DEPARTMENT OFDEPARTMENT OFDEPARTMENT OFDEPARTMENT OF
PRIMARY INDUSTRIESPRIMARY INDUSTRIESPRIMARY INDUSTRIESPRIMARY INDUSTRIES
Pea leafminerPea leafminerPea leafminerPea leafminerLiriomyza huidobrensisLiriomyza huidobrensisLiriomyza huidobrensisLiriomyza huidobrensis (Blanchard) (Blanchard) (Blanchard) (Blanchard)
Liriomyza huidobrensis Draft Diagnostic Recommendations and Literature Review
2
Liriomyza huidobrensis Liriomyza huidobrensis Liriomyza huidobrensis Liriomyza huidobrensis (Blanchard)(Blanchard)(Blanchard)(Blanchard)
Bonny Rowles-van Rijswijk
Dr Mali Malipatil
Department of Primary Industries, Knoxfield
Private Bag 15
Ferntree Gully Delivery Centre
Victoria 3156
Australia
Published by Primary Industries Research Victoria
Department of Primary Industries
Knoxfield
June 2005
© Copyright State of Victoria 2005© Copyright State of Victoria 2005© Copyright State of Victoria 2005© Copyright State of Victoria 2005
Liriomyza huidobrensis Draft Diagnostic Recommendations and Literature Review
3
This publication is copyright. No part may be reproduced by any process except in
accordance with the provisions of the Copyright Act 1968.
Authorised by the Victorian Government, 1 Treasury Place, East Melbourne.Authorised by the Victorian Government, 1 Treasury Place, East Melbourne.Authorised by the Victorian Government, 1 Treasury Place, East Melbourne.Authorised by the Victorian Government, 1 Treasury Place, East Melbourne.
ISBN XXXXXXXISBN XXXXXXXISBN XXXXXXXISBN XXXXXXX
This publication may be of assistance to you but the State of Victoria and its
employees do not guarantee that the publication is without flaw of any kind or is
wholly appropriate for your particular purposes and therefore disclaims all liability
for any error, loss or other consequence which may arise from you relying on any
information in this publication.
For more information about DPI visit the website at www.dpi.vic.gov.au
or call the Customer Service Centre on 136 186.
Liriomyza huidobrensis Draft Diagnostic Recommendations and Literature Review
4
Table of Contents
1. Leafminer; Liriomyza huidobrensis (Blanchard) __________________5
2. Distribution ________________________________________________6
3. Host Range and Feeding Damage ______________________________8
4. Life cycle _________________________________________________10
5. Control ___________________________________________________14
6. Threat to Australia _________________________________________14
7. Visual Identification ________________________________________16
8. Identification through Protein Electrophoresis __________________18
9. Molecular techniques used to distinguish Liriomyza _____________20
References _________________________________________________21
Related Articles______________________________________________23
Appendix 1. Plant hosts of Liriomyza huidobrensis.________________24
Appendix 2. A taxonomic description of Liriomyza huidobrensis, as
provided by Shiao & Wu (2000): ________________________________25
Appendix 3. An assay to separate the three leafminer species L.
huidobrensis, L. bryoniae and L. strigata, by means of protein
electrophoresis (Collins, 1996)._________________________________26
Liriomyza huidobrensis Draft Diagnostic Recommendations and Literature Review
5
Liriomyza huidobrensis (Blanchard) Literature Review
1. Liriomyza huidobrensis (Blanchard)
The larvae of several families of flies and moths, that mine leaves of
horticultural crops (fig. 1), are collectively known as leafminers. The most
common and damaging species are small flies from the family Agromyzidae,
especially the Liriomyza species (WA, 2003).
Figure 1. Leafminer mines on a spinach leaf, making the produce unsaleable(© Ohio Sate University).
The pea leafminer, Liriomyza huidobrensis (Blanchard), was described
originally as Agromyza huidobrensis from South America (Blanchard, 1926).
Since that time, L. huidobrensis has undergone numerous name changes due
to changes in taxonomy;
L. cucumifoliae Blanchard
Agromyza huidobrensis Blanchard
L. dianthi Frick
L. langei Frick (WA, 2003).
This species has been further separated using molecular techniques, after it
was noted that populations of L. huidobrensis in different areas appeared to
prefer different plant hosts and exhibited varying levels of insecticide
Liriomyza huidobrensis Draft Diagnostic Recommendations and Literature Review
6
resistance. Flies from California and Hawaii formed one clade, whilst
specimens from South and Central America formed another clade (Scheffer,
2000; Scheffer & Lewis, 2001).
Subsequently, the name L. huidobrensis (Blanchard) became restricted to flies
belonging to the South American clade, which includes all L. huidobrensis in
Central and South America and all introduced populations of L. huidobrensis.
The name L. langei Frick has been resurrected for the Californian clade of L.
huidobrensis-like flies found in California and Hawaii. It is estimated that the
South American and Californian clades diverged approximately 2 million years
ago. Although the two species have been separated using DNA sequence
data, they unfortunately can not be separated morphologically (Scheffer, 2000;
Scheffer & Lewis, 2001).
