Date post: | 19-Mar-2018 |
Category: |
Documents |
Upload: | nguyennhan |
View: | 220 times |
Download: | 4 times |
Annals of R.S.C.B., Vol. XIX, Issue 3, 2015, pp. 9 - 20 doi: 10.ANN/RSCB-2015-0028:RSCB Received 18 June 2015; accepted 01 July 2015.
The Romanian Society for Cell Biology ©, Annals of R. S. C. B., Vol. XIX, Issue 3, 2015, Anca V. Sima., pp. 9 – 20
9
Oxidized LDL induce C-reactive protein secretion in human macrophages through mechanisms involving oxidative stress
Running Head:
OX-LDL INDUCE CRP SECRETION IN HUMAN MACROPHAGES
G. M. SANDA (1), M. DELEANU (1) (2), M. SIMIONESCU (1), A.V. SIMA (1) *
1 Institute of Cellular Biology and Pathology “Nicolae Simionescu” of the Romanian Academy, Bucharest, Romania 2 Faculty of Biotechnology, University of Agronomical Sciences and Veterinary Medicine, Bucharest, Romania
*Corresponding author
Anca V. Sima, Ph.D.
Head, Lipidomics Department
Institute of Cellular Biology and Pathology “N. Simionescu” of the Romanian Academy
8, B.P. Hasdeu Street, Bucharest 050568, Romania
Phone: +40(0)21.319.4518, Fax: +40(0)21.319.4519, e-mail: [email protected]
Keywords: C-reactive protein, endoplasmic reticulum stress, macrophages, oxidized LDL, reactive
oxygen species.
Summary
The endoplasmic reticulum (ER) stress and
the oxidative stress play critical roles in the
activation of inflammatory reactions in
atherosclerosis. The aim of the present study
was to investigate C-reactive protein (CRP)
expression, an inflammatory cytokine known
to contribute to atherosclerosis and the
subsequent cardiovascular events, in human
macrophages. We asked whether oxLDL-
induced ER stress and oxidative stress in
human macrophages determine the secretion
of this molecule. To this purpose, cultured
human THP-1 macrophages were incubated
with oxLDL in the presence or absence of
inhibitors for ER stress (salubrinal, sodium
phenylbutyrate) or oxidative stress (N-acetyl
cysteine, apocynin). The results showed that
oxLDL-triggered ER stress (via the activation
of eukaryotic initiation factor-2 α and inositol
requiring-protein 1 α, the up-regulation of
C/EBP homologous protein) and oxidative
stress (by stimulation of NADPH oxidase
activity and ROS production) is followed by
the induction of CRP gene expression and
protein secretion in human macrophages.
Furthermore, we found that oxLDL-induced
CRP gene expression and protein secretion
were reduced by the inhibitors of oxidative
stress, and not by the inhibitors of ER stress.
These data demonstrate that oxLDL induce
CRP secretion from human macrophages via
a mechanism that involves the induction of
the oxidative stress.
Introduction
Atherosclerosis entails a complex disease
consequent to a lipid disorder or an
inflammatory process having as a result the
atheroma formation (Simionescu, 2007;
Simionescu and Sima, 2012). The initial event
is the accumulation of modified lipoproteins
(Lp) within the subendothelial space
(Simionescu et al., 1986; Sakalen et al., 2002,
Moore & Tabas, 2011). Lp that are trapped in
the arterial wall are susceptible to various
modifications (such as oxidation, glycation,
enzymatic and non-enzymatic cleavage,
aggregation), which render them pro-
inflammatory and induce the activation of the
overlying endothelial cells (Stancu et al.,
2012; Moore et al., 2013). The development
of atherosclerotic lesions due to the vascular
Annals of R.S.C.B., Vol. XIX, Issue 3, 2015, pp. 9 - 20 doi: 10.ANN/RSCB-2015-0028:RSCB Received 18 June 2015; accepted 01 July 2015.
The Romanian Society for Cell Biology ©, Annals of R. S. C. B., Vol. XIX, Issue 3, 2015, Anca V. Sima., pp. 9 – 20
10
inflammation triggered by the modified Lp
begins with the infiltration of monocytes into
the arterial wall, where they differentiate into
macrophages, take up modified Lp and
become foam cells, that are a hallmark of the
atherosclerotic plaque (Steinberg & Witztum,
2002). Within the plaque, foam cells
contribute to the local inflammation through
secretion of pro-inflammatory mediators, such
as chemokines, cytokines, reactive oxygen
and nitrogen species, and matrix-degrading
proteases (Moore et al., 2013). As a
representative marker of the inflammatory
response, C-reactive protein (CRP)
participates in all stages of the atherosclerotic
process, and provides a pivotal link between
inflammation and atherogenesis (Kaperonis et
al., 2006). Plasma levels of oxidized low
density lipoproteins (oxLDL) are known to be
elevated in patients with type 2 diabetes and
coronary artery disease (CAD) and are
associated with a high risk of cardiac events
in the general population, as well as in
patients with stable CAD (Ehara et al., 2001;
Holvoet et al., 2004; Shimada et al., 2004).
