j ourna l h om epage: www.elsev ier .com/ locate /micres
henotypic and molecular characteristics of an Aeromonas hydrophilatrain isolated from the River Nile
eata Furmanek-Blaszk ∗
epartment of Microbiology, University of Gdansk, 80-308 Gdansk, Wita Stwosza 59, Poland
r t i c l e i n f o
rticle history:eceived 14 June 2013eceived in revised form 28 October 2013ccepted 5 November 2013vailable online 15 November 2013
eywords:
a b s t r a c t
Aeromonas hydrophila, an inhabitant of aquatic ecosystems found in most parts of the world, has consid-erable virulence potential. The polymerase chain reaction technique was used to assay for the presenceof five virulence factor genes: haemolytic toxins aerA and ahh1, elastase ahyB, the enterotoxin act, andthe polar flagella flaA/flaB in the A. hydrophila strain isolated from the River Nile. Drug screening showedhigh levels of resistance to �-lactam antibiotics and tetracycline. Slime production was determined bythe Congo red agar plate test. The isolate produced two restriction enzymes named AehI and AehII which
irulence propertiesntimicrobial resistancelasmid
are isoschizomers of XhoI and StuI respectively. The complete nucleotide sequence of the cryptic plasmidpAhy2.5 (2524 bp) from this strain was determined. Sequence analysis revealed the presence of two openreading frames (ORFs) encoding putative proteins. The protein coded by ORF1 is homologous with Repproteins of plasmids belonging to the pC194 family, which are known to replicate by the rolling-circlemechanism. The putative double-strand origin of replication and a region with palindromic sequences
ingle-
that could function as a s
. Introduction
The genus Aeromonas comprises a collection of Gram-negativeacteria that have been implicated in a wide spectrum of diseases
n both humans and fish (Janda and Abbott 2010). Aeromonads cane divided into two groups; the first includes the psychotrophiceromonas, represented by Aeromonas salmonicida and the sec-nd by the mesophilic Aeromonas such as Aeromonas hydrophilaSeshadri et al. 2006). Among the species belonging to this genus,. hydrophila has attracted attention due to its frequent associationith infection in humans, including septicaemia, wound infec-
ions and gastroenteritis. It is a major etiologic agent of motileeromonads septicaemia in a variety of aquatic animals. A numberf virulence factors derived from A. hydrophila have been proposedn an effort to explain the pathogenesis of infections due to theserganisms, including toxins with haemolysins, enterotoxins,ndotoxins and adhesions which together contribute to overallisease progress.
Naturally occurring plasmids, encoding different virulence fac-ors, have been identified in the genus Aeromonas (Brown et al.997; Majumdar et al. 2007). The presence of plasmids in these
otentially pathogenic microorganisms may present a potentialublic health hazard, because they may be transferred from animalso man (Bello-Lopez et al. 2010; Janda and Abbott 2010).
The objectives of this study were to (i) search for the presenceof the virulence gene in the isolate, (ii) determine the antimicrobialsensitivity of the isolate, (iii) test the strain for the presence of site-specific restriction endonuclease activity and (iv) investigate thesmall plasmid pAhy2.5 present in this strain. This plasmid was fullysequenced and further characterized at the genomic level.
2. Materials and methods
2.1. Growth conditions
The studied A. hydrophila strain was isolated from the River Nile,near the Aswan Dam, Egypt. Bacterial colonies were grown on LuriaBretani (LB) agar plates and subjected to the Gram stain. The strainwas identified using different biochemical methods: the VITEK2system (bioMerieux) and an API 20E test kit (bioMerieux). Molecu-lar sequencing of the DNA fragment containing the 16S–23S inter-genic spacer corresponding to the conserved region of 16S rDNA(Martinez-Murcia et al. 1992) allowed for an unambiguous classi-fication of the isolate as A. hydrophila. The bacteria was maintainedon LB agar plates at room temperature and for long-term storagekept frozen at −70 ◦C in LB broth supplemented with 20% glycerol.
2.2. Virulence factors and antimicrobial susceptibility
To determine the haemolytic activity, the A. hydrophila strainwas plated onto blood agar plates. Haemolysin production was
respectively (Fig. 1). This is in agreement with earlier studies thatthe occurrence of haemolytic factors in aeromonads is widespreadand their presence can be used as indicators of virulence (Zhanget al. 2000).