L. huidobrensis, in South and Central America, was under natural biological
control until it was secondarily subjected to massive amounts of insecticides
in the 1970s directed at a lepidopterean pest in potatoes (Chavez and Raman,
1987). This exposure to insecticides bred resistance, causing the leafminer to
develop into an economically important pest. At present, the only effective
insecticides are translaminar insecticides (abamectin, cyromazine, neem and
spinosad), which penetrate the leaves to affect the leafminer larvae
(Weintraub, 2002).
2. Distribution
Although endemic to South and Central America, L. huidobrensis was only
considered a minor pest. In the coastal areas of Peru it was generally kept in
check by a large complex of hymenopteran parasitoids. However, since the
early 1980s there has been a dramatic increase in damage to vegetables,
especially potatoes, due to over-use of insecticides, leading to the
development of insecticide-resist leafminers, and the elimination of it’s natural
enemies (Shephard et al., 1998).
During the past decade (1990-2000), L. huidobrensis has become globally
invasive and can now be found in many greenhouses and vegetable and flower
Liriomyza huidobrensis Draft Diagnostic Recommendations and Literature Review
7
growing areas of Europe, Asia, Africa, and the Middle East (Scheffer & Lewis,
2001).
Insecticide-resistant L. huidobrensis was first detected in Europe in 1987 on
glasshouse- lettuces, grown in the Netherlands. The EPPO presumed that the
leafminer was imported directly from South America. Within the EPPO region
it has spread to Austria, Belgium, Cyprus, Czech Republic (Vlk, 1999), France,
Israel, Italy (including Sicily), Malta, Netherlands, Portugal, Spain (including
Canary Islands), and the UK (England, Northern Ireland, Scotland). L.
huidobrensis has been intercepted, or has occurred and been eradicated, in
Denmark, Finland, Germany, Ireland and Sweden. The leafminer remains
absent from a significant number of countries in Central and Eastern Europe
(Source:
http://www.eppo.org/QUARANTINE/insects/Liriomyza_huidobrensis/LIRIHU_ds.
pdf).
Subsequent to the leafminers’ spread throughout Europe, it was introduced
into Israel. The first outbreak in Israel occurred in February 1992 in the Jordan
Valley, when chrysanthemum growers encountered a leafminer that could not
be chemically controlled. It is thought that L. huidobrensis had probably
entered Israel 1-2 years prior to this sighting (Weintraub and Horowitz, 1995).
L. huidobrensis has been reported in Asia, within India, Thailand (Source:
http://www.eppo.org/QUARANTINE/insects/Liriomyza_huidobrensis/LIRIHU_ds.
pdf), China (He et al., 2002), Taiwan (Shiao & Wu, 2000), and Indonesia
(Shephard et al., 1998).
The pea leafminer was first found in Taiwan in 1999, most likely on smuggled
in on plant material or entered due quarantine failure. It is now a widespread
and dominant pest species on some vegetable crops (Cucurbitaceae, legumes
and composites) (Shiao & Wu, 2000). Shortly thereafter, there were outbreaks
of L. huidobrensis in China, which were proven to originate from the South
American clade after phylogenetic analysis (sequenced mitochondrial
cytochrome oxidase II gene) (He et al., 2002).
The greatest threat to the Australian potato industry comes from Indonesia. L.
huidobrensis was first reported in potatoes, in Java, in 1994. Since then L.
huidobrensis has rapidly spread and can be found on many vegetable and
Liriomyza huidobrensis Draft Diagnostic Recommendations and Literature Review
8
ornamental crops in Java, Sumatra and Sulawesi. It has become widely
established on both cultivated and weed hosts. L. huidobrensis is thought to
have been introduced into Indonesia on cut flowers from Europe or North
America (Shephard et al., 1998).
L. huidobrensis has established because cooler temperatures, such as in the
highland vegetable production areas of Indonesia, favour feeding and
oviposition. Severe damage occurs on potato, shallots, tomato, beans, and
other crops, ornamentals and weeds at high elevations in Sumatra and Java
(Shephard et al., 1998). It should be noted “that potato was especially
susceptible to attack by L. huidobrensis, and severely damaged fields were
common. On occasion estimated yield losses were 75%. Farmers mentioned
that no pesticide was effective against the leafminer in potato, and some
growers were abandoning potato cultivation in favour of sweet potato. In the
Alahan Panjang area of West Sumatra, it was estimated that about 40% of the
usual potato-growing area was now planted to other crops due to devastating
attacks by L. huidobrensis” (Shephard et al., 1998).
3. Host Range and Feeding Damage
L. huidobrensis, along with two other leafminers of economic importance, L.
sativae and L. trifolii, is on the EPPO A1/A2 quarantine list (Shiao, 2004), in part
due to the breadth of its plant host range. Unlike most species of
Agromyzidae, L. huidobrensis is highly polyphagous, with 14 plant families
recorded as hosts. This leafminer has no clear preference for any particular
family; hosts include numerous vegetable and flower crops (appendix 1)
(Scheffer & Lewis, 2001; WA, 2003).
