+ All Categories
Home > Documents > PCR is another in vitro DNA synthesis reaction The twist in this case is that the reaction is...

PCR is another in vitro DNA synthesis reaction The twist in this case is that the reaction is...

Date post: 17-Apr-2015
Category:

Documents
Upload: internet
View: 106 times
Download: 1 times
Download Report this document
Share this document with a friend
Popular Tags:
seqnciamento slide
amplified slide
maring slide
informao slide
capilares slide
cycles of pcr slide
automated sequencer
seqenciador automtico
36
Transcript
Page 1: PCR is another in vitro DNA synthesis reaction The twist in this case is that the reaction is repeated 25-30 times so that the DNA between the primers.
Page 2: PCR is another in vitro DNA synthesis reaction The twist in this case is that the reaction is repeated 25-30 times so that the DNA between the primers.

PCR is another in vitro DNA synthesis reactionThe twist in this case is that the reaction is repeated 25-30 times so that the DNA between

the primers is amplified

Page 3: PCR is another in vitro DNA synthesis reaction The twist in this case is that the reaction is repeated 25-30 times so that the DNA between the primers.

The first PCR cycle:The sequence between the two primers will be

amplified

Page 4: PCR is another in vitro DNA synthesis reaction The twist in this case is that the reaction is repeated 25-30 times so that the DNA between the primers.

Four cycles of PCR

Page 5: PCR is another in vitro DNA synthesis reaction The twist in this case is that the reaction is repeated 25-30 times so that the DNA between the primers.

Copy number of the sequence between the primers increases exponentially

Page 6: PCR is another in vitro DNA synthesis reaction The twist in this case is that the reaction is repeated 25-30 times so that the DNA between the primers.

SEQUENCIAMENTO DE DNA

Profa. Dra. Maria Aparecida Fernandez

Depto de Biologia Celular e Genética

Universidade Estadual de Maringá

Page 7: PCR is another in vitro DNA synthesis reaction The twist in this case is that the reaction is repeated 25-30 times so that the DNA between the primers.

Structure of dideoxynucleotide triphosphates

Page 8: PCR is another in vitro DNA synthesis reaction The twist in this case is that the reaction is repeated 25-30 times so that the DNA between the primers.

Dideoxy DNA sequencing is an in vitro DNA synthesis reaction with a twist

DNAP requires a template and a primer

The [ddNTP] determines the distribution of chain lengths produced.

The primer is labeled so the DNA fragments synthesized can be detected by autoradiography.

Page 9: PCR is another in vitro DNA synthesis reaction The twist in this case is that the reaction is repeated 25-30 times so that the DNA between the primers.
Page 10: PCR is another in vitro DNA synthesis reaction The twist in this case is that the reaction is repeated 25-30 times so that the DNA between the primers.

TGGCTCGGCCTCAAGTCGAGGTTATCAGATCTGCAACTCAA

Alto peso molecular

Baixo peso molecular

Filme de raio X

Auto-radiograma

Leitura manual

Page 11: PCR is another in vitro DNA synthesis reaction The twist in this case is that the reaction is repeated 25-30 times so that the DNA between the primers.

Automated DNA Sequencing

Page 12: PCR is another in vitro DNA synthesis reaction The twist in this case is that the reaction is repeated 25-30 times so that the DNA between the primers.

Reação de seqüênciamentoReação de seqüênciamento

Page 13: PCR is another in vitro DNA synthesis reaction The twist in this case is that the reaction is repeated 25-30 times so that the DNA between the primers.

Fragmentos amplificados na reação de seqüênciamentoFragmentos amplificados na reação de seqüênciamento

Page 14: PCR is another in vitro DNA synthesis reaction The twist in this case is that the reaction is repeated 25-30 times so that the DNA between the primers.

Typical output of an automated sequencer

Page 15: PCR is another in vitro DNA synthesis reaction The twist in this case is that the reaction is repeated 25-30 times so that the DNA between the primers.

Eletroforese no seqüênciamentoEletroforese no seqüênciamento

Page 16: PCR is another in vitro DNA synthesis reaction The twist in this case is that the reaction is repeated 25-30 times so that the DNA between the primers.
Page 17: PCR is another in vitro DNA synthesis reaction The twist in this case is that the reaction is repeated 25-30 times so that the DNA between the primers.

