Perforin mediated apoptosis of cerebral microvascular

endothelial cells during experimental cerebral malaria

Sarah Potter a, Tailoi Chan-Ling b, Helen J. Ball a, Hussein Mansour b,

Andrew Mitchell a, Linda Maluish a, Nicholas H. Hunt a,*

a Department of Pathology, Medical Foundation Building (K25), University of Sydney, Sydney, NSW 2006, Australiab Department of Anatomy, Institute for Biomedical Research, University of Sydney, Sydney, NSW 2006, Australia

Received 10 June 2005; received in revised form 15 December 2005; accepted 18 December 2005

Abstract

Cerebral malaria is a serious complication of Plasmodium falciparum infection. We have investigated the role of perforin in the pathogenesis of

cerebral malaria in a murine model (Plasmodium berghei ANKA (PbA) infection). C57BL/6 mice demonstrated the typical neuropathological

symptoms of experimental cerebral malaria infection from day 5 p.i. and became moribund on day 6 p.i. This pathology was not seen in PbA-

infected, perforin-deficient (pfpK/K) mice. From days 5–6 p.i. onwards there was a significant increase in mRNA for granzyme B and CD8, but

not CD4, in brain tissue from PbA-infected C57BL/6 and pfpK/K mouse brains. Perforin mRNA was strongly increased in the brains of PbA-

infected C57BL/6 mice on day 6 p.i. Immunohistochemistry revealed increased perforin staining and elevated numbers of CD8C cells within the

cerebral microvessels in PbA-infected C57BL/6 at days 5 and 6 p.i. compared with uninfected animals. At day 6 p.i., there were TUNEL-positive

cells and activated caspase-3 positive cells of endothelial morphology in the CNS of PbA-infected C57BL/6 mice. The TUNEL-positive cells

were greatly reduced in pfpK/K mice. These results suggest that CD8CT lymphocytes induce apoptosis of endothelial cells via a perforin-

dependent process, contributing to the fatal pathogenic process in murine cerebral malaria.

q 2005 Australian Society for Parasitology Inc. Published by Elsevier Ltd. All rights reserved.

Keywords: T lymphocytes; Cerebral malaria; Endothelial cells; Neuroimmunology; Apoptosis; Perforin

1. Introduction

Malaria remains one of the most globally important

infectious diseases in terms of mortality and morbidity, with

more than 2 million people each year dying from the

consequences of severe malaria (WHO, 2000). There are a

diverse range of disease presentations associated with severe

malaria, such as acute respiratory distress, renal failure,

hyperanemia and cerebral malaria (CM), all of which can

arise due to infection with Plasmodium falciparum. CM is one

of the most serious complications of falciparum infection, with

a wide range of associated neuropathological features

commonly including parasitised erythrocyte sequestration to

the endothelial surface of the microvasculature, and petechial

and ring hemorrhages.

0020-7519/$30.00 q 2005 Australian Society for Parasitology Inc. Published by E

doi:10.1016/j.ijpara.2005.12.005

* Corresponding author. Tel.: C61 2 9036 3242; fax: C61 2 9036 3286.

E-mail address: nhunt@med.usyd.edu.au (N.H. Hunt).

Pathological changes of the blood–brain barrier (BBB) as a

consequence of human CM have been investigated in relatively

few studies. The extent of damage to, and consequent

permeability of, the BBB during CM remains a matter of

some debate and the reported findings are often contradictory.

Studies in adult Indian patients have demonstrated both severe

cerebral edema, which may be functionally related to

decreased BBB integrity, and increased capillary permeability

to albumin during CM (Patnaik et al., 1994). There is also

evidence of raised intracranial pressure in Kenyan children

(Newton et al., 1991) and in Vietnamese adults significant

activation of cerebral microvascular endothelial cells (EC) and

focal breakdown of the BBB during CM infection has been

demonstrated (Brown et al., 1999). However, the finding of

BBB dysfunction was restricted to post-mortem tissue samples,

and a later study by this group (Brown et al., 2000) of

cerebrospinal fluid from other adult CM patients was unable to

find evidence of protein leakage across the BBB, leading them

to conclude that the BBB was intact in these patients. This

concurred with findings from earlier studies (Looareesuwan

International Journal for Parasitology 36 (2006) 485–496

www.elsevier.com/locate/ijpara

lsevier Ltd. All rights reserved.

S. Potter et al. / International Journal for Parasitology 36 (2006) 485–496486

et al., 1983; Warrell et al., 1986) from Thai adults, which also

did not find evidence of BBB breakdown. However, the extent

of edema reported in Malawian children with CM has been

greater than that seen in many adult patient groups and these

differences in the response of the BBB to malaria-mediated

pathology may be related to overall differences in the

presentation of malaria between different age groups (Brown

et al., 1999).

Experimental murine models of CM provide reproducible

and easily manipulated systems that closely resemble the

human condition (de Souza and Riley, 2002; Hunt and Grau,

2003). C57BL/6 mice infected with Plasmodium berghei

ANKA (PbA) demonstrate neuropathological symptoms such

as hemorrhage and leukocyte margination within the CNS

microvasculature. Edema is one of the most prominent features

of late stage experimental CM, and widely distributed EC

damage also has been reported (Thumwood et al., 1988). The

leakage of Evans blue dye, which binds to serum albumin,

across the BBB into the CNS parenchyma has been

demonstrated in both the brain and retina of PbA-infected

mice, with increased vascular permeability to protein being

evident from as early as day 3 p.i. (Chan-Ling et al., 1992).

Vascular leakage also has been reported in the lungs, hearts and

kidneys of PbA-infected mice and is apparently mediated by

CD8CT cells, as CD8-depleted mice demonstrate reduced

vascular permeability compared with wild types (Chang et al.,

2001). Although the sequestration of parasitised erythrocytes is

not a common feature of PbA-induced experimental CM, it has

been reported that there is widespread leukocyte margination,

and upregulation of cell surface markers including ICAM-1

and MHC class II on the microvascular endothelium (Ma et al.,

1996; Monso-Hinard et al., 1997).

Results of several studies suggest that CD8CT cells have a

critical role in the pathogenesis of experimental CM.

Administration of anti-CD8 antibodies abrogates the develop-

ment of cerebral symptoms in mice infected with PbA

(Hermsen et al., 1997), and beta-2-microglobulin deficient

(b2MK/K) mice are protected from developing CM (Yanez

et al., 1996). While b2MK/K mice are functionally deficient

in CD8CT cells, they have been shown to compensate for this

by the marked upregulation of CD4CT cell cytotoxic activity

in response to viral infection (Vikingsson et al., 1996).

Therefore the mechanisms of CD8CT cell-mediated pathology

remained unclear. However, the development of perforin

deficient gene-knockout mice (pfpK/K) (Kagi et al., 1994;

Lowin et al., 1994; Walsh et al., 1994), which demonstrate

normal T and natural killer (NK) cell development but have

perturbed granule exocytosis and thus compromised cytolytic

lymphocyte function (Smyth et al., 2001), has allowed

investigation of specific immune functions typically associated

with CD8CT cells.