The larvae of L. huidobrensis tunnel in the chloroplast-containing spongy
mesophyll layers, disrupting photosynthesis (Shephard et al., 1998). The
larvae leave winding trails (mines) as they feed inside leaves and other plant
parts. The mines are easily visible (fig. 1-4), and when the larvae are in large
numbers this feeding damage can cause substantial economic losses (Arnold,
2002).
Liriomyza huidobrensis Draft Diagnostic Recommendations and Literature Review
9
Figure 2. Damage to celery typical of Liriomyza huidobrensis(Source: Ministry of Agriculture and Food Ontario, Canada. © Queen's Printer for
Ontario).
Figure 3. Mines on snap-beans caused by feeding larvae(© J. Lotz, Division of Plant Industry University of Florida).
Figure 4. Mines on potato caused by feeding larvae (© REDEPAPA-CORPOICA).
The typical feeding habits and symptoms of adult and larval leafminers are
listed below (WA, 2003):
• Adult leafminer feeding punctures appear as white speckles 0.13-0.15 mm
in diameter,
• Oviposition punctures are smaller (0.05 mm diameter), more uniformly
round, and difficult to detect with the naked eye,
Liriomyza huidobrensis Draft Diagnostic Recommendations and Literature Review
10
• The larvae feed primarily within the leaf tissues, with the exception of peas,
where larvae may also feed on the outer surface of young seed-pods,
• Larval mines are usually white with dampened black and dried brown areas,
and are commonly associated with the midrib and lateral leaf veins,
• Mines are serpentine, tightly coiled and of irregular shape, increasing in
width as larvae mature,
• If several larvae are feeding on a single leaf, the damage may produce a
secondary ‘blotch’ mine type and leaf wilt may occur.
Symptoms produced specifically in potato are listed below:
• ‘Feeding punctures can often be seen all over the growing plant, giving the
impression that a generalised outbreak of larval infestation is in process,
• The development of the larval damage follows a fixed pattern, somewhat
different from that of the adult fly population,
• Firstly, the initial larval infestation and corresponding damage occur in the
lower third of the plant, moving upwards to the top of the plant. At this time,
practically the whole aboveground part of the plant becomes necrotic and
dies,
• Larval damage is consistently less severe during vegetative growth stages
than when the plant the plant is full-grown, which may be explained by the
occurrence of egg extrusion in the growing leaves’ (WA, 2003).
4. Life cycle
Female L. huidobrensis puncture leaves to lay eggs within the leaf tissue, and
feed on plant sap. Eggs are inserted just below the leaf surface (fig. 5), and the
number of eggs laid varies according to temperature and plant host; eggs are
0.2-0.3 mm x 0.10-0.15 mm, off-white in colour, and slightly translucent. It
should be noted that approximately 15% of the punctures made by L. trifolii
and L. sativae (two very closely related leafminer species) contain viable eggs
(WA, 2003).
Liriomyza huidobrensis Draft Diagnostic Recommendations and Literature Review
11
Figure 5. L. huidobrensis egg excised from under plant leaf surface(©UC Statewide IPM Project Jack Kelly Clark)
Feeding punctures cause the destruction of a large number of cells and are
more clearly visible to the naked eye than punctures caused by oviposition
(fig. 6). Male L. huidobrensis are unable to puncture leaves, but have been
observed feeding at punctures produced by females. Both male and female
leafminers take nectar from flowers (WA, 2003).
Figure 6. Feeding and oviposition punctures on cauliflower leaves by the pealeafminer, Liriomyza huidobrensis (© J. Lotz, Division of Plant Industry University of
Florida).
Eggs hatch in 2-5 days, according to temperature, producing larva that are tiny
cream or pale yellow maggots about 2 mm long. The headless maggots grow
up to 3.25 mm in length (fig. 7). The first-instar are colourless on hatching,
turning pale yellow-orange, with later instars being yellow-orange in colour.
The posterior spiracle (respiratory aperture) forms a crescent with 6 to 9
mounted spores (WA, 2003).
Liriomyza huidobrensis Draft Diagnostic Recommendations and Literature Review
12
Figure 7. Leafminer larva excised from mine (© UC Statewide IPM Project Jack KellyClark).
Larval development is generally 4-7 days at mean temperatures above 24oC,
however, at higher temperatures larval development can be stunted, as shown
in California, when reductions in population levels of L. huidobrensis were
seen once daily maximum temperatures reached 40oC (WA, 2003).
L. huidobrensis pupates within the leaf, whereas other species of leafminer
usually pupate externally either on the foliage or in the soil just beneath the
surface. High humidity and drought adversely affect pupation. The pupa is
oval, slightly flattened ventrally (ventral - abdominal segment of an insect), 1.3-
2.3 x 0.5-0.75 mm, and variable colour. The pupae can look like shiny tan or
brown grains of rice (fig. 8). Adult leafminers (fig. 9) emerge 7-14 days after
pupation when the temperature is 20-30oC; at lower temperatures emergence is
delayed (WA, 2003).
