Phosphorylation analysis of measles matrix, nucleo- and phosphoprotein by phosphate affinity gel electrophoresis
Riia Jrvi, Faculty of Agriculture and Forestry, August 2015
Riia Jrvi
Masters thesis
University of Helsinki
HEBIOT
Biotechnology
August 2015
HELSINGIN YLIOPISTO HELSINGFORS UNIVERSITET UNIVERSITY OF HELSINKI
Tiedekunta/Osasto Fakultet/Sektion Faculty
Maatalous-metstieteellinen tiedekunta
Laitos Institution Department
Elintarvike- ja ympristtieteiden laitos
Tekij Frfattare Author
Riia Jrvi
Tyn nimi Arbetets titel Title
Tuhkarokkoviruksen matriksi-, nukleo- ja fosfoproteiinin fosforylaatioanalyysi fosfaatti-
affiniteettigeelielektroforeesilla
Oppiaine Lromne Subject
Biotekniikka
Tyn laji Arbetets art Level
Maisterintutkielma Aika Datum Month and year
Elokuu 2015 Sivumr Sidoantal Number of pages
80
Tiivistelm Referat Abstract
Vaikka rokote tuhkarokkoa vastaan kehitettiin jo vuonna 1963, vuonna 2012 oli edelleen
122 000 tuhkarokon aiheuttamaa kuolemantapausta Maailman terveysjrjest WHO:n
mukaan. Yli 95 % kuolemantapauksista tapahtuu kehitysmaissa, mutta tautiaaltoja ilmenee
edelleen mys alueilla, joilla on tehokkaat rokotusohjelmat. Taudin puhkeaminen nill
alueilla johtuu tuhkarokon erittin suuresta tarttuvuudesta sek laumaimmuniteetin laske-
misesta rokotuksista kieltytymisen tai immunisoinnin eponnistumisen takia. Tuhkarok-
ko saattaa aiheuttaa vakavia komplikaatioita, eik sen hoitamiseen ole spesifist antiviraa-
lista lkett. Lisksi samassa paramyksovirusten ryhmss on muitakin ihmispatogeene-
ja, joille ei ole viel kehitetty spesifist hoitoa tai edes rokotetta: parainfluenssa (PIV) sek
RS-virus (HRSV).
Tuhkarokkoviruksella on ssRNA genomi, joka on pakattu kierteisen nukleoproteii-
nikapsidin sislle. Fosfoproteiini (P) est nukleoproteiineja (N) polymerisoitumasta en-
nenaikaisesti pitmll nm monomeerisina. P toimii mys kofaktorina viruksen geno-
min replikoinnissa ja transkriptiossa auttamalla polymeraasia psemn ksiksi
nukleoproteiinikapsidin sisll olevaan genomiin. Matriksiproteiini (M) auttaa kon-
sentroimaan ribonukleokapsidit kohtiin, joista uudet viruspartikkelit vapautuvat isntso-
lusta.
Tuhkarokkoviruksen proteiinien fosforylaatio vaikuttaa viruksen vuorovaikutukseen
infektoimansa isntsolun kanssa. Tss maisterintutkielmassa tuotin ja puhdistin rekom-
binantti N-, P- ja M-proteiineja sek villityypin tuhkarokkovirusta. Selvitin, ovatko ko.