Preliminary work in our laboratory demonstrated that

pfpK/K mice were protected from CM pathology (Potter et

al., 1999). More recently, Belnoue et al. (2002) investigated the

potential pathogenicity of various T cell subsets in the brains of

PbA-infected C57BL/6 mice and found that the development

of pathology was dependent on the sequestration of CD8CT

cells within the brain microvasculature. These cells were

present in relatively low numbers (20,000–50,000 in total, or

4% of the total brain leukocyte population) and did not appear

to be localised to any specific region of the brain. Other

workers showed that PbA-infected C57BL/6 and pfpK/Kmice had significantly higher numbers of CD8C and CD4CT

cells in the brain, compared with uninfected animals (Nitcheu

et al., 2003). These studies all suggested that CD8CT cell-

mediated, perforin-dependent cytotoxic mechanisms were

involved in damage to the EC of the BBB. However, the

presence of perforin protein within the CNS of mice with

experimental CM, the location of CD8C cells, or the presence

of apoptotic EC has not been investigated previously. In the

present study, we demonstrate increased numbers of CD8C

cells and CD8 mRNA expression, increased expression of

perforin protein and mRNA, and the occurrence of apoptotic

vascular EC, specifically within the CNS, and only in mice

demonstrating the symptoms of experimental CM.

2. Materials and methods

2.1. Animal and parasite maintenance

Female 6–8 week old C57BL/6 and Prf1tm1sdz perforin gene

knockout (pfpK/K) (courtesy of Dr G. Karupiah, Australian

National University, Canberra, ACT, Australia) mice were

housed under standard conditions with free access to food and

water. All experimental procedures involving these mice were

performed in accordance with the guidelines of the University

of Sydney Animal Care and Ethics Committee. The parasite

strains used were P. berghei ANKA (PbA) (courtesy of Dr G.

Grau, Marseille, France) and P. bergheiK173 (courtesy of Dr I.

Clark, Australian National University, Canberra, ACT,

Australia). Parasites were administered to the mice in 100 mldoses containing 106 parasitised erythrocytes via i.p. injection.

Parasitemia, as the percentage of infected erythrocytes, was

determined in tail-vein blood smears by counting 400 cells per

smear.

2.2. Fibrinogen, perforin and CD8 immunohistochemistry

Perfused brain and spleen tissue were removed following

euthanasia with CO2 gas. Formalin (10% w/v)-fixed tissues

were processed and paraffin-embedded and 5–7 mm thick

sections were cut onto silane-coated slides. For CD8

immunohistochemistry, tissues were removed directly post-

mortem, optimum cutting temperature (OCT)-embedded and

frozen in liquid nitrogen before being cut as described above

and fixed in acetone for 7 min. Where tissue was required for

RNA extraction or measurement of tissue edema, animals were

not perfused, but tissues removed instantly and processed as

described below. For immunohistochemistry on fixed and

fresh-frozen tissues, sections were initially blocked for non-

specific peroxidase binding in 0.3% (v/v) H2O2 in methanol for

30 min. An avidin–biotin block kit (DAKO, NSW, Australia)

was used to block any endogenous avidin–biotin activity.

Antigen retrieval was performed on fixed tissues only, by

Table 1

Antibodies and dilutions

Primary antibody Dilution Secondary Antibody Dilution

Rabbit anti-human fibrinogen (Dako, NSW, Australia) 1:2000 Biotinylated goat anti-rabbit IgG (Dako) 1:200

Rabbit anti-rat perforin (Torrey Pines Biolabs, TX, USA) 1:3000 Biotinylated goat anti-rabbit IgG (Dako) 1:300

Purified rat anti-mouse CD8 (BD Biosciences-Pharmingen,

NSW, Australia)

1:100 Biotinylated goat anti-rat IgG (mouse adsorbed)

(CALTAG laboratories, CA, USA)

1:300

S. Potter et al. / International Journal for Parasitology 36 (2006) 485–496 487

boiling slides for 20 min in citric acid buffer (10 mM citric

acid, pH 3.0). Sections were papped (Zymed, CA, USA) and

washed 3!3 min in TNT buffer (0.1 M Tris–HCl buffer pH 7.5

containing 0.3 M NaCl, 0.05% (v/v) Tween 20), and incubated

in 10% (v/v) normal horse serum (NHS) in TNT buffer for

30 min at room temperature (RT). Sections were then

incubated for 1 h at RT in primary antibody (see Table 1 for

antibody sources and dilutions) diluted in TNT buffer/1% (v/v)

NHS. After a further 3!3 min wash in TNT buffer, sections

were incubated in secondary antibody at RT for 20 min. This

was followed by incubation in avidin–biotin–peroxidase

complex (Vector Laboratories, CA, USA) at RT for 20 min.

Slides were then visualised in Dako Liquid DAB substrate-

chromogen system (Dako, NSW, Australia), hematoxylin

counterstained and mounted in DPX (Vector Laboratories).

All slides were read blind.

2.3. Activated caspase-3, Glial Fibrillary (FIX) AP, TUNEL

and isolectin-B4 immunohistochemistry

Detached retinal tissue was dissected as described pre-

viously (Chan-Ling, 1997) and fixed in 4% (w/v) paraformal-

dehyde for 4 h at 4 8C. The retinas were washed 3!10 min in

0.1 M PBS, pH 7.4 and permeabilised in 1% (w/v) Triton

X-100 for 30 min, washed 3!5 min in PBS and blocked in 1%

(w/v) BSA in PBS for 30 min. The tissue was incubated

in primary antibody (Cell Signaling Technology) against

activated caspase 3 (Asp175) overnight at 4 8C, followed by

a 10 min wash in PBS. The tissue was then reacted in

biotinylated anti-rabbit Ig secondary antibody, followed by

Cy3-streptavidin. Following a further PBS wash, the tissue was

incubated overnight in a monoclonal antibody against glial

fibrillary alkaline phosphatase (GFAP) (Sigma) followed by

incubation for 2 h at RT in Alexa Fluor 488 anti-mouse IgG1.

The retina were washed in PBS and then mounted in antifade

and examined on a Zeiss Deconvolution Fluorescence camera.

For terminal deoxynucleotidyl transferase biotin-dUTP nick

end labeling (TUNEL) immunostaining, retinal wholemounts

were prepared as described above, and TUNEL staining was

then performed using an in situ Cell Death Detection Kit-POD

according to the manufacturer’s instructions (Roche, NSW,

Australia). HRP reaction solution (0.05% (w/v) diaminobenzi-

dine, 0.01% (v/v) hydrogen peroxide in tris buffered saline

(TBS)) was added to the TUNEL-labeled wholemounts and the

reaction visualised under a microscope. Following the

completion of the TUNEL reaction, samples were washed

in PBS for 3!10 min, and retinas were incubated overnight

in isolectin GS-1B4 from Griffonia simplicifolia (1:100 in

PBS) at 4 8C. After a further wash, 500 ml of ABC complex

(ABC-Alkaline-Phosphatase Standard, Vector Laboratories)

was added to each retina, and incubated with gentle agitation

for a further 2 h at RT. Samples were then visualised under

light microscopy in freshly prepared alkaline phosphatase

substrate (Vector Laboratories, BCIP/NBT alkaline phospha-

tase kit IV) with Levamisole (Vector Laboratories) for between

2 and 15 min. Samples were then washed, mounted on plain

slides in PBS:glycerol (1:2) and analysed blind.

