+ All Categories
Home > Documents > Overview of iGEM and synthetic biology - Amazon S3 · Overview of iGEM and synthetic biology Andrew...

Overview of iGEM and synthetic biology - Amazon S3 · Overview of iGEM and synthetic biology Andrew...

Date post: 14-Mar-2020
Category:
Upload: others
View: 3 times
Download: 0 times
Share this document with a friend
60
Overview of iGEM and synthetic biology Andrew Hessel University of Lethbridge, July 19 2007 [email protected]
Transcript
Page 1: Overview of iGEM and synthetic biology - Amazon S3 · Overview of iGEM and synthetic biology Andrew Hessel University of Lethbridge, July 19 2007 ... •Mexico • Taiwan • Russia

Overview of iGEM and synthetic biology

Andrew HesselUniversity of Lethbridge, July 19 2007

[email protected]

Page 2: Overview of iGEM and synthetic biology - Amazon S3 · Overview of iGEM and synthetic biology Andrew Hessel University of Lethbridge, July 19 2007 ... •Mexico • Taiwan • Russia

A Scientist discovers that which exists; an Engineer creates that which never was.

-- Theodore Von Kármán

Page 3: Overview of iGEM and synthetic biology - Amazon S3 · Overview of iGEM and synthetic biology Andrew Hessel University of Lethbridge, July 19 2007 ... •Mexico • Taiwan • Russia

“Synthetic biology is an emerging area of research that can broadly be described as the design and construction of novel artificial biological pathways, organisms or devices, or the redesign of existing natural biological systems.”

Page 4: Overview of iGEM and synthetic biology - Amazon S3 · Overview of iGEM and synthetic biology Andrew Hessel University of Lethbridge, July 19 2007 ... •Mexico • Taiwan • Russia

Technology of synthetic biology

Page 5: Overview of iGEM and synthetic biology - Amazon S3 · Overview of iGEM and synthetic biology Andrew Hessel University of Lethbridge, July 19 2007 ... •Mexico • Taiwan • Russia

DNA is fundamental…

It is the machine language program for biochemical processes

Page 6: Overview of iGEM and synthetic biology - Amazon S3 · Overview of iGEM and synthetic biology Andrew Hessel University of Lethbridge, July 19 2007 ... •Mexico • Taiwan • Russia

The ability to manipulate this one molecule allows virtually anything biological to be engineered!

DNA is to biology as the electron is to computing

Page 7: Overview of iGEM and synthetic biology - Amazon S3 · Overview of iGEM and synthetic biology Andrew Hessel University of Lethbridge, July 19 2007 ... •Mexico • Taiwan • Russia
Page 8: Overview of iGEM and synthetic biology - Amazon S3 · Overview of iGEM and synthetic biology Andrew Hessel University of Lethbridge, July 19 2007 ... •Mexico • Taiwan • Russia

Nobel foundation

Reading code

Page 9: Overview of iGEM and synthetic biology - Amazon S3 · Overview of iGEM and synthetic biology Andrew Hessel University of Lethbridge, July 19 2007 ... •Mexico • Taiwan • Russia

1980 1987 1995

1998 2007 – Sequencing by Synthesis500,000 bp/day (automatic)

500 bp/day (manual)

1GB bp/day (automatic)

36,000 bp/day (semi-auto) 144,000 bp/day (semi-auto)

Page 10: Overview of iGEM and synthetic biology - Amazon S3 · Overview of iGEM and synthetic biology Andrew Hessel University of Lethbridge, July 19 2007 ... •Mexico • Taiwan • Russia
Page 11: Overview of iGEM and synthetic biology - Amazon S3 · Overview of iGEM and synthetic biology Andrew Hessel University of Lethbridge, July 19 2007 ... •Mexico • Taiwan • Russia

280.6 TFLOPS with 131072 nodes

Comprehension

Page 12: Overview of iGEM and synthetic biology - Amazon S3 · Overview of iGEM and synthetic biology Andrew Hessel University of Lethbridge, July 19 2007 ... •Mexico • Taiwan • Russia

http://www.sanger.ac.uk/Projects/E_carotovora/gfx/erwinia.gif

Page 13: Overview of iGEM and synthetic biology - Amazon S3 · Overview of iGEM and synthetic biology Andrew Hessel University of Lethbridge, July 19 2007 ... •Mexico • Taiwan • Russia

http://llmpp.nih.gov/lymphoma/images/large_figure1.jpg

Page 14: Overview of iGEM and synthetic biology - Amazon S3 · Overview of iGEM and synthetic biology Andrew Hessel University of Lethbridge, July 19 2007 ... •Mexico • Taiwan • Russia

http://www.molgen.mpg.de/~lappe/photos/final_webPict.jpg

Page 15: Overview of iGEM and synthetic biology - Amazon S3 · Overview of iGEM and synthetic biology Andrew Hessel University of Lethbridge, July 19 2007 ... •Mexico • Taiwan • Russia