proteiinit fosforyloituneet yksin ilmentynein tai P-N kompleksissa kyttmll Kinoshi-
ta et al. (2006) kehittm fosfaattiaffiniteettigeelielektroforeesia. Ko. menetelmss ky-
tetn apuna proteiinien fosfaattiryhmi reversiibelisti sitovia merkkimolekyylej. Tuhka-
rokon proteiinien post-transkriptionaalisten muokkausten merkityksen selvittminen valot-
taisi paramyksoviruksen rakennetta ja signalointia sek voisi edesauttaa biolketieteellis-
ten sovellusten synty. Avainsanat Nyckelord Keywords
matriksiproteiini, tuhkarokkovirus, Mononegavirales-infektiot, Morbillivirus-infektiot,
nukleoproteiini, Paramyxoviridae-infektiot, fosfaattiaffiniteettielektroforeesi, fosfaattiin
sitoutuva merkkiaine, fosfoproteiini, pleomorfinen virus, RNA-virusinfektiot, virustaudit Silytyspaikka Frvaringsstlle Where deposited
HELDA Muita tietoja vriga uppgifter Further information
Vastuuprofessori: professori Annele Hatakka
Kokeellisen osuuden ohjaaja: professori Sarah Butcher
Muu ohjaaja: tohtori Lassi Liljeroos
HELSINGIN YLIOPISTO HELSINGFORS UNIVERSITET UNIVERSITY OF HELSINKI
Tiedekunta/Osasto Fakultet/Sektion Faculty
Faculty of Agriculture and Forestry
Laitos Institution Department
Department of Food and Environmental
Sciences
Tekij Frfattare Author
Riia Jrvi
Tyn nimi Arbetets titel Title
Phosphorylation analysis of measles matrix, nucleo- and phosphoprotein by phosphate
affinity gel electrophoresis
Oppiaine Lromne Subject
Biotechnology
Tyn laji Arbetets art Level
Masters thesis Aika Datum Month and year
August 2015 Sivumr Sidoantal Number of pages
80
Tiivistelm Referat Abstract
Although a vaccine for measles was developed already in 1963 by Enders et al., in 2012
there were still 122 000 deaths caused by measles according to the World Health
Organization. More than 95% of the incidences happen in developing countries, but there
are still outbreaks also in areas with good vaccination programs. In these regions, the
onset of decease happens because of the extreme high infectivity of the measles virus
(MV) and the decrease of herd immunity of a population because of vaccine refusals or
other fails to immunize. Measles can cause serious complications and there is not a
specific antiviral treatment for it. In addition, there are also other human pathogens in the
same group of paramyxoviruses that have not a specific cure or even a vaccine:
parainfluenza (PIV) and Human respiratory syncytial virus (HRSV).
MV has ssRNA genome that is packed inside a helical nucleoprotein capsid.
Phosphoprotein (P) keeps the nucleoproteins (N) from self-assembling prematurely by
binding to them and keeping them as monomers. P also works as a cofactor in viral RNA
replication and transcription by helping the polymerase to access the genome inside the
nucleoproteincapsid. Matrix protein (M) helps to concentrate the ribonucleocapsid to the
sites where new virus particles are released from the host cell.
The phosphorylation of MV proteins affects virus signalling with the host cell. In this
Masters thesis, I produced and purified recombinant measles N, P and M proteins as well
as wild type MV. I determined the phosphorylation status of these proteins alone and in
the P-N complex by using phosphate affinity electrophoresis method developed by
Kinoshita et al. (2006). The phosphate affinity electrophoresis uses tag molecules that
bind reversibly to phosphate groups in proteins. Determining the significance of post-
transcriptional modifications in measles proteins would shed light to understanding
paramyxovirus structure and signalling and possibly help the development of biomedical
applications. Avainsanat Nyckelord Keywords
matrix protein, measles virus, Mononegavirales infections, Morbillivirus infections,
nucleoprotein, Paramyxoviridae infections, phosphate affinity electrophoresis, phosphate-
binding tag, phosphoprotein, pleomorphic virus, RNA virus infections, virus diseases Silytyspaikka Frvaringsstlle Where deposited
HELDA Muita tietoja vriga uppgifter Further information
Professor in charge of the major subject: Prof. Annele Hatakka
Primary supervisor of the experimental section: Prof. Sarah Butcher
Other supervisor: Dr. Lassi Liljeroos
ABBREVIATIONS
CK2 Casein kinase 2
EBNA1 Epstein-Barr virus nuclear antigen 1
F Fusion protein
H Hemagglutinin-attachment protein
HRSV Human respiratory syncytial virus
Hsp72 Heat shock protein 72
IFN Interferon
IKK IB kinase
IRF7 IFN regulatory factor 7
JAK Janus kinase
L Large protein
LGP2 Laboratory of genetics and physiology 2
M Matrix protein
MDA5 Melanoma differentiation-associated gene 5 product
MCP Membrane cofactor protein
MV Measles virus
N Nucleoprotein
NF-B Nuclear factor of the light chain enhancer of B cells
P Phosphoprotein
PCT Phosphoprotein C-terminal domain
PEI Polyethylenimine
Prdx1 Peroxiredoxin 1
PKB Protein kinase B
PLK1 Polo-like kinase 1
PMD Phosphoprotein multimerization domain
PNT Phosphoprotein N-terminal domain
PIV Parainfluenza
PX Phosphoprotein X domain
RdRp RNA-dependent RNA-polymerase
RE Recycling endosome
RIPA Radioimmunoprecipitation assay buffer
RNP Ribonucleocapsid
