, 7612-7624.
Kobayashi, H., Sakurai, T., Imai, M., Takahashi, N., Fukuda, A., Yayoi, O., Sato, S., Nakabayashi, K., Hata, K., Sotomaru, Y., Suzuki, Y., and Kono, T. (2012). Contribution of intragenic DNA methylation in mouse gametic DNA methylomes to establish oocyte-specific heritable marks. PLoS Genet 8, e1002440.
Kornberg, R.D., and Thomas, J.O. (1974). Chromatin structure: oligomers of the histones. Science 184, 865-868.
Kouzarides, T. (2000). Acetylation: a regulatory modification to rival phosphorylation? EMBO J 19, 1176-1179.
Kouzarides, T. (2007). Chromatin modifications and their function. Cell 128, 693-705.
Kwak, H., and Lis, J.T. (2013). Control of transcriptional elongation. Annu Rev Genet 47, 483-508.
Lai, A. Y., Fatemi, M., Dhasarathy, A., Malone, C., Sobol, S. E., Geigerman, C., Jaye, D. L., Mav, D., Shah, R., Li, L., and Wade, P. A. (2010). DNA methylation prevents CTCF-mediated silencing of the oncogene BCL6 in B cell lymphomas. J Exp Med 207, 1939-1950.
Lan, K., Kuppers, D.A., Verma, S.C., and Robertson, E.S. (2004). Kaposi's sarcoma-associated herpesvirus-encoded latency-associated nuclear antigen inhibits lytic replication by targeting Rta: a potential mechanism for virus-mediated control of latency. J Virol 78, 6585-6594.
Lee, W., Tillo, D., Bray, N., Morse, R.H., Davis, R.W., Hughes, T.R., and Nislow, C. (2007). A high-resolution atlas of nucleosome occupancy in yeast. Nat Genet 39, 1235-1244.
Li, B., Carey, M., and Workman, J.L. (2007). The role of chromatin during transcription. Cell 128, 707-719.
151
Li, D.J., Verma, D., Mosbruger, T., and Swaminathan, S. (2014). CTCF and Rad21 act as host cell restriction factors for Kaposi's sarcoma-associated herpesvirus (KSHV) lytic replication by modulating viral gene transcription. PLoS Pathog 10, e1003880.
Li, E., Bestor, T.H., and Jaenisch, R. (1992). Targeted mutation of the DNA methyltransferase gene results in embryonic lethality. Cell 69, 915-926.
Li, G., and Reinberg, D. (2011). Chromatin higher-order structures and gene regulation. Curr Opin Genet Dev 21, 175-186.
Li, T., Hu, J.F., Qiu, X., Ling, J., Chen, H., Wang, S., Hou, A., Vu, T.H., and Hoffman, A.R. (2008). CTCF regulates allelic expression of Igf2 by orchestrating a promoter-polycomb repressive complex 2 intrachromosomal loop. Mol Cell Biol 28, 6473-6482.
Lieberman, P.M. (2013). Keeping it quiet: chromatin control of gammaherpesvirus latency. Nat Rev Microbiol 11, 863-875.
Liotta, L., and Petricoin, E. (2000). Molecular profiling of human cancer. Nat Rev Genet 1, 48-56.
Lister, R., O'Malley, R.C., Tonti-Filippini, J., Gregory, B.D., Berry, C.C., Millar, A.H., and Ecker, J.R. (2008). Highly integrated single-base resolution maps of the epigenome in Arabidopsis. Cell 133, 523-536.
Lister, R., Pelizzola, M., Dowen, R. H., Hawkins, R. D., Hon, G., Tonti-Filippini, J., Nery, J. R., Lee, L., Ye, Z., Ngo, Q. M., Edsall, L., Antosiewicz-Bourget, J., Stewart, R., Ruotti, V., Millar, A. H., Thomson, J. A., Ren, B., and Ecker, J. R. (2009). Human DNA methylomes at base resolution show widespread epigenomic differences. Nature 462, 315-322.
