1
Pathogen prevalence in ticks collected from the vegetation and 1
livestock in Nigeria 2
3
Running title: Tick-borne pathogens in Nigeria 4
5
Anna L. Reye1+, Olatunbosun G. Arinola2+, Judith M. Hübschen1 and Claude P. Muller1* 6
7
1) Institute of Immunology, Centre de Recherche Public de la Santé / National Public Health 8
Laboratory, Luxembourg, Luxembourg 9
2) Department of Chemical Pathology and Immunology, College of Medicine, University of 10
Ibadan, Ibadan, Nigeria 11
12
+ Both authors contributed equally to this work 13
14
* Corresponding Author: 15
Prof. Dr. Claude P Muller 16
Institute of Immunology, Centre de Recherche Public de la Santé / National Public 17
Health Laboratory 18
20A, rue Auguste-Lumière 19
L-1950 Luxembourg, Luxembourg 20
Tel: +352 490604 220, Fax: +352 490686 21
Email: [email protected] 22
23
Copyright © 2012, American Society for Microbiology. All Rights Reserved.Appl. Environ. Microbiol. doi:10.1128/AEM.06686-11 AEM Accepts, published online ahead of print on 10 February 2012
on April 21, 2020 by guest
http://aem.asm
.org/D
ownloaded from
2
Abstract 24
Ticks are important disease vectors that can cause considerable economic losses by affecting 25
animal health and productivity, especially in tropical and subtropical regions. In this study, we 26
investigated the prevalence and diversity of bacterial and protozoal tick-borne pathogens in 27
ticks collected from the vegetation and cattle in Nigeria by PCR. The infection rates of 28
questing ticks were 3.1% for Rickettsia species, 0.1% for Coxiella burnetii and 0.4% for 29
Borrelia species. Other pathogens like Babesia, Theileria, Anaplasma and Ehrlichia species 30
were not detected in ticks from the vegetation. Feeding ticks collected from cattle displayed 31
infection rates of 12.5% for Rickettsia species, 14% for Coxiella burnetii, 5.9% for 32
Anaplasma species, 5.1% for Ehrlichia species and 2.9% for Theileria mutans. Babesia and 33
Borrelia species were not detected in ticks collected from cattle. Mixed infections were found 34
only in feeding ticks and mainly Rickettsia species and Coxiella burnetii were involved. 35
The diversity of tick-borne pathogens in Nigeria was higher in feeding than in questing ticks, 36
suggesting that cattle serve as reservoirs for at least some of the studied pathogens, in 37
particular C. burnetii. The total estimated infection rates of herds of 20.6% for a Rickettsia 38
africae-like species, 27% for Coxiella burnetii and 8.5% for Anaplasma marginale/centrale 39
suggest that these pathogens may have considerable implications for human and animal 40
health. 41
42
on April 21, 2020 by guest
http://aem.asm
.org/D
ownloaded from
3
Introduction 43
Ticks are important disease vectors that can cause considerable economic losses by affecting 44
animal health and productivity, especially in tropical and subtropical regions (28, 32, 37). In 45
Africa, the tick fauna is remarkably diverse with about fifty endemic tick species that are 46
known to infest domestic animals (38). However, the highest impact on livestock health is 47
caused by species belonging to only three genera, namely Amblyomma, Hyalomma and 48
Rhipicephalus (28). Damage is either direct (skin lesions, impairment of animal growth) or 49
indirect by transmission of a variety of pathogens (32). Major economical impact has been 50
associated with the four tick-borne diseases anaplasmosis, heartwater, babesiosis and 51
theileriosis, all of which are prevalent in Africa (4). 52
Bovine anaplasmosis is caused by the highly pathogenic species Anaplasma marginale sensu 53
stricto and the naturally attenuated A. marginale subspecies centrale (2, 7). Anaplasma 54
species are commonly detected in cattle and seroprevalence rates between 4.6% (Kenya) to 55
98% (South Africa) from different sub-Saharan countries are reported (4, 18, 26, 31). The 56
causative agents of bovine babesiosis and theileriosis have been frequently detected in blood 57
smears of cattle in Ghana, with prevalences as high as 97% for Theileria mutans, 87% for 58
Theileria velifera and 61% for Babesia bigemina (4). Tick-borne human ehrlichiosis of 59
varying severity are caused by Ehrlichia chaffeensis and E. ewingii (24). Several human 60
pathogenic tick-borne Rickettsia species have been found in Africa including Rickettsia 61
conorii conorii, R. conorii caspia, R. africae, R. aeschlimannii, R. massiliae, R. akari and R. 62
sibirica mongolotimonae (8, 19, 27). Humans are frequently infected with Rickettsia species 63
in Senegal, Burkina Faso, Cameroon, Mali and the Ivory Coast, where seroprevalence rates 64
from 17-36% have been reported (16). Coxiella burnetii causes Q fever in humans and high 65
serological prevalences have been reported from West African countries (17). Although 66
transmission mainly occurs via contact with infected reservoir hosts (domestic goats, sheep 67
on April 21, 2020 by guest
http://aem.asm
.org/D
ownloaded from
4
and cows), C. burnetii can also be transmitted by ticks. The most important borrelial infection 68
of humans in Africa is relapsing fever transmitted either by lice (louse-borne relapsing fever) 69
or soft ticks (tick-borne relapsing fever, TBRF). TBRF is caused by at least 16 Borrelia 70