SLAM Signalling lymphocyte activation molecule
SSPE Subacute sclerosing panencephalitis
STAT Signal transducers and activation of transcription protein
TABLE OF CONTENTS
1 INTRODUCTION ..............................................................................................8
1.1 Taxonomy and pathogenesis ................................................................. 8 1.2 Structure and assembly ........................................................................ 10
1.2.1 Attachment and viral entry ........................................................... 11 1.2.2 Viral replication and transcription ................................................ 12 1.2.3 Interaction with host proteins and immunosuppression ............... 16 1.2.4 Viral release from the host cell .................................................... 17
1.3 Phosphorylation in measles proteins .................................................. 19 1.4 Phosphate affinity electrophoresis as a method for studying phosphorylation .......................................................................................... 21
2 RESEARCH OBJECTIVE .............................................................................. 23
3 MATERIALS AND METHODS ....................................................................... 23
3.1 Cloning ................................................................................................... 23 3.2 Protein overexpression in HEK293EBNA1 tissue culture ................. 25 3.3 Protein purification from HEK293EBNA1 cells ................................... 27 3.4 Virus production in Vero/SLAM tissue culture ................................... 29 3.5 Phosphate affinity electrophoresis ...................................................... 30 3.6 Immunoblotting ..................................................................................... 30
4 RESULTS ....................................................................................................... 31
4.1 Cloning ................................................................................................... 31 4.2 Tissue culture ........................................................................................ 36
4.2.1 Transfection optimization with PEI .............................................. 36 4.2.2 Transfection with measles gene constructs to create heterologous overexpression .......................................................................................... 38
4.3 Protein purification from mammalian cells with Ni-NTA beads ........ 38 4.4 Virus production .................................................................................... 40 4.5 Mycoplasma test ................................................................................... 43 4.6 Phosphorylation analysis ..................................................................... 44
4.6.1 Phosphoprotein has three predominant phosphate isoforms ...... 44 4.6.2 Nucleoprotein is the most phosphorylated as a recombinant protein when expressed alone and otherwise very scarcely ...................... 47 4.6.3 Matrix protein is unphosphorylated .............................................. 49
5 DISCUSSION ................................................................................................. 51
5.1 Cloning ................................................................................................... 51 5.2 Tissue culture ........................................................................................ 52 5.3 Protein purification ............................................................................... 53 5.4 Virus production .................................................................................... 54 5.5 Phosphate affinity gel electrophoresis ............................................... 55 5.6 Phosphorylation analysis and its effect on virus life cycle ............... 56
6 CONCLUSIONS ............................................................................................. 59
ACKNOWLEDGEMENTS ................................................................................. 60
REFERENCES .................................................................................................. 61
APPENDIX 1: POSSIBLE PHOSPHORYLATION SITES ................................. 69
APPENDIX 2: TOOL SITES IN THE ORDER OF USAGE ............................... 71
APPENDIX 3: PTT5SH8Q2-PLASMID ............................................................. 72
APPENDIX 4: PCR REACTIONS AND PROGRAMS FOR P1-48/PTT5SH8Q2 AND P/PTT5SH8Q2 ......................................................................................... 73
APPENDIX 5: GEL & RUNNING BUFFER COMPOSITIONS.......................... 75
APPENDIX 6: SEQUENCING RESULTS ......................................................... 77
8
1 INTRODUCTION
1.1 Taxonomy and pathogenesis
Measles virus (MV) belongs in the Mononegavirales order (group V, negative-sense
single-stranded RNA i.e. ssRNA) of the seven different virus orders (ICTV 2013).