2.4. Tissue weight

For assessment of cerebral edema, wet weight of the brain

was immediately determined and the tissue placed in a 55–

65 8C oven for a period of no less than 4 days, until the dry

weight became constant. The percentage fluid content of the

tissue, and thus the extent of edema, could then be determined

from the difference between dry and wet weights.

2.5. RNA extraction and reverse transcription (RT)-PCR

Brain and spleen samples were collected and approximately

400 mg of each tissue was immediately placed into 1 ml Tri-

reagent (Sigma, USA) and 0.5 ml zirconia beads (Biospec

Products, OK, USA). Samples were then homogenised using a

Fastprep homogeniser (Qbiogene, CA, USA). Chloroform

(0.2 ml) was added and the lysate mixed thoroughly. After

centrifuging at 12,000!g for 20 min at 4 8C, the aqueous layer

was transferred to a new tube. RNA was precipitated with

500 ml of isopropanol and pelleted by microfuging at 12,000!g for 20 min at 4 8C. The pellet was washed with 70% v/v

ETOH and resuspended in RNAse-free water. Any contami-

nating genomic DNA was removed by DNase treatment using

the DNAfree kit (Ambion, TX, USA) according to the

manufacturer’s instructions. DNase-treated RNA samples

were subsequently stored at K80 8C.

Reverse transcription of RNA samples was performed prior

to quantitative PCR. cDNA was synthesised from up to 2 mg oftotal RNA using 0.1 ng of oligodT18, 0.6 mM of each

nucleotide, 5 U Prime RNase inhibitor (Eppendorf) and an

MMLV-reverse transcriptase kit (Invitrogen). The resulting

cDNA was diluted 1:25 by the addition of 480 ml of dH20.

cDNA samples were stored at K200 8C. Primers used in

quantitative PCR analysis were designed using the program

Primer Express (Perkin–Elmer, MA, USA). BLAST (www.

ncbi.nih.gov) searches were performed on primer sequences to

avoid potential amplification of contaminating genomic DNA.

In each case, the forward primer also was designed to target a

different exon than the reverse primer, thus preventing

Table 2

Primer sequences

Target gene or mRNA Primer, 5 0/3 0

Forward Reverse

18-S GCCGCTAGAGGTGAAATTCTTG GAAAACATTCTTGGCAAATGCTTT

Perforin TTGGCCCATTTGGTGGTAAG AGTCTCCCCACAGATGTTCTGC

Granzyme B CCTGAAGGAGGCTGTGAAAGAATC CCCTGCACAAATCATGTTTAGTCC

CD4 CGGATGCAGAAGAGCCATAATC AGGCAGCGTGTCTGCTACATTC

CD8 TCAAGACGGCCCTTTCTCAGT TCCCTGTCCCAAAGACCATCT

TNFa AATGGCCTCCCTCTCATCAGTT CCACTTGGTGGTTTGCTACGA

ICAMb GCCTCCGGACTTTCGATCTT GTCAGGGGTGTCGAGCTTTG

MHC Ic AAGAGCAGTGGTTCCGAGTGA GGTTGTAGTAGCCGAGCAGGTT

LFA-1d GAGTCAAGCTCAAGGCATGCTT AGCAGGCGACCTTGAAACTGT

a Tumor necrosis factor.b Intercellular adhesion molecule.c Major histocompatibility complex type I.d Leukocyte function antigen 1.

S. Potter et al. / International Journal for Parasitology 36 (2006) 485–496488

amplification of contaminating genomic DNA. Primer

sequences used here are described in Table 2.

The quantitative real-time PCR assay was performed

using an ABI Prism 7700 Sequence Detector System

(Applied Biosystems, Scoresby, Victoria, Australia).

Approximately 20 ng of cDNA was used in each 20 ml

PCR reaction using Platinum Quantitative PCR SuperMix-

UDG with added ROX reference dye (Invitrogen), 0.3!SYBR Green nucleic acid stain (Molecular Probes) and

100 nM of each primer. After a 10 min incubation at 95 8C,

amplification was achieved by 40 cycles of a 15 s

incubation at 95 8C followed by a 60 s incubation at

60 8C. The identity and purity of the PCR product was

confirmed by using dissociation curves and by checking the

melting temperature of the PCR product, independently of

the PCR reaction. All PCR products demonstrated appro-

priate dissociation curves, or were not included in

experimental data. To determine the relative amount of

target cDNA present, the cycles to threshold (Ct) values of

the target genes were compared with the basal expression

of the housekeeping gene, 18S mRNA. The average amount

of 18S mRNA present in each mouse group (by mouse

strain, mouse tissue and day p.i.) was used to normalise the

Table 3

Histopathological scores

Mouse Parameter Day 3 Day 4 D

C57BL/6 Petechial hemorrhage 0 (0) 0 (0) 1

Leukocyte adherence 0 (0) 1 (0–1) 1

Edema 0 (0) 1 (1–2) 1

Parasitemia 1.2 (0.2) 5.2 (0.7) 1

pfpK/K Petechial hemorrhage 0 (0) 0 (0) 0

Leukocyte adherence 0 (0) 0 (0–1) 1

Edema 0 (0) 0 (0) 0

Parasitemia 1.0 (0.2) 5.7 (0.7) 1

Histopathological scores and percent parasitemia for individual C57BL/6 and pfpK

indicates widespread and severe hemorrhage, edema or leukocyte adherence throu

adherent leukocytes within the cerebral microvasculature, and moderate edema throu

adherence, throughout the brain. A score of 1 indicates minimal hemorrhage or edem

score of 0 indicates that no histopathological changes associated with experimental c

to that time point for analysis. Mode and (range) given, with nZ6, except ‘Parasit

quantity of target mRNA sequence against total RNA in

each reaction. The differences in Ct value between

housekeeping gene and target gene were then compared

with untreated control samples of the same mouse strain

and tissue type to determine the relative change in mRNA

expression. We verified that each primer set had a similar,

high amplification efficiency.

2.6. Statistical analysis

All statistical analyses were performed using GraphPad

PRISM V3 (GraphPad Software, USA). The Mann–Whitney or

Kruskal–Wallis non-parametric tests were used to compare

data sets and group means were considered statistically

significantly different where P!0.05.

3. Results

3.1. Hematology and histology

Parasitemia was found to be comparable in pfpK/K and

C57BL/6 mice between day 0 and day 6 p.i. (Table 3). Brain

tissue sections were examined histologically for pathological

ay 5 Day 6 Day 8 Day 10 Day 12

(0–1) 4 (3–4) ND ND ND

(1–2) 3 (3–4) ND ND ND

(1–2) 4 (3–4) ND ND ND

1.5 (1.0) 20.1 (1.8) ND ND ND

(0) 0 (0) 0 (0) 0 (0) 0 (0)

(1–2) 1 (1–2) 3 (2–3) 0 (0) 0 (0)

(0) 0 (0) 0 (0) 0 (0) 0 (0)

3.8 (0.9) 20.5 (1.4) 35.4 (3.8) 16.5 (2.2) 11.8 (4.0)

/K mice infected with Plasmodium berghei ANKA. The maximum score of 4

ghout the brain. A score of 3 indicates moderate numbers of hemorrhages and

ghout the brain. A score of 2 indicates minimal hemorrhage, edema or leukocyte

a, restricted to a focal area of the brain, with few adherent leukocytes present. A

erebral malaria were present. ND: not done, and indicates that no mice survived

emia’ where mean (and SEM) are given, with nZ16.