Lobanenkov, V.V., Nicolas, R.H., Adler, V.V., Paterson, H., Klenova, E.M., Polotskaja, A.V., and Goodwin, G.H. (1990). A novel sequence-specific DNA binding protein which interacts with three regularly spaced direct repeats of the CCCTC-motif in the 5'-flanking sequence of the chicken c-myc gene. Oncogene 5, 1743-1753.
Lorch, Y., LaPointe, J.W., and Kornberg, R. (1987). Nucleosomes inhibit the initiation of transcription but allow chain elongation with the displacement of histones. Cell 49, 203-210.
Lorincz, M.C., Dickerson, D.R., Schmitt, M., and Groudine, M. (2004). Intragenic DNA methylation alters chromatin structure and elongation efficiency in mammalian cells. Nat Struct Mol Biol 11, 1068-1075.
Lu, F., Stedman, W., Yousef, M., Renne, R., and Lieberman, P.M. (2010). Epigenetic regulation of Kaposi's sarcoma-associated herpesvirus latency by virus-encoded microRNAs that target Rta and the cellular Rbl2-DNMT pathway. J Virol 84, 2697-2706.
152
Lu, F., Zhou, J., Wiedmer, A., Madden, K., Yuan, Y., and Lieberman, P.M. (2003). Chromatin remodeling of the Kaposi's sarcoma-associated herpesvirus ORF50 promoter correlates with reactivation from latency. J Virol 77, 11425-11435.
Luger, K., Mader, A.W., Richmond, R.K., Sargent, D.F., and Richmond, T.J. (1997). Crystal structure of the nucleosome core particle at 2.8 Å resolution. Nature 389, 251-260.
Maeda, R.K., and Karch, F. (2007). Making connections: boundaries and insulators in Drosophila. Curr Opin Genet Dev 17, 394-399.
Marini, J.C., Levene, S.D., Crothers, D.M., and Englund, P.T. (1982). Bent helical structure in kinetoplast DNA. Proc Natl Acad Sci USA 79, 7664-7668.
Matsumura, S., Fujita, Y., Gomez, E., Tanese, N., and Wilson, A.C. (2005). Activation of the Kaposi's sarcoma-associated herpesvirus major latency locus by the lytic switch protein RTA (ORF50). J Virol 79, 8493-8505.
Maunakea, A. K., Nagarajan, R. P., Bilenky, M., Ballinger, T. J., D'Souza, C., Fouse, S. D., Johnson, B. E., Hong, C., Nielsen, C., Zhao, Y., Turecki, G., Delaney, A., Varhol, R., Thiessen, N., Shchors, K., Heine, V. M., Rowitch, D. H., Xing, X., Fiore, C., Schillebeeckx, M., Jones, S. J., Haussler, D., Marra, M. A., Hirst, M., Wang, T., and Costello, J. F. (2010). Conserved role of intragenic DNA methylation in regulating alternative promoters. Nature 466, 253-257.
Miele, V., Vaillant, C., d'Aubenton-Carafa, Y., Thermes, C., and Grange, T. (2008). DNA physical properties determine nucleosome occupancy from yeast to fly. Nucleic Acids Res 36, 3746-3756.
Mito, Y., Henikoff, J.G., and Henikoff, S. (2007). Histone replacement marks the boundaries of cis-regulatory domains. Science 315, 1408-1411.
Mukhopadhyay, R., Yu, W., Whitehead, J., Xu, J., Lezcano, M., Pack, S., Kanduri, C., Kanduri, M., Ginjala, V., Vostrov, A., Quitschke, W., Chernukhin, I., Klenova, E., Lobanenkov, V., and Ohlsson, R. (2004). The binding sites for the chromatin insulator protein CTCF map to DNA methylation-free domains genome-wide. Genome Res 14, 1594-1602.
Myoung, J., and Ganem, D. (2011). Generation of a doxycycline-inducible KSHV producer cell line of endothelial origin: maintenance of tight latency with efficient reactivation upon induction. J Virol Methods 174, 12-21.