Mononegavirales has five families of which MV belongs to the paramyxoviridae family
(para meaning alongside and myxo meaning mucus from Greek and virus
meaning venom from Latin). Paramyxoviridae also includes other human pathogens
such as parainfluenza (PIV) and human respiratory syncytial virus (HRSV). Currently
there are no specific antiviral treatment for any of these three viruses nor are there
vaccines for PIV or HRSV. Measles belongs in the subfamily of Paramyxovirinae, in
the Morbillivirus genus that has six species. Morbilliviruses infect primates, dogs,
cattle, cetaceans and possibly bats (SIB, ViralZone, Morbillivirus 2011, de Vries et al.
2015) and they can cause severe systemic disease. However, MV only have disease
reservoirs in humans, which is one of the prerequisites for making its eradication
possible since animals can not cause disease outbreaks in humans (Moss & Griffin
2012).
Measles is one of the most infectious viruses known (Strebel et al. 2013). It is
transmitted through touch or contact with respiratory droplets from infected people or
through the air (THL, Measles 2014). Symptoms start 1012 days after infection and
include high fever, runny nose, bloodshot eyes and tiny white spots inside of the mouth
(WHO, Health topics: measles 2014). Several days later a recognizable rash starts on
the face and spreads downwards. People with measles mostly recover by themselves
within 23 weeks but measles also causes serious complications mostly in malnourished
children. Most of the deaths happen because of secondary infections occurring during
the immunosuppression caused by the virus (Moss & Griffin 2006) (see chapter 1.2.3.
for more about the mechanism of immunosuppression). In industrialized countries the
most common complications, in order of prevalence, include ear infection, diarrhea,
pneumonia, death (0.10.3%), postinfectious encephalitis and subacute sclerosing
panencephalitis (SSPE) that causes lethal progressive neurological deterioration (Moss
& Griffin 2012, Strebel et al. 2013).
9
MV was first isolated in 1954 (Enders & Peebles 1954). The isolation of the so
called Edmonston strain was soon followed by the development of a measles vaccine in
1963 (Enders 1961, Katz et al. 1962, Marley 1963). The live vaccine contains viruses
that have been attenuated by cell culture passaging. Since widespread vaccinations the
number of measles incidences have plummeted and the World Health Organization has
a goal to eradicate measles by 2020 from everywhere else except the Southeast Asia
WHO region (for example India and Indonesia). This region reported most of the fatal
measles cases (55%) in 2010 and thus the process is expected to take longer there. The
eradication should be accomplished by improving surveillance and maintaining or
improving the vaccination coverage. The worldwide goal was to decrease the mortality
by 95% between the years 2000 to 2015 (Simons et al. 2012). In the year 2000 an
estimated 535 000 people died from measles. There are no exact numbers because of
insufficient reporting in developing countries without extensive surveillance. The World
Health Organization has already reported a 77% reduction down to 122 000 deaths in
2012 (WHO, Measles fact sheet 2014). It seems that the 95% reduction plan was too
ambitious and will not be met, but no one can deny that the achievement already
reached is impressive (WHO, Weekly Epidemiological Record 2014).
More than 95% of the reported measles deaths occur in developing countries and
are children under the age of five. However, there are also outbreaks in industrialized
countries with good vaccination programs mostly because of vaccine refusals which
temporarily lowers the herd immunity (Jansen et al. 2003, Zandotti et al. 2004). The
herd immunity has to be as high as 95% for prevention of measles outbreaks (Moss &
Griffin 2006). This is why measles currently poses a risk that is often underestimated
to the public in industrialized countries. More so than the presently ongoing outbreak
of Ebola virus that is also caused by a member of Mononegavirales.