species, of which Borrelia crocidura seems to be of increasing importance in West Africa 71
(36). In Ghana, 15% of blood smears from cattle were positive for Borrelia species (4). 72
Pathogens belonging to the genera of Anaplasma, Ehrlichia, Coxiella, Rickettsia, Babesia, 73
Theileria and Borrelia have been reported in ticks from some West African countries. In 74
Mali, Niger, Mauretania and Cameroon, feeding ticks from cattle were analysed for Rickettsia 75
species and prevalence rates ranging from 7.4 to 75% were observed (21, 27). In Cameroon, 76
the prevalence of Ehrlichia species in ticks removed from dogs was found to be 56% for E. 77
chaffeensis, and 6% for E. canis (24). However, it is important that these studies on feeding 78
ticks are complemented by pathogen prevalence studies in unfed (questing) ticks collected 79
from the vegetation to estimate the risk of infection after tick bites during the next blood 80
meal. So far, throughout West Africa only a single study investigated questing Amblyomma 81
variegatum ticks from Burkina Faso for Ehrlichia ruminantium and reported a prevalence rate 82
of 3.7% (1). 83
Thus, studies on tick-borne pathogens in ticks are fairly limited in West Africa. Here we 84
present the first comprehensive study on the diversity of bacterial and protozoal tick-borne 85
pathogens in questing and feeding ticks from Nigeria. 86
87
on April 21, 2020 by guest
http://aem.asm
.org/D
ownloaded from
5
Materials and Methods 88
In 2009, questing and feeding ticks were collected in Oyo State, Southwestern Nigeria. The 89
field collection sites were located within a 65 km radius of Ibadan, while the collection sites 90
of feeding ticks were located within a 20 km radius. Questing ticks were collected from the 91
vegetation at seven locations (Elepo, Alowo-nle, Fuleni, Orisunbare, Lanlate, Maya, Igbo-92
Ora) by cloth dragging and by direct hand-picking from their questing location. Collection 93
sites included rain forest, derived savannah, shrubs and herbaceous (mainly graminoid) plant 94
cover and displayed no notable topographical or climatic differences. Feeding ticks were 95
obtained from 11 herds comprising of 1 to 13 cattle at four locations (Moniya, Alakia, Bodija, 96
Mokola). Collection was performed throughout the year, but intensified in the wet season for 97
questing ticks, especially in June and July (67.6%; 473/700). The collection of feeding ticks 98
was most intense from January to March (80.9%; 110/136). 99
Ticks were stored in 70% ethanol at 4°C until further processing. For molecular analysis, 700 100
ticks from the vegetation (100 ticks per region) and 136 ticks from 62 cows were randomly 101
selected and morphologically identified to the species level (38). The ticks were washed three 102
times in phosphate buffered saline, rinsed with distilled water and dried on sterile filter paper 103
before disruption and homogenization. Ticks were crushed individually in 300μl lysis buffer 104
from the InviMag Tissue DNA Mini kit (Invitek, Berlin, Germany) using the TissueLyser II 105
(Qiagen, Venlo, Netherlands) and DNA extraction was performed with the KingFisher 96 106
Magnetic Particle Processor (Thermo Scientific, Waltham, Massachusetts, USA) following 107
the manufacturers’ instructions. 108
Detection PCRs were carried out using family-specific primers for members of the 109
Rickettsiaceae and Piroplasmidae and species-specific primers for Coxiella burnetii as 110
described before (references given in Table 1). The primers for the detection of 111
Anaplasmataceae were modified to be genus specific for Anaplasma and Ehrlichia. The 112
on April 21, 2020 by guest
http://aem.asm
.org/D
ownloaded from
6
Borrelia spp. primers were adapted to allow amplification of Relapsing Fever Group and 113
Lyme Disease Spirochetes (Table 1). Primers directed against the flagellar B gene of Borrelia 114
burgdorferi sensu lato group were used for further characterization of detected Borrelia 115
species (Table 1). The resulting PCR amplicons of the right fragment size were either directly 116
purified (Jet Quick PCR Purification Spin kit, Genomed, Loehne, Germany) or excised from a 117
1.5% agarose gel (QIAquick Gel Extraction Kit, Qiagen, Venlo, NL). Sequencing was 118
performed as described before (30). Neighbour-joining phylogenetic analyses using the 119
Kimura 2-parameter model with 1,000 bootstrap replicates and pairwise deletion were 120
performed using MEGA v.4.0.2 software (13). Statistical analyses of differences in the 121
prevalence rates between feeding and questing ticks were performed with Fisher’s exact test 122
(in case of sampling number < 5) or Pearson's goodness of fit Chi-square (GFX) test (P values 123
are given in Table 3 and 4). 124
Sequences are available at NCBI under accession numbers JN871727 - JN871848 for 125
Rickettsia species, JN871849 - JN871863 for Coxiella burnetii, JN871864 - JN871869 for 126
Anaplasma species, JN871870 - JN871872 for Borrelia species, JN871873 - JN871879 for 127
Ehrlichia species and JN871880 - JN871883 for Theileria mutans. 128
Results 129
The 836 analysed ticks were comprised of four species. The predominant species on cattle 130
were Rhipicephalus (Boophilus) annulatus (37.5%, n = 51) and Amblyomma variegatum 131