Fig. 1. Detection and identification of Aeromonas hydrophila virulence genes by
48 B. Furmanek-Blaszk / Microbiol
ecorded as clearance of the medium around bacterial colonies after4 h at 37 ◦C.
The Congo Red Agar plate test was prepared by adding 0.8 g ofongo red and 50 g of sucrose, both of which had been previouslyutoclaved separately into 1L of Brain Heart Infusion agar (Freemant al. 1989). The studied A. hydrophila strain was grown on platesor 24 h in 37 ◦C and 48 h at room temperature.
Antibiotic susceptibility was determined by the standard disk-iffusion method on Mueller-Hinton (MH) agar plates, using OXOIDntibiotic disks. The A. hydrophila strain was grown overnight inB broth, the turbidity of the cell suspensions was adjusted tohat equivalent of a 0.5 McFarland standard and used to inoculate
H agar plates, which were incubated at 30 ◦C for 24 h. Antibi-tic susceptibility was determined by measuring the diameter ofhe clear zone. Resistance profiles were assigned using Clinical andaboratory Standards Institute (2011) breakpoints.
.3. DNA isolation and PCR amplification
The genomic DNA and plasmid DNA used in this studyere isolated using Genomic Mini and Plasmid Mini Kits (A&Aiotechnology, Poland). The presence of the following genes encod-
ng virulence factors was determined in the isolate: cytolyticeat-labile enterotoxin act, cytotonic heat-labile enterotoxin alt,ytotonic heat-stable enterotoxin ast, aerolysin aerA, haemolysinhh1, ahyB for elastase, flaA/flaB for polar flagella and lafA for lat-ral flagella. Primers based on the A. hydrophila ATCC 7966 16S rRNAequence were used to amplify a portion of the 16S rRNA gene asn internal control. The details of primers used and their corre-ponding amplicons are shown in Table 1. The identity of each PCRroduct was confirmed by nucleotide sequencing.
.4. Purification of restriction endonucleases
The occurrence of restriction endonucleases in the A. hydrophilatrain was tested by the modified lysozyme and Triton X-100ethod (Belavin et al. 1988). Bacterial cells were collected from
etri dishes and transferred into 20 �l of incubation mixture Aontaining 20 mM Tris–HCl, pH 8.0, 1000 mM NaCl, 12.5 mM EDTA,0 mM 2-mercaptoethanol (ME), and lysozyme at a concentrationf 10 g/L. The sample was incubated for 30 min at room temperaturend then 20 �l of incubation mixture B containing 20 mM Tris–HCl,H 8.0, 2% Triton X-100 and 10 mM ME was added for 60 min at◦C. The restriction endonuclease activity was assayed in 20 �l of
eaction mixture containing 0.1 �g �DNA, 2 �l restriction bufferango and 2 �l of bacterial lysate cleared by centrifugation for 1 min10,000 × g). For the purpose of further characterization, restrictionndonucleases were purified using ion-exchange chromatography.rom a 1000 ml of overnight culture cells were harvested, resus-ended in 20 ml of buffer S (10 mM potassium phosphate pH 6.5,0 mM KCl, 1 mM EDTA, 10 mM ME, 5% glycerol) supplementedith a protease inhibitor 0.1 mM phenyl-methyl-sulfonyl-fluoride
nd disrupted by sonication at 4 ◦C in 60 × 10-s bursts. After cen-rifugation, the supernatant was applied to a phosphocellulose11 column equilibrated with buffer S. The proteins were elutedith a 150 ml KCl gradient (20–1000 mM) in the same buffer. The
ctive fractions were dialysed against buffer S, loaded onto a CM-ephadex C-50 column, and eluted with 150 ml of a linear gradientf KCl from 25 mM to 1000 mM.