Writing code: synthesis

Page 16: Overview of iGEM and synthetic biology - Amazon S3 · Overview of iGEM and synthetic biology Andrew Hessel University of Lethbridge, July 19 2007 ... •Mexico • Taiwan • Russia

If we can’t build it, we don’t understand it.

Page 17: Overview of iGEM and synthetic biology - Amazon S3 · Overview of iGEM and synthetic biology Andrew Hessel University of Lethbridge, July 19 2007 ... •Mexico • Taiwan • Russia
Page 18: Overview of iGEM and synthetic biology - Amazon S3 · Overview of iGEM and synthetic biology Andrew Hessel University of Lethbridge, July 19 2007 ... •Mexico • Taiwan • Russia
Page 19: Overview of iGEM and synthetic biology - Amazon S3 · Overview of iGEM and synthetic biology Andrew Hessel University of Lethbridge, July 19 2007 ... •Mexico • Taiwan • Russia
Page 20: Overview of iGEM and synthetic biology - Amazon S3 · Overview of iGEM and synthetic biology Andrew Hessel University of Lethbridge, July 19 2007 ... •Mexico • Taiwan • Russia

Digital DNA “design”

Physical DNA and outputs

Page 21: Overview of iGEM and synthetic biology - Amazon S3 · Overview of iGEM and synthetic biology Andrew Hessel University of Lethbridge, July 19 2007 ... •Mexico • Taiwan • Russia
Page 22: Overview of iGEM and synthetic biology - Amazon S3 · Overview of iGEM and synthetic biology Andrew Hessel University of Lethbridge, July 19 2007 ... •Mexico • Taiwan • Russia

EGFP gene 714 bp

Page 23: Overview of iGEM and synthetic biology - Amazon S3 · Overview of iGEM and synthetic biology Andrew Hessel University of Lethbridge, July 19 2007 ... •Mexico • Taiwan • Russia

Applications dependent on synthetic capabilities

basepairs

102 107105104103 106

single genes*

genetic circuits, viruses, GEMs Engineered organisms

minimal life

Page 24: Overview of iGEM and synthetic biology - Amazon S3 · Overview of iGEM and synthetic biology Andrew Hessel University of Lethbridge, July 19 2007 ... •Mexico • Taiwan • Russia
Page 25: Overview of iGEM and synthetic biology - Amazon S3 · Overview of iGEM and synthetic biology Andrew Hessel University of Lethbridge, July 19 2007 ... •Mexico • Taiwan • Russia
Page 26: Overview of iGEM and synthetic biology - Amazon S3 · Overview of iGEM and synthetic biology Andrew Hessel University of Lethbridge, July 19 2007 ... •Mexico • Taiwan • Russia

- -5 years: 0.5 - 5kb, $10-$15/bp- 0 years: 50 - 500kb $0.50-$1/bp- +5 years: 5mb - 5gb <$0.0001/bp

Carlson, R. (2003) The Pace and Proliferation of Biological Technologies

Page 27: Overview of iGEM and synthetic biology - Amazon S3 · Overview of iGEM and synthetic biology Andrew Hessel University of Lethbridge, July 19 2007 ... •Mexico • Taiwan • Russia
Page 28: Overview of iGEM and synthetic biology - Amazon S3 · Overview of iGEM and synthetic biology Andrew Hessel University of Lethbridge, July 19 2007 ... •Mexico • Taiwan • Russia

Engineering philosophy

Page 29: Overview of iGEM and synthetic biology - Amazon S3 · Overview of iGEM and synthetic biology Andrew Hessel University of Lethbridge, July 19 2007 ... •Mexico • Taiwan • Russia
Page 30: Overview of iGEM and synthetic biology - Amazon S3 · Overview of iGEM and synthetic biology Andrew Hessel University of Lethbridge, July 19 2007 ... •Mexico • Taiwan • Russia