Nabilsi, N.H., Broaddus, R.R., and Loose, D.S. (2009). DNA methylation inhibits p53-mediated survivin repression. Oncogene 28, 2046-2050.
153
Nakahashi, H., Kwon, K. R., Resch, W., Vian, L., Dose, M., Stavreva, D., Hakim, O., Pruett, N., Nelson, S., Yamane, A., Qian, J., Dubois, W., Welsh, S., Phair, R. D., Pugh, B. F., Lobanenkov, V., Hager, G. L., and Casellas, R. (2013). A genome-wide map of CTCF multivalency redefines the CTCF code. Cell Rep 3, 1678-1689.
Nathan, D., and Crothers, D.M. (2002). Bending and flexibility of methylated and unmethylated EcoRI DNA. J Mol Biol 316, 7-17.
Oh, J., and Fraser, N.W. (2008). Temporal association of the herpes simplex virus genome with histone proteins during a lytic infection. J Virol 82, 3530-3537.
Ohlsson, R., Renkawitz, R., and Lobanenkov, V. (2001). CTCF is a uniquely versatile transcription regulator linked to epigenetics and disease. Trends Genet 17, 520-527.
Okano, M., Bell, D.W., Haber, D.A., and Li, E. (1999). DNA methyltransferases Dnmt3a and Dnmt3b are essential for de novo methylation and mammalian development. Cell 99, 247-257.
Ooi, S. K., Qiu, C., Bernstein, E., Li, K., Jia, D., Yang, Z., Erdjument-Bromage, H., Tempst, P., Lin, S. P., Allis, C. D., Cheng, X., and Bestor, T. H. (2007). DNMT3L connects unmethylated lysine 4 of histone H3 to de novo methylation of DNA. Nature 448, 714-717.
Otani, J., Nankumo, T., Arita, K., Inamoto, S., Ariyoshi, M., and Shirakawa, M. (2009). Structural basis for recognition of H3K4 methylation status by the DNA methyltransferase 3A ATRX-DNMT3-DNMT3L domain. EMBO Rep 10, 1235-1241.
Oudet, P., Gross-Bellard, M., and Chambon, P. (1975). Electron microscopic and biochemical evidence that chromatin structure is a repeating unit. Cell 4, 281-300.
Pardo, C.E., Darst, R.P., Nabilsi, N.H., Delmas, A.L., and Kladde, M.P. (2011). Simultaneous single-molecule mapping of protein-DNA interactions and DNA methylation by MAPit. Curr Protoc Mol Biol Chapter 21, Unit 21.22.1-21.22.18.
Pastor, W. A., Pape, U. J., Huang, Y., Henderson, H. R., Lister, R., Ko, M., McLoughlin, E. M., Brudno, Y., Mahapatra, S., Kapranov, P., Tahiliani, M., Daley, G. Q., Liu, X. S., Ecker, J. R., Milos, P. M., Agarwal, S., and Rao, A. (2011). Genome-wide mapping of 5-hydroxymethylcytosine in embryonic stem cells. Nature 473, 394-397.
Phillips, J.E., and Corces, V.G. (2009). CTCF: master weaver of the genome. Cell 137, 1194-1211.
Plaisance-Bonstaff, K., Choi, H.S., Beals, T., Krueger, B.J., Boss, I.W., Gay, L.A., Haecker, I., Hu, J., and Renne, R. (2014). KSHV miRNAs decrease expression of lytic genes in latently infected PEL and endothelial cells by targeting host transcription factors. Viruses 6, 4005-4023.
154
Portela, A., and Esteller, M. (2010). Epigenetic modifications and human disease. Nat Biotechnol 28, 1057-1068.
Pradhan, S., Bacolla, A., Wells, R.D., and Roberts, R.J. (1999). Recombinant Human DNA (Cytosine-5) Methyltransferase. I. expression, purification, and comparison of de novo and maintenance methylation. J Biol Chem 274, 33002-33010.
Pugh, B.F. (2010). A preoccupied position on nucleosomes. Nat Struct Mol Biol 17, 923.