.5. Sequencing strategy
The pAhy2.5 DNA was initially separately digested with dif-erent restriction endonucleases, to identify suitable fragmentshat could be generated for cloning purposes. When pAhy2.5as digested with the enzyme MlsI, one restriction fragment
Research 169 (2014) 547–552
approximately 2.5 kb could be observed (data not shown). Thisfragment was gel eluted, followed by ligation into HincII digestedcloning vector pUC18. The ligation mixture was transformedinto Escherichia coli DH5� cells. The transformant containing thedesired recombinant plasmid was designated pAhy5.2. For ini-tial sequence information, cycle sequencing reactions were carriedout using recombinant plasmid and the vector-specific universalprimers M13 forward or M13 reverse. The nucleotide sequencewas determined by the cycle sequencing method using the BigDyeTerminator V3 1 Cycle Sequencing Kit as recommended by themanufacturer [Applied Biosystems Inc., USA]. The sequence infor-mation obtained from the pAhy5.2 recombinant clone was used todesign sequence specific primers. Using these primers, the com-plete nucleotide sequence of the plasmid pAhy2.5 was determinedand has been deposited in the NCBI GenBank database under theaccession number KC525245.
3. Results and discussion
3.1. Virulence factors and antimicrobial susceptibility
Strains of Aeromonas release a variety of virulence factors whichare important for their pathogenicity (Janda and Abbott 2010).The majority of A. hydrophila virulent strains secrete at leasttwo types of haemolysins (Wang et al. 2003). One of them ischannel-forming aerolysin (AerA) and the second a non-channel-forming haemolysin AHH1 showing 50% identity to a Vibrio choleraeHlyA haemolytic toxin. Both toxins contribute to virulence in A.hydrophila and are widespread within virulent strains of motileaeromonads (Wong et al. 1998).
The A. hydrophila isolate exhibited �-haemolytic activity onblood agar plates (data not shown). To confirm further the presenceof haemolysins in this strain the PCR method targeting the virulencegenes was used. The sizes of the amplification products were iden-tical to those predicted from the designed primers (Table 1). ThePCR revealed the presence of an amplification product at 356 bpcharacteristic for the genus Aeromonas and allowed the detectionof haemolytic gene fragments 130 bp and 309 bp for aerA and ahh1,
amplification of fragments in the PCR assay. Lane 1, DNA size marker 50-bp GeneRuler (Fermentas); lane 2, the ahh1 gene (130 bp fragment); lane 3, the act gene(232 bp fragment); 4, the aerA gene (309 bp fragment); lane 5, A. hydrophila 16SrRNA internal control showing a 356 bp fragment; lane 6, the ahyB gene (513 bpfragment); 7, flaA/flaB genes (608 bp fragment).
B. Furmanek-Blaszk / Microbiological Research 169 (2014) 547–552 549
Table 1Primers used for amplification.
Primer pair Sequence (5′–3′) Size of amplified product (bp) References
AHH1F/AHH1R GCCGAGCGCCCAGAAGGTGAGTT/GAGCGGCTGGATGCGGTTGT 130 Wang et al. (2003)AH-aerAF/AH-aerAR CAAGAACAAGTTCAAGTGGCCA/ACGAAGGTGTGGTTCCAGT 309 Wang et al. (2003)A16SF/A16SR GGGAGTGCCTTCGGGAATCAGA/TCACCGCAACATTCTGATTTG 356 Wang et al. (2003)ElasF/ElasR ACACGGTCAAGGAGATCAAC/CGCTGGTGTTGGCCAGCAGG 513 Sen and Rodgers (2004)FlaF/FlaR TCCAACCGTYTGACCTC/GMYTGGTTGCGRATGGT 608 Sen and Rodgers (2004)LafA1/LafA2 GGTCTGCGCATCCAACTC/GCTCCAGACGGTTGATG 550 Merino et al. (2003)
CTTGAAGCCGC
ttvttpifltb
alAfScrfait
bpacoR
wTcSrttt2
asbTb�lacTb(
of all five highly conserved characteristic motifs of the replicationinitiator proteins of RCR replicons belonging to the pC194 plasmidfamily (del Solar et al. 1998). The cysteine-rich motif I is a potential
Table 2The antibiotic sensitivity and resistance pattern of an Aeromonas hydrophila isolate.
Since virulence in Aeromonas is considered to be multifactoral,he PCR approach to detect more virulence genes was used. Thehree enterotoxins Act, Alt, and Ast have been implicated as majorirulence factors in diarrhoeal disease, however the presence ofhese toxins may not be sufficient for virulence (Sha et al. 2002). Theemperature-stable metalloprotease AhyB with elastolytic activitylays an important role in the invasiveness and establishment of
nfection (Janda and Abbott 2010). Both lateral (Laf) and polar (Fla)agella are involved in the initial attachment of bacteria to the gas-rointestinal epithelium and the subsequent adherence process andiofilm formation (Cascon et al. 2000).