(33.8%, n = 46), followed by Hyalomma impeltatum (14.7%, n = 20) and Rhipicephalus 132
evertsi (14%, n = 19). From the vegetation, only Rh. evertsi (n = 700) was collected. Mainly 133
adult ticks were collected from both environmental sources (males: 45.1%, females: 53.5%, 134
nymphs: 1.4%). 135
Anaplasmataceae. Members of the Anaplasmataceae were detected in 11% (15/136) of ticks 136
removed from cattle, with Anaplasma marginale subspecies being the most prevalent (53.3%; 137
on April 21, 2020 by guest
http://aem.asm
.org/D
ownloaded from
7
8/15). Both Ehrlichia ewingii and Ehrlichia chaffeensis were detected in a single tick only 138
(Figure 1A). In five ticks, not clearly identifiable Ehrlichia species with 99% sequence 139
homology to Ehrlichia ewingii (3/5) or Ehrlichia ruminantium (2/5) were found. All four tick 140
species were found to harbour Anaplasmataceae (Rh. [Bo.] annulatus: A. marginale ssp. 141
[n = 7] and E. ewingii [n = 1]; Hy. impeltatum: A. marginale ssp. [n = 1], E. chaffeensis 142
[n = 1] and Ehrlichia sp. [n = 1], Am. variegatum: Ehrlichia sp. [n = 1] and Rh. evertsi: 143
Ehrlichia sp. [n = 3]). In total, 45.5% (5/11) of cattle herds were infected with A. marginale 144
subspecies, 45.5% (5/11) with Ehrlichia sp., 9.1% (1/11) with E. chaffeensis and 9.1% (1/11) 145
with E. ewingii (see also Table 2). In most cases, only one tick from one cow per herd was 146
infected, except for A. marginale subspecies. 147
Ticks from the vegetation were not found to be infected with Anaplasmataceae bacteria. 148
However, two sequences with highest nucleotide similarity of 99% to an uncultured alpha 149
proteobacterium (GenBank accession number AY254690) were recovered from two questing 150
Rh. evertsi ticks collected in Lanlate (Figure 1A, Table 3). 151
Rickettsiaceae. Rickettsia species were detected in 12.5% (17/136) of ticks from cattle and in 152
3.1% (22/700) of ticks from the vegetation. In feeding ticks, a Rickettsia africae-like species 153
(RAL) was predominant (82.4%; 14/17), all sequences of which showed a nucleotide 154
homology of 99 to 100% to Rickettsia africae. Rickettsia aeschlimannii was the second 155
predominant Rickettsia species (17.6%; 3/17). In at least one tick of each species, members of 156
the Rickettsiaceae were detected: Am. variegatum (RAL, n = 10; R. aeschlimannii, n = 1), Rh. 157
(Bo.) annulatus (RAL, n = 1; R. aeschlimannii, n = 1), Rh. evertsi (RAL, n = 1; R. 158
aeschlimannii, n = 1) and Hy. impeltatum (RAL, n = 2). In 63.6% (7/11) of herds, RAL was 159
detected in ticks. In most cases, more than one tick from more than one cattle per herd was 160
positive and the estimated infection rate of cattle in positive herds ranged from 15.4 to 50% 161
(Table 2). R. aeschlimannii was detected in 27.3% (3/11) of herds. Two nymphal 162
on April 21, 2020 by guest
http://aem.asm
.org/D
ownloaded from
8
Am. variegatum ticks were infected with Rickettsia species, namely RAL (8.3%; 1/12) and 163
R. aeschlimannii (8.3%; 1/12). 164
The predominant species Rickettsia massiliae was detected in 3% (21/700) of questing 165
Rh. evertsi ticks from all locations (Table 3). In 0.1% (1/700) of ticks, a Rickettsia species 166
belonging to the Rickettsia rickettsii group was detected (Figure 1B, Table 3). 167
Piroplasmidae. Theileria mutans was the only species of Piroplasmidae detected in ticks 168
from Nigeria (Figure 1C). It was exclusively detected in feeding ticks and its prevalence 169
ranged from 0.7% (1/136) in Hy. impeltatum to 2.2% (3/136) in Rh. (Bo.) annulatus. The 170
infected ticks originated from three cattle of the same herd in Moniya (Table 2). 171
Coxiella burnetii. In 14% (19/136) of feeding ticks, Coxiella burnetii was detected (Figure 172
1D). Again, at least one tick of each species was found to harbour C. burnetii (Am. 173
variegatum, n = 9; Rh. (Bo.) annulatus, n = 5; Hy. impeltatum, n = 2; Rh. evertsi, n = 3). In 174
total, 63.6% (7/11) of herds were infested with ticks positive for Coxiella and in most cases 175
more than on cattle per herd was involved (Table 2). Three Am. variegatum nymphs from 176
different cattle of the same herd in Moniya and one from Bodija were found to harbour 177
C. burnetii (33.3%, 4/12). The only C. burnetii infected questing tick (0.1%; 1/700) was 178
collected in Orisunbare (Table 3). 179
Borrelia species. Borrelia species were only found in questing Rh. evertsi ticks (0.4%; 3/700) 180
collected in Maya (Table 3). Borrelia species identification was not possible with the 181
sequence obtained from the 16S rRNA gene, which showed a nucleotide homology of 99% to 182
members of the Borrelia burgdorferi sensu lato complex (Figure 1E). Further characterization 183
of the Borrelia species using primers directed against the flagellar gene was also 184
unsuccessful. In addition, 16S rRNA sequences from unknown organisms were detected in 185
nine DNA extracts from questing Rh. evertsi. Three of these sequences had highest nucleotide 186
similarity of 94 to 97% to the soil bacterium Conexibacter woesei; the remaining six 187
on April 21, 2020 by guest
http://aem.asm
.org/D
ownloaded from
9
sequences formed a separate cluster with 83 to 85% nucleotide homology to C. woesei 188
(Figure 1F). 189
Mixed Infections. All mixed infections (1.3%; 11/836) were detected in feeding ticks and 190