It was reported that the endoplasmic
reticulum (ER) stress is activated in
macrophages from human atherosclerotic
lesions (Feng et al., 2003; Myoishi et al.,
2007). Existing data show that oxLDL induce
ER stress during the formation of
macrophage-derived foam cells (Yao et al.,
2014). It was reported that the ER stress
determines the secretion of pro-inflammatory
cytokines, such as CRP in HepG2 cells
(Chung et al., 2011) and interleukin-1β in
U937 macrophages (Kim et al., 2014). The
generated oxidative stress and reactive
oxygen species (ROS) are integral
components of ER stress and not just
consequences of the ER stress induction
(Hotamisligil, 2010). The generated ROS up-
regulate the production of pro-inflammatory
cytokines, such as CRP in U937 macrophages
and endothelial cells (Li et al., 2011; Han et
al., 2010). Reports show that oxLDL and
other oxidized lipids trigger the intracellular
generation of ROS and the cellular oxidative
stress in macrophages (Leonarduzzi et al.,
2005; Vindis et al., 2006) and may induce ER
stress (Malhotra & Kaufman, 2007).
We hypothesized that oxLDL can determine
CRP synthesis and secretion from human
macrophages in culture through the activation
of ER stress and oxidative stress. We report
here that oxLDL stimulate NADPH oxidase
and the ensuing ROS production, the process
leading to the secretion of CRP. Materials and methods
Reagents
RPMI-1640 medium, phorbol-12-myristate-
13-acetate (PMA), tunicamycin (TM), N-
acetyl cysteine (NAC), apocynin (Apoc),
dihydroethidium (DHE), 2',7'-
dichlorofluorescein diacetate (DCFH-DA)
and thiazolyl blue tetrazolium bromide (MTT)
were purchased from Sigma-Aldrich, St.
Louis, MO, USA. Primary antiobodies against
human CRP (mouse monoclonal), and
horseradish peroxidase-conjugated goat
secondary antibodies against mouse or rabbit
IgG were obtained from Abcam, Cambridge,
UK. The antibodies to human β-actin (mouse
monoclonal), IRE1α (rabbit polyclonal),
KDEL ER Marker (mouse monoclonal),
sodium phenylbutyrate (PBA) and salubrinal
were purchased from Santa Cruz
Biotechnology, Santa Cruz, CA, USA. The
antibodies to phospho-eIF2α (Ser51, rabbit
polyclonal) and eIF2α (mouse monoclonal)
were obtained from Cell Signaling, Beverly,
MA, USA. 4-hydroxy-nonenal (4-HNE) and
(±)9-hydroxy-10E,12Z-octadecadienoic acid
cholesteryl ester (9-HODE) were obtained
from Cayman Chemicals, Ann Arbor, MI,
USA.
Isolation of human lipoproteins and
preparation of oxLDL
LDL was isolated from human plasma of
healthy donors from the Blood Transfusion
Center, Bucharest by density gradient
ultracentrifugation in Optima LE-80 or XP-80
ultracentrifuges (Beckman Coulter
International SA, Nyon, Switzerland).
Copper-oxidized LDL (oxLDL) was prepared
Annals of R.S.C.B., Vol. XIX, Issue 3, 2015, pp. 9 - 20 doi: 10.ANN/RSCB-2015-0028:RSCB Received 18 June 2015; accepted 01 July 2015.
The Romanian Society for Cell Biology ©, Annals of R. S. C. B., Vol. XIX, Issue 3, 2015, Anca V. Sima., pp. 9 – 20
11
and characterized as previously described
(Sima et al., 2010).
Cell culture and experimental design
Human leukemic monocytic THP-1 cell line
was grown in RPMI-1640 culture medium
supplemented with 10% heat-inactivated fetal
calf serum (EuroClone, Siziano, Italy),
penicillin (100 U/ml) and streptomycin
(100µg/ml). For macrophage differentiation,
THP-1 cells were seeded at a density of
106/ml into 6-well plates in standard growth
medium supplemented with 100nM PMA for
72h. In all the experiments, macrophages
were incubated with native LDL (nLDL) or
oxLDL at a concentration of 100μg
protein/ml in serum free-medium (RPMI-
1640 with antibiotics) for 24h. Macrophages
cultured in the same conditions except the
exposure to LDL were used as control cells.
Induction of ER stress was obtained by
adding an UPR activator, tunicamycin (TM, 1
µg/ml) that inhibits protein glycosylation
[25]. Alternatively, THP-1 macrophages were
exposed for 24h to 10 and 20 μM 4-
hydroxynonenal (4-HNE) or to 1 and 3 μg/ml
9-HODE. Reduction of the ER stress was
attained by adding a chemical chaperone, 20
mM 4-phenylbutyrate (PBA) or a selective
inhibitor of eukaryotic translation initiation
factor 2α (eIF2α), 5 µM salubrinal. Decrease
of the oxidative stress was achieved using the
general antioxidant, 5 mM N-acetyl-cysteine
(NAC) or a NADPH oxidase inhibitor, 50 µM
apocynin (Apoc).
Evaluation of cell viability
Cell viability was measured as a function of
the mitochondrial activity using a cell growth
determination assay based on tetrazolium salt
(MTT, Sigma, St. Louis, MO, USA).
Measurement of the intracellular reactive
oxygen species production
The intracellular ROS production in
macrophages was assessed using
dihydroethidium (DHE) (Zhao et al., 2005)
and dichlorofluorescein-diacetate (DCFH-
DA) (Cathcart et al., 1983), as described
earlier (Sima et al., 2010; Ungvari et al.,
2003) and expressed as relative fluorescence
units (RFU) per microgram of total cell
protein. The NADPH oxidase (NADPHox)
activity was determined as previously
described (Ungvari et al., 2003) and
expressed as relative light units (RLU) per
microgram of total cell protein. Lipid
peroxides levels in culture media were
measured as thiobarbituric acid reactive
substances (TBARS) by UHPLC method
(Seljeskog et al., 2006) and expressed as
malondialdehyde (MDA) pmoles/ml.