Quitschke, W.W., Taheny, M.J., Fochtmann, L.J., and Vostrov, A.A. (2000). Differential effect of zinc finger deletions on the binding of CTCF to the promoter of the amyloid precursor protein gene. Nucleic Acids Res 28, 3370-3378.
Rattray, A.M., and Muller, B. (2012). The control of histone gene expression. Biochem Soc Trans 40, 880-885.
Rauch, T.A., Wu, X., Zhong, X., Riggs, A.D., and Pfeifer, G.P. (2009). A human B cell methylome at 100-base pair resolution. Proc Natl Acad Sci USA 106, 671-678.
Rebollo, R., Miceli-Royer, K., Zhang, Y., Farivar, S., Gagnier, L., and Mager, D.L. (2012). Epigenetic interplay between mouse endogenous retroviruses and host genes. Genome Biol 13, R89.
Renda, M., Baglivo, I., Burgess-Beusse, B., Esposito, S., Fattorusso, R., Felsenfeld, G., and Pedone, P.V. (2007). Critical DNA binding interactions of the insulator protein CTCF: a small number of zinc fingers mediate strong binding, and a single finger-DNA interaction controls binding at imprinted loci. J Biol Chem 282, 33336-33345.
Renne, R., Blackbourn, D., Whitby, D., Levy, J., and Ganem, D. (1998). Limited transmission of Kaposi's sarcoma-associated herpesvirus in cultured cells. J Virol 72, 5182-5188.
Renne, R., Lagunoff, M., Zhong, W., and Ganem, D. (1996a). The size and conformation of Kaposi's sarcoma-associated herpesvirus (human herpesvirus 8) DNA in infected cells and virions. J Virol 70, 8151-8154.
Renne, R., Zhong, W., Herndier, B., McGrath, M., Abbey, N., Kedes, D., and Ganem, D. (1996b). Lytic growth of Kaposi's sarcoma-associated herpesvirus (human herpesvirus 8) in culture. Nat Med 2, 342-346.
Rhee, H.S., and Pugh, B.F. (2011). Comprehensive genome-wide protein-DNA interactions detected at single-nucleotide resolution. Cell 147, 1408-1419.
Richards, E.J., and Elgin, S.C. (2002). Epigenetic codes for heterochromatin formation and silencing: rounding up the usual suspects. Cell 108, 489-500.
155
Rodriguez, C., Borgel, J., Court, F., Cathala, G., Forne, T., and Piette, J. (2010). CTCF is a DNA methylation-sensitive positive regulator of the INK/ARF locus. Biochem Biophys Res Commun 392, 129-134.
Rose, N.R., and Klose, R.J. (2014). Understanding the relationship between DNA methylation and histone lysine methylation. Biochim Biophys Acta 1839, 1362-1372.
Russo, J. J., Bohenzky, R. A., Chien, M. C., Chen, J., Yan, M., Maddalena, D., Parry, J. P., Peruzzi, D., Edelman, I. S., Chang, Y., and Moore, P. S. (1996). Nucleotide sequence of the Kaposi sarcoma-associated herpesvirus (HHV8). Proc Natl Acad Sci USA 93, 14862-14867.
Satchwell, S.C., Drew, H.R., and Travers, A.A. (1986). Sequence periodicities in chicken nucleosome core DNA. J Mol Biol 191, 659-675.
Savić, N., and Schwank, G. (2015). Advances in therapeutic CRISPR/Cas9 genome editing. Transl Res.
Saxonov, S., Berg, P., and Brutlag, D.L. (2006). A genome-wide analysis of CpG dinucleotides in the human genome distinguishes two distinct classes of promoters. Proc Natl Acad Sci USA 103, 1412-1417.
Schmeisser, F., and Weir, J.P. (2007). Incorporation of a lambda phage recombination system and EGFP detection to simplify mutagenesis of herpes simplex virus bacterial artificial chromosomes. BMC Biotechnol 7, 22.
Schoenherr, C.J., Levorse, J.M., and Tilghman, S.M. (2003). CTCF maintains differential methylation at the Igf2/H19 locus. Nat Genet 33, 66-69.