Captura do fluorescente e processamento da informaçãoCaptura do fluorescente e processamento da informação

Page 18: PCR is another in vitro DNA synthesis reaction The twist in this case is that the reaction is repeated 25-30 times so that the DNA between the primers.
Page 19: PCR is another in vitro DNA synthesis reaction The twist in this case is that the reaction is repeated 25-30 times so that the DNA between the primers.
Page 20: PCR is another in vitro DNA synthesis reaction The twist in this case is that the reaction is repeated 25-30 times so that the DNA between the primers.

Seqüenciador automáticoSeqüenciador automático

Page 21: PCR is another in vitro DNA synthesis reaction The twist in this case is that the reaction is repeated 25-30 times so that the DNA between the primers.
Page 22: PCR is another in vitro DNA synthesis reaction The twist in this case is that the reaction is repeated 25-30 times so that the DNA between the primers.
Page 23: PCR is another in vitro DNA synthesis reaction The twist in this case is that the reaction is repeated 25-30 times so that the DNA between the primers.
Page 24: PCR is another in vitro DNA synthesis reaction The twist in this case is that the reaction is repeated 25-30 times so that the DNA between the primers.
Page 25: PCR is another in vitro DNA synthesis reaction The twist in this case is that the reaction is repeated 25-30 times so that the DNA between the primers.
Page 26: PCR is another in vitro DNA synthesis reaction The twist in this case is that the reaction is repeated 25-30 times so that the DNA between the primers.
Page 27: PCR is another in vitro DNA synthesis reaction The twist in this case is that the reaction is repeated 25-30 times so that the DNA between the primers.
Page 28: PCR is another in vitro DNA synthesis reaction The twist in this case is that the reaction is repeated 25-30 times so that the DNA between the primers.
Page 29: PCR is another in vitro DNA synthesis reaction The twist in this case is that the reaction is repeated 25-30 times so that the DNA between the primers.

Conjunto

de

16 capilares

Page 30: PCR is another in vitro DNA synthesis reaction The twist in this case is that the reaction is repeated 25-30 times so that the DNA between the primers.
Page 31: PCR is another in vitro DNA synthesis reaction The twist in this case is that the reaction is repeated 25-30 times so that the DNA between the primers.
Page 32: PCR is another in vitro DNA synthesis reaction The twist in this case is that the reaction is repeated 25-30 times so that the DNA between the primers.
Page 33: PCR is another in vitro DNA synthesis reaction The twist in this case is that the reaction is repeated 25-30 times so that the DNA between the primers.
Page 34: PCR is another in vitro DNA synthesis reaction The twist in this case is that the reaction is repeated 25-30 times so that the DNA between the primers.

Panorama no momento da corrida

Page 35: PCR is another in vitro DNA synthesis reaction The twist in this case is that the reaction is repeated 25-30 times so that the DNA between the primers.

Análise preliminar pós corrida

Page 36: PCR is another in vitro DNA synthesis reaction The twist in this case is that the reaction is repeated 25-30 times so that the DNA between the primers.

ELETROFEROGRAMAS


Recommended
Implikasi REPLIKASI DNA DAN PCR (Polymerase Chain Reaction)

Implikasi REPLIKASI DNA DAN PCR (Polymerase Chain Reaction)

Documents

Thermus DNA and reaction-amplified · PDF filedirect sequencingofpolymerasechain reaction-amplified DNA ... tion of DNAby the polymerase chain reaction (PCR) (9). Withthismethod,segmentsofsingle-copygenomicDNAcan

Thermus DNA and reaction-amplified · PDF filedirect sequencingofpolymerasechain reaction-amplified DNA ... tion of DNAby the polymerase chain reaction (PCR) (9). Withthismethod,segmentsofsingle-copygenomicDNAcan

Documents

Polymerase Chain Reaction (PCR). Tópicos 1. DNA 2. PCR –Alvos –Denaturação –Primers –Anelamento –Ciclos –Requerimentos.

Polymerase Chain Reaction (PCR). Tópicos 1. DNA 2. PCR –Alvos –Denaturação –Primers –Anelamento –Ciclos –Requerimentos.

Documents

DNA Replication Lecture - WordPress.com...DNA Replication D. DNA Primers DNA polymerases cannot initiate synthesis of a polynucleotide because they can only add nucleotides to the

DNA Replication Lecture - WordPress.com...DNA Replication D. DNA Primers DNA polymerases cannot initiate synthesis of a polynucleotide because they can only add nucleotides to the

Documents

DNA Synthesis 3' 5' SSB 5' Leading Strand 5' DNA Pol I 3' DNA Ligase Lagging Strand Helicase Gyrase 3' 5' DNA Pol III Primase RNA primers DNA template.