There are yet no specific or efficient broad-spectrum antiviral treatments for
measles. Herein, it is crucially important to determine its molecular and functional
architecture. Usually it is treated with a broad-spectrum antiviral drug with vitamin A
supplements to prevent complications. However there are new promising drugs in
development e.g. BCX4430 (Warren et al. 2014) and ERDRP-0519 (Krumm et al.
2014). Both inhibit the viral RNA polymerase and have been tested in rodents.
BCX4430 is a broad-spectrum antiviral drug terminating RNA chain formation as a
nucleoside analogue (Warren et al. 2014). ERDRP-0519 also targets the RNA
polymerase, but with a lead compound and it is specific to morbilliviruses (Krumm et
al. 2014). ERDRP-0519 is more potent candidate for measles because of its efficiency.
10
MV also shows promise in oncolytic virotherapy because it targets cancer cells
through the nectin-4 receptor (Noyce et al. 2011). Paramyxoviruses are appealing as
viral vectors in general because they are free of icosahedral capsid symmetry constraints
and have two different proteins on their envelope that mediate recognition and fusion
for easier retargeting (Cattaneo 2010). Understanding MV structure and the signalling
of its proteins will give valuable information to the battle against virus diseases and also
for the biotherapeutic usage of paramyxovirus vectors.
1.2 Structure and assembly
MV is an enveloped pleomorphic virus, which means that virions i.e. virus particles
look different in shape and size (Liljeroos et al. 2011). In the wild type virus, the size
ranges from 50 to 510 nm. It has a linear nonsegmented ssRNA genome that is packed
inside a helical nucleoprotein capsid (Moss & Griffin 2006). The 16 kb nucleotide
genome has six genes that code for eight proteins: nucleoprotein (N), phosphoprotein
(P), virulence factors C and V, matrix (M), fusion (F), hemagglutinin (H) and large (L)
protein (Figure 1). C and V are nonstructural proteins and are expressed from the P
gene. C is expressed by alternative initiation codon and is much smaller than P as is
seen in Figure 1. V is also smaller than P and is expressed by mRNA editing:
pseudotemplated insertion of one or sometimes three G nucleotides at position 753
resulting in protein with the same N-terminal region and a different cysteine rich, zinc
finger-like C-terminal region (Cattaneo et al. 1989). Both P and V mRNA are produced
in similar quantities. A schematic diagram of the MV structure is presented in Figure 2.
11
Figure 1. Measles genome reproduced and modified with permission from
(viralzone.expasy.org, SIB Swiss Institute of Bioinformatics). The genome has six
genes that code for eight proteins: nucleoprotein (N), phosphoprotein (P), C, V, matrix
(M), fusion (F), hemagglutinin (H) and large (L) protein. C is produced from the P gene
by so called leaky scanning of the polymerase resulting in a different starting codon. V
is produced from the same start codon than P, but mRNA editing changes its reading
frame in the C-terminal region.
Figure 2. MV structure reproduced and modified with permission from (Liljeroos et al.
2011).
1.2.1 Attachment and viral entry
The life cycle of a virus starts with a virus entering a host cell. As seen in Figure 2, the
viral membrane of the MV contains H and F glycoproteins. They work together in viral
entry in to the host cell (Moss & Griffin 2006). H recognizes the potential host cell and
attaches to a receptor in its membrane. H in a wild type virus binds primarily to
signalling lymphocyte activation molecule (SLAM) i.e. CD150 in host cell membranes
(Tatsuo et al. 2000) and in the Edmonston vaccine strain to both SLAM and membrane
cofactor protein (MCP) i.e. CD46 (Naniche et al. 1993, Schneider et al. 2002, Moss &
12
Griffin 2006). CD46 receptor is present on all nucleated cells, whereas SLAM is present
only in activated B and T lymphocytes and antigen-presenting cells (dendritic cells and
macrophages). H also binds to nectin-4 in epithelial cells of the respiratory tract, as
found more recently, which makes the virus transmissible after circulation in the body
(Mhlebach et al. 2011). The infection cycle in a host body is depicted in Figure 3.