Analysis of mRNA expression by real-time
PCR
Total RNA was isolated from cultured
macrophages using the GenElute mRNA
Miniprep Kit (Sigma-Aldrich, St. Louis, MO,
USA). The M-MLV Reverse Transcriptase kit
(Invitrogen, Carlsbad, CA, USA) was
employed for the reverse-transcription of
RNA, then the amplification and
quantification of the resulting complementary
DNA (cDNA) was done by the SYBR Select
master mix (Applied Biosystems, Carlsbad,
CA, USA). Real-time PCR was carried out
using the ViiA7 real-time PCR system
(Applied Biosystems, Life Technologies,
Carlsbad, USA) employing human specific
primers for sXBP1, XBP1, CHOP, CRP and
β-actin (as housekeeping gene)
(Supplementary Table 1).
Annals of R.S.C.B., Vol. XIX, Issue 3, 2015, pp. 9 - 20 doi: 10.ANN/RSCB-2015-0028:RSCB Received 18 June 2015; accepted 01 July 2015.
The Romanian Society for Cell Biology ©, Annals of R. S. C. B., Vol. XIX, Issue 3, 2015, Anca V. Sima., pp. 9 – 20
12
Supplementary Table 1. Primers used for real-time PCR analysis.
Gene GeneBank
accession number Sequences of oligonucleotide primers
Amplicon
size (bp)
sXBP1 NM_005080.3
NM_ 001079539.1
FW: 5'-GCAGGTGCAGGCCCAGT-3'
RW: 5'-GAATGCCCAACAGGATATCAGACT-3' 100
uXBP1 NM_005080.3
NM_ 001079539.1
FW: 5'-
TGGAACAGCAAGTGGTAGATTTAGAA -3'
RW: 5'-CATCCCCAAGCGCTGTCTT -3'
125
CHOP NM_001195053.1 FW: 5'-CAGATGAAAATGGGGGTACCT -3'
RW: 5'-AGAAGCAGGGTCAAGAGTGGT -3' 86
CRP NM_000567.2 FW: 5'-GTGTTTCCCAAAGAGTCGGATACT -3'
RW: 5'-CCACGGGTCGAGGACAGTT -3' 116
β-actin
NM_001101.3
FW: 5'-GTCTTCCCCTCCATCGT -3'
RW: 5'-CGTCGCCCACATAGGAAT -3' 82
The relative quantification was achieved by
the Fit-Point method (Livak & Schmittgen,
2001) based on SYBR-Green detection.
Immunoblot assays
Total cell proteins were extracted using a
RadioImmuno Precipitation Assay (RIPA)
lysis buffer containing protease and
phosphatase inhibitors. The culture media
collected from macrophages were
concentrated by ultrafiltration with Amicon
Ultracentrifugal filters with a 10 kDa-cutoff
(Milipore, Billerica, MA, USA). Equal
amounts of cell proteins or equal volumes of
culture media were subjected to SDS-PAGE,
transferred onto nitrocellulose (NC)
membranes and blocked in Tris-buffered
saline (TBS) containing 0.1% Tween 20 and
5% bovine serum albumin (BSA) or 5% skim
milk (Millipore). The NC membranes were
incubated sequentially with primary
antibodies followed by HRP–conjugated
second antibodies; an enhanced
chemiluminescence (ECL) kit (Thermo
Scientific Pierce, Rockford, IL, USA or
Applichem, USA) and an ImageQuant
LAS4000 imaging system (GE Healthcare
Biosciences, Pittsburgh, PA, USA) were used
to visualize the proteins. The relative protein
expression was determined by densitometric
analysis using ImageQuant-TL software (GE
Healthcare Biosciences, Pittsburgh, PA,
USA). On the Western blots, the protein
expression was normalised to β-actin and that
of phosphoproteins to the respective total
protein expression. The protein expression of
the secreted proteins in the culture media was
normalized to the total cell protein.
Statistical analysis
GraphPad 5.0 (GraphPad Software, Inc., La
Jolla, CA, USA) was employed for statistical
analysis. Statistical evaluation was done by
independent two-tailed (Student’s) T-test; a p
value less than 0.05 was considered
statistically significant. Data were expressed
as mean ± standard deviation (SD).
Annals of R.S.C.B., Vol. XIX, Issue 3, 2015, pp. 9 - 20 doi: 10.ANN/RSCB-2015-0028:RSCB Received 18 June 2015; accepted 01 July 2015.
The Romanian Society for Cell Biology ©, Annals of R. S. C. B., Vol. XIX, Issue 3, 2015, Anca V. Sima., pp. 9 – 20
13
Results and discussions
Oxidized LDL induce ER stress
In order to establish the concentration of
oxLDL to be used in the experiments,
macrophages were exposed to 100 µg/ml and
200 µg/ml of oxLDL added to the culture
media for 24h. The results showed that
oxLDL at 100 µg/ml decreased the cell
viability only by 10% (p<0.05), whereas at
200 µg/ml was cytotoxic and reduced cell
viability by 47% (p<0.001). In similar
conditions, 1 µg/ml TM diminished cell
viability by 29% (p <0.001) (Supplementary
Figure 1). Consequently, for further
experiments oxLDL at 100 µg/ml culture
media was employed.