were predominantly formed by RAL and C. burnetii (36.4%; 4/11) as well as T. mutans and 191
A. marginale ssp. (18.2%; 2/11; see also Table 4). Pathogen combinations found only once 192
were E. chaffeensis and C. burnetii, Ehrlichia sp. and C. burnetii, as well as Ehrlichia sp. and 193
RAL. Two triple infections formed by C. burnetii, T. mutans and A. marginale ssp. as well as 194
C. burnetii, RAL and Ehrlichia sp. were found. Tick species, in which multiple infections 195
were detected, included Am. variegatum (n = 5), Hy. impeltatum (n = 3), Rh. (Bo.) annulatus 196
(n = 2) and Rh. evertsi (n = 1). Mixed infections mainly occurred in adult ticks (90.9%), but 197
one nymphal Am. variegatum was found to be coinfected with RAL and C. burnetii. 198
Discussion 199
The tick species found in this study are known to commonly infest livestock in West African 200
countries (38). The exclusive finding of Rh. evertsi from the vegetation can be explained by 201
differences in life cycles and host-seeking behaviour of the identified tick species. Rh. evertsi 202
has a two-host life cycle, in which larval and adult instars display questing behaviour (38). 203
Am. variegatum and Hy. impeltatum have a three-host cycle, in which all instars feed on 204
different vertebrate hosts. Larval ticks of both species display questing behaviour, whereas the 205
adults are active hunters (38). Rh. (Bo.) annulatus is a one-host tick species and only larval 206
instars quest on the vegetation. Since the collection of questing larval ticks by cloth dragging 207
can be difficult, it is likely that even though other tick species than Rh. evertsi may have been 208
present at the field collection sites, they have been neglected due to limitations of the 209
collection methods. 210
This is the first comprehensive study on the diversity of bacterial and protozoal tick-borne 211
pathogens in both questing and feeding ticks not only in Nigeria, but sub-Saharan Africa. All 212
on April 21, 2020 by guest
http://aem.asm
.org/D
ownloaded from
10
of the investigated pathogens are widespread throughout Africa and represent a threat to both 213
human and animal health (4, 19-25, 27). As expected, the infection rate for most of the 214
pathogens was significantly higher in feeding than in questing ticks (Table 2), suggesting that 215
a number of these pathogens originated from the cattle blood ingested before tick collection 216
rather than from transstadially maintained infections acquired during earlier blood meals. 217
Therefore, the detection of pathogens in feeding ticks cannot establish vector competence 218
whereas infected unfed ticks have at least maintained the pathogen transstadially. Although 219
the latter are more likely to serve as potential vectors of live pathogens, in vitro experiments 220
are required to confirm this. The fact that tick species diversity was much higher in feeding 221
ticks may contribute significantly to the low prevalence rate of pathogens observed in 222
questing ticks. It may well be that Rh. evertsi is a less suitable vector of pathogens than other 223
tick species, although vector competence has been reported for Babesia, Theileria and 224
Anaplasma species (38). 225
The only study on the prevalence of C. burnetii in ticks from Africa was conducted in 226
Senegal, where 0.7 to 6.8% of feeding ticks from cattle were found to be infected (17). This 227
rate is considerably lower than the 14% of feeding ticks that we found to be infected. 228
Interestingly, C. burnetii was frequently detected in multiple ticks collected from the same 229
cow. In addition, the infection rate of feeding Rh. evertsi was considerably higher (15.8%; 230
3/19) than in questing Rh. evertsi (0.1%; 1/700) and also the infection rate of feeding nymphal 231
Am. variegatum ticks (33.3%; 4/12) was higher as compared to adults of the same species 232
(14.7%; 5/34). These observations and the difference between infection rates in questing and 233
feeding ticks (0.1% vs. 14%, p < 0.01) may be a reflection of the reservoir status of cattle for 234
C. burnetii. In Nigeria, C. burnetii seems to represent a considerable risk factor for those in 235
contact with cattle. In Senegal, where the prevalence of C. burnetii in cattle is relatively low 236
(3.6%), seroprevalence rates in humans can be as high as 21.4 to 51% (12, 17), suggesting 237
on April 21, 2020 by guest
http://aem.asm
.org/D
ownloaded from
11
even higher prevalence rates in Nigeria, where an estimated 27% (17/63) of cattle were 238
infected. Thus, both ticks and cattle must be considered as a considerable source of Q fever 239
and a significant threat to human health in the region. 240
Eight Anaplasma marginale/centrale positive ticks were collected and the estimated 241
prevalence in cattle was 9.5%, which is higher than the prevalence found in cattle blood 242
smears (1.9%) from Nigeria (11). Based on the detection PCR used in the present study, it 243
was not possible to differentiate between the highly pathogenic bovine A. marginale sensu 244
stricto and the naturally attenuated A. marginale subsp. centrale, which is sometimes used as 245
a vaccine (7). As the cattle in this study were not vaccinated, they must have been naturally 246