The A. hydrophila isolate was found to posses genes act, ahyBnd flaA/flaB, while genes for enterotoxins Alt and Ast, and theateral flagella LafA were not identified. The cytolytic enterotoxinct, protease AhyB and polar flagella Fla are important virulence
actors in aeromonads (Kingombe et al. 1999; Cascon et al. 2000;en and Rodgers 2004), however the exact combinations of spe-ific microbial determinants involved in the pathogenesis processemains unknown. These results show that A. hydrophila isolateound in environmental water possess a wide variety of virulence-ssociated genes and suggest the importance of examining as manysolates as possible in order to better understand the health riskhese bacteria may present.
The application of the PCR assay to detect virulence genes hasecome a specific and easy method for identifying potentiallyathogenic Aeromonas spp. The presence of virulence determinantss genetic markers has been widely used in many epidemiologi-al studies to differentiate pathogenic from non-pathogenic strainsf Aeromonas (Kingombe et al. 1999; Wang et al. 2003; Sen andodgers 2004).
The production of slime by the A. hydrophila strain under studyas assessed by culturing the strain on Congo red agar plates.
he isolate was found to be slime positive, producing black shinyolonies with a metallic tinge whereas the non-slime producer,taphylococcus epidermidis reference strain test ATCC 12228, lookeded (data not shown). Slime production is thought to be one ofhe virulence factors responsible for biofilm formation. This pro-ective layer is highly significant to the pathogenesis and appearso contribute to infections in fish and humans (Janda and Abbott010).
The resistance of the A. hydrophila pattern isolate toward 22ntimicrobial agents tested is shown in Table 2. As expected thistrain displayed resistance toward most of �-lactam antibioticsut was susceptible to the 1st and 3rd generation cephalosporins.he �-lactam resistance phenotype may be explained in party Aeromonas spp.’s naturally occurring, chromosomally encoded-lactamases (Jacobs and Chenia 2007). The A. hydrophila iso-
ate showed susceptibility to chloramphenicol, co-trimoxazole,minoglycosides and quinolones. While this strain displayed sus-
eptibility to doxycycline, resistance to tetracycline was observed.he isolate in the present study appeared to have a suscepti-ility profile similar to environmental, fish and clinical isolatesJacobs and Chenia 2007). However, data regarding antimicrobial
ACTC 232 Kingombe et al. (1999)G 331 Sen and Rodgers (2004)
442 Sen and Rodgers (2004)
resistance for A. hydrophila have varied. Differences in antimicrobialsusceptibility between Aeromonas may be related to the source ofthe isolates and the frequency of use of antimicrobial agents pre-scribed for treating Aeromonas infection in a specific geographicarea (Son et al. 1997; Aravena-Roman et al. 2012).
3.2. Complete nucleotide sequence of pAhy2.5
When the total cellular DNA of A. hydrophila was separated byelectrophoresis through a 1% agarose gel, a single extra chromo-somal DNA band was observed (data not shown). To investigatethis extrachromosomal element in greater detail, plasmid DNA waspurified. Restriction analysis identified a single plasmid of about2.5 kb designated pAhy2.5. The occurrence of pAhy2.5 was notaffected by the bacterial growth stage or repeated subculturing.To shed further light on the possible significance of pAhy2.5 inA. hydrophila antibiotic resistance and/or virulence, the nature ofthe plasmid was examined. The nucleotide sequence analysis ofpAhy2.5 revealed a circular molecule of 2524 bp with a mean GCcontent of 56.5% which is lower than that of A. hydrophila chromo-somal DNA (61.5%) (Seshadri et al. 2006). Computer analysis of thesequence of pAhy2.5 revealed the presence of seven putative ORFswith at least 95 amino acid codons in length. However, only twoORFs which have the same transcription direction on the plasmidwere predicted to encode putative proteins (Fig. 2). To attributefunctions to the deduced products of the ORFs, these were com-pared to the gene products available in the databases. Thus ORF1,which starts with an ATG codon, contains 1284 bp and is foundbetween coordinates (140–1423) encodes a protein showing a rel-atively high amino acid sequence similarity with several plasmidreplication proteins. The Rep protein shares 28% and 27% identityover its whole length with the putative replication proteins of thepC194 plasmid family encoded in plasmids pJS46 (GenBank acces-sion no. AAV68396) from Comamonas sp and pBL63 (NCBI referencesequence YP 227352) from Bacillus licheniformis, respectively. Thehighest similarities (39%) between the ORF1 product and these pro-teins were observed mainly in the central and C-terminal parts ofthese proteins. Amino acid sequence analysis revealed the presence
ig. 2. Schematic map of pAhy2.5. Some restriction sites and their positions arehown. Closed arrows indicate the two ORFs.