DNA Synthesis 3' 5' SSB 5' Leading Strand 5' DNA Pol I 3' DNA Ligase Lagging Strand Helicase Gyrase 3' 5' DNA Pol III Primase RNA primers DNA template.

Documents

Amplifying DNA with Arbitrary Ollgonucleotide Primers

Amplifying DNA with Arbitrary Ollgonucleotide Primers

Documents

Testing “technologies”...Bst DNA polymerase, 5´ → 3´ polymerase and strand-displacement activity Amplifies by “unzipping” DNA. Complementary sequences on primers form a

Testing “technologies”...Bst DNA polymerase, 5´ → 3´ polymerase and strand-displacement activity Amplifies by “unzipping” DNA. Complementary sequences on primers form a

Documents

Modeling DNA Amplification by Polymerase Chain Reaction (PCR)

Modeling DNA Amplification by Polymerase Chain Reaction (PCR)

Education

General-use polymerase chain reaction primers for ...web.stanford.edu/group/Palumbi/manuscripts/General... · species, these primers are an easy starting point for cloning amplified

General-use polymerase chain reaction primers for ...web.stanford.edu/group/Palumbi/manuscripts/General... · species, these primers are an easy starting point for cloning amplified

Documents

Title High-coverage ITS primers for the DNA-based ... · High-Coverage ITS Primers for the DNA-Based Identification of Ascomycetes and Basidiomycetes in Environmental Samples Hirokazu

Title High-coverage ITS primers for the DNA-based ... · High-Coverage ITS Primers for the DNA-Based Identification of Ascomycetes and Basidiomycetes in Environmental Samples Hirokazu

Documents

Recombinant DNA and Polymerase Chain Reaction

Recombinant DNA and Polymerase Chain Reaction

Documents

Reaction of Single-Stranded DNA with Hydroxyl Radical ...

Reaction of Single-Stranded DNA with Hydroxyl Radical ...

Documents

LUX Fluorogenic Primers - Thermo Fisher Scientifictools.thermofisher.com/content/sfs/manuals/luxprimers_man.pdf · LUX ™ Primers from a target DNA sequence using Web- or desktop-based

LUX Fluorogenic Primers - Thermo Fisher Scientifictools.thermofisher.com/content/sfs/manuals/luxprimers_man.pdf · LUX ™ Primers from a target DNA sequence using Web- or desktop-based

Documents

Polymerase Chain Reaction - uvm.edubiology/Classes/296D/4_PCR.pdf · PCR 1. Separate the Double Helix 2. Bind primers (2) to sequence you want to replicate 3. DNA Polymerase copies

Polymerase Chain Reaction - uvm.edubiology/Classes/296D/4_PCR.pdf · PCR 1. Separate the Double Helix 2. Bind primers (2) to sequence you want to replicate 3. DNA Polymerase copies

Documents

DNA Technology. Techniques in DNA technology Restriction enzymes Gel electrophoresis PCR polymerase chain reaction Recombinant DNA.

DNA Technology. Techniques in DNA technology Restriction enzymes Gel electrophoresis PCR polymerase chain reaction Recombinant DNA.

Documents

Deep-sea vent phage DNA polymerase specifically initiates ... · Deep-sea vent phage DNA polymerase specifically initiates DNA synthesis in the absence of primers Bin Zhua,1, Longfei

Deep-sea vent phage DNA polymerase specifically initiates ... · Deep-sea vent phage DNA polymerase specifically initiates DNA synthesis in the absence of primers Bin Zhua,1, Longfei

Documents

Polymerase chain reaction AMPLIFYING DNA

Polymerase chain reaction AMPLIFYING DNA

Documents

Home Page: Soybean Genomics and Improvement Laboratory ... · SSR loci (Table 1). Reaction mixes contained 30 ng of soybean genomic DNA, 1mM of Mg , 0.15 PIM of 3' and 5' end primers,

Home Page: Soybean Genomics and Improvement Laboratory ... · SSR loci (Table 1). Reaction mixes contained 30 ng of soybean genomic DNA, 1mM of Mg , 0.15 PIM of 3' and 5' end primers,

Documents