Figure 8. Leafminer pupa (© UC Statewide IPM Project Jack Kelly Clark).
Liriomyza huidobrensis Draft Diagnostic Recommendations and Literature Review
13
Figure 9. Adult Liriomyza huidobrensis (© UC Statewide IPM Project Jack Kelly Clark).
Peak emergence of adults occurs before midday, with male leafminers usually
emerging before females. Mating takes place 24 hours after emergence, and a
single mating is sufficient to fertilise all eggs laid (WA, 2003).
The adults generally live for 15-30 days, with females living longer than males.
The adult is small, greyish-black, compact-bodied, 1.3-2.3 mm in both body
length and wing length. Female adults are slightly larger than males. In
general, any agromyzid of this size with a bright-yellow central area of the
scutellum and bright yellow areas of the head and pleura, belongs to the genus
Liriomyza, which makes it difficult to distinguish between species (WA, 2003).
To give an example of the length of each life stage; in Peru the life cycle is as
follows: egg stage (3-4 days), 1st instar larva (3-4 days), 2nd instar larva (2-3
days), 3rd instar (3-4 days), pupal stage (12-18 days), with females having an
average longevity of 3-28 days, and males 2-6 days. The mean number of eggs
laid per female in winter is 117, and spring 161 (WA, 2003).
In Southern USA, the endemic leafminers’ life cycle is most probably
continuous throughout the year, although there is a noticeable first generation,
which reaches a peak in April, with the lifecycle completed in 17-30 days
during summer, and 50-65 days in winter. In the Netherlands and Czech
Republic, the leafminer is mainly a glasshouse pest, but a proportion of the
pupae can survive outdoors during an average Dutch winter, proving how
adaptable this pest is (Vlk, 1999; WA, 2003).
Liriomyza huidobrensis Draft Diagnostic Recommendations and Literature Review
14
5. Control
Apart from quarantine regulations imposed, there are no control methods for L.
huidobrensis. Researchers are looking at alternative pesticides and plant
breeding programs to develop methods of control for leafminer populations.
In Israel, Weintraub and Horowitz (1997) have studied the effects of a neem-
based larvicide, in an effort to expand the spectrum of pesticides available
against L. huidobrensis. Laboratory bean plants were treated with soil
drenches and by dipping leaves in insecticidal solutions. It was found that
‘treating the plants with the neem insecticide before exposure to egg-laying
adults had a greater effect on inhibiting the development of pupae and adult
eclosion than treatment at the 1st-instar larval stage. The systemic effects from
a soil drench had a greater adverse effect on pupation and adult eclosion than
leaf dipping’ (Weintraub & Horowitz, 1997).
In China, the host feeding and oviposition selection of 47 plant species by the
female leafminer was studied. After studying 15 leaf tissue structure
characteristics, it was found that the host feeding selection positively
correlated with the percentage moisture content of leaves, and negatively with
thickness of the epidermis wall, the densities of the palisade and spongy
tissues of leaves. Thickness of epidermis wall, densities of the palisade and
spongy tissues can act as a physical barrier to female oviposition, and hence,
leafminer larvae activity. The three traits could be selected in future plant
breeding programs (Wei et al., 2000).
6. Threat to Australia
The West Australian Government has assessed the risk of entry, establishment
and spread of L. huidobrensis in Australia. In each case it was found to be high
Current quarantine and phytosanitary measures rely on cold storage and
inspections to prevent the insect from entering Australia. It is known that all
life stages of L. huidobrensis are killed within a few weeks by cold storage at
Liriomyza huidobrensis Draft Diagnostic Recommendations and Literature Review
15
0oC, with the exception of newly laid eggs. Therefore, cuttings of infested
plants are maintained under normal glasshouse conditions for 3-4 days after
lifting, to allow eggs to hatch, and then subsequently stored at 0oC for 1-2
weeks to kill the leafminer larvae (WA, 2003).
For the importation of fresh vegetables and cut flowers, storage at 0oC is not
an option, so inspections of produce are required. For Apium, Capsicum,
carnations, chrysanthemums, Cucumis, Gerbera, Gypsophila, lettuces,
Senecio and tomatoes from countries where the pest occurs, it is
recommended that propagating material (except seeds) of must be inspected
at least every month, and found to be pest-free during the previous three
months. And a phytosanitary certificate is required for all imports of cut
flowers and vegetables with leaves (WA, 2003).
Although there are phytosanitary measures in place, intercepts of insects and
other invertebrates occur, mostly on cutflower imports from African countries
(South Africa, Zimbabwe and Kenya), India, Singapore and to a lesser extent
China. These intercepts are a cause for concern, as the Australian climate, and
wide range of host plants both in glasshouses and outside provides ideal
conditions for establishment for L. huidobrensis. Once established, the
economic impact would be high, and spread rapid, due to the frequent
movement of produce between nurseries and markets in the cutflower and
other horticultural industries (WA, 2003).
