+ All Categories
Home > Documents > PCR The polymerase chain reaction. Crick and Watson – structure of DNA.

PCR The polymerase chain reaction. Crick and Watson – structure of DNA.

Date post: 08-Jan-2018
Category:
Upload: kerrie-sullivan
View: 217 times
Download: 1 times
Share this document with a friend
Description:
A double helix with two antiparallel strands
24
PCR The polymerase chain reaction
Transcript
Page 1: PCR The polymerase chain reaction. Crick and Watson – structure of DNA.

PCR

The polymerase chain reaction

Page 2: PCR The polymerase chain reaction. Crick and Watson – structure of DNA.

Crick and Watson – structure of DNA

Page 3: PCR The polymerase chain reaction. Crick and Watson – structure of DNA.

A double helix with two antiparallel strands

Page 4: PCR The polymerase chain reaction. Crick and Watson – structure of DNA.

“It has not escaped our notice that the specific pairing we have postulated immediately suggests a copying mechanism for the genetic material.”

Page 5: PCR The polymerase chain reaction. Crick and Watson – structure of DNA.

Ends5’ end

3’end

3’ end

5’ end

Page 6: PCR The polymerase chain reaction. Crick and Watson – structure of DNA.
Page 7: PCR The polymerase chain reaction. Crick and Watson – structure of DNA.
Page 8: PCR The polymerase chain reaction. Crick and Watson – structure of DNA.
Page 9: PCR The polymerase chain reaction. Crick and Watson – structure of DNA.

My gene:

5’TCACGACGTTGTAAAACGACGTCTATACCGAGCTCCTCTCTCTCTCATAGCTGTTTCCTGTGTGAA3’

I design custom oligonucleotides to the “sense” strand at the beginning and the “antisense” at the end

Sense 5’TCACGACGTTGTAAAACGACGTCTATACCGAGCTCCTCTCTCTCTCATAGCTGTTTCCTGTGTGAA3’

Anti 3’AGTGCTGCAACATTTTGCTGCAGATATGGCTCGAGGAGAGAGAGAGTATCGACAAAGGACACACTT5’

“forward primer”5’TCACGACGTTGTAAAACGACG3’

“reverse primer”3’GTATCGACAAAGGACACACTT5’

Page 10: PCR The polymerase chain reaction. Crick and Watson – structure of DNA.
Page 11: PCR The polymerase chain reaction. Crick and Watson – structure of DNA.
Page 12: PCR The polymerase chain reaction. Crick and Watson – structure of DNA.
Page 13: PCR The polymerase chain reaction. Crick and Watson – structure of DNA.

http://www.people.virginia.edu/~rjh9u/pcranim.html

Page 14: PCR The polymerase chain reaction. Crick and Watson – structure of DNA.
Page 15: PCR The polymerase chain reaction. Crick and Watson – structure of DNA.
Page 16: PCR The polymerase chain reaction. Crick and Watson – structure of DNA.

DNA hybridization rate is altered by changing

Temperature: template dependent

Salt Concentration: can be standardized

DNA concentration: can be standardized

Time: can be standardized

Page 17: PCR The polymerase chain reaction. Crick and Watson – structure of DNA.

Thermal cyclerPeltier effectheating / coolingblock

Heated lid(preventsevaporationproblems)

96 well plateformat Microprocessor controlled

thermal program

Page 18: PCR The polymerase chain reaction. Crick and Watson – structure of DNA.
Page 19: PCR The polymerase chain reaction. Crick and Watson – structure of DNA.
Page 20: PCR The polymerase chain reaction. Crick and Watson – structure of DNA.
Page 21: PCR The polymerase chain reaction. Crick and Watson – structure of DNA.
Page 22: PCR The polymerase chain reaction. Crick and Watson – structure of DNA.

Real-time PCR

Quantitative

Fast

High sample processing speed

Very sensitive

Page 23: PCR The polymerase chain reaction. Crick and Watson – structure of DNA.
Page 24: PCR The polymerase chain reaction. Crick and Watson – structure of DNA.

Parasitic Worm Inoculation Levels

Violet = 200 worms per root

Red = 50 worms per root

Blue = 20 worms per root


Recommended