Our Test OrganismDrosophila simulans

Trait of Interest

• Red vs. White

What did we do in lab 1?

• Vial of 5 white-eyed females• Vial of 6 males, 5 white-eyed

– With ONE red-eyed male mixed in– What is p(red-eye allele)?

• 1/11

• What did we say about the fitness of the red-eyed mutant?— Sensory perception— Should be more fit because has better vision— White eyes = reduced mate tracking

What should we expect to see?

• More or less red-eyed flies?• So we have an adaptive allele (red-eyed

mutation)…– Should increase in frequency.. What is this called?

• Selective sweep

– What about polymorphisms located near it?• Hitchhiking

• How can we tell if a sweep and hitchhiking has happened?

Genotype the flies near that gene!

• Need to first get DNA from the flies (DNA Isolation)

– Squish flies to release all their DNA

• Need to look at polymorphisms near that gene– Polymerase Chain Reaction

• Amplify the DNA of interest enough so we can look at it on a gel

Ahhh! Help meeeeeee

Drosophila chromosome

Red / Whiteeye color gene

“Near” “Far”

22 million bases of DNA

What are we going to look at?• Two markers on X-chromosome

o One close to the gene for white eyeso One far from the gene for white eyes

• Why are we going to look at 2 markers?

22 million bases of DNA

Polymorphisms

• Red: gene mutated to give flies red-eyes• Blue: indel polymorphism

– What is an indel polymorphism?– NEAR marker

• Yellow: indel polymorphism– FAR marker

Recombination Hotspot!

• Who is linked to the red gene?– Blue or yellow?

• Say that 1 red-eyed male in the first lab had:– Insertion at the near marker (blue)– Deletion at the far marker (yellow)

• All white-eyed individuals had:– Deletion at the near marker (blue)– Insertion at the far marker (yellow)

• What will our flies today look like at each marker?

Recombination Hotspot!

Hypothesis

This is called genetic hitchhiking

• As chromosomes are passed down over generations, they sometimes “trade pieces” with other chromosomes... (recombination)

• More likely to keep the same close neighbor gene variants than far away neighbors.

• If natural selection makes one variant spread quickly, itsclose neighbor variants may also spread.

Selective Sweep (positive directional selection)

Frequency in sample

# si

tes

1 2 3 4Frequency in sample

# si

tes

1 2 3 4

Advantageous mutation

Selective Sweep/HitchhikingBefore sweep After sweep

This is one chromosome from 12 different people. The different colors represent different alleles for that gene.

What happened?

Selective Sweep/Hitchhiking

• If a mutation is advantageous it will likely increase in frequency

• Why?• What will happen to genes/traits that are

closely linked to the advantageous mutation?

• What will happen to genes/traits that are not closely linked to the advantageous mutation?

Variation at 3 loci

• 2 variants at the eye color gene– Red & White alleles

• 2 variants at the Near marker– High and Low – The red-eyed male from Day 1 has the high allele at Near– The white eyed flies had both variants

• 2 variants at the Far marker– High and Low– The red-eyed male from Day 1 has the low allele at Far– The white eyed flies had both variants

• Sequence differences (aka variation) between alleles• Usually base pair repeats, insertions, or deletions• Used for between & within-species comparisons

How are we going to observe & measure genetic variation?- Microsatellite Markers -

“Genetic markers”Reference point in the genome with 2+ alleles

A sequence: AACATGGTGACGGCTAGCA

a sequence: AACATGGTGAGAGAGACGGCTAGCA

High allele

Low allele

How to tell males from females

• Males have black abdomens

• Look close at the tip of the male abdomen and you will see his junk

• Females have rounded abdomens

Female Male

Red male

Red female

White male

White female

Sexing your flies: males have a “black butt”, females have large white abdomen

Sexing

Female Male

A note about contamination

• DO NOT CONTAMINATE YOUR DNA ISOLATIONS!– Change tips in between EACH fly squish! – Just because you can’t see the DNA on the tip,

doesn’t mean it’s not there!