etal-binding motif that is shared with Rep proteins of the pC194amily. Motif III contains two conserved histidine residues which
ay act as ligands for the Mg2+ and Mn2+ ions required for the Repunction. Motif IV includes the conserved tyrosine residue that haseen proposed to be involved in DNA cleavage and linking. Motif, also known as the C-terminal motif, is involved in nucleophilicttack of the newly synthesized leading strand near the replica-ion termination site. In contrast to the above described motifs, theunction of motif II, conserved among RCR plasmids, remains to belucidated.
ORF2 spans positions 1973–2269 and encodes a hypotheticalrotein of 98 amino acids, which shared 37–59% identity withypothetical proteins found in various Aeromonas spp. (Fig. 3) andnrelated bacteria. In addition to the sequence similarity, the orf2-
ike genes are all positioned in close proximity to the rep geneuggesting that orf2 may be involved in replication of these plas-ids. These two genes were organized similar to the corresponding
enes for plasmid replication in the plasmids pAsa3, pAsa1 isolatedrom A. salmonicida subsp. salmonicida A449 (Boyd et al. 2003) andAQ2-1, pAQ2-2 isolated from Aeromonas sobria SNUFPC-A1 and A.ydrophila SNUFPC-A5, respectively (Han et al. 2012).
In addition to the five conserved motifs in the replicationroteins, RC plasmids are characterized by the presence of dou-le (dso)- and single (sso)-stranded origins of replication. In theAhy2.5 sequence these elements were predicted in the intergenicegion upstream of the rep gene on the same strand. The non-codingegion between 2270 nt and 139 nt located upstream of the rep genexhibits multiple inverted repeated sequences that are typical forhe origin of replication of some RCR plasmids. This DNA fragmentontains two possible hairpin loops which are positioned from nt275 to nt 2333 and from nt 2355 to nt 2390. Usually, the nickegions, important in the binding of the Rep protein and the nickingf the double strand, are highly conserved in the dsos of all plas-ids belonging to the same family, while the binding sequences
f the dsos are less well conserved (Khan 2005). Moreover, the dsos present in a plasmid region that has the potential to form sec-ndary structures. Having identified the gene encoding a potentialep protein of the pC194 type, the search for the correspondingrigin of replication in the pAhy2.5 plasmid was performed. Such
sequence is located upstream of the rep gene and contains theighly conserved sequence 5′-CTTGATA-3′, identical to the originescribed for the plasmid pC194 group (del Solar et al. 1998).
The nucleotide sequences of the ssos of RCR plasmid are notell conserved and generally exist within the region characterized
y inverted repeats that form strong secondary structures occur-ing in proximity to the dsos (del Solar et al. 1998). In the loopf these hairpin structures it is often possible to find a conservedequence termed CS-6 (5′-TAGCGt/a-3′) that was shown by Kramer
Research 169 (2014) 547–552
et al. (1997) to be involved in the termination of primer RNA synthe-sis. In pAhy2.5, a 59 bp long inverted-repeat sequence, able to forma potential stem-and-loop structure, was located from nt 2275 to2333. This putative secondary structure shows extensive sequencehomology (84–89%) with the sso of various Gram-negative bacterialplasmids (GenBank accession number in brackets): p40-95A fromSalmonella sp. (JQ418539), pKYM from Shigella sonnei (S77326),pO145-NM from E. coli (HM38194). Within the loop region there isa sequence 5′-TTGTGG-3′ which shares three out of six nucleotideswith the CS-6 motif.