Schones, D.E., Cui, K., Cuddapah, S., Roh, T.Y., Barski, A., Wang, Z., Wei, G., and Zhao, K. (2008). Dynamic regulation of nucleosome positioning in the human genome. Cell 132, 887-898.
Schwabish, M.A., and Struhl, K. (2006). Asf1 mediates histone eviction and deposition during elongation by RNA polymerase II. Mol Cell 22, 415-422.
Schwartz, Y. B., Linder-Basso, D., Kharchenko, P. V., Tolstorukov, M. Y., Kim, M., Li, H. B., Gorchakov, A. A., Minoda, A., Shanower, G., Alekseyenko, A. A., Riddle, N. C., Jung, Y. L., Gu, T., Plachetka, A., Elgin, S. C., Kuroda, M. I., Park, P. J., Savitsky, M., Karpen, G. H., and Pirrotta, V. (2012). Nature and function of insulator protein binding sites in the Drosophila genome. Genome Res 22, 2188-2198.
Segal, E., and Widom, J. (2009). Poly(dA:dT) tracts: major determinants of nucleosome organization. Curr Opin Struct Biol 19, 65-71.
156
Segal, M.R. (2008). Re-cracking the nucleosome positioning code. Stat Appl Genet Mol Biol 7, Article 14.
Shalginskikh, N., Poleshko, A., Skalka, A.M., and Katz, R.A. (2013). Retroviral DNA methylation and epigenetic repression are mediated by the antiviral host protein Daxx. J Virol 87, 2137-2150.
Shann, Y.J., Cheng, C., Chiao, C.H., Chen, D.T., Li, P.H., and Hsu, M.T. (2008). Genome-wide mapping and characterization of hypomethylated sites in human tissues and breast cancer cell lines. Genome Res 18, 791-801.
Sharif, J., Muto, M., Takebayashi, S., Suetake, I., Iwamatsu, A., Endo, T. A., Shinga, J., Mizutani-Koseki, Y., Toyoda, T., Okamura, K., Tajima, S., Mitsuya, K., Okano, M., and Koseki, H. (2007). The SRA protein Np95 mediates epigenetic inheritance by recruiting Dnmt1 to methylated DNA. Nature 450, 908-912.
Sharma, S., Kelly, T.K., and Jones, P.A. (2010). Epigenetics in cancer. Carcinogenesis 31, 27-36.
Shogren-Knaak, M., Ishii, H., Sun, J.M., Pazin, M.J., Davie, J.R., and Peterson, C.L. (2006). Histone H4-K16 acetylation controls chromatin structure and protein interactions. Science 311, 844-847.
Shukla, S., Kavak, E., Gregory, M., Imashimizu, M., Shutinoski, B., Kashlev, M., Oberdoerffer, P., Sandberg, R., and Oberdoerffer, S. (2011). CTCF-promoted RNA polymerase II pausing links DNA methylation to splicing. Nature 479, 74-79.
Siegal, B., Levinton-Kriss, S., Schiffer, A., Sayar, J., Engelberg, I., Vonsover, A., Ramon, Y., and Rubinstein, E. (1990). Kaposi's sarcoma in immunosuppression. Possibly the result of a dual viral infection. Cancer 65, 492-498.
Soulier, J., Grollet, L., Oksenhendler, E., Cacoub, P., Cazals-Hatem, D., Babinet, P., d'Agay, M. F., Clauvel, J. P., Raphael, M., Degos, L., and Sigaux, F. (1995). Kaposi's sarcoma-associated herpesvirus-like DNA sequences in multicentric Castleman's disease. Blood 86, 1276-1280.
Splinter, E., Heath, H., Kooren, J., Palstra, R.J., Klous, P., Grosveld, F., Galjart, N., and de Laat, W. (2006). CTCF mediates long-range chromatin looping and local histone
modification in the -globin locus. Genes Dev 20, 2349-2354.