Fig. 1. Oxidized LDL trigger ER stress in human macrophages. The cells were incubated with 100 µg/ml of native LDL
(nLDL) or oxidized LDL (oxLDL) or 1 µg/ml tunicamycin (TM) for 24h. Control macrophages (C) were cultured in the
same conditions without LDL exposure. (A, B, C) Phospho-eIF2α (p-eIF2α), eIF2α, IRE1α and KDEL-motif-bearing
proteins (Grp94 and Grp78) were normalized to β-actin and expressed as fold change vs. C. (D, F) Unspliced XBP1
(uXBP1) and its spliced form (sXBP1) and CHOP mRNA levels were determined by real-time PCR relative to β-actin
and expressed as fold change vs. C . All data are presented as mean ± SD. *p<0.05, **p<0.01, ***p<0.001 vs. nLDL.
#p<0.05, ##p<0.01, ###p<0.001 vs. oxLDL.
The experiments showed that incubation of
macrophages with 100 µg/ml oxLDL induced
the activation of eIF2α and IRE1α manifested
by a 2-fold increase of the phosphorylation
level of eiF2α (p-eIF2α/eIF2α, p<0.05) above
the values obtained for nLDL, but comparable
to the effect induced by the cells incubation
with TM (2.3-fold, p<0.05) (Figure 1A).
Similarly, both oxLDL and TM increased
significantly the protein expression of IRE1α
(1.5-fold, p<0.01) as compared to nLDL
(Figure 1B). In contrast, oxLDL induced a
modest increase of the ER resident
chaperones protein expression, Grp94 (32%)
and Grp78 (44%), whereas TM significantly
increased both Grp94 (3-fold, p<0.01) and
Grp78 (4-fold, p<0.01) in macrophages
(Figure 1C). Other experiments revealed that
oxLDL did not activate XBP1 splicing, while
TM significantly increased the gene
Annals of R.S.C.B., Vol. XIX, Issue 3, 2015, pp. 9 - 20 doi: 10.ANN/RSCB-2015-0028:RSCB Received 18 June 2015; accepted 01 July 2015.
The Romanian Society for Cell Biology ©, Annals of R. S. C. B., Vol. XIX, Issue 3, 2015, Anca V. Sima., pp. 9 – 20
14
expression of both sXBP1 (14-fold,
p<0.001) and uXBP1 (21-fold, p<0.001), as
shown in Figure 1D. Nonetheless, the CHOP
gene expression was significantly augmented
by oxLDL (2.5-fold, p<0.001), and especially
amplified by TM (25-fold, p<0.001) (Figure
1E). Together, these results indicated that
oxLDL induce ER stress through the
activation of eIF2α and IRE1α and up-
regulation CHOP.
Oxidized LDL stimulates ROS production
To assess the pro-oxidant effect of oxLDL on
macrophages and the mechanism involved,
the cellular NADPHox activity was
determined. The results revealed that the
NADPHox activity was significantly
enhanced by oxLDL (55%, p<0.01) as
compared to nLDL, but was similar to the
effect of TM (78%, p<0.01) (Figure 2A). We
questioned whether in our experimental
condition, oxLDL induce an intracellular
ROS production in macrophages. The results
showed that oxLDL stimulated significantly
the intracellular ROS, both as O2- (29%,
p<0.001) and as H2O2 (77%, p<0.01),
compared to nLDL (Figure 2B, C). The cells
exposure to TM induced a similar increase of
O2- level (21%, p<0.01) and no increase for
H2O2 (Figure 2B). This effect was associated
with a significant increase of the MDA levels
present in the culture media, mostly for the
cells incubated with oxLDL (20-fold,
p<0.05), and less for those exposed to TM
(2.7-fold, p<0.05) (Figure 2D).
Fig. 2. Oxidized LDL induce ROS production in human macrophages. Cells were incubated with 100 µg/ml native LDL
(nLDL), 100 µg/ml oxidized LDL (oxLDL) or 1 µg/ml tunicamycin (TM) for 24h. Control macrophages (C) were
cultured in the same conditions in the absence of LDL exposure. Macrophages were preincubated with 5 mM NAC or
50 µM Apoc for 2h before incubation with 100 µg/ml oxLDL. NADPH oxidase activity was determined by lucigenin-
enhanced chemiluminescence assay (A), expressed as relative luminiscence units per microgram of total cell protein
and represented as fold change vs. C. ROS level was determined using DHE for superoxide (O2-) detection (B, E) and
DCFH-DA for hydrogen peroxide (H2O2) detection (C,F), expressed as relative fluorescence units per microgram of
total cell protein and represented as fold change vs. C or oxLDL. Lipid peroxides levels in culture media were assessed
as TBARS by UHPLC and expressed as malondialdehyde (MDA) pmoles/ml (D). All data are presented as mean ± SD.
*p<0.05, **p<0.01, ***p<0.001 vs. nLDL. ##p<0.01, ###p<0.001 vs. oxLDL.
Annals of R.S.C.B., Vol. XIX, Issue 3, 2015, pp. 9 - 20 doi: 10.ANN/RSCB-2015-0028:RSCB Received 18 June 2015; accepted 01 July 2015.
The Romanian Society for Cell Biology ©, Annals of R. S. C. B., Vol. XIX, Issue 3, 2015, Anca V. Sima., pp. 9 – 20
15
Exposure to 5 mM NAC, a free radicals
scavenger, and to the specific inhibitor of
NADPHox, 50 µM Apoc, reduced oxLDL-
induced O2- generation in macrophages
(18%, p<0.001 and 13%, p<0.01,
respectively) (Figure 2E), while H2O2
production was reduced only by 5 mM NAC
(43%, p<0.01) (Figure 2F). Together, these
experiments indicate that oxLDL stimulate
ROS production through the activation of
NADPHox.