Aeromonads are known to carry plasmids encoding antibioticresistance and/or virulence determinants (Borrego et al. 1991;Majumdar et al. 2007). There are studies which reported Aeromonasstrains harboring one or more plasmids (Borrego et al. 1991; Sonet al. 1997; Boyd et al. 2003) but their exact role in virulence isyet to be established. The presence of plasmids in these poten-tially pathogenic bacteria may facilitate the exchange of geneticinformation between different Aeromonas species and between thehuman and aquaculture environments. Plasmids are considered thepredominant factors mediating horizontal gene transfer betweenbacteria in the environment (Halary et al. 2010). However, neitherthe antibiotic resistance nor virulence of A. hydrophila has beenfound to be associated with the pAhy2.5 plasmid. Therefore, thegenes conferring resistance toward antibiotics could be locatedelsewhere in the chromosomal or in other endogenous plasmids.The role of other ORFs of pAhy2.5 is presently unknown but mayconfer advantages to the isolate which carries them in a particularenvironment.
3.3. Characterization of restriction endonucleases
Numerous bacterial species harbor restriction-modification(R-M) systems as a prokaryotic defense mechanism against bac-teriophage infection (Roberts et al. 2007). The ability of the type IIrestriction endonucleases to cleave DNA only at their recognitionsites makes these enzymes important tools in molecular biologyand genetic engineering. Due to the virulence of pathogenic bacte-ria only a few studies have been conducted to assess the presence ofrestriction enzymes in the bacterial cell. Locally growing microor-ganisms offer the chance to isolate new restriction endonucleases,for this reason A. hydrophila was tested for the occurrence of theseenzymes. A two-step purification protocol was used for isolationof restriction enzymes from a culture of A. hydrophila. Phospho-cellulose P11 chromatography of the cell extract resulted in thedetection of two peaks of site specific endonucleolytic activities.The endonucleases named AehI and AehII were eluted at 0.2–0.35 MKCl and 0.35–0.5 M KCl, respectively. To separate proteins of bothpeaks the central fractions in each case were run on CM-SephadexC50. To determine the recognition sequences of enzymes, restric-tion sites were mapped on � DNA. The restriction data suggestthat � DNA is cleaved by AehI at one site producing two frag-ments of approximate sizes 33,000 and 15,000 bp (Fig. 4). TheAehII restriction endonuclease cleaved � DNA into four fragments(approximately 19,000, 12,000, 8000, 7000 bp) (Fig. 4). The tar-get sequences of purified enzymes were inferred from restrictionmapping of recognition sites on � DNA using double digestionswith restriction endonucleases EcoRI or HindIII (data not shown).Based on the restriction patterns obtained from single and doubledigestions of � DNA it was assumed that AehI and AehII rec-ognize 5′-CTCGAG-3′ and 5′-AGGCCT-3′ sequences respectively.Computer-generated fragment sizes of � DNA after cleavage withXhoI and StuI prototypes of type II restriction endonucleases were
in close agreement with the fragment sizes observed experimen-tally for AehI and AehII. The type of isoschizomer and the identityof the restriction profile were confirmed by double digestion of �DNA by AehI-XhoI and AehII-StuI. To date, isoschizomer of AehI
B. Furmanek-Blaszk / Microbiological Research 169 (2014) 547–552 551
Fig. 3. Alignment of the deduced amino acid sequences of pAhy2.5 ORF2 and putative replication proteins from Aeromonas spp. The GenBank accession numbers of proteins A. salmS . hydr1
h1b
iddTsrvctRtD
FsAA
equences are given in parenthesis. A. salmonicida 01-B256 (EHI50146) contig 121,
NUFPC-A1 (AEW70680) pAQ2-1, A. hydrophila SNUFPC-A5 (AEW70684) pAQ2-2, A.1, A. salmonicida (CAD48426) pAsal2.
as been detected in the A. hydrophila AH63 strain (Miyahara et al.996), however an AehII counterpart in aeromonads has not yeteen reported.