infected with either one of these subspecies, but the risk of severe disease cannot be 247
estimated. 248
Theileria mutans, the causative agent of benign bovine theileriosis, was detected in four Rh. 249
(Bo.) annulatus and Hy. impeltatum ticks removed from three cows of the same herd in 250
Moniya. This pathogen was not detected in any questing Rh. evertsi ticks from the seven field 251
locations, suggesting that this tick species may not be a competent vector or that T. mutans 252
has a limited distribution in Nigeria. It seems that in Nigeria, the estimated prevalence rate of 253
cattle (4.8%; 3/63) is comparable to that of cattle blood smears from within the country 254
(3.3%) (11). Interestingly, it is much lower than in Ghana, where 97% of cattle blood smears 255
were found to be positive for T. mutans (4). However, all cattle came from an area within a 256
30 km radius, thus also reflecting only a focal prevalence of T. mutans in few cattle herds. 257
Interestingly, Babesia species were not detected in any of the analysed ticks, although reports 258
on the seroprevalence of Babesia bigemina (29.4%) and Babesia bovis (14.1%) in Nigeria 259
exist (3). However, this study was performed in Northern Nigeria in the 1980s, suggesting 260
geographical as well as temporal differences in the distribution of Babesia species. 261
on April 21, 2020 by guest
http://aem.asm
.org/D
ownloaded from
12
Different SFG Rickettsia species have been reported in ticks from cattle in Mali (16.2%), 262
Niger (16.3%), Mauretania (0%) and Cameroon (74.7%). We detected R. massiliae and a 263
member of the R. rickettsii group only in questing ticks (p < 0.05). This is compatible with the 264
minor role of vertebrates in the perpetuation and survival of R. massiliae (15). In contrast, 265
RAL and R. aeschlimannii were only detected in feeding ticks, indicating a potential role of 266
cattle as hosts. The estimated prevalence rate of RAL in cattle from the same herd was high 267
(15.4 to 50%), either supporting the suspected role of cattle as a reservoir or reflecting a high 268
transovarial transmission rate of RAL in the local tick population. Further studies are 269
warranted to unambiguously identify the involved Rickettsia species and clarify the life cycle 270
of RAL. 271
Different Borrelia species have been described in Africa, most of which are transmitted by 272
soft ticks (36). Ticks of the genus Rhipicephalus are known to transmit Borrelia theileri to 273
cattle, causing bovine borreliosis. The 16S rRNA sequences of the Borrelia species detected 274
in this study differed at least in three nucleotide positions from all known Borrelia sequences. 275
These new sequences form a separate cluster within the Borrelia burgdorferi s.l. group, 276
possibly belonging to a so far unknown Borrelia species. Unfortunately, further 277
characterization based on another gene was unsuccessful. 278
Several sequences from unknown bacteria were obtained in the Anaplasmataceae and 279
Borrelia detection PCRs. As these sequences showed highest similarities to soil bacteria, they 280
were most likely derived from bacteria from the outside rather than the inside of the ticks. 281
We also report here for the first time mixed infections in feeding ticks from Western Africa 282
involving mainly RAL and C. burnetii. Mixed infections involving C. burnetii may originate 283
either from subsequent blood meals, co-feeding events, or feeding on coinfected hosts. In 284
mixed infections involving Rickettsia species also transovarial transmission may play a role 285
(15). Coinfections with multiple pathogens may complicate clinical diagnosis and treatment. 286
on April 21, 2020 by guest
http://aem.asm
.org/D
ownloaded from
13
In the Northern hemisphere, symptoms of Lyme Borreliosis have been reported to be more 287
diverse, intense and persistent in patients coinfected with either human anaplasmosis or 288
babesiosis (34). As treatment with an additional antimicrobial is necessary for a 289
Borreliosis/Babesiosis coinfection, misdiagnosis may lead to prolonged illness of patients 290
(34). For other tick-borne human pathogens, including spotted fever group rickettsiae and 291
Coxiella burnetii, the impact of coinfections on the severity of symptoms has not yet been 292
assessed. No such information exists on coinfections in cattle, although coinfections with 293
severe symptoms have been reported in dogs (9, 33). 294
The diversity of tick-borne pathogens in Nigeria was higher in feeding than in questing ticks, 295
suggesting that cattle serve as reservoirs for at least some of the studied pathogens, in 296
particular Coxiella burnetii. Investigations on the implications for human and animal health as 297
well as on the economic impact of these infections are warranted to determine the cost benefit 298
of vaccination of ruminants against A. marginale marginale, C. burnetii or ticks. Other 299
preventive measures like removal of feeding ticks and the concerted use of acaricides also 300
need to be assessed. 301
302
on April 21, 2020 by guest
http://aem.asm
.org/D
ownloaded from
14
Acknowledgements 303
The authors want to thank the staff of the Department of Chemical Pathology and 304
Immunology of the University of Ibadan and others for assisting in the tick collection as well 305