Dispersal within crops by L. huidobrensis is by flight, but movement is
restricted as they are weak fliers, with peak flight times only at 8:00-10:00 and
18:00-20:00. Human aided dispersal is of far greater concern, such as when
plant material is moved from propagating nurseries, to other commercial
premises. As an example, in South Africa virtually the whole country was
infested within 3 years due to human aided dispersal (WA, 2003).
Liriomyza huidobrensis Draft Diagnostic Recommendations and Literature Review
16
7. Visual Identification
Shiao (2004) found that the use of abdominal colour patterns for rapid, easy
species identification was only suitable for use on adult males, and that to
distinguish between Liriomyza species required the use of boiled up male
genitalia. A range of morphological features needs to be used to identify a
species of Liriomyza, but the depth of knowledge needs to be increased,
especially as L. huidobrensis can easily confused with L. bryoniae, not only
from external morphology but also from male genitalia (Shiao, 2004; Shiao &
Wu, 2000).
Shiao & Wu (2000) found that in general, L. huidobrensis adults have a larger
body size and darker body colour when compared with other Liriomyza pests,
and that the male genitalia (especially the phallus), is undoubtedly the most
characteristic. Careful examination of male genitalia from both from lateral and
ventral aspects is needed, to prevent mis-identification with similar, closely
related species. Appendix 2 contains a description to aid in the identification of
L. huidobrensis (Shiao & Wu, 2000).
In Israel, the emphasis is on distinguishing L. huidobrensis from L. trifolii, both
major agromyzid pests, causing similar damage to crops by oviposition and
feeding. In general, L. trifolii is smaller and distinctly yellowish in appearance;
whereas the overall appearance of L. huidobrensis is dark. See the diagram
below (fig.10) for specific differences (Weintraub, 2002).
Liriomyza huidobrensis Draft Diagnostic Recommendations and Literature Review
17
Figure 10. Colour Differences Between Liriomyza huidobrensis and L.trifolii.A1, B1, C1 - L. trifolii; A2-3, B2-3, C2 - L. huidobrensisA. Fly head showing background coloration,B. B. Body side (mesopleuron),C. Back (mesonotum and scutellum)(© Gilat Research Center).
In 2003, the Western Australian Department of Agriculture released a datasheet
for the cutflower industry on how to distinguish L. huidobrensis from L. trifolii
and L. bryoniae (WA, 2003). A set of simple characters, listed below, is used
for initial identification.
- L. huidobrensis has inner vertical setae usually on a dark ground (yellow
mixed with black) and outer vertical setae standing on a black ground, and the
prescutum and scutum are shiny black.
- L. trifolii and L. bryoniae have inner and outer vertical setae on a yellow
ground, whereas L. sativae has inner vertical setae on a yellow ground (WA,
2003).
A comprehensive protocol produced by the Central Science Laboratory, UK,
presents visual methodologies by which the identity of L. huidobrensis can be
confirmed from larvae, pupae, or adult
flies.(http://www.csl.gov.uk/science/organ/ph/diagpro/liriomyza.pdf).
Liriomyza huidobrensis Draft Diagnostic Recommendations and Literature Review
18
The EPPO Protocol for the detection of L. huidobrensis, L. bryoniae, and L.
sativae concludes that identification based on morphological differences
outlined by Spencer (1973) and Knodel-Montz & Poe (1982) is slow compared
to protein electrophoresis (Anon, 1992). The EPPO protocol, although
recognising that differences exist between the types of mines produced by the
larvae of different Liriomyza species, finds that mines are not a reliable
diagnostic as these differences depend very much on the host species (Anon,
1992).
8. Identification through Protein Electrophoresis
Menken and Ulenberg (1986) developed a diagnostic protocol to separate the
Liriomyza pest species, L. bryoniae, L. huidobrensis, L. sativae and L. trifolii,
listed in the EC legislation, including the pre-adult stages, which are
morphologically difficult to separate. This last point is particularly important,
as larvae and pupae are usually the life stages intercepted by European
quarantine.
This protocol is able to identify each species at all three stages of the life
cycle. The techniques of specimen preparation, horizontal starch gel
electrophoresis and enzymatic staining are described in Menken (1982) and
Menken & Ulenberg (1983), with specific buffer formulations described below.
Although individuals can be used, it is recommended to use 2-5 individuals of
the same life stage, as individual insects can show low activity over the range
of enzymes studied. The biochemical key (key 1) below describes how to
interpret the results.
The specific buffer systems used for each enzyme assay were as follows:
I. Electrode buffer: 0.23 M Tris and 0.086 M Citric acid; pH 6.3
Gel buffer: 0.008 M Tris and 0.003 M Citric acid; pH 6.7; 6 h at 12 V/cm
II. Electrode buffer: 0.01 M EDTA, 0.25 M Boric acid and 0.45 M Tris; pH 8.7
Gel buffer: 1/20 diluted electrode buffer; 5 h at 20 V/cm
III. Electrode buffer: 0.3 M Boric acid and o.o5 M NaOH; pH 8.65
Gel buffer: 0.076 M Tris and 0.005 M Citric acid; pH 8.65; 6.5 h at 20V/cm
Liriomyza huidobrensis Draft Diagnostic Recommendations and Literature Review
19
Key 1. Biochemical key to the species of Liriomyza (L. bryoniae is used as
standard).