Stadler, M. B., Murr, R., Burger, L., Ivanek, R., Lienert, F., Scholer, A., van Nimwegen, E., Wirbelauer, C., Oakeley, E. J., Gaidatzis, D., Tiwari, V. K., and Schübeler, D. (2011). DNA-binding factors shape the mouse methylome at distal regulatory regions. Nature 480, 490-495.
157
Staudt, M.R., and Dittmer, D.P. (2006). Promoter switching allows simultaneous transcription of LANA and K14/vGPCR of Kaposi's sarcoma-associated herpesvirus. Virology 350, 192-205.
Stedman, W., Kang, H., Lin, S., Kissil, J.L., Bartolomei, M.S., and Lieberman, P.M. (2008). Cohesins localize with CTCF at the KSHV latency control region and at cellular c-myc and H19/Igf2 insulators. EMBO J 27, 654-666.
Strahl, B.D., and Allis, C.D. (2000). The language of covalent histone modifications. Nature 403, 41-45.
Strahl, B.D., Ohba, R., Cook, R.G., and Allis, C.D. (1999). Methylation of histone H3 at lysine 4 is highly conserved and correlates with transcriptionally active nuclei in Tetrahymena. Proc Natl Acad Sci USA 96, 14967-14972.
Sturzl, M., Gaus, D., Dirks, W.G., Ganem, D., and Jochmann, R. (2013). Kaposi's sarcoma-derived cell line SLK is not of endothelial origin, but is a contaminant from a known renal carcinoma cell line. Int J Cancer 132, 1954-1958.
Sun, X.J., Wei, J., Wu, X.Y., Hu, M., Wang, L., Wang, H.H., Zhang, Q.H., Chen, S.J., Huang, Q.H., and Chen, Z. (2005). Identification and characterization of a novel human histone H3 lysine 36-specific methyltransferase. J Biol Chem 280, 35261-35271.
Szyf, M., Eliasson, L., Mann, V., Klein, G., and Razin, A. (1985). Cellular and viral DNA hypomethylation associated with induction of Epstein-Barr virus lytic cycle. Proc Natl Acad Sci USA 82, 8090-8094.
Takai, D., Gonzales, F.A., Tsai, Y.C., Thayer, M.J., and Jones, P.A. (2001). Large scale mapping of methylcytosines in CTCF-binding sites in the human H19 promoter and aberrant hypomethylation in human bladder cancer. Hum Mol Genet 10, 2619-2626.
Takeshima, H., Suetake, I., and Tajima, S. (2008). Mouse Dnmt3a preferentially methylates linker DNA and is inhibited by histone H1. J Mol Biol 383, 810-821.
Tan, M., Luo, H., Lee, S., Jin, F., Yang, J. S., Montellier, E., Buchou, T., Cheng, Z., Rousseaux, S., Rajagopal, N., Lu, Z., Ye, Z., Zhu, Q., Wysocka, J., Ye, Y., Khochbin, S., Ren, B., and Zhao, Y. (2011). Identification of 67 histone marks and histone lysine crotonylation as a new type of histone modification. Cell 146, 1016-1028.
Tempera, I., Klichinsky, M., and Lieberman, P.M. (2011). EBV latency types adopt alternative chromatin conformations. PLoS Pathog 7, e1002180.
Tessarz, P., and Kouzarides, T. (2014). Histone core modifications regulating nucleosome structure and dynamics. Nat Rev Mol Cell Biol 15, 703-708.
158
Tischer, B.K., von Einem, J., Kaufer, B., and Osterrieder, N. (2006). Two-step Red-mediated recombination for versatile high-efficiency markerless DNA manipulation in Escherichia coli. Biotechniques 40, 191-197.
Toth, Z., Brulois, K., Lee, H.R., Izumiya, Y., Tepper, C., Kung, H.J., and Jung, J.U. (2013). Biphasic euchromatin-to-heterochromatin transition on the KSHV genome following de novo infection. PLoS Pathog 9, e1003813.
Toth, Z., Maglinte, D. T., Lee, S. H., Lee, H. R., Wong, L. Y., Brulois, K. F., Lee, S., Buckley, J. D., Laird, P. W., Marquez, V. E., and Jung, J. U. (2010). Epigenetic analysis of KSHV latent and lytic genomes. PLoS Pathog 6, e1001013.