as livestock traders and abattoir staff for allowing access to cattle. 306
This work was funded by the Ministry of Cooperation of the Grand-Duchy of Luxembourg 307
and the Centre de Recherche Public-Santé. A.L. Reye was supported by a fellowship from the 308
Bourse Formation Recherche and the Aides à la Formation Recherche of the Fonds National 309
de la Recherche Luxembourg. 310
311
on April 21, 2020 by guest
http://aem.asm
.org/D
ownloaded from
15
References 312
1. Adakal, H., L. Gavotte, F. Stachurski, M. Konkobo, H. Henri, S. 313 Zoungrana, K. Huber, N. Vachiery, D. Martinez, S. Morand, and R. 314 Frutos. 2010. Clonal origin of emerging populations of Ehrlichia 315 ruminantium in Burkina Faso. Infect. Genet. Evol. 10:903-912. 316
2. Adakal, H., F. Stachurski, M. Konkobo, S. Zoungrana, D. F. Meyer, 317 V. Pinarello, R. Aprelon, I. Marcelino, P. M. Alves, D. Martinez, T. 318 Lefrancois, and N. Vachiery. 2010. Efficiency of inactivated vaccines 319 against heartwater in Burkina Faso: impact of Ehrlichia ruminantium 320 genetic diversity. Vaccine 28:4573-4580. 321
3. Ajayi, S. A., and O. O. Dipeolu. 1986. Prevalence of Anaplasma 322 marginale, Babesia bigemina and B. bovis in Nigerian cattle using 323 serological methods. Vet. Parasitol. 22:147-149. 324
4. Bell-Sakyi, L., E. B. Koney, O. Dogbey, and A. R. Walker. 2004. 325 Incidence and prevalence of tick-borne haemoparasites in domestic 326 ruminants in Ghana. Vet. Parasitol. 124:25-42. 327
5. Casati, S., H. Sager, L. Gern, and J. C. Piffaretti. 2006. Presence of 328 potentially pathogenic Babesia sp. for human in Ixodes ricinus in 329 Switzerland. Ann. Agric. Environ. Med. 13:65-70. 330
6. Clark, K., A. Hendricks, and D. Burge. 2005. Molecular identification 331 and analysis of Borrelia burgdorferi sensu lato in lizards in the 332 southeastern United States. Appl. Environ. Microbiol. 71:2616-2625. 333
7. De Wall, D. T. 2000. Anaplasmosis control and diagnosis in South 334 Africa. Ann N Y Acad Sci 916:474-483. 335
8. Fournier, P. E., B. Xeridat, and D. Raoult. 2003. Isolation of a 336 Rickettsia related to Astrakhan fever Rickettsia from a patient in Chad. 337 Ann. N. Y. Acad. Sci. 990:152-157. 338
9. Gal, A., S. Harrus, I. Arcoh, E. Lavy, I. Aizenberg, Y. Mekuzas-339 Yisaschar, and G. Baneth. 2007. Coinfection with multiple tick-borne 340 and intestinal parasites in a 6-week-old dog. Can. Vet. J. 48:619-622. 341
10. Ishikura, M., S. Ando, Y. Shinagawa, K. Matsuura, S. Hasegawa, T. 342 Nakayama, H. Fujita, and M. Watanabe. 2003. Phylogenetic analysis 343 of spotted fever group rickettsiae based on gltA, 17-kDa, and rOmpA 344 genes amplified by nested PCR from ticks in Japan. Microbiol. Immunol. 345 47:823-832. 346
11. Kamani, J., A. Sannusi, O. K. Egwu, G. I. Dogo, T. J. Tanko, S. 347 Kemza, A. E. Tafarki, and D. S. Gbise. 2010. Prevalence and 348 Significance of Haemoparasitic Infections of Cattle in North- Central, 349 Nigeria. Veterinary World Vol.3:445-448. 350
12. Kamga-Waladjo, A. R., O. B. Gbati, P. Kone, R. A. Lapo, G. 351 Chatagnon, S. N. Bakou, L. J. Pangui, H. Diop Pel, J. A. Akakpo, 352 and D. Tainturier. 2010. Seroprevalence of Neospora caninum 353 antibodies and its consequences for reproductive parameters in dairy 354
on April 21, 2020 by guest
http://aem.asm
.org/D
ownloaded from
16
cows from Dakar-Senegal, West Africa. Trop. Anim. Health Prod. 355 42:953-959. 356
13. Kumar, S., K. Tamura, and M. Nei. 2004. MEGA3: Integrated software 357 for Molecular Evolutionary Genetics Analysis and sequence alignment. 358 Brief. Bioinform. 5:150-163. 359
14. Marconi, R. T., and C. F. Garon. 1992. Development of polymerase 360 chain reaction primer sets for diagnosis of Lyme disease and for 361 species-specific identification of Lyme disease isolates by 16S rRNA 362 signature nucleotide analysis. J. Clin. Microbiol. 30:2830-2834. 363
15. Matsumoto, K., M. Ogawa, P. Brouqui, D. Raoult, and P. Parola. 364 2005. Transmission of Rickettsia massiliae in the tick, Rhipicephalus 365 turanicus. Med. Vet. Entomol. 19:263-270. 366
16. Mediannikov, O., G. Diatta, F. Fenollar, C. Sokhna, J. F. Trape, and 367 D. Raoult. Tick-borne rickettsioses, neglected emerging diseases in 368 rural Senegal. PLoS Negl. Trop. Dis. 4: e821. 369
17. Mediannikov, O., F. Fenollar, C. Socolovschi, G. Diatta, H. Bassene, 370 J. F. Molez, C. Sokhna, J. F. Trape, and D. Raoult. 2010. Coxiella 371 burnetii in humans and ticks in rural Senegal. PLoS Negl. Trop. Dis. 372 4:e654. 373
18. Mtshali, M. S., J. de la Fuente, P. Ruybal, K. M. Kocan, J. Vicente, P. 374 A. Mbati, V. Shkap, E. F. Blouin, N. E. Mohale, T. P. Moloi, A. M. 375 Spickett, and A. A. Latif. 2007. Prevalence and genetic diversity of 376 Anaplasma marginale strains in cattle in South Africa. Zoonoses Public 377 Health 54:23-30. 378
19. Mura, A., C. Socolovschi, J. Ginesta, B. Lafrance, S. Magnan, J. M. 379 Rolain, B. Davoust, D. Raoult, and P. Parola. 2008. Molecular 380 detection of spotted fever group rickettsiae in ticks from Ethiopia and 381 Chad. Trans. R. Soc. Trop. Med. Hyg. 102:945-949. 382
20. Ndi, C., P. H. Bayemi, F. N. Ekue, and B. Tarounga. 1991. Preliminary 383 observations on ticks and tick-borne diseases in the north west province 384 of Cameroon. I. Babesiosis and anaplasmosis. Rev. Elev. Med. Vet. 385 Pays. Trop. 44:263-265. 386