After attachment of the virus, the infection cycle of the cell continues by a
conformational change of H, which allows the activation of the other glycoprotein F
(Brindley et al. 2013, Jardetzky & Lamb 2014). F then also goes through a
conformational change that mediates fusion of the virion with the host cell membrane
and so the viral RNA is released to the host cytoplasm.
Figure 3. MV infection cycle reproduced and modified with permission from
(Immunopediae.org 2010).
1.2.2 Viral replication and transcription
In the host cell cytoplasm, viral RNA is transcribed and translated to viral proteins and
later in the viral life cycle preferably just replicated (Plumet et al. 2005). The genes are
transcribed in fashion of polarized attenuation, where the polymerase sometimes
dissociates in between reading the genes at an intergenic junction leading to a polarized
13
mixture of mRNA (Ray & Fujinami 1987, Plumet et al. 2005). The polarized mixture
contains different amounts of each transcribed gene, where the first gene is transcribed
the most abundantly and the last gene is transcribed the least abundantly and so on. The
RNA genome is coated with N protein; NCORE domain (Figure 4) is responsible for
forming the ribonucleocapsid (RNP) where N self-assembles in to a helical capsid
coating the viral RNA genome (Karlin et al. 2002a) (Figure 5A).
P protein however has two main functions. The first is to work as a chaperone
(Figure 5A and B). P keeps the newly synthesized N0 (N without RNA) from
assembling around the host RNA; P N-terminal (PNT) domain (Figure 4) binds to
N0CORE and P C-terminal (PCT) domain binds to N0
TAIL and keeps N0 from self-
assembling around the wrong RNA (Curran et al. 1995a, Chen et al. 2003). P also
retains N in the cytoplasm (Huber et al. 1991). N alone would localize to nucleus.
Secondly, P also works as a tetramer (Communie et al. 2013a) binding to RNP
(Figure 5B) (Karlin et al. 2003). In this second function, it is believed to cartwheel
along the RNP (Tarbouriech et al. 2000) organizing the loose NTAIL structures and
tethering the RNA-dependent RNA-polymerase (RdRp) to the genome and so
stabilizing the polymerasegenome interaction (Krumm et al. 2013). PNT and NTAIL
domains are structurally disordered adapting secondary structure only when induced by
binding to another protein (Karlin et al. 2002b, Bourhis et al. 2006). Structural disorder
is believed to be beneficial because it enables binding with multiple different proteins.
And as support for this NTAIL does have multiple binding partners in the host cell as told
in more detail in chapter 1.2.3 (p. 16).
14
Figure 4. A) P and B) N structure and binding sites reproduced and modified with
permission from (Bourhis et al. 2006).
L protein is a polymerase that replicates viral RNA even without the disassembly of the
RNP structure. This is possible by the help of P working as a cofactor and helping the
polymerase to access the N protein protected genome (Figure 5A) (Bourhis et al. 2006,
Leyrat et al. 2011). The polymerase binding site in P has not been verified for MV,
except that it is somewhere in PCT domain (Chen et al. 2003). Together they form the
hetero-oligomeric RdRp complex. The newly replicated genome is immediately
encapsidated by N where the P-N0 encapsidation complex is used as a substrate
(Figure 5A). The N0 is readily attached to RNP because the N-RNA complex is thought
to be more stable than P-N0 complex (Leyrat et al. 2011). P and L also work together to
transcribe the viral RNA (Sun et al. 2011) (Figure 6). L has all the polymerase enzyme
functions needed for initiation, elongation and termination of RNA synthesis and adding
the 5-cap and 3-poly(A) tail. The binding site of the polymerase differs in
paramyxoviruses, but as said in MV the PCT domain recruits the transcriptional
machinery by binding to RNP and L (Bourhis et al. 2006). Only PCT is required for
transcription (Karlin et al. 2002b) as opposed to replication where PNT is required for
encapsidation of the new genome. It has been suggested that P or P-L complex binds to
NTAIL, but the interaction is weak in order for the P-L complex to be able to move along
the RNP (Kingston et al. 2004b).