Oxidized LDL and their oxidation products
induce CRP gene expression and secretion
in human macrophages
To assess whether the oxidative milieu affects
the secretion of CRP, we set up experiments
to investigate the effect of oxLDL on CRP
expression and secretion in macrophages. The
results showed that in these cells, oxLDL
induced a 3-fold increase of CRP mRNA
(p<0.001) above the values obtained for
nLDL (controls) and similar to the values
given by 1 µg/ml TM (4.5-fold, p<0.001)
(Figure 3A). Consistent with the gene
expression results, oxLDL induced a
significant increase of the secreted CRP
compared to nLDL in the cells’ culture media
(4-fold, p<0.01); a high level of secreted CRP
was obtained also upon the incubation of the
cells with TM (7-fold, p<0.01) (Figure 3B).
Fig. 3. Oxidized LDL induce CRP mRNA and
secretion in human macrophages. Cells were incubated
with 100 µg/ml native LDL (nLDL), 100 µg/ml
oxidized LDL (oxLDL) or 1 µg/ml tunicamycin (TM)
for 24h. Control macrophages (C) were cultured in the
same conditions without LDL exposure. (A) CRP
mRNA levels were measured by real-time PCR relative
to β-actin and expressed as fold change vs. C. (B)
Secreted CRP was quantified in the culture media,
normalized to β-actin and expressed as fold change vs.
C. All data are presented as mean ± SD. **p<0.01,
***p<0.001 vs. nLDL. #p<0.05, ##p<0.01 vs. oxLDL.
These studies were extended employing
two main lipid peroxidation products that are
components of oxLDL, 4-HNE and 9-HODE.
Incubation of human macrophages with 10 or
20 µM 4-HNE or 1 or 3 µg/ml 9-HODE
induced a concentration-dependent up-
regulation of CRP gene expression and that of
the secreted protein in the culture media,
compared to control cells. The CRP mRNA
levels in the cells exposed to 10 or 20 µM 4-
HNE increased by 5-fold (p<0.001) and 13-
fold (p<0.001), respectively, while the
exposure to 1 or 3 µg/ml of 9-HODE induced
an increase of 1.8-fold (p<0.001) and 11-fold
(p<0.001) respectively (Figure 4A). The CRP
secreted by macrophages in the culture media
increased 7-fold (p<0.001) and 13-fold
(p<0.01), respectively, in the cells incubated
Annals of R.S.C.B., Vol. XIX, Issue 3, 2015, pp. 9 - 20 doi: 10.ANN/RSCB-2015-0028:RSCB Received 18 June 2015; accepted 01 July 2015.
The Romanian Society for Cell Biology ©, Annals of R. S. C. B., Vol. XIX, Issue 3, 2015, Anca V. Sima., pp. 9 – 20
16
with 10 µM and 20 µM 4-HNE. A similar
phenomenon was detected in cells incubated
with 9-HODE, which induced a 3-fold (1
µg/ml, p<0.001) and a 10-fold (3 µg/ml,
p<0.001) increase of the secreted CRP
(Figure 4B).
Fig. 4. Lipid oxidation products from oxidized LDL
induce CRP mRNA and secretion in human
macrophages. Cells were exposed to 10 and 20 µM 4-
HNE or 1 and 3 µg/ml 9-HODE for 24h. Control
macrophages (C) were cultured in the same conditions
without LDL exposure. (A) CRP mRNA levels were
measured by real-time PCR relative to β-actin and
expressed as fold change vs. C. (B) Secreted CRP was
quantified in the culture media, normalized to β-actin
and expressed as fold change vs. C. All data are
presented as mean ± SD. $$$p<0.001 vs.C.
Oxidized LDL-induced CRP secretion from
human macrophages is mediated by
oxidative stress
To reveal whether the ER stress triggering is
involved in the oxLDL-induced secretion of
CRP from macrophages, the cells were
incubated with oxLDL in the presence of the
inhibitors of ER stress, 5 µM salubrinal or 20
mM PBA. The results showed that none of
the tested inhibitors affected CRP mRNA and
protein secretion from macrophages exposed
to oxLDL (data not shown).
To elucidate whether the oxidative stress
activation is responsible for the secretion of
CRP from macrophages, the cells were
incubated with oxLDL in the presence of
oxidative stress inhibitors, 5 mM NAC or 50
µM Apoc. The results of these experiments
showed that both inhibitors decreased
oxLDL-induced CRP mRNA, namely NAC
73% (p<0.001) and Apoc 48% (p<0.01). In
addition, NAC reduced the CRP secreted by
oxLDL-exposed macrophages by 24%
(p<0.05). (Figure 5A, B). These results
corroborate well and support the implication
of the oxidative stress in CRP expression and
secretion by macrophages.
Annals of R.S.C.B., Vol. XIX, Issue 3, 2015, pp. 9 - 20 doi: 10.ANN/RSCB-2015-0028:RSCB Received 18 June 2015; accepted 01 July 2015.
The Romanian Society for Cell Biology ©, Annals of R. S. C. B., Vol. XIX, Issue 3, 2015, Anca V. Sima., pp. 9 – 20
17
Fig. 5. Oxidative stress mediates oxidized LDL-
induced CRP secretion in human macrophages. Cells
were preincubated with 5 mM NAC or 50 µM Apoc for
2h before adding 100 µg/ml oxLDL for 24h. (A) CRP
mRNA levels were measured by real-time PCR relative
to β-actin and expressed as fold change vs. oxLDL. (B)
Secreted CRP was quantified in cells’ media,
normalized to β-actin and expressed as fold change vs.
oxLDL. All data are presented as mean ± SD.