1. 6-Phosphogluconate dehydrogenase. – Mobility same as or slower than
standard 1
-. 6-Phosphogluconate dehydrogenase. – Mobility faster than standard
2
2. Isocitrate dehydrogenase. – Mobility same as standard
bryoniae
-. Isocitrate dehydrogenase. – Mobility slower than standard huidobrensis
3. Isocitrate dehydrogenase. – Mobility same as standard. Malic enzyme. –
Mobility notably slower than standard
trifolii
-. Isocitrate dehydrogenase. – Mobility faster than standard. Malic enzyme. –
Mobility same or somewhat slower than standard
sativae
The EPPO quarantine procedure recommends the process described by
Menken & Ulenberg (1983, 1986), as once prepared, the method can provide an
unequivocal identification within 24 hours, after the specimen has been
identified to belong to one of four species, L. bryoniae, L. huidobrensis, L.
sativae, L. trifolii (Anon, 1992).
Collins (1996) developed an assay to separate the three leafminer species L.
huidobrensis, L. bryoniae and L. strigata, by means of protein electrophoresis
on a cellulose acetate membrane. The protocol involves staining for 2
enzymes, glucose-6-phosphate dehydrogenase (G6PDH) and leucine-glycine
peotidase (PEP). The effect of parasitism on L. huidobrensis by Dacnusa
sibirica was investigated and shown unlikely to cause mis-identification of the
leafminer host. The protocol is described in appendix 3.
Liriomyza huidobrensis Draft Diagnostic Recommendations and Literature Review
20
9. Molecular techniques used to distinguish Liriomyza
Although there are no polymerase chain reaction (PCR) primer pairs specific
for the detection of L. huidobrensis, DNA fragments have been amplified from
this leafminer species, as described in the three protocols below.
Scheffer (2000) used PCR and DNA sequencing of amplicons to show that what
was previously believed to be L. huidobrensis were actually two distinct
clades, L. huidobrensis and L. langei. The method used is outlined below.
Adult L. huidobrensis were stored in 95-100% ethanol prior to testing. Each
specimen was ground for DNA extraction in 180 µl of phosphate-buffered
saline. Subsequent DNA extraction followed the Blood and Body Fluid Protocol
of the QIAmp Blood Kit. Each extract was subjected to PCR using two sets of
primers. The first primer set, C1-J-2797 (5’-cctcgacgttattcagattacc) and TK-N-
3785 (5’-gtttaagagaccagtacttg) amplified a 987 bp product spanning portions of
the mitochondrial cytochrome oxidase I and II genes and all of the leucine
tRNA. The second primer set C2-J-3279 (5’-ggacaacttattgaaataatttgaac) and
C2-N-3389 (5’-tcataacttcagtatcattg) was used to generate a product suitable for
sequencing.
Because the primer sets were not specific to Liriomyza, or L. huidobrensis,
Scheffer et al. (2001) developed a restriction fragment length polymorphism-
PCR (RFLP-PCR). The amplicon generated by the primer pair C1-J-2797 and
TK-N-3785 was digested with the restriction enzymes EcoRV and SpeI to
differentiate between L. huidobrensis and L. langei. After digestion, the two
species could be distinguished, as amplicons generated by L. langei were
broken into 611 bp and 420 bp components by SpeI, and 1031 bp by EcoRV.
Whereas amplicons from L. huidobrensis were cut into 1031 bp pieces by SpeI
and 856 bp and 175 bp by EcoRV. The RFLP-PCR was not expanded to include
other Liriomyza species.
Liriomyza huidobrensis Draft Diagnostic Recommendations and Literature Review
21
Kox et al. (2005) developed an RFLP-PCR assay to distinguish between four
economically important Liriomyza species; L. huidobrensis (includes L.
langei), L. bryoniae, L. sativae and L. trifolii. The protocol developed was
found to be robust enough to generate results from specimens stored at –80oC
for more than a decade and samples kept in 70% ethanol for over two years.
However, the primer pair, TL2-J-3037 (atggcagattagtgcaatgg) and TK-N-3785Lir
(gtt(a/t)aagagaccatt(a/g)cttg), used to generate a 790 bp product spanning the
mitochondrial COII gene, is not specific for Liriomyza, as products can also be
amplified from other insect species. And there were discrepancies in the
restriction digestions (using the enzymes DdeI, HinfI, SspI and TaqI) for L.
sativae and L. trifolii due to unexpected sequence differences, owing to
geographical origin.
References
Anon (1992) Quarantine procedure. Identification of Liriomyza spp. Bulletin
OEPP/EPPO 22, 235-238.
Arnold J (2002) Leafminers identified faster - molecular structure differentiates
two pests - Brief article.
http://www.findarticles.com/p/articles/mi_m3741/is_7_50/ai_90117989/print
July, 1-3.
Blanchard E (1926) A dipterous leaf-miner on Cineraria, new to science. Review
of Social Entomology Argentina 1,10-11.