15
Figure 5. The first function of P: A) P (denoted as blue) in an N-P-L complex (N
denoted as red, L and RNA denoted as green) in replication: 1: P and L working
together in P-L complex 2: P brings N0 for new RNP in the replication site, P attaches to
NTAIL in RNP, 3: N0 is given to newly constructed RNP as PX domain attaches to NTAIL
in RNP rather than N0TAIL. PMD is the polymerization domain. B) P binding to N.
Reproduced and modified with permission from Bourhis et al. 2006.
16
Figure 6. The second function of P in transcription: P (denoted as purple) in complex
with L (denoted as grey) in transcription. Reproduced and modified with permission
from viralzone.expasy.org, SIB Swiss Institute of Bioinformatics.
1.2.3 Interaction with host proteins and immunosuppression
Efficient viral RNA synthesis requires host proteins (Moyer et al. 1990). Virus needs
cellular enzymes, but also other virushost interactions are important and some of them
have already been discovered. For example, cytoskeletal proteins like tubulin is
believed to provide a physical anchor for the viral RNA synthesis (Moyer et al. 1990,
Berghll et al. 2004). The role of actin is under an ongoing research. Actin is needed to
help in the virus release out of the host cell probably by helping the virus to protrude
outwards from the cell (Moyer et al. 1990, Berghll et al. 2004, Dietzel et al. 2013).
Also, M-RNP complex is delivered to cell surface along actin filaments (Wakimoto et
al. 2013, Dietzel et al. 2013). Actin indirectly regulates glycoprotein mediated cell-to-
cell fusion by binding to M (more about cell-to-cell fusion in chapter 1.2.4, p. 18). N
protein increases viral replication and transcription by binding to cellular heat shock
protein Hsp72 and Peroxiredoxin 1 (Prdx1) (Zhang et al. 2005, Watanabe et al. 2011).
They both inhibit P binding to NTAIL by competitive inhibition and possibly increase the
speed the RdRp complex travels along the RNP because the interaction of P and NTAILS
are less frequent.
MV also interferes with the immune system of the host with mostly the help of its V
protein, but also C and P proteins. V protein binds and blocks host proteins from acting
for eradication of the virus infection; V protein, and also C and P indirectly, prevent
17
interferon (IFN) production, which is essential for normal immune response. IFN is an
infected cells way to communicate to nearby cells to promote their antiviral defences.
V protein binds, at least, to DexD/H-box helicases called a melanoma differentiation-
associated protein 5 (MDA5) and a Laboratory of genetics and physiology protein 2
(LGP2) and blocks their sensor activity for recognizing viral RNAs and thereof by
blocking also consequently IFN production (Nakatsu et al. 2008, Childs et al. 2012). V
works also as a decoy for IB kinase (IKK) and prevents the phosphorylation of its
substrate IFN regulatory factor 7 (IRF7) which is needed again for IFN production
(Pfaller & Conzelmann 2008). V also binds to p65 subunit of nuclear factor of the
light chain enhancer of B cells (NF-B) and prevents its nuclear localization and
function as a transcription factor for enhancing IFN production (Schuhmann et al.
2011). Also P and C inhibit NF-B to a lesser extent, but with different unknown
mechanism. Furthermore, V also inhibits JAK/STAT signal transduction cascade
needed for IFN production by inhibiting signal transducers and activation of
transcription (STAT) proteins (Devaux et al. 2007). Likewise P does this, but in smaller
scale as V. On the other hand, the importance of C protein remains to be elucidated, but
it (and possibly V also) has been suggested to downregulate the transcription of viral
genes to an optimal level that allows virus production, but minimises IFN production so
that the host cell does not die too quickly (Witko et al. 2006, Nakatsu et al. 2008).