#p<0.05, ###p<0.001 vs. oxLDL.
The data obtained in this study show that
exposure of human macrophages to oxLDL
induces: (i) ER stress, as revealed by the
activation of eIF2α and IRE1α, and up-
regulation of CHOP gene expression; (ii)
oxidative stress, as manifested by stimulation
of NADPHox activity and ROS production
and (iii) CRP gene and protein expression,
and secretion mediated by the oxidative
stress.
We previously reported that oxLDL and
their two major lipid peroxidation products,
4-HNE and 9-HODE, induce ER stress in
human macrophages by the activation of
eIF2α and c-Jun N-terminal kinase
(SAPK/JNK) signalling pathways (Niculescu
et al., 2013). In the present study, we show
that oxLDL increase the protein expression of
ER stress sensor IRE1α, which is involved in
the c-Jun N-terminal kinase pathway and up-
regulate CHOP gene expression, data that are
in good agreement with Yao et al., 2013.
Reportedly, oxLDL and oxidized lipids
trigger intracellular generation of ROS and
cellular oxidative stress (Leonarduzzi et al.,
2005). Our experiments established that
oxLDL stimulate ROS production (O2- and
H2O2) in human cultured macrophages
through the activation of NADPH oxidase.
The results corroborate well with the reported
similar increases of H2O2 production in
RAW264.7 (Lee et al., 2014) and J774
macrophages (Bae et al., 2009).
In the present study, we demonstrate that
oxLDL, as well as two oxidation-generated
lipid components of oxLDL, 4-HNE and 9-
HODE, induce the secretion of CRP from
macrophages, in good agreement with Li et
al., 2015. We also found that TM, a well-
known ER and oxidative stress inducer,
increases the CRP gene expression and
protein secretion in macrophages. The
inhibition of ER stress, such as the treatment
with salubrinal or PBA, did not influence
CRP secretion. The pre-incubation of
macrophages with antioxidants, such as NAC
or apocynin, decreased oxLDL-induced CRP
gene expression and protein secretion. These
data indicate that oxLDL-induced CRP
secretion from macrophages is associated
with ROS production, in good agreement with
a report from literature that showed the
involvement of ROS in the angiotensin II-
induced CRP expression in U937
macrophages (Li et al., 2011).
Annals of R.S.C.B., Vol. XIX, Issue 3, 2015, pp. 9 - 20 doi: 10.ANN/RSCB-2015-0028:RSCB Received 18 June 2015; accepted 01 July 2015.
The Romanian Society for Cell Biology ©, Annals of R. S. C. B., Vol. XIX, Issue 3, 2015, Anca V. Sima., pp. 9 – 20
18
In vivo, the local effect of CRP secretion
from macrophages may have an important
impact on the adjacent endothelial cells in the
atheroma. We have previously reported that
CRP induces a decrease of the gene and
protein expression of endothelial nitric oxide
synthase and the increase of the intracellular
reactive nitrogen species levels in human
endothelial cells in culture (Toma et al.,
2012). In addition, we have shown that CRP
increases the phosphorylation of pro-
inflammatory signalling molecules (p65
subunit of NF-kB and p38MAPK) and
induces increased MCP-1 expression in HEC
(Toma et al., 2012).
Conclusions
Our data demonstrate that oxLDL contribute
in part to the development of the
atherosclerotic plaques by inducing the
activation of the NADPH oxidase, the
ensuing ROS production, and the secretion of
pro-inflammatory molecules from
macrophages, such as CRP, which contribute
to the development and destabilization of the
plaque.
Acknowledgements
The authors thank Ms. Daniela Rogoz and
Ms. Cristina Dobre for their skilful technical
assistance. This work was supported by the
Romanian Academy, the Romanian Ministry
of National Education PN-II-PT-PCCA-2011-
3.1-0184 project (grant number PCCA-
127/2012), co-financed (GMS) by the
European Social Fund through Sectorial
Operational Program Human Resources
Development 2007-2013 (project
POSDRU/159/1.5/S/133391). References
Baec, Y.S., Lee, J.H., Choi, S.H., Kim, S., Almazan,
F., Witztum, J.L., Miller, Y.I.: Macrophages
generate reactive oxygen species in response to
minimally oxidized low-density lipoprotein: toll-
like receptor 4- and spleen tyrosine kinase-
dependent activation of NADPH oxidase 2, Circ.
Res., 104, 210-218, 2009.
Cathcart, R., Schwiers, E., Ames, B.N.: Detection of
picomole levels of hydroperoxides using a
fluorescent dichlorofluorescein assay, Anal.
Biochem., 134, 111-116, 1983.
Chung, J., Shin, D.Y., Zheng, M., Joe, Y., Pae, H.O.,
Ryter, S.W., Chung, H.T.: Carbon monoxide, a
reaction product of heme oxygenase-1, suppresses
the expression of C-reactive protein by
endoplasmic reticulum stress through modulation of
the unfolded protein response, Mol. Immunol., 48,
1793-1799, 2011.
Erbay, E., Babaev, V.R., Mayers, J.R., Makowski, L.,
Charles, K.N., Snitow, M.E., Fazio, S., Wiest,
M.M., Watkins, S.M., Linton, M.F., Hotamisligil,
G.S.: Reducing endoplasmic reticulum stress
through a macrophage lipid chaperone alleviates
atherosclerosis, Nat. Med., 15, 1383-1391, 2009.