21. Ndip, L. M., E. B. Fokam, D. H. Bouyer, R. N. Ndip, V. P. Titanji, D. H. 387 Walker, and J. W. McBride. 2004. Detection of Rickettsia africae in 388 patients and ticks along the coastal region of Cameroon. Am. J. Trop. 389 Med. Hyg. 71:363-366. 390
22. Ndip, L. M., M. Labruna, R. N. Ndip, D. H. Walker, and J. W. McBride. 391 2009. Molecular and clinical evidence of Ehrlichia chaffeensis infection 392 in Cameroonian patients with undifferentiated febrile illness. Ann. Trop. 393 Med. Parasitol. 103:719-725. 394
23. Ndip, L. M., R. N. Ndip, S. N. Esemu, V. L. Dickmu, E. B. Fokam, D. 395 H. Walker, and J. W. McBride. 2005. Ehrlichial infection in 396 Cameroonian canines by Ehrlichia canis and Ehrlichia ewingii. Vet. 397 Microbiol. 111:59-66. 398
24. Ndip, L. M., R. N. Ndip, S. N. Esemu, D. H. Walker, and J. W. 399 McBride. 2010. Predominance of Ehrlichia chaffeensis in Rhipicephalus 400
on April 21, 2020 by guest
http://aem.asm
.org/D
ownloaded from
17
sanguineus ticks from kennel-confined dogs in Limbe, Cameroon. Exp. 401 Appl. Acarol. 50:163-168. 402
25. Ndip, L. M., R. N. Ndip, V. E. Ndive, J. A. Awuh, D. H. Walker, and J. 403 W. McBride. 2007. Ehrlichia species in Rhipicephalus sanguineus ticks 404 in Cameroon. Vector Borne Zoonotic Dis. 7:221-227. 405
26. Okuthe, O. S., and G. E. Buyu. 2006. Prevalence and incidence of tick-406 borne diseases in smallholder farming systems in the western-Kenya 407 highlands. Vet. Parasitol. 141:307-312. 408
27. Parola, P., H. Inokuma, J. L. Camicas, P. Brouqui, and D. Raoult. 409 2001. Detection and identification of spotted fever group Rickettsiae and 410 Ehrlichiae in African ticks. Emerg. Infect. Dis. 7:1014-1027. 411
28. Rajput, Z. I., S. H. Hu, W. J. Chen, A. G. Arijo, and C. W. Xiao. 2006. 412 Importance of ticks and their chemical and immunological control in 413 livestock. J Zhejiang Univ. Sci. B. 7:912-921. 414
29. Rar, V. A., N. V. Fomenko, A. K. Dobrotvorsky, N. N. Livanova, S. A. 415 Rudakova, E. G. Fedorov, V. B. Astanin, and O. V. Morozova. 2005. 416 Tickborne pathogen detection, Western Siberia, Russia. Emerg. Infect. 417 Dis. 11:1708-1715. 418
30. Reye, A. L., J. M. Hubschen, A. Sausy, and C. P. Muller. 2010. 419 Prevalence and seasonality of tick-borne pathogens in questing Ixodes 420 ricinus ticks from Luxembourg. Appl. Environ. Microbiol. 76:2923-2931. 421
31. Simuunza, M., W. Weir, E. Courcier, A. Tait, and B. Shiels. 2011. 422 Epidemiological analysis of tick-borne diseases in Zambia. Vet. 423 Parasitol. 175:331-342. 424
32. Stachurski, F. 2000. Invasion of West African cattle by the tick 425 Amblyomma variegatum. Med. Vet. Entomol. 14:391-399. 426
33. Suksawat, J., Y. Xuejie, S. I. Hancock, B. C. Hegarty, P. 427 Nilkumhang, and E. B. Breitschwerdt. 2001. Serologic and molecular 428 evidence of coinfection with multiple vector-borne pathogens in dogs 429 from Thailand. J. Vet. Intern. Med. 15:453-462. 430
34. Swanson, S. J., D. Neitzel, K. D. Reed, and E. A. Belongia. 2006. 431 Coinfections acquired from Ixodes ticks. Clin. Microbiol. Rev. 19:708-432 727. 433
35. To, H., N. Kako, G. Q. Zhang, H. Otsuka, M. Ogawa, O. Ochiai, S. V. 434 Nguyen, T. Yamaguchi, H. Fukushi, N. Nagaoka, M. Akiyama, K. 435 Amano, and K. Hirai. 1996. Q fever pneumonia in children in Japan. J. 436 Clin. Microbiol. 34:647-651. 437
36. van Dam, A. P., T. van Gool, J. C. Wetsteyn, and J. Dankert. 1999. 438 Tick-borne relapsing fever imported from West Africa: diagnosis by 439 quantitative buffy coat analysis and in vitro culture of Borrelia 440 crocidurae. J. Clin. Microbiol. 37:2027-2030. 441
37. Vesco, U., N. Knap, M. B. Labruna, T. Avsic-Zupanc, A. Estrada-442 Pena, A. A. Guglielmone, G. H. Bechara, A. Gueye, A. Lakos, A. 443 Grindatto, V. Conte, and D. De Meneghi. 2011. An integrated 444 database on ticks and tick-borne zoonoses in the tropics and subtropics 445
on April 21, 2020 by guest
http://aem.asm
.org/D
ownloaded from
18
with special reference to developing and emerging countries. Exp. Appl. 446 Acarol. 54:65-83. 447
38. Walker, A. R., A. Bouattour, J. L. Camicas, A. Estrada Pena, I. G. 448 Horak, A. A. Latif, P. R.G., and P. M. Preston. 2003. Ticks of domestic 449 animals ticks in Africa: a guide to identification of species. Bioscience 450 reports:1-221. 451
452
on April 21, 2020 by guest
http://aem.asm
.org/D
ownloaded from
19
Figure legend 453
454
Figure 1 455
Neighbour-Joining phylogenetic trees based on (A) a 263 nucleotide (nt) fragment of the 16S 456
rRNA gene of Anaplasmataceae (nt 246466 - 246728 of CP001079.1), (B) a 339 nt fragment 457
of the 17-kDa gene of Rickettsiaceae (nt 1194686 - 1195024 of CP000766.2), (C) a 226 nt 458
fragment of the 18S rRNA gene of Piroplasmidae (nt 656 - 881 of HQ184411.1), (D) a 317 nt 459
fragment of the htpB gene of Coxiella (nt 273435 - 273751 of CP000733.1), (E) a 323 nt 460
fragment of the 16S rRNA gene of Borrelia species (nt 444099 - 443777 of CP002228.1) and 461
(F) a 321 nt fragment of the 16S rRNA gene of Conexibacter woesei (nt 834 - 1151 of 462
NR_028979.1). Nigerian sequences are named with their unique identifier, tick species, 463
geographic location and biological source. Compressed clusters containing sequences from 464