S. Potter et al. / International Journal for Parasitology 36 (2006) 485–496 489

features consistent with experimental CM. As characterised

previously in the model (Grau et al., 1987; Thumwood et al.,

1988; Neill and Hunt, 1992; Lou et al., 2001) hemorrhage,

especially in the olfactory bulb and cerebellum, was a common

finding in C57BL/6 mice at day 6 p.i., and leukocyte

sequestration within the cerebral microvasculature became

noticeable from day 4 p.i. The neuropil also became less dense

and developed a more sponge-like and open texture consistent

with the development of edema within the brain. Many of the

cerebral vessels were visibly congested with parasitised

erythrocytes, even after cerebral perfusion. In contrast,

pfpK/K mice did not have cerebral hemorrhage or visible

changes in neuropil consistency at any stage during the

infection, but did have significant numbers of leukocytes

adherent within the cerebral microvasculature. These adherent

cells were visible from day 4 p.i. and were most numerous at

day 8 p.i. but were not associated with the development of any

clinical symptoms or other pathological changes. These

observations, summarised in Table 3, are consistent with the

previously described protection from cerebral symptoms in

pfpK/K mice (Potter et al., 1999).

3.2. Evidence of edema and disruption of the blood–brain

barrier

A measure of cerebral edema was obtained by comparing

brain wet weight with brain dry weight. During PbA infection

there was a statistically significant increase in fluid content

within the brain tissue of C57BL/6 mice (Fig. 1) at days 5 and

6 p.i. This increase was not apparent in the pfpK/K mice,

which maintained percent fluid levels consistent with those

seen in uninfected animals. The cerebral microvascular

endothelium has been shown to become progressively more

positive for, and increasingly permeable to, fibrinogen during

experimental CM (AM Hansen, manuscript in preparation),

indicative of endothelial activation and BBB breakdown. The

extent of fibrinogen-positive staining in the brain tissue of PbA-

infected pfpK/K and C57BL/6 mice investigated. At day

% fl

uid

cont

ent o

f bra

in ti

ssue

75.0

Day 0

Day 3

Day 4

Day 5

Day 6

Day 8

Day 1

0

Day 1

2

Day 1

6

75.576.0

76.577.077.578.078.5

79.079.5

80.0 C57Bl/6

PFP -/-

*

*

Days post inoculation

Fig. 1. Percentage fluid content within the brain tissue of pfpK/K and

C57BL/6 mice with Plasmodium berghei ANKA (PbA) infection. Points and

bars represent mean and SEM, nZ6. Asterisks denote significant change (P!0.05) compared with uninfected (day 0 p.i.) mice of the same strain.

6 p.i., C57BL/6 mice showed widespread diffusion of

fibrinogen into the cerebral parenchyma, which corroborates

the results of our previous investigations of Evans Blue

extravasation (Potter et al., 1999) and cerebral edema in this

model. Our results suggest that PbA-infected wild type mice

had a significant loss of BBB function, which became

gradually more evident from day 4 p.i. This was accompanied

by a generalised activation of cerebral microvascular EC.

PfpK/K mice demonstrated similar endothelial staining for

fibrinogen, indicating that the endothelium was activated in

these animals but there was no suggestion of leakage of

fibrinogen into the parenchyma, indicating that the BBB

remained intact in these animals. Faint staining for fibrinogen

became apparent within the meningeal vessels from day 3 p.i.

and this increased in intensity and distribution throughout the

brain between days 4 and 8 p.i. At day 10 p.i., endothelial

staining for fibrinogen was less strong but still widespread.

3.3. Up-regulated transcription of mRNA associated with

increased cytolytic processes and endothelial activation

in the CNS of PbA-infected animals

We investigated mRNA transcription related to specific

proteins that could potentially be involved in the breakdown of

the BBB. Splenic mRNA expression in PbA-infected animals

was analyzed to contrast systemically regulated changes with

those occurring specifically within the brain, and brain mRNA

expression was also investigated in the non-cerebral strain of

experimental malaria, PbK, to definitively link changes in

mRNA expression patterns specifically to experimental CM.

The expression of perforin mRNA was investigated in wild

type C57BL/6 mice only. Perforin mRNA expression was not

significantly increased in spleen tissue, or in PbK-infected

mouse brain, but demonstrated aO30-fold increase in

expression levels in the brains of PbA-infected mice at days

5 and 6 p.i. (Fig. 2A). Granzyme B mRNA expression showed

a O1000-fold induction at days 5 and 6 p.i. in the brains of

PbA-infected C57BL/6 mice (Fig. 2C). While there were

moderate increases in the level of granzyme B mRNA

expression in the brain in late-stage PbK infection, there was

no increase in the spleen. In the pfpK/K mice, there was a

200- to 300-fold increase in granzyme B mRNA expression in

the brain on days 8 and 10 p.i. of PbA-infection (Fig. 2E).

While there was a considerable range in the level of expression

in the pfpK/K mice, the increase was significant at both time

points (P!0.01).

There also was a significant increase in CD8 mRNA in brain

tissue from PbA-infected C57BL/6 and pfpK/Kmice (Fig. 2B

and D). These data imply an increase in CD8C cells

specifically within the brain, in agreement with previous

reports (Belnoue et al., 2002). In contrast to CD8 mRNA

expression, CD4 mRNA expression was not significantly

changed in tissue homogenates from either C57BL/6 or

pfpK/K mice (data not shown). There were also significant

increases in the transcription of MHC class I, tumor necrosis

factor (TNF), ICAM-1 and leukocyte function antigen (LFA)-1

mRNA in the brains of PbA-infected C57BL/6 and pfpK/K

0

Day 0

Day 3

Day 4

Day 5

Day 6

Day 8

Day 1

0

10

Per

forin

Fol

d in

duct

ion

(a.u

.)

20

30

40

50 *

*

C57Bl/6 PbA Brain

C57Bl/6 PbA spleen

C57Bl/6 PbK brain

C57Bl/6 PbKSpleen

A

Days post inoculation

0

25

50

75 *

*

B C57Bl/6 PbA Brain

C57Bl/6 PbA spleen

C57Bl/6 PbK brain

C57Bl/6 PbK Spleen

Days post inoculationDay

0

Day 3

Day 4

Day 5

Day 6

Day 8

Day 1

0

CD

8F

old

indu

ctio

n (a

.u.)

0

1000

2000*

*

CC57Bl/6 PbA Brain

C57Bl/6 PbA spleen

C57Bl/6 PbK brain

C57Bl/6 PbK Spleen

Days post inoculationDay

0

Day 3

Day 4

Day 5

Day 6

Day 8

Day 1

0

Gra

nzym

e B

Fol

d in

duct

ion

(a.u

.)

0

100

200

300 *

**

pfp -/- PbA Brain

pfp -/- PbA Spleen

pfp -/-PbK Brain

D

Days post inoculation

Day 0

Day 3

Day 4

Day 5

Day 6

Day 8

Day 1

0

Day 1

2

Day 1

6C

D8

Fol

d in

duct

ion

(a.u

.)

0

250

500

750

1000

*

E

*

pfp -/- PbA brain

pfp -/- PbA spleen

pfp-/- PbK brain

Days post inoculationDay

0

Day 3

Day 4

Day 5

Day 6

Day 8

Day 1

0

Day 1

2

Day 1

6

Gra

nzym

e B

Fol

d in

duct

ion

(a.u

.)