Engineering process…

Some success

More success

Even more success

•Electronics

•Software

•Aeronautics

•Structures

•Materials

•Automotives

complexity

refinement

refinement

refinement

Page 31: Overview of iGEM and synthetic biology - Amazon S3 · Overview of iGEM and synthetic biology Andrew Hessel University of Lethbridge, July 19 2007 ... •Mexico • Taiwan • Russia

C0076cinI

B0034rbs

ccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttata

B0015terminator

Name: B0015Type: Double terminatorLength 129 bpDesigned by: Reshma ShettyForward efficiency: 0.984Reverse efficiency: .295

F1760Sender Device

Page 32: Overview of iGEM and synthetic biology - Amazon S3 · Overview of iGEM and synthetic biology Andrew Hessel University of Lethbridge, July 19 2007 ... •Mexico • Taiwan • Russia

ccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttata

B0015terminator

DNA

F1760Sender Device

Part

Device

System

STANDARDIZED DATA

synthesis

assembly

F1760Synthetic system or cell

Page 33: Overview of iGEM and synthetic biology - Amazon S3 · Overview of iGEM and synthetic biology Andrew Hessel University of Lethbridge, July 19 2007 ... •Mexico • Taiwan • Russia

http://parts.mit.edu

Page 34: Overview of iGEM and synthetic biology - Amazon S3 · Overview of iGEM and synthetic biology Andrew Hessel University of Lethbridge, July 19 2007 ... •Mexico • Taiwan • Russia
Page 35: Overview of iGEM and synthetic biology - Amazon S3 · Overview of iGEM and synthetic biology Andrew Hessel University of Lethbridge, July 19 2007 ... •Mexico • Taiwan • Russia

Growing a community by sharing:

• Physical DNA parts (Biobricks)

• DNA code• Protocols• Experience• Publications

Encourages play, independence, creativity

Page 36: Overview of iGEM and synthetic biology - Amazon S3 · Overview of iGEM and synthetic biology Andrew Hessel University of Lethbridge, July 19 2007 ... •Mexico • Taiwan • Russia
Page 37: Overview of iGEM and synthetic biology - Amazon S3 · Overview of iGEM and synthetic biology Andrew Hessel University of Lethbridge, July 19 2007 ... •Mexico • Taiwan • Russia

2006 Jamboree – 400 gengineers

Page 38: Overview of iGEM and synthetic biology - Amazon S3 · Overview of iGEM and synthetic biology Andrew Hessel University of Lethbridge, July 19 2007 ... •Mexico • Taiwan • Russia
Page 39: Overview of iGEM and synthetic biology - Amazon S3 · Overview of iGEM and synthetic biology Andrew Hessel University of Lethbridge, July 19 2007 ... •Mexico • Taiwan • Russia
Page 40: Overview of iGEM and synthetic biology - Amazon S3 · Overview of iGEM and synthetic biology Andrew Hessel University of Lethbridge, July 19 2007 ... •Mexico • Taiwan • Russia
Page 41: Overview of iGEM and synthetic biology - Amazon S3 · Overview of iGEM and synthetic biology Andrew Hessel University of Lethbridge, July 19 2007 ... •Mexico • Taiwan • Russia
Page 42: Overview of iGEM and synthetic biology - Amazon S3 · Overview of iGEM and synthetic biology Andrew Hessel University of Lethbridge, July 19 2007 ... •Mexico • Taiwan • Russia

iGEM 2007• 57 teams – 20 countries

• USA (26)• Scotland (3)• Colombia• Italy (2)• Mexico• Taiwan• Russia• Germany• South Africa

• Middle East• Canada (6)• Japan (2)• Australia• England• Switzerland• China (4)• Spain• India• France• Slovenia

Page 43: Overview of iGEM and synthetic biology - Amazon S3 · Overview of iGEM and synthetic biology Andrew Hessel University of Lethbridge, July 19 2007 ... •Mexico • Taiwan • Russia

U of A iGEM Team

• Biobutanol project – “Plan B”• Moving metabolic pathway from

Clostridium into E. coli

Page 44: Overview of iGEM and synthetic biology - Amazon S3 · Overview of iGEM and synthetic biology Andrew Hessel University of Lethbridge, July 19 2007 ... •Mexico • Taiwan • Russia

U of C iGEM team

• Combination of mechanical and biological devices

• 2D plotter system• Switched agarase

activation• Allows precise

“carving” of agarasemedium

Page 45: Overview of iGEM and synthetic biology - Amazon S3 · Overview of iGEM and synthetic biology Andrew Hessel University of Lethbridge, July 19 2007 ... •Mexico • Taiwan • Russia

Opportunities for Alberta

Page 46: Overview of iGEM and synthetic biology - Amazon S3 · Overview of iGEM and synthetic biology Andrew Hessel University of Lethbridge, July 19 2007 ... •Mexico • Taiwan • Russia

Source: Bio era

Synthetic biology is going to grow fast!