Travers, A.A., and Klug, A. (1987). The bending of DNA in nucleosomes and its wider implications. Philos Trans R Soc Lond Biol 317, 537-561.
Ulianov, S.V., Gavrilov, A.A., and Razin, S.V. (2015). Nuclear compartments, genome folding, and enhancer-promoter communication. Int Rev Cell Mol Biol 315, 183-244.
Uppal, T., Banerjee, S., Sun, Z., Verma, S.C., and Robertson, E.S. (2014). KSHV LANA - the master regulator of KSHV latency. Viruses 6, 4961-4998.
Valouev, A., Ichikawa, J., Tonthat, T., Stuart, J., Ranade, S., Peckham, H., Zeng, K., Malek, J. A., Costa, G., McKernan, K., Sidow, A., Fire, A., and Johnson, S. M. (2008). A high-resolution, nucleosome position map of C. elegans reveals a lack of universal sequence-dictated positioning. Genome Res 18, 1051-1063.
Van Bortle, K., Ramos, E., Takenaka, N., Yang, J., Wahi, J.E., and Corces, V.G. (2012). Drosophila CTCF tandemly aligns with other insulator proteins at the borders of H3K27me3 domains. Genome Res 22, 2176-2187.
Vogelauer, M., Wu, J., Suka, N., and Grunstein, M. (2000). Global histone acetylation and deacetylation in yeast. Nature 408, 495-498.
Wallace, J.A., and Felsenfeld, G. (2007). We gather together: insulators and genome organization. Curr Opin Genet Dev 17, 400-407.
Wang, H., Maurano, M. T., Qu, H., Varley, K. E., Gertz, J., Pauli, F., Lee, K., Canfield, T., Weaver, M., Sandstrom, R., Thurman, R. E., Kaul, R., Myers, R. M., and Stamatoyannopoulos, J. A. (2012). Widespread plasticity in CTCF occupancy linked to DNA methylation. Genome Res 22, 1680-1688.
Wang, Y.H., Amirhaeri, S., Kang, S., Wells, R.D., and Griffith, J.D. (1994). Preferential nucleosome assembly at DNA triplet repeats from the myotonic dystrophy gene. Science 265, 669-671.
159
Weber, M., Hellmann, I., Stadler, M.B., Ramos, L., Paabo, S., Rebhan, M., and Schübeler, D. (2007). Distribution, silencing potential and evolutionary impact of promoter DNA methylation in the human genome. Nat Genet 39, 457-466.
Wen, K.W., and Damania, B. (2010). Kaposi sarcoma-associated herpesvirus (KSHV): molecular biology and oncogenesis. Cancer Lett 289, 140-150.
Weth, O., Paprotka, C., Gunther, K., Schulte, A., Baierl, M., Leers, J., Galjart, N., and Renkawitz, R. (2014). CTCF induces histone variant incorporation, erases the H3K27me3 histone mark and opens chromatin. Nucleic Acids Res 42, 11941-11951.
Widom, J. (2001). Role of DNA sequence in nucleosome stability and dynamics. Q Rev Biophys 34, 269-324.
Workman, J.L. (2006). Nucleosome displacement in transcription. Genes Dev 20, 2009-2017.
Workman, J.L., and Kingston, R.E. (1992). Nucleosome core displacement in vitro via a metastable transcription factor nucleosome complex. Science 258, 1780-1784.
Wu, L., Lo, P., Yu, X., Stoops, J.K., Forghani, B., and Zhou, Z.H. (2000). Three-dimensional structure of the human herpesvirus 8 capsid. J Virol 74, 9646-9654.
Xu, Y., AuCoin, D.P., Huete, A.R., Cei, S.A., Hanson, L.J., and Pari, G.S. (2005). A Kaposi's sarcoma-associated herpesvirus/human herpesvirus 8 ORF50 deletion mutant is defective for reactivation of latent virus and DNA replication. J Virol 79, 3479-3487.