Frequently, newly discovered enzymes are found to cut DNAn patterns identical to those of previously isolated enzymes. Theata presented shows that restriction endonucleases AehI and AehIIisplay an identical cleavage pattern as XhoI and StuI respectively.hus, it is reasonable to postulate the existence of similar type IIR-Mystems in A. hydrophila. The occurrence of relatively rarely cuttingestriction endonucleases is an interesting but not unusual obser-ation and could be attributed to the horizontal transfer of genesoding for these systems. In complex microbial ecosystems such ashe reservoir, rich in bacteriophages and free DNA, possession of-M systems might provide important advantages to the host pro-
ecting it from genome subversion through any invading foreignNA.
ig. 4. Restriction endonucleases of Aeromonas hydrophila characterized in thistudy. Agarose gel electrophoresis of �-DNA digests. Lanes: (1) �-DNA cleaved byehII; (2) �-DNA cleaved by StuI; (3) �-DNA cleaved by XhoI; (4) �-DNA cleaved byehI; (5) DNA size marker, �-DNA cleaved by HindIII.
onicida A449 (AAP69900) pAsa3, A. salmonicida A449 (AAP69885) pAsa1, A. sobriaophila SNUFPC-A8 (AEW70672) pAHH01, A. veronii AER39 (EKB18347) supercontig
The increasing interest in bacteria belonging to the genusAeromonas has grown over the past two decades due its path-ogenicity for aquatic organisms and humans. The potential riskfrom Aeromonas spp. isolated from aquatic environments to humanhealth has been noted by several researchers (Bello-Lopez et al.2010; Janda and Abbott 2010). Cases of infections in healthy peopleassociated with recreational water activities have been described,as have cases of pneumonia following aspiration of contaminatedrecreational water. The fact that virulence factors are present in theenvironmental A. hydrophila strain suggests that the aquatic envi-ronment may act as a reservoir of potentially virulent Aeromonasspp.
Acknowledgments
The author thanks Agnieszka Kobylska for technical assistanceand Martin Blaszk for excellent help with editing this manuscript.
References
Aravena-Roman M, Inglis TJJ, Henderson B, Riley T, Chang BJ. Antimicrobial suscep-tibilities of Aeromonas strains isolated from clinical and environmental sourcesto 26 antimicrobial agents. Antimicrob Agents Chemother 2012;56(2):1110–2.
Belavin PA, Dedkov VS, Degtyarev S. Kh. A simple technique for detection ofrestriction endonucleases in bacterial colonies. Appl Biochem Microbiol (Russia)1988;24(1):121–4.
Bello-Lopez JM, Fernandez-Rendon E, Curiel-Quesada E. In vivo transfer of plasmidpRAS1 between Aeromonas salmonicida and Aeromonas hydrophila in artificiallyinfected Cyprinus carpio L. J Fish Dis 2010;33(3):251–9.
Borrego JJ, Morinigo MA, Martinez-Manzanares E, Bosca M, Castro D, Barja JL, et al.Plasmid associated virulence properties of environmental isolates of Aeromonashydrophila. J Med Microbiol 1991;35(5):264–9.
Boyd J, Williams J, Curtis B, Kozera C, Singh R, Reith M. Three small, cryp-tic plasmids from Aeromonas salmonicida subsp. salmonicida A449. Plasmid2003;50(2):131–44.
Brown RL, Sanderson K, Kirov SM. Plasmids and Aeromonas virulence. FEMS ImmunMed Microbiol 1997;17(4):217–23.
Cascon A, Yugueros J, Temprano A, Sanchez M, Hernanz C, Luengo JM, et al. A major
secreted elastase is essential for pathogenicty of Aeromonas hydrophila. InfectImmun 2000;68(6):3233–41.
Clinical and Laboratory Standards Institute. Performance standards for antimicro-bial susceptibility testing: Twenty First Informational Supplement M100-S21.Wayne, PA: CLSI; 2011.
genes in Aeromonas hydrophila attenuates virulence in a suckling mouse model.Microbiology 1998;144(2):291–8.
Zhang YL, Ong CT, Leung KY. Molecular analysis of genetic differences between vir-ulent and avirulent strains of Aeromonas hydrophila isolated from diseased fish.