Fig. 2. Relative mRNA transcription in brain and spleen whole tissue homogenates from PbA- and PbK- infected C57Bl/6 (A–C) and pfpK/K (D, E) mice. Fold

induction (arbitrary units (a.u.) relative to the mean value of control tissue from uninfected mice. Points and vertical bars represent mean and SEM (nZ4–6).

Asterisks denote significant change compared with uninfected (day 0 p.i.) mice of the same strain. (A) Perforin mRNA in C57BL/6 mice; (B) and (D) CD8 mRNA in

C57BL/6 and pfpK/K mice, respectively; (C) and (E) Granzyme B mRNA in C57BL/6 and pfpK/K mice, respectively.

S. Potter et al. / International Journal for Parasitology 36 (2006) 485–496490

mice. The pattern of transcription was similar between the two

strains of mice, with mRNA levels increasing from day 5 p.i.,

and reaching the peak of expression at day 8 in the PbA-

infected pfpK/K mice. These data are summarised in

(Table 5).

Table 4

Overview and quantification of immunohistochemical staining in C57BL/6 mice

Immunohistochemical Stain Day 0 Day 3 p.i. Day

Perforin 0 0 1

CD8 0 1 1

TUNEL/isolectin 0 0 0

Caspase-3/isolectin 0 0 ND

Quantification of immunohistochemical staining during Plasmodium berghei ANK

positive staining, with the maximum amount of staining seen in any section given a r

1 and 2. Mode score of two sections per brain with nZ4 or 5 mice per time-point. F

end labeling (TUNEL) immunohistochemistry it was possible to count individual ce

two to eight mice. CD8 was graded according to the number of positive cells seen p

section; 3,O50 cells per section. TUNELwas graded according to the number of TU

1–2 cells per retina; 2, 3–10 cells seen per retina; 3, O 10 cells per retina. Caspase

retina; 0, no positive cells seen; 1, 1–2 cells per retina; 2, 3–10 cells seen per retin

3.4. Immunohistochemical staining for CD8 and perforin

in animals with experimental CM

To determine the presence and location of perforin

protein expression in PbA-infected brains, anti-perforin

4 p.i. Day 5 p.i. Day 6 p.i. Day 7 p.i.

2 3 ND

2 3 ND

1 2 3

3 2 2

A infection in C57Bl/6 mice. Perforin is graded according to the amount of

ank of 3, no staining a rank of 0 and intermediate levels between these ranked as

or CD8, caspase 3 and terminal deoxynucleotidyl transferase biotin dUTP nick

lls. All cell counts used to generate the rating scales were means from groups of

er section: 0, no positive cells seen; 1, 1–10 cells per section; 2, 11–50 cells per

NEL-positive endothelial cells (ECs) seen per retina; 0, no positive cells seen; 1,

-3 was graded according to the number of caspase-3-positive cells EC seen per

a; 3, O10 cells per retina.

Table

5

Overview

ofchanges

inmRNA

transcriptionduringexperim

entalcerebralmalaria

C57BL/6

pfpK/K

PbA

Brain

PbA

Spleen

PbK

Brain

PbK

Spleen

PbA

Brain

PbA

Spleen

PbK

Brain

D3

D6

D3

D6

D3

D6

D3

D6

D3

D8

D3

D8

D3

D8

CD4

0.5

1.2

2.1

0.7

0.3

0.2

0.7

1.2

0.9

1.1

3.9

2.2

0.3

0.1

TNFa

8.9*

48.2*

11.4*

0.9

1.3

2.7

2.4

2.5

5.2

185.0*

23.6*

14

1.5

1.3

ICAM-1

b1.6

10.3*

5.9

0.8

0.7

1.0

1.8

2.5

1.2

20.6*

15.5

14.6

0.8

0.7

LFA-1

c1.0

6.8*

3.1

0.5

0.5

0.7

1.1

1.6

0.7

28.9*

10

10.6

0.6

0.6

MHCId

1.5

5.8*

0.4

1.1

–2.9

–0.4

––

––

––

Overviewofchanges

in18-S

norm

alised

mRNAexpressionduringexperim

entalcerebralmalaria.Averagefold

induction(nZ4–6)atspecified

timepointsrepresentingearlyandpeakmRNAinductioninbrainand

spleen

homogenates

fromPbA-andPbK-infected

C57Bl/6andpfpK/K

micerelativetoequivalenttissues

fromcontrolmiceofthesamestrain.*Asterisksdenotesignificantdatapoint(P!0.05)compared

withday

0miceofthesamestrain.

aTumornecrosisfactor.

bIntercellularadhesionmolecule.

cMajorhistocompatibilitycomplextypeI.

dLeukocyte

functionantigen

1.

S. Potter et al. / International Journal for Parasitology 36 (2006) 485–496 491

immunohistochemistry was performed on brain sections from

mice infected with either PbA or PbK. The extent of perforin-

positive staining within a sagittal section was graded semi-

quantitatively (Table 4). There was no positive staining for

perforin in either uninfected control mouse brains (Fig. 3A) or

PbK-infected mouse brains at the time-points investigated.

However, perforin staining was visible in PbA-infected mouse

meningeal vessels and brain tissue from as early as day 3 p.i. At

day 4 p.i., perforin immunoreactivity was visible within vessels

in the olfactory bulb, as well as in the meningeal vessels. Brain

tissue from mice on days 5 and 6 p.i. of PbA infection revealed

the most intense perforin staining visible in numerous vessels

throughout the CNS. Representative illustrations of anti-

perforin immunohistochemical staining at day 6 p.i. are

shown in Fig. 3B and C.

Immunohistochemical staining for CD8 demonstrated a

significant increase in the number of CD8C cells in the

microvasculature of the brain in PbA-infected C57BL/6 mice

(Fig. 3D–G). CD8C cells were infrequent in uninfected

control mice. In PbA-infected animals, CD8C cells became

gradually more numerous from days 3 to 6 p.i., when they

were visible in many of the microvessels within the CNS.

CD8C cells were not localised within the cerebral parench-

yma, nor were they found in larger numbers in any particular

region of the brain, but appeared to be located specifically

within the vascular lumen throughout the entire CNS. The

number of CD8C cells per sagittal brain section were counted

and graded according to a semi-quantitative scale (Table 4).

CD3C cell numbers also were determined by immunohis-

tochemistry during the course of PbA and PbK infection and it

was possible to estimate that 80–90% of these were CD8C

(data not shown). Late-stage PbK-infected animals also

demonstrated an increase in the number of CD8C cells in

comparison to uninfected controls but the overall number of

positive cells was much less than seen in the late-stage PbA

infection (data not shown).

3.5. Immunohistochemical evidence of endothelial apoptosis

While the above results provided evidence supporting a key

role for perforin in mediating BBB breakdown, it also was

important to investigate the kinetics and cellular location of

any apoptotic processes that might be occurring within the

PbA-infected mouse brain. The retina, as an extrusion of the

diencephalon, can be considered as part of the CNS

(Chan-Ling, 1994), and has been shown in human and murine

studies to demonstrate parallel pathology to the brain during

CM (Chan-Ling et al., 1992; Neill et al., 1993; White et al.,

2001). Retinal wholemounts also have the advantage of

possessing easily visualised architectural features and are

thus ideal for this type of investigation. TUNEL was used to

identify apoptotic cells within the retinae of PbA-infected

C57BL/6 mice, in combination with isolectin, a well-

characterised marker of ECs and activated microglia (Medana

et al., 1997). The number of TUNEL/isolectin-positive

cells was counted within each retinal wholemount (Table 4).