Ehara, S., Ueda, M., Naruko, T., Haze, K., Itoh, A.,
Otsuka, M., Komatsu, R., Matsuo, T., Itabe, H.,
Takano, T., Tsukamoto, Y., Yoshiyama, M.,
Takeuchi, K., Yoshikawa, J., Becker, A.E.:
Elevated levels of oxidized low density lipoprotein
show a positive relationship with the severity of
acute coronary syndromes, Circulation, 103, 1955-
1960, 2001.
Feng, B., Yao, P.M., Li, Y., Devlin, C.M., Zhang, D.,
Harding, H.P., Sweeney, M., Rong, J.X.,
Kuriakose, G., Fisher, E.A., Marks, A.R., Ron, D.,
Tabas, I.: The endoplasmic reticulum is the site of
cholesterol-induced cytotoxicity in macrophages,
Nat. Cell Biol., 5, 781-792, 2003.
Fu, Y., Luo, N., Lopes-Virella, M.F., Garvey, W.T.:
The adipocyte lipid binding protein (ALBP/aP2)
gene facilitates foam cell formation in human THP-
1 macrophages, Atherosclerosis, 165, 259-269,
2002.
Han, C., Liu, J., Liu, X., Li, M.: Angiotensin II induces
C-reactive protein expression through ERK1/2 and
JNK signaling in human aortic endothelial cells,
Atherosclerosis, 212, 206-212, 2010.
Holvoet, P., Kritchevsky, S.B., Tracy, R.P., Mertens,
A., Rubin, S.M., Butler, J., Goodpaster, B., Harris,
T.B.: The metabolic syndrome, circulating oxidized
LDL, and risk of myocardial infarction in well-
functioning elderly people in the health, aging, and
body composition cohort, Diabetes, 53, 1068-1073,
2004.
Hotamisligil, G.S.: Endoplasmic reticulum stress and
the inflammatory basis of metabolic disease, Cell,
140, 900-917, 2010.
Kaperonis, E.A., Liapis, C.D., Kakisis, J.D.,
Dimitroulis, D., Papavassiliou, V.G.: Inflammation
and atherosclerosis, Eur. J. Vasc. Endovasc. Surg.,
31, 386-393, 2006.
Kim, S., Joe, Y., Jeong, S.O., Zheng, M., Back, S.H.,
Park, S.W., Ryter, S.W., Chung, H.T.: Endoplasmic
reticulum stress is sufficient for the induction of IL-
1beta production via activation of the NF-kappaB
and inflammasome pathways, Innate Immun., 20,
Annals of R.S.C.B., Vol. XIX, Issue 3, 2015, pp. 9 - 20 doi: 10.ANN/RSCB-2015-0028:RSCB Received 18 June 2015; accepted 01 July 2015.
The Romanian Society for Cell Biology ©, Annals of R. S. C. B., Vol. XIX, Issue 3, 2015, Anca V. Sima., pp. 9 – 20
19
799-815, 2014.
Lee, S.J., Thien Quach, C.H., Jung, K.H., Paik, J.Y.,
Lee, J.H., Park, J.W., Lee, K.H.: Oxidized low-
density lipoprotein stimulates macrophage 18F-
FDG uptake via hypoxia-inducible factor-1alpha
activation through Nox2-dependent reactive oxygen
species generation, J. Nucl. Med., 55, 1699-1705,
2014.
Leonarduzzi, G., Chiarpotto, E., Biasi, F., Poli, G.: 4-
Hydroxynonenal and cholesterol oxidation products
in atherosclerosis, Mol. Nutr. Food Res., 49, 1044-
1049, 2005.
Li, S.F., Hu, Y.W., Zhao, J.Y., Ma, X., Wu, S.G., Lu,
J.B., Hu, Y.R., Wang, Y.C., Gao, J.J., Sha, Y.H.,
Zheng, L., Wang, Q.: Ox-LDL upregulates CRP
expression through the IGF2 pathway in THP-1
macrophages, Inflammation, 38, 2, 576-583, 2015.
Li, M., Liu, J., Han, C., Wang, B., Pang, X., Mao, J.:
Angiotensin II induces the expression of c-reactive
protein via MAPK-dependent signal pathway in
U937 macrophages, Cell Physiol. Biochem., 27, 63-
70, 2011.
Malhotra, J.D., Kaufman, R.J.: Endoplasmic reticulum
stress and oxidative stress: a vicious cycle or a
double-edged sword?, Antioxid. Redox Signal., 9,
2277-2293, 2007.
Moore, K.J., Sheedy, F.J., Fisher, E.A.: Macrophages
in atherosclerosis: a dynamic balance, Nat. Rev.
Immunol., 13, 709-721, 2013.
Moore, K.J., Tabas, I.: Macrophages in the
pathogenesis of atherosclerosis, Cell, 145, 341-355,
2011.
Myoishi, M., Hao, H., Minamino, T., Watanabe, K.,
Nishihira, K., Hatakeyama, K., Asada, Y., Okada,
K., Ishibashi-Ueda, H., Gabbiani, G., Bochaton-
Piallat, M.L., Mochizuki, N., Kitakaze, M.:
Increased endoplasmic reticulum stress in
atherosclerotic plaques associated with acute
coronary syndrome, Circulation, 116, 1226-1233,
2007.