52 B. Furmanek-Blaszk / Microbiol
el Solar G, Giraldo R, Ruiz-Echevarria MJ, Espinosa M, Diaz-Orejas R. Repli-cation and control of circular bacterial plasmids. Microbiol Mol Biol Rev1998;62(2):434–64.
reeman DJ, Falkiner FR, Keane CT. New method for detecting slime production bycoagulase negative staphylococci. J Clin Pathol 1989;42(8):872–4.
alary S, Leigh JW, Cheaib B, Lopez P, Bapteste E. Network analyses structuregenetic diversity in independent genetic worlds. Proc Natl Acad Sci U S A2010;107(1):127–32.
an JE, Kim JH, Choresca CH Jr, Shin SP, Jun JW, Chai JY, et al. First description of ColE-type plasmid in Aeromonas spp. carrying quinolone resistance (qnrS2) gene. LettAppl Microbiol 2012;55(4):290–4.
acobs L, Chenia HY. Characterization of integrons and tetracycline resistance deter-minants in Aeromonas spp. isolated from South African aquaculture systems. IntJ Food Microbiol 2007;114(3):295–306.
anda JM, Abbott SL. The genus Aeromonas: taxonomy, pathogenicity, and infection.Clin Microbiol Rev 2010;23(1):35–73.
han SA. Plasmid rolling-circle replication: highlights of two decades of research.Plasmid 2005;53(2):126–36.
ingombe CI, Huys G, Tonolla M, Albert MJ, Swings J, Peduzzi R, et al. PCR detec-tion, characterization and distribution of virulence genes in Aeromonas spp. ApplEnviron Microbiol 1999;65(12):5293–302.
ramer MG, Khan SA, Espinosa M. Plasmid rolling circle replication: identification ofthe RNA polymerase-directed primer RNA and requirement for DNA polymeraseI for lagging strand synthesis. EMBO J 1997;16(18):5784–95.
ajumdar T, Datta S, Ghosh D, Dutta S, Chakraborty A, Goswami R, et al. Role ofvirulence plasmid of Aeromonas hydrophila in the pathogenesis of ulcerativedisease syndrome in Clarias batrachus. Ind J Biochem Biophys 2007;44(5):401–6.
artinez-Murcia AJ, Benlloch S, Collins MD. Phylogenetic interrelationships of mem-
bers of the genera Aeromonas and Plesiomonas as determined by 16S ribosomalDNA sequencing: lack of congruence with results of DNA–DNA hybridizations.Int J Syst Bacteriol 1992;42(3):412–21.
erino S, Gavin R, Vilches S, Shaw JG, Tomas JM. A colonization factor(production of lateral flagella) of mesophilic Aeromonas spp. is inactive
Research 169 (2014) 547–552
in Aeromonas salmonicida strains. Appl Environ Microbiol 2003;69(1):663–7.
Miyahara M, Kimizuka F, Kita A, Matsushita S, Kudo Y, Shimada T, et al. Isolationand characterization of restriction endonuclease in Plesiomonas shigelloides andAeromonas species. Biol Pharm Bull 1996;19(11):1506–7.
Roberts RJ, Vincze T, Posfai J, Macelis D. REBASE – enzymes and genes for DNArestriction and modification. Nucl Acids Res 2007;35(Suppl. 1):D269–70.
Sen K, Rodgers M. Distribution of six virulence factors in Aeromonas species iso-lated from US drinking water utilities: a PCR identification. J Appl Microbiol2004;97(5):1077–86.
Seshadri R, Joseph SW, Chopra AK, Sha J, Shaw J, Graf J, et al. Genomesequence of Aeromonas hydrophila ATCC 7966T: jack of all trades. J Bacteriol2006;188(23):8272–82.
Sha J, Kozlova EV, Chopra AK. Role of various enterotoxins in Aeromonashydrophila-induced gastroenteritis: generation of enterotoxin gene-deficientmutants and evaluation of their enterotoxic activity. Infect Immun 2002;70(4):1924–35.
Son R, Rusul G, Sahilah AM, Zainuri A, Raha AR, Salmah I. Antibiotic resistanceand plasmid profile of Aeromonas hydrophila isolates from cultured fish, Telapia(Telapia mossambica). Lett Appl Microbiol 1997;24(6):479–82.
Wang G, Clark CG, Liu C, Pucknell C, Munro CK, Kruk TMAC, et al. Detection andcharacterization of the hemolysin genes in Aeromonas hydrophila and Aeromonassobria by multiplex PCR. J Clin Microbiol 2003;41(3):1048–54.
Wong CYF, Heuzenroeder MW, Flower RLP. Inactivation of two haemolytic toxin