Collins DW (1996) The separation of Liriomyza huidobrensis (Diptera:
Agromyzidae) from related indigenous and non-indigenous species
encountered in the United Kingdom using cellulose acetate electrophoresis.
Annals of Applied Biology 128, 387-398.
He L, Zhang Y, Xiao N, Wei J and Kuang R (2002) Liriomyza huidobrensis in
Yunnan, China: current distribution and genetic structure of a recently
established population. Entomolgia Experimentalis et Applicata 102(3), 213-
219.
Liriomyza huidobrensis Draft Diagnostic Recommendations and Literature Review
22
Kox LFF, van den Beld HE, Lindhout BI and de Goffau LJW (2005) Identification
of economically important Liriomyza species by PCR-RFLP analysis. Bulletin
OEPP/EPPO Bulletin 35, 79-85.
Menken SBJ (1982) Biochemical genetics and systematics of small ermine
moths (Lepidoptera, Yponomeutidae). Zeitschrift fur zoologischen Systematik
und Evolutionsforschung 20, 131-143.
Menken SBJ and Ulenberg SA (1983) Diagnosis of the agromyzids Liriomyza
bryoniae and L. trifolii by means of starch gel electrophoresis. Entomologia
experimentalis et applicata 34, 205-208.
Menken SBJ and Ulenberg SA (1986) Allozymatic diagnosis of four
economically important Liriomyza species (Diptera: Agromyzidae). Annals of
Applied Biology 109, 41-47.
Scheffer SJ (2000) Molecular evidence of cryptic species within Liriomyza
huidobrensis (Dipter: Agromyzidae). Journal of Economic Entomology 93(4),
1146-1151.
Scheffer SJ and Lewis ML (2001) Two nuclear genes confirm mitochondrial
evidence of cryptic species within Liriomyza huidobrensis (Diptera:
Agromyzidae). Annals of the Entomological Society of America 94(5), 648-653.
Scheffer SJ, Wijesekara A, Visser D and Hallett RH (2001) Polymerase chain
reaction-restriction fragment-length polymorphism method to distinguish
Liriomyza huidobrensis from L. langei (Diptera: Agromyzidae) applied to three
recent leafminer invasions. Journal of Economic Entomology 94(5), 1177-1182.
Shepherd BM, Samsudin and Braun AR (1998) Seasonal incidence of Liriomyza
huidobrensis (Diptera: Agromyzidae) and its parasitoids on vegetables in
Indonesia. International Journal of Pest Management 44(1), 43-47.
Shiao SF (2004) Morphological diagnosis of six Liriomyza species (Diptera:
Agromyzidae) of quarantine importance in Taiwan. Applied Entomology and
Zoology 39(1), 27-39.
Liriomyza huidobrensis Draft Diagnostic Recommendations and Literature Review
23
Shiao SF and Wu WJ (2000) Liriomyza huidobrensis (Blanchard), a newly
invaded insect of economic importance to Taiwan (Diptera: Agromyzidae).
Plant Protection Bulletin 42, 249-254.
Vlk R (1999) Distribution of quarantine leafminers Liriomyza spp. In the Czech
Republic, especially their occurrence and overwintering outside glasshouses.
Bulletin OEPP/EPPO 29, 85-89.
WA (2003) Hortguard Threat Data Sheet for the Cutflower Industry in WA.
Common Name (Scientific Name): Liriomyza huidobrensis (Blanchard)) &
Liriomyza trifolii Burgess, 1880)). Department of Agriculture, Western Australia,
October, 1-28.
Wei J, Zou L, Kuang R and He L (2000) Influence of leaf tissue structure on
host feeding selection by pea leafminer Liriomyza huidobrensis (Diptera:
Agromyzidae). Zoological Studies 39(4), 295-300.
Weintraub P (2002) The Pea Leafminer, Liriomyza huidobrensis, in Israel.
http://www.agri.gov.il/gilat-molcho/leafminer_english.html
Weintraub, P.G. and Horowitz, A.R. 1995. The newest leafminer pest in Israel,
Liriomyza huidobrensis. Phytoparasitica 23,177-184.
Related Articles
Morgan DJW, Reitz SR, Atkinson PW and Trumble JT (2000) The resolution of
Californian populations of Liriomyza trifolii (Diptera: Agromyzidae) using PCR.
Heredity 85, 53-61.
Trumble JT & Quiros CF (1988) Antixenotic and antibiotic resistance in Apium
species to Liriomyza trifolii (Diptera: Agromyzidae). Journal of Economic
Entomology 81(2), 602-607.
Zhao YX and Kang L (2003) Olfactory responses of the leafminer Liriomyza
sativae (Dipt., Agromyzidae) to the odours of host and non-host plants. Journal
of Applied Entomology 127, 80-84.
Liriomyza huidobrensis Draft Diagnostic Recommendations and Literature Review
24
Appendix 1. Plant hosts of Liriomyza huidobrensis.