Niculescu, L.S., Sanda, G.M., Sima, A.V.: HDL
inhibits endoplasmic reticulum stress by stimulating
apoE and CETP secretion from lipid-loaded
macrophages, Biochem. Biophys. Res. Commun.,
434, 173-178, 2013.
Pahl, H.L., Baeuerle, P.A.: A novel signal transduction
pathway from the endoplasmic reticulum to the
nucleus is mediated by transcription factor NF-
kappa B, EMBO J., 14, 2580-2588, 1995.
Seljeskog, E., Hervig, T., Mansoor, M.A.: A novel
HPLC method for the measurement of
thiobarbituric acid reactive substances (TBARS). A
comparison with a commercially available kit, Clin.
Biochem., 39, 947-954, 2006.
Shimada, K., Mokuno, H., Matsunaga, E., Miyazaki,
T., Sumiyoshi, K., Miyauchi, K., Daida, H.:
Circulating oxidized low-density lipoprotein is an
independent predictor for cardiac event in patients
with coronary artery disease, Atherosclerosis, 174,
343-347, 2004.
Sima, A.V., Botez, G.M., Stancu, C.S., Manea, A.,
Raicu, M., Simionescu, M.: Effect of irreversibly
glycated LDL in human vascular smooth muscle
cells: lipid loading, oxidative and inflammatory
stress, J. Cell. Mol. Med., 14, 2790-2802, 2010.
Simionescu, M.: Implications of early structural-
functional changes in the endothelium for vascular
disease, Arterioscler. Thromb. Vasc. Biol., 27, 266-
274, 2007.
Simionescu, M., Sima A.V., Morphology of
atherosclerotic lesions. In: Inflammation and
Atherosclerosis, pp.19-37, 2012. Edited by G. Wick
and C. Grundtman, Springer-Verlag, Wien.
Simionescu, N., Vasile, E., Lupu, F., Popescu, G.,
Simionescu, M.: Prelesional events in
atherogenesis. Accumulation of extracellular
cholesterol-rich liposomes in the arterial intima and
cardiac valves of the hyperlipidemic rabbit, Am. J.
Pathol., 123, 109-125, 1986.
Skalen, K., Gustafsson, M., Rydberg, E.K., Hulten,
L.M., Wiklund, O., Innerarity, T.L., Boren, J.:
Subendothelial retention of atherogenic lipoproteins
in early atherosclerosis, Nature, 417, 750-754,
2002.
Stancu, C.S., Toma, L., Sima, A.V.: Dual role of
lipoproteins in endothelial cell dysfunction in
atherosclerosis, Cell Tissue Res., 349, 433-446,
2012.
Steinberg, D., Witztum, J.L.: Is the oxidative
modification hypothesis relevant to human
atherosclerosis? Do the antioxidant trials conducted
to date refute the hypothesis?, Circulation, 105,
2107-2111, 2002.
Toma, L., Sanda, G.M., Stancu, C.S., Rogoz, D., Sima,
A.V.: Combined effect of inflammatory C-reactive
protein and hyperglycemia on endothelial cell
dysfunction, Annals of the Romanian Society for
Cell Biology, 17, 29-36, 2012.
Torres, M., Forman, H.J.: Redox signaling and the
MAP kinase pathways, Biofactors, 17, 287-296,
2003.
Ungvari, Z., Csiszar, A., Edwards, J.G., Kaminski,
P.M., Wolin, M.S., Kaley, G., Koller, A.: Increased
superoxide production in coronary arteries in
hyperhomocysteinemia: role of tumor necrosis
factor-alpha, NAD(P)H oxidase, and inducible
nitric oxide synthase, Arterioscler. Thromb. Vasc.
Biol., 23, 418-424, 2003.
Vindis, C., Escargueil-Blanc, I., Elbaz, M., Marcheix,
B., Grazide, M.H., Uchida, K., Salvayre, R., Negre-
Salvayre, A.: Desensitization of platelet-derived
growth factor receptor-beta by oxidized lipids in
vascular cells and atherosclerotic lesions:
prevention by aldehyde scavengers, Circ. Res., 98,
785-792, 2006.
Yao, S., Miao, C., Tian, H., Sang, H., Yang, N., Jiao,
P., Han, J., Zong, C., Qin, S. Endoplasmic
reticulum stress promotes macrophage-derived
foam cell formation by up-regulating cluster of
differentiation 36 (CD36) expression, J. Biol.
Chem., 289, 4032-4042, 2014.
Yao, S., Zong, C., Zhang, Y., Sang, H., Yang, M., Jiao,
P., Fang, Y., Yang, N., Song, G., Qin S.: Activating
transcription factor 6 mediates oxidized LDL-
Annals of R.S.C.B., Vol. XIX, Issue 3, 2015, pp. 9 - 20 doi: 10.ANN/RSCB-2015-0028:RSCB Received 18 June 2015; accepted 01 July 2015.
The Romanian Society for Cell Biology ©, Annals of R. S. C. B., Vol. XIX, Issue 3, 2015, Anca V. Sima., pp. 9 – 20
20
induced cholesterol accumulation and apoptosis in
macrophages by up-regulating CHOP expression, J.
Atheroscler. Thromb., 20, 94-107, 2013.
Zhao, H., Joseph, J., Fales, H.M., Sokoloski, E.A.,
Levine, R.L., Vasquez-Vivar, J., Kalyanaraman, B.:
Detection and characterization of the product of
hydroethidine and intracellular superoxide by
HPLC and limitations of fluorescence, Proc. Natl.
Acad. Sci. U. S. A., 102, 5727-5732, 2005.