TUNEL-positive staining was infrequently seen in

Fig. 3. A–C. Immunohistochemical staining for perforin in C57BL/6 mouse brain. (A) Cerebellum of PbK-infected mouse at day 10 p.i. There is no visible positive

staining for perforin within the tissue. Hematoxylin counterstain, 10!objective. (B) Meningeal region of cerebrum from PbA-infected mouse at day 6 p.i. Perforin-

positive staining of cells (brown, arrows) is widespread throughout the vasculature. Hematoxylin counterstain, 40!objective. (C) Meningeal region of cerebrum

from PbA-infected mouse at day 5 p.i. At higher magnification, perforin-positive staining (brown, arrows) appears quite granular. Hematoxylin counterstain, 60!objective. D–G. Immunohistochemical staining for CD8 protein expression in C57BL/6 mouse brain. (D) Cerebellum of uninfected mouse. There is no visible

positive staining for CD8 protein within the tissue. Hematoxylin counterstain, 20!objective. (E) Cerebellum from PbA-infected mouse at day 3 p.i. There are

relatively few CD8 positive cells visible (brown, arrow) within the tissue. Hematoxylin counterstain, 20!objective. (F) Cerebellum from PbA-infected mouse at day

5 p.i. There are numerous CD8 positive cells visible within the microvasculature (brown, arrows). Hematoxylin counterstain, 40!objective. (G) Cerebellum from

PbA-infected mouse at day 6 p.i. There are significant numbers of CD8 positive cells visible within the microvasculature (brown, arrows). Hematoxylin counterstain,

60!objective. (For interpretation of the references to colour in this figure legend, the reader is referred to the web version of this article)

S. Potter et al. / International Journal for Parasitology 36 (2006) 485–496492

PbA-infected mice, except at days 6 and 7 p.i., when there were

numerous TUNEL/isolectin double positive cells of EC

morphology within the retinae of C57BL/6 mice (Fig. 4A

and B). These were not observed in PbK-infected C57BL/6

mice or in PbA-infected pfpK/K mice, at any stage of

infection (data not shown).

Further evidence of apoptotic EC was provided by staining

of the retinae with activated caspase-3, in conjunction with

either isolectin (for EC and microglia) or GFAP (for

astrocytes). Isolectin- or GFAP-caspase-3 staining revealed

comparable results to those seen with the TUNEL reaction, in

that there were infrequent caspase-3 positive cells in uninfected

animals, with a significant increase in the number of caspase-3

positive cells of endothelial morphology in the retinal tissue of

animals at days 5–7 p.i. (Figs. 4 and 5, Table 5). The presence

of GFAP-positive activated caspase-3-positive cells indicated

the occurrence of apoptotic astrocytes (Fig. 4). There also were

numerous activated caspase-3-positive cells of leukocyte

morphology within the lumen of the retinal microvasculature

(Fig. 5).

Fig. 4. Apoptotic endothelial cells and astrocytes in retinas of PbA-infected mice at day 7 p.i. (A and B) terminal deoxynucleotidyl transferase biotin dUTP nick end

labeling (TUNEL) and GS lectin immunostaining to identify apoptotic cells. (A) TUNEL-positive cell (brown, arrowed) with endothelial morphology. The vessel

appears to be blocked with GS-lectin-negative leukocytes (arrowhead). (B) TUNEL-positive cells of endothelial morphology (brown, arrows). The vasculature is

faintly positive for GS-lectin (blue). (C) Glial fibrillary alkaline phosphatase (GFAP) positive staining only. (D) activated caspase-3 positive staining only. Arrows

indicate two activated caspase-3 positive cells that are GFAP negative (and therefore not astrocytes) but with an elongated morphology typical of vascular

endothelial cells. (E) GFAP/activated caspase-3 double staining (merged images). At higher magnification, arrows clearly show cells with endothelial cell

morphology that are positive for activated caspase-3 but GFAP negative. The arrowhead shows an activated caspase-3 positive cell soma associated with GFAP-

positive cell processes, indicating an apoptotic astrocyte (for interpretation of the references to colour in this figure legend, the reader is referred to the web version of

this article).

S. Potter et al. / International Journal for Parasitology 36 (2006) 485–496 493

Fig. 5. Apoptotic endothelial cells in retinas of PbA-infected mice. A,D,G: GS lectin staining of retinal vessels. B,E,H: staining for activated caspase-3. C, F, I: GS

lectin and activated caspase-3 staining (merged images). (A–F) mice infected 5 days previously with PbA. Co-labelling of cells in C and F demonstrates apoptotic

endothelial cells (arrowed). (G–I) mice infected 7 days previously with PbA. Co-labelling shows apoptotic endothelial cell (arrowed). Arrowheads indicate

intravascular cells, probably leukocytes, labelled for activated caspase-3 but not labelled with GS lectin.

S. Potter et al. / International Journal for Parasitology 36 (2006) 485–496494

4. Discussion

This study demonstrates for the first time a mechanism by

which the BBB is compromised during experimental CM in

C57BL/6 mice. Our results show, firstly, that pfpK/K mice

maintain BBB integrity, while the BBB of the wild type

C57BL/6 mice is clearly compromised, during experimental

CM. Second, the evidence presented here indicates that

perforin is the key mediator of damage to the BBB, via the

induction of microvascular EC apoptosis. In perforin-deficient

mice, the BBB was not compromised, since there was no

cerebral edema or fibrinogen leakage into the cerebral

parenchyma. However, our findings suggest that the micro-

vascular endothelium was activated to a similar level in both

pfpK/K and C57BL/6 mice. Furthermore, pfpK/K mice

demonstrated leukocyte adherence within the cerebral micro-

vasculature that was comparable with their C57BL/6

counterparts.

The data obtained from quantitative RT-PCR and

immunohistochemistry provide evidence for an increase in

the number of CD8C lymphocytes within the brain during

PbA infection, consistent with a previous report (Belnoue et

al., 2002), both in C57BL/6 and pfpK/K mice. The

involvement of NK cells in mediating cerebral pathology is

likely to be minimal in this system, based on the results from

NK cell-depleted mice, which are not protected from

developing experimental CM (Yanez et al., 1996). The

upregulation of perforin and granzyme B mRNA transcrip-

tion, in combination with the upregulation of CD8 mRNA

expression, was seen specifically in the brains of PbA-

infected animals and indicates an influx of activated CD8CT

cells into this tissue. Immunohistochemical analysis showed

that CD8C cells were located specifically within the cerebral

microvasculature and it therefore appears that transendothe-

lial migration into the cerebral parenchyma is not a

requirement for the pathological processes in this model.