Nigeria are marked with an asterisk. Only bootstrap values above 70 are shown 465
on April 21, 2020 by guest
http://aem.asm
.org/D
ownloaded from
20
TABLE 1. Primers and PCR conditions used for the detection of the five different pathogen groups. PCR protocol: 94°C for 3min; 40 cycles of 466
94°C for 30s, specific annealing conditions for 30s and 72°C for specific elongation time; subsequent incubation at 72°C for 10min. 467
Pathogen Primer
name
Primer
orientation
Target
gene 5’-3’ Sequence Reference
[Primer]
(µM)
[MgCl2]]
(mM)
Annealing
temperature (°C)
Elongation
time (s)
Anaplasmataceae EHR1 forward 16S rRNA GAACGAACGCTGGCGGCAAGC 0.4 2 63 45
newEHR2* reverse 16S rRNA CACGCTTTCGCACCTCAGTGTC
EHR3 forward 16S rRNA TGCRTAGGAATCTRCCTAGTAG 0.8 2 59 45
newEHR2* reverse 16S rRNA CACGCTTTCGCACCTCAGTGTC (29)
Rickettsiaceae Rr17k.1p forward 17-kDa TTTACAAAATTCTAAAAACCAT 0.8 2 55 45
Rr17k.539n reverse 17-kDa TCAATTCACAACTTGCCATT
Rr17k.90p forward 17-kDa GCTCTTGCAACTTCTATGTT 0.8 2 54 45
Rr17k.539n reverse 17-kDa TCAATTCACAACTTGCCATT (10)
Piroplasmidae BJ1 forward 18S rRNA GTCTTGTAATTGGAATGATGG 0.8
3
61
60
BN2 reverse 18S rRNA TAGTTTATGGTTAGGACTACG (5)
Coxiella Q5 forward htpB GCGGGTGATGGTACCACAACA
0.4
1.5
58
30 Q3 reverse htpB GGCAATCACCAATAAGGGCCG
Q6 forward htpB TTGCTGGAATGAACCCCA
0.8
2
56
30 Q4 reverse htpB TCAAGCTCCGCACTCATG (35)
Borrelia species newLDf* forward 16S rRNA GTAAACGATGCACACTTGGTG
0.4
2
61
30 newLDr* reverse 16S rRNA TCCGRCTTATCACCGGCAGTCT (14)
Outer1 forward flaB gene AARGAATTGGCAGTTCAATC
Outer2 reverse flaB gene GCATTTTCWATTTTAGCAAGTGATG 0.8 2 59 30
Inner1 forward flaB gene ACATATTCAGATGCAGACAGAGGTTCTA
Inner2 reverse flaB gene GAAGGTGCTGTAGCAGGTGCTGGCTGT (6) 0.8 2 59 30
* primer sequence modified 468
on April 21, 2020 by guest
http://aem.asm
.org/D
ownloaded from
21
TABLE 2. Origin and number of herds, numbers of cattle and feeding ticks analysed and prevalence of detected pathogens. Asterisks mark total prevalence rates 69
in ticks which differ significantly from those observed in ticks from vegetation (p < 0.05). 70
A. marginale/centrale E. chaffeensis E. ewingii Ehrlichia sp. R. aeschlimannii RAL T. mutans C. burnetii
Herd Ticks (T/C)
Cattle Inf. ticks (%)
Pot. Inf. cattle
(%)
Inf. ticks (%)
Pot. Inf. cattle
(%)
Inf. ticks (%)
Pot. Inf. cattle
(%)
Inf. ticks (%)
Pot. Inf. cattle
(%)
Inf. ticks (%)
Pot. Inf. cattle
(%)
Inf. ticks (%)
Pot. Inf. cattle
(%)
Inf. ticks (%)
Pot. Inf. cattle
(%)
Inf. ticks (%)
PoInf. c
(%
Alakia 9
(1-2) 8
1 (11.1)
1 (12.5)
- - 1
(11.1) 1
(12.5) 1
(11.1) 1
(12.5) - -
3 (33.3)
3 (37.5)
- - 2
(22.2) 2
(25
Aleshinloye 1
(1) 1 - - - - - - - -
1 (100)
1 (100)
- - - - - -
Bodija 1 9
(1-2) 7 - - - - - -
1 (11.1)
1 (14.3)
- - - - - - - -
Bodija 2 20
(3-6) 4 - - - - - - - - - -
1 (5)
1 (25)
- - 1
(5) 1
(25
Bodija 3 2
(1) 2 - - - - - - - -
1 (50)
1 (50)
1 (50)
1 (50)
- - 1
(50) 1
(50
Moniya 1 20
(1-3) 13
1 (5)
1 (7.7)
- - - - 1
(5) 1
(7.7) 1
(5) 1
(7.7) 2
(10) 2
(15.4) - -
1 (5)
1(7.
Moniya 2 20
(1-3) 13
1 (5)
1 (7.7)
- - - - - - - - 4
(20) 3
(23.1) - -
3 (15)
2(15
Moniya 3 45
(1-7) 11
4 (8.9)
2 (18.2)
1 (2.2)
1 (9.1)
- - 1
(2.2) 1
(9.1) - -
2 (4.4)
2 (18.2)
4 (8.9)
3 (27.3)
8 (17.8)
8(72
Moniya 4 2
(2) 1 - - - - - - - - - - - - - - - -
Moniya 5 2
(2) 1 - - - - - - - - - - - - - - - -
Moniya 6 6
(3) 2
1 (16.7)
1 (50)
- - - - 1
(16.7) 1
(50) - -
1 (16.7)
1 (50)
- - 3
(50) 2
(10
Total 136
(1-7) 63
8 (5.9)*
6 (9.5)
1 (0.7)
1 (1.6)
1 (0.7)
1 (1.6)
5 (3.7)*
5 (7.9)
3 (2.2)*
3 (4.8)
14 (10.3)*
13 (20.6)
4 (2.9)*
3 (4.8)
19 (14)*
17(27
T/C, Range of numbers of ticks per cow; A., Anaplasma; E., Ehrlichia; R., Rickettsia; RAL, Rickettsia africae-like species; T, Theileria; C, Coxiella; Inf., 71
Infected; Pot., Potentially; -, not detected (0%).72
on April 21, 2020 by guest
http://aem.asm
.org/D
ownloaded from
22
TABLE 3. Names of locations, numbers of questing ticks analysed and prevalence of detected pathogens. Asterisks mark total prevalence rates in ticks which 73
differ significantly from those observed in ticks from cattle (p < 0.05). 74
Location Ticks alpha proteobacterium
(%) R. massiliae
(%) RRG (%)
Borrelia sp. (%)
unknown bacterium (%)
C. burnetii (%)
Alowo-nle 100 -
4 (4)
- - - -
Igbo Ora 100 -
2 (2)
- - - -
Fuleni 100 -
1 (1)
- - - -
Maya 100 - 2
(2) -
3 (3)
2 (2)
-
Lanlate 100 2
(2) 8
(8) - -
4 (4)
-
Elepo 100 - 2
(2) 1
(1) - - -
Orisunbare 100 - 2
(2) - -
3 (3)
1 (1)
Total 700 2
(0.3) 21
(3)* 1
(0.1) 3
(0.4) 9
(1.3) 1
(0.1)*
R., Rickettsia; RRG, Rickettsia rickettsii group; C, Coxiella; -, not detected (0%). 75
76
TABLE 4. Mixed infections in ticks feeding on cattle and pathogen species involved. Ticks from the vegetation were not found to harbour multiple pathogens. 77
Pathogen species involved in mixed infections Ticks feeding on cattle
(%) Potentially infected cattle
(%) RAL C. burnetii 4 (2.9) 4 (6.3)
A. marginale/centrale T. mutans 2 (1.5) 2 (3.2) A. marginale/centrale T. mutans C. burnetii 1 (0.7) 1 (1.6)
E. chaffeensis C. burnetii 1 (0.7) 1 (1.6) Ehrlichia sp. C. burnetii 1 (0.7) 1 (1.6) Ehrlichia sp. RAL 1 (0.7) 1 (1.6) Ehrlichia sp. RAL C. burnetii 1 (0.7) 1 (1.6)
A., Anaplasma; E., Ehrlichia; RAL, Rickettsia africae-like species; T, Theileria; C, Coxiella. 78
on April 21, 2020 by guest
http://aem.asm
.org/D
ownloaded from