Page 47: Overview of iGEM and synthetic biology - Amazon S3 · Overview of iGEM and synthetic biology Andrew Hessel University of Lethbridge, July 19 2007 ... •Mexico • Taiwan • Russia
Page 48: Overview of iGEM and synthetic biology - Amazon S3 · Overview of iGEM and synthetic biology Andrew Hessel University of Lethbridge, July 19 2007 ... •Mexico • Taiwan • Russia

Engineering synthetic biological constructs will become the foundational technology of the 21st century Tom Knight, MIT, SB3

• Biology > Physics ($, staff, discoveries)• Biology is more important than physics, as measured by

its economic outputs, ethical implications, and effects on human welfare

• Alberta already has a vibrant bio-economy• Well-positioned to become a global leader in synthetic

biotechnologies if we act quickly and decisively

• DNA has always been high impact, and this is a ground-floor opportunity

Page 49: Overview of iGEM and synthetic biology - Amazon S3 · Overview of iGEM and synthetic biology Andrew Hessel University of Lethbridge, July 19 2007 ... •Mexico • Taiwan • Russia

We need to start education programs and do outreach…

Page 50: Overview of iGEM and synthetic biology - Amazon S3 · Overview of iGEM and synthetic biology Andrew Hessel University of Lethbridge, July 19 2007 ... •Mexico • Taiwan • Russia
Page 51: Overview of iGEM and synthetic biology - Amazon S3 · Overview of iGEM and synthetic biology Andrew Hessel University of Lethbridge, July 19 2007 ... •Mexico • Taiwan • Russia

Build a bio-fab to support research community and next-gen companies

Page 52: Overview of iGEM and synthetic biology - Amazon S3 · Overview of iGEM and synthetic biology Andrew Hessel University of Lethbridge, July 19 2007 ... •Mexico • Taiwan • Russia

Nanoscale biology

Page 53: Overview of iGEM and synthetic biology - Amazon S3 · Overview of iGEM and synthetic biology Andrew Hessel University of Lethbridge, July 19 2007 ... •Mexico • Taiwan • Russia
Page 54: Overview of iGEM and synthetic biology - Amazon S3 · Overview of iGEM and synthetic biology Andrew Hessel University of Lethbridge, July 19 2007 ... •Mexico • Taiwan • Russia
Page 55: Overview of iGEM and synthetic biology - Amazon S3 · Overview of iGEM and synthetic biology Andrew Hessel University of Lethbridge, July 19 2007 ... •Mexico • Taiwan • Russia
Page 56: Overview of iGEM and synthetic biology - Amazon S3 · Overview of iGEM and synthetic biology Andrew Hessel University of Lethbridge, July 19 2007 ... •Mexico • Taiwan • Russia
Page 57: Overview of iGEM and synthetic biology - Amazon S3 · Overview of iGEM and synthetic biology Andrew Hessel University of Lethbridge, July 19 2007 ... •Mexico • Taiwan • Russia

• *Applications (health, biofuels, bioproducts)

• Software: Metabolic and genomic design tools

• Hardware: Advanced synthesis hardware, biological test and measurement devices

• Ethics and social policy of synthetic biology

• Educational program development

• Next-generation biotechnology company development

Page 58: Overview of iGEM and synthetic biology - Amazon S3 · Overview of iGEM and synthetic biology Andrew Hessel University of Lethbridge, July 19 2007 ... •Mexico • Taiwan • Russia
Page 59: Overview of iGEM and synthetic biology - Amazon S3 · Overview of iGEM and synthetic biology Andrew Hessel University of Lethbridge, July 19 2007 ... •Mexico • Taiwan • Russia
Page 60: Overview of iGEM and synthetic biology - Amazon S3 · Overview of iGEM and synthetic biology Andrew Hessel University of Lethbridge, July 19 2007 ... •Mexico • Taiwan • Russia

http://www.electrowiz.com/


Recommended