S. Potter et al. / International Journal for Parasitology 36 (2006) 485–496 495

Consistent with the identification of leukocytes adherent to

the microvascular endothelium of PbA-infected mice, there

were significant increases in the mRNA expression of ICAM-1

and LFA-1, the T cell receptor for ICAM-1, within brain tissue

of PbA-infected pfpK/K and C57BL/6 mice at days 5 and 6

p.i. These findings suggest that T cell-EC interactions occur

during experimental CM, and indicate that EC activation

occurs in both strains of mice independent of damage to the

BBB or endothelium. This suggests that protection from BBB

breakdown in pfpK/Kmice is not related to suppression of the

immune response, and also that EC/leukocyte interactions

occur in the pfpK/K mice as they do in the C57BL/6 wild

type. However, in the absence of perforin these interactions do

not lead to damage to the BBB or the induction of the

downstream pathological and clinical symptoms of experi-

mental CM. TNF mRNA expression was also similar in wild

type and pfpK/K mice, though the significance of this

cytokine in the pathogenesis of experimental CM is not clear

(Hunt and Grau, 2003).

Perforin immunohistochemical staining has been used

previously to identify the presence of functionally active

CTLs within the microvasculature (Fox et al., 1993). We found

that perforin protein expression was localised within the

cerebral microvasculature and not found within the parench-

yma. These results provide further evidence of a role for

perforin in mediating damage to the microvascular endo-

thelium. Perforin protein was identified in those areas where

hemorrhage is most severe, in the olfactory bulbs and the

meninges, and was visible from as early as day 3 p.i., which is

consistent with previous reports of reduced BBB integrity at

this time point (Chan-Ling et al., 1992). Brain tissue from PbK-

infected mice, in which breakdown of the BBB does not occur,

did not reveal perforin-positive staining, which concurs with

the data obtained from mRNA expression analysis. Further

evidence of perforin-mediated damage to the BBB comes from

TUNEL and activated caspase-3 immunohistochemistry,

showing that apoptotic EC are found in significant numbers

specifically in PbA-infected C57BL/6 mouse retinae on days 5,

6 and 7 p.i.

Cytotoxic T cells have been shown to damage the

endothelium in a number of disease states, including

accelerated arteriosclerosis (Fox et al., 1993) and IL-2-induced

vascular leak syndrome (Rafi et al., 1998). Furthermore,

apoptotic EC are able to induce the upregulation of cellular

adhesion molecules on surrounding EC, leading to hyperadhe-

siveness and a potential for the augmentation of cerebral

pathology (Pino et al., 2003). It is feasible that EC present

malarial antigen, as non-professional APC, in the context of

MHC class I during blood-stage malarial infection. In vitro

studies have shown that killing of APC by antigen-specific

CD8CT cells is perforin-dependent andMHC Class I-restricted

(Loyer et al., 1999). As we have shown here, MHC class I

mRNA expression is increased during CM in the mouse.

Antigen presentation by EC has been implicated in the

prevention of autoimmunity and in the induction and

maintenance of peripheral tolerance (Marelli-Berg et al.,

2000). The control of antigenic stimulation by the elimination

of APCs may be a necessary step in limiting T cell activation

and reducing tissue damage (Spielman et al., 1998; Hermans

et al., 2000; Ludewig et al., 2001). However, as the EC of the

BBB have a specific and unique protective role, their

elimination may have much more severe consequences than

the elimination of EC within other tissues.

In conclusion, we suggest that perforin-mediated cytolysis,

via apoptosis, of activated EC leads to breakdown of the BBB

during murine experimental CM. This process is critical in the

development of further cerebral pathology. Although the

question of antigen presentation by EC and its consequences

during malaria immunity remains to be resolved, the evidence

presented here indicates a significant role for the interactions

between cerebral microvascular EC and CD8CT cells in the

development of cerebral pathology during experimental CM

infection.

Acknowledgements

We thank Dr Jane Radford for her excellent technical

assistance. This work was supported by a grant to NHH and

TCL from the National Health and Medical Research Council

of Australia. SP was supported by an Australian Postgraduate

Award.

References

Belnoue, E., Kayibanda, M., Vigario, A.M., Deschemin, J.C., van Rooijen, N.,

Viguier, M., Snounou, G., Renia, L., 2002. On the pathogenic role of brain-

sequestered alphabeta CD8CT cells in experimental cerebral malaria.

J. Immunol. 169, 6369–6375.

Brown, H., Hien, T.T., Day, N., Mai, N., Chuong, L.V., Chau, T.T., Loc, P.P.,

Phu, N.H., Bethell, D., Farrar, J., Gatter, K., White, N., Turner, G., 1999.

Evidence of blood–brain barrier dysfunction in human cerebral malaria.

Neuropath. Appl. Neurobiol. 25, 331–340.

Brown, H.C., Chau, T.T., Mai, N.T., Day, N.P., Sinh, D.X., White, N.J.,

Hien, T.T., Farrar, J., Turner, G.D., 2000. Blood–brain barrier function in

cerebral malaria and CNS infections in Vietnam. Neurology 55, 104–111.

Chang, W.L., Jones, S.P., Lefer, D.J., Welbourne, T., Sun, G., Yin, L.,

Suzuki, H., Huang, J., Granger, D.N., van der Heyde, H.C., 2001. CD8(C)-

T-cell depletion ameliorates circulatory shock in Plasmodium berghei-

infected mice. Infect. Immun. 69, 7341–7348.

Chan-Ling, T., 1994. Glial, neuronal and vascular interactions in the

mammalian retina. Prog. Retin. Eye Res. 13, 357–389.

Chan-Ling, T., 1997. Glial, vascular, and neuronal cytogenesis in whole-

mounted cat retina. Microsc. Res. Tech. 36, 1–16.

Chan-Ling, T., Neill, A.L., Hunt, N.H., 1992. Early microvascular changes in

cerebral and non-cerebral malaria detected using retinal wholemounts. Am.

J. Pathol. 140, 1121–1130.

de Souza, J.B., Riley, E.M., 2002. Cerebral malaria: the contribution of studies

in animal models to our understanding of immunopathogenesis. Microbes

Infect. 4, 291–300.

Fox III, W.M., Hameed, A., Hutchins, G.M., Reitz, B.A., Baumgartner, W.A.,

Beschorner, W.E., Hruban, R.H., 1993. Perforin expression localizing

cytotoxic lymphocytes in the intimas of coronary arteries with transplant-

related accelerated arteriosclerosis. Hum. Pathol. 24, 477–482.

Grau, G.E., Fajardo, L.F., Piguet, P.-F., Allet, B., Lambert, P.-H., Vassalli, P.,

1987. Tumor necrosis factor (cachectin) as an essential mediator in murine

cerebral malaria. Science 237, 1210–1212.

Hermans, I.F., Ritchie, D.S., Yang, J., Roberts, J.M., Ronchese, F., 2000.

CD8CT cell-dependent elimination of dendritic cells in vivo limits the

induction of antitumor immunity. J. Immunol. 164, 3095–3101.

S. Potter et al. / International Journal for Parasitology 36 (2006) 485–496496

Hermsen, C., van de Wiel, T., Mommers, E., Sauerwein, R., Eling, W., 1997.

Depletion of CD4C or CD8C T-cells prevents Plasmodium berghei

induced cerebral malaria in end-stage disease. Parasitology 114, 7–12.

Hunt, N.H., Grau, G.E., 2003. Cytokines: accelerators and brakes in the

pathogenesis of cerebral malaria. Trends Immunol. 24, 491–499.

Kagi, D., Ledermann, B., Burki, K., Seiler, P., Odermatt, B., Olsen, K.J.,

Podack, E.R., Zinkernagel, R.M., Hengartner, H., 1994. Cytotoxicity

mediated by T cells and natural killer cells is greatly impaired in perforin-

deficient mice. Nature 369, 31–37.

Looareesuwan, S., Warrell, D.A., White, N.J., Sutharasami, P.,

Chanthavanich, P., Sundaravej, K., Jeul-Jenson, B.E., Bunnag, D.,

Harinasuta, T., 1983. Do patients with cerebral malaria have cerebral

oedema? A computed tomography study. Lancet i, 434–437.

Lou, J., Lucas, R., Grau, G.E., 2001. Pathogenesis of cerebral malaria: recent

experimental data and possible applications for humans. Clin. Microbiol.

Rev. 14, 810–820.

Lowin, B., Beermann, F., Schmidt, A., Tschopp, J., 1994. A null mutation in the

perforin gene impairs cytolytic T lymphocyte- and natural killer cell-

mediated cytotoxicity. Proc. Natl Acad. Sci. USA 91, 11571–11575.

Loyer, V., Fontaine, P., Pion, S., Hetu, F., Roy, D.C., Perreault, C., 1999. The

in vivo fate of APCs displaying minor H antigen and/or MHC differences is

regulated by CTLs specific for immunodominant class I-associated

epitopes. J. Immunol. 163, 6462–6467.

Ludewig, B., Bonilla, W.V., Dumrese, T., Odermatt, B., Zinkernagel, R.M.,

Hengartner, H., 2001. Perforin-independent regulation of dendritic cell

homeostasis by CD8(C) T cells in vivo: implications for adaptive

immunotherapy. Eur. J. Immunol. 31, 1772–1779.

Ma, N., Hunt, N.H., Madigan, M., Chan-Ling, T., 1996. Correlation between

enhanced vascular permeability, upregulation of cell adhesion molecules

and monocyte adhesion in retina during fatal murine cerebral malaria. Am.

J. Pathol. 149, 1745–1762.

Marelli-Berg, F.M., Scott, D., Bartok, I., Peek, E., Dyson, J., Lechler, R.I.,

2000. Activated murine endothelial cells have reduced immunogenicity for

CD8C T cells: a mechanism of immunoregulation? J. Immunol. 165,

4182–4189.

Medana, I.M., Hunt, N.H., Chan-Ling, T., 1997. Early activation of microglia

in the pathogenesis of fatal murine cerebral malaria. Glia 19, 91–103.

Monso-Hinard, C., Lou, J.N., Behr, C., Juillard, P., Grau, G.E., 1997.

Expression of major histocompatibility complex antigens on mouse brain

microvascular endothelial cells in relation to susceptibility to cerebral

malaria. Immunology 92, 53–59.

Neill, A.L., Hunt, N.H., 1992. Pathology of fatal and resolving Plasmodium

berghei cerebral malaria in mice. Parasitology 105, 165–175.

Neill, A.L., Chan-Ling, T., Hunt, N.H., 1993. Comparisons between

microvascular changes in cerebral and non-cerebral malaria in mice,

using the retinal whole-mount technique. Parasitology 107, 477–487.

Newton, C.R.J.C., Kirkham, F.J., Winstanley, P.A., Pasvol, G., Peshu, N.,

Warrell, D.A., Marsh, K., 1991. Intracranial pressure in African children

with cerebral malaria. Lancet 337, 573–576.

Nitcheu, J., Bonduelle, O., Combadiere, C., Tefit, M., Seilhean, D., Mazier, D.,

Combadiere, B., 2003. Perforin-dependent brain-infiltrating cytotoxic

CD8CT lymphocytes mediate experimental cerebral malaria pathogenesis.

J. Immunol. 170, 2221–2228.

Patnaik, J.K., Das, B.S., Mishra, S.K., Mohanty, S., Satpathy, S.K.,

Mohanty, D., 1994. Vascular clogging, mononuclear cell margination,

and enhanced pathogenesis of human cerebral malaria. Am. J. Trop. Med.

Hyg. 51, 642–647.

Pino, P., Vouldoukis, I., Kolb, J.P., Mahmoudi, N., Desportes-Livage, I.,

Bricaire, F., Danis, M., Dugas, B., Mazier, D., 2003. Plasmodium berghei-

infected erythrocyte adhesion induces caspase activation and apoptosis in

human endothelial cells. J. Infect. Dis. 187, 1283–1290.

Potter, S., Chaudhri, G., Hansen, A., Hunt, N.H., 1999. Fas and perforin

contribute to the pathogenesis of murine cerebral malaria. Redox Rep. 4,

333–335.

Rafi, A.Q., Zeytun, A., Bradley, M.J., Sponenberg, D.P., Grayson, R.L.,

Nagarkatti, M., Nagarkatti, P.S., 1998. Evidence for the involvement of fas

ligand and perforin in the induction of vascular leak syndrome. J. Immunol.

161, 3077–3086.

Smyth, M.J., Kelly, J.M., Sutton, V.R., Davis, J.E., Browne, K.A., Sayers, T.J.,

Trapani, J.A., 2001. Unlocking the secrets of cytotoxic granule proteins.

J. Leuko. Biol. 70, 18–29.

Spielman, J., Lee, R.K., Podack, E.R., 1998. Perforin/Fas-ligand double

deficiency is associated with macrophage expansion and severe pancrea-

titis. J. Immunol. 161, 7063–7070.

Thumwood, C.M., Hunt, N.H., Clark, I.A., Cowden,W.B., 1988. Breakdown of

the blood–brain barrier in murine cerebral malaria. Parasitology 96, 579–

589.

Vikingsson, A., Pederson, K., Muller, D., 1996. Altered kinetics of CD4CT

cell proliferation and interferon-gamma production in the absence of

CD8CT lymphocytes in virus-infected beta2-microglobulin-deficient

mice. Cell Immunol. 173, 261–268.

Walsh, C.M., Matloubian, M., Liu, C.C., Ueda, R., Kurahara, C.G.,

Christensen, J.L., Huang, M.T., Young, J.D., Ahmed, R., Clark, W.R.,

1994. Immune function in mice lacking the perforin gene. Proc. Natl Acad.

Sci. USA 91, 10854–10858.

Warrell, D.A., Looareesuwan, S., Phillips, R.E., White, N.J., Warrell, M.J.,

Chapel, H.M., Areekul, S., Tharavanij, S., 1986. Function of the blood-

cerebrospinal fluid barrier in human cerebral malaria: rejection of the

permeability hypothesis. Am. J. Trop. Med. Hyg. 35, 882–889.

White, V.A., Lewallen, S., Beare, N., Kayira, K., Carr, R.A., Taylor, T.E.,

2001. Correlation of retinal haemorrhages with brain haemorrhages in

children dying of cerebral malaria in Malawi. Trans. R. Soc. Trop. Med.

Hyg. 95, 618–621.

WHO, 2000. Severe falciparum malaria. Trans. R. Soc. Trop. Med. Hyg. 94

(Suppl. 1), 1–90.

Yanez, D.M., Manning, D.D., Cooley, A.J., Weidanz, W.P., Van der

Heyde, H.C., 1996. Participation of lymphocyte subpopulations in the

pathogenesis of experimental murine cerebral malaria. J. Immunol. 157,

1620–1624.