Yakushko, Y., Hackmann, C., Gunther, T., Ruckert, J., Henke, M., Koste, L., Alkharsah, K., Bohne, J., Grundhoff, A., Schulz, T. F., and Henke-Gendo, C. (2011). Kaposi's sarcoma-associated herpesvirus bacterial artificial chromosome contains a duplication of a long unique-region fragment within the terminal repeat region. J Virol 85, 4612-4617.
Yuan, G.C., Liu, Y.J., Dion, M.F., Slack, M.D., Wu, L.F., Altschuler, S.J., and Rando, O.J. (2005). Genome-scale identification of nucleosome positions in S. cerevisiae. Science 309, 626-630.
Yuan, Y., and Renne, R. (2009). Organization and expression of the Kaposi's Sarcoma-Associated Herpesvirus genome. In DNA Tumor Viruses, B. Damania, and J.M. Pipas, eds. (Springer), p. 798.
Zampieri, M., Guastafierro, T., Calabrese, R., Ciccarone, F., Bacalini, M.G., Reale, A., Perilli, M., Passananti, C., and Caiafa, P. (2012). ADP-ribose polymers localized on Ctcf-Parp1-Dnmt1 complex prevent methylation of Ctcf target sites. Biochem J 441, 645-652.
160
Zhang, X., Yazaki, J., Sundaresan, A., Cokus, S., Chan, S. W., Chen, H., Henderson, I. R., Shinn, P., Pellegrini, M., Jacobsen, S. E., and Ecker, J. R. (2006). Genome-wide high-resolution mapping and functional analysis of DNA methylation in Arabidopsis. Cell 126, 1189-1201.
Zhang, Y., Jurkowska, R., Soeroes, S., Rajavelu, A., Dhayalan, A., Bock, I., Rathert, P., Brandt, O., Reinhardt, R., Fischle, W., and Jeltsch, A. (2010). Chromatin methylation activity of Dnmt3a and Dnmt3a/3L is guided by interaction of the ADD domain with the histone H3 tail. Nucleic Acids Res 38, 4246-4253.
Zhang, Z., Wippo, C.J., Wal, M., Ward, E., Korber, P., and Pugh, B.F. (2011). A packing mechanism for nucleosome organization reconstituted across a eukaryotic genome. Science 332, 977-980.
Zilberman, D., Gehring, M., Tran, R.K., Ballinger, T., and Henikoff, S. (2007). Genome-wide analysis of Arabidopsis thaliana DNA methylation uncovers an interdependence between methylation and transcription. Nat Genet 39, 61-69.
161
BIOGRAPHICAL SKETCH
Mayank Talwar was born (1986) in Galveston, Texas. He was raised in Indiana,
Pennsylvania where he attended school from kindergarten to high school to
undergraduate studies. He attended Indiana University of Pennsylvania (IUP), from the
fall of 2004 to the spring of 2008, where he received a Bachelor in Science majoring in
biology (with honors) with a chemistry and mathematics minor in 2008. His honors
thesis project was to study the effects of nitrates and nitrites on developing Zebrafish
embryos. After undergraduate studies, he was accepted to a professional science
master’s degree program at the Pennsylvania State University (PSU) where he received
a Master of Biotechnology degree in the fall of 2009. During his master’s program, he
received a non-academic internship at the Walter Reed Army Institute of Research
(WRAIR) in Silver Spring, Maryland where he further developed his skills at the
laboratory bench and analyzing large sets of data. His project during his time at WRAIR
was to test more than 10,000 organic small-molecule compounds for their drug
resistance and cell viability characteristics on malaria (Plasmodium falciparum). After
graduating in 2009, Mayank continued as a researcher at WRAIR until he was accepted
into a Ph.D. program. In 2010, Mayank was accepted into the Interdisciplinary Program
in Biomedical Sciences program where he joined the laboratory of Dr. Michael Kladde in
the spring of 2011 in the Biochemistry and Molecular Biology concentration. He
received his Doctorate of Philosophy from the University of Florida in the spring of 2016.