Botanical Name Common Name Botanical Name Common Name
Primary hosts:
Allium cepa onion Allium sativa garlic
Apium graveolens celery Chrysanthemum
x morifolium
(chrysanthemum
(flortists’))
Cucurbita peo ornamental gourd Lactuca sativa (lettuce)
Phaseolus
vulgaris
bean
Secondary hosts:
Amaranthus grain amaranth Amaranthus
retroflexus
redroot, Prince of
Wales
Aster Beta vulgaris beetroot
Calendula marigolds Capsicum annum bell pepper
Cucumis melo melon Cucumis sativa cucumber
Datura Galinsoga
Gerbera Baberton’s daisy Gypsophila
paniculata
babysbreath
Lathyrus vetchling Linum
Lycopersicum
esculentum
tomato Medicago sativa lucerne, alfalfa
Melilotus melilots Petunia Petunia
Pisum sativum
var. arvense
Austrian winter
pea
Solanum
melongena
aubergine
Solanum
tuberosum
potato Spinacia oleracea spinach
Tagetes marigold Tropaeolum nasturtium
Vicia faba broad bean
Wild hosts:
Bidens pilosa spanish needle Emilia sonchifolia consumption
weed
Galinsoga
parviflora
gallant soldier Portulaca
oleracea
pigweed
Sonchus sowthistle Oxalis wood sorrels
Liriomyza huidobrensis Draft Diagnostic Recommendations and Literature Review
25
(WA, 2003).
Appendix 2. A taxonomic description of Liriomyza huidobrensis, as provided
by Shiao & Wu (2000):
Adult:
- Medium-sized species; wing length 1.7 mm in male, 2.0 mm in female
- Frons yellow, about 1.5 times as wide as eye
- Gena and postgena bright yellow; vertical angle, ocellar triangle, and
occiput dark brown to black
- Antenna yellow with 3rd segment rounded laterally, arista dark brown and
pubescent Orbital bristles 4 pairs; upper 2 pairs directed upwards, lower 2
pairs obviously inclinate
- Both inner and outer vertical bristles on brown ground
- Dorsocentral bristles 1 + 3 type
- Acrostichals in about 4 irregular rows
- Halter yellow
- Costa extending to M1+2; M1+2 near to wing tip; proportion of 2nd to 4th
costal sections, 5.2: 1: 1.3
- Squama brown with long dark fringes
- Male terminalia: Surstylus bearing 1 stout spine and 4-5 sensory hairs on
posteroventral tip
- Cercus covered with long hairs
- Sperm pump elongated with larger basal bulb
- Phallus length about 0.17 mm; distiphallus paired and sac-shaped from
ventral view, mesophallus well-developed with obvious long membranous
process, membranous area obviously divide the distiphallus and
mesophallus, basiphallus short but highly sclerotized
- Female terminalia: 9th sternite with 4 pairs of marginal setae
- Cercus with 7 setae and 6 tactile sensilla.
Larva:
- Fully-developed third instar about 2.5 mm in length
- Mandible with 2 teeth
- Posterior spiracle with 6 to 9 pores; anterior spiracle with 5 pores
Liriomyza huidobrensis Draft Diagnostic Recommendations and Literature Review
26
Appendix 3. An assay to separate the three leafminer species L.
huidobrensis, L. bryoniae and L. strigata, by means of protein
electrophoresis (Collins, 1996).
1. All equipment used during sample preparation and the electrophoretic run
was manufactured by Helena Laboratories (UK). The basic components were
an electrophoretic chamber (UK Cat # 1283) and an applicator kit (UK Cat #
4093), the latter made up of the applicator itself, a sample well plate and an
aligning base for the electrophoretic plates.
2. Each well was filled with 5 µl of a NADP grinding buffer solution (10 mg
NADP in 1 ml sdH2O). Specimens to be assayed were either fresh or frozen at –
80oC and applied as individual larvae or puparia to each well. They were then
crushed using the end of a heat sealed pasteur pipette.
3. Electrophoresis was carried out using 94 x 76 mm cellulose acetate plates
(Titan III: Cat # 3024). The applicator was used to load the homogenate onto 2
plates. These were run simultaneously at 200V (approx. 2 mA per plate) in a 25
mM Tris Glycine, pH 8.5, gel/electrode buffer (with 50 mg NADP added per litre
of buffer).
4. After 20 min one plate was removed from the electrophoretic chamber and
stained for glucose-6-phosphate dehydrogenase (G6PDH) (EC 1.1.1.49).
5. The second plate was run for a further 20 min before removal and staining
for leucine-glycine peptidase (PEP) (EC 3.4.22 or 13).
6. Plates were stained for these specific enzymes following the staining
schedules outlined in the Helena Laboratories Handbook (Herbert & Beaton,
1989).
7. Interpretation of the band patterns of unknown samples was made by direct
comparison with those from pupae taken from the laboratory cultures of L.
huidobrensis and L. bryoniae and run on the same plate.
This comparative approach was essential as proteins on a cellulose acetate
plate are subject to the phenomenon of evaporative drift, whereby their
movement through the gel matrix is not at a constant rate. As a result, the
position of a protein cannot be predicted simply by reference to previous runs.