Herein, the P gene products interfere with the immune system in many ways. Possibly
this mainly V-induced change in lymphocyte signalling together with lymphopenia (loss
of lymphocytes and formation of syncytia i.e. virus spread through cell-to-cell fusion
and less lymphocytes circulating in blood), cause the long immunosuppression in
patients, unique to MV infection among the paramyxoviruses (Pfaller & Conzelmann
2008).
1.2.4 Viral release from the host cell
Finally, the M protein is especially important at the end of the virus life cycle. As
recently reported, it primarily coats the RNP that contains the genome of the virus,
although some of it directly underlines the viral membrane (Figure 2) (Liljeroos et al.
2011). Its importance is also highlighted in the fact that mutated M protein defective in
binding N causes inefficient virus production and lingering infection in SSPE (Hirano et
al. 1993). M is believed to transport the RNP to the virus release site along actin fibers,
18
working as a so-called assembly organizer, bringing the genome together with the
envelope of the virus (Dietzel et al. 2013). In some other paramyxoviruses M protein
binds directly to actin (Giuffre et al. 1982), but it seems that in measles probably a
myosin a motor protein that transports cargo along actin fibers transports the
M-RNP complex inside a Rab11A-positive recycling endosomes (REs) to the cell
membrane (Nakatsu et al. 2013). When M-RNP complex reaches the host cell
membrane, it groups efficiently to lipid rafts (Vincent et al. 2000, Mani et al. 2000).
Lipid rafts are cell membrane domains enriched in certain proteins and lipids
(cholesterol and sphingolipids). They are sites where MV preferably pinches off from
the host cell. Also glycoprotein F groups independently to lipid rafts and enhances the
enrichment of M in those sites (Vincent et al. 2000, Pohl et al. 2007). F associates with
the other glycoprotein H bringing it to the release site (Vincent et al. 2000). M then
interacts with F and H (Cathomen et al. 1998a, Wakimoto et al. 2013) and herein all the
viral components have concentrated to the release site. And finally, the virion pinches
off from the cell and the RNP is enveloped in a yet unclear mechanism with a host-
derived membrane that is enriched with viral F and H glycoproteins (Salditt et al. 2010).
MV is released from the apical side of the polarized epithelial cells (Blau &
Compans 1995, Sinn et al. 2002, Nakatsu et al. 2013). In the host body, the initial site
of the infection is respiratory system and the epithelial cells lining the cavities of the
respiratory tract. Once inside the cells, the virus needs to be released to the right side of
the respiratory epithelia to produce enough virions to infect other hosts through
coughing etc. The M-RNP complex is delivered to the apical side by Rab11A-positive
REs along the actin fiber network that is highly concentrated in the apical side of
epithelial cells (Naim et al. 2000, Riedl et al. 2002, Liljeroos et al. 2011, Nakatsu et al.
2013). M-RNP then directs the remaining viral components - the glycoproteins - to the
apical side also and determines the so called polarity of the virus release. Though the
virus is released mainly from the apical surface, it is suspected to infect neighbouring
epithelial cells and underlying tissues by cell-to-cell fusion directed by the
glycoproteins F and H (Moll et al. 2001). The glycoproteins have basolateral sorting
signals that direct them away from apical side in increasing amounts during virus life
cycle (at least in cell culture) (Naim et al. 2000). So new viruses are at first probably
released mostly from the apical side to the lumen of the respiratory tracts and later they
spread more and more to neighbouring cells through local cell-to-cell fusion.
Eventually, the virus ends up in white blood cells that are trying to clear up the infection
19
by engulfing infected cells. The virus then hitchhikes a ride spreading throughout the
reticuloendothelial system creating systemic infection and viremia (see Figure 3).
Differences in the release of viral particles among paramyxoviruses might be the
leading reason for the high infectivity for MV. For example HRSV and Sendai virus M
protein does not associate lipid rafts individually without the glycoproteins (Harrison et
al. 2010) and also the polarized release system for MV allows efficient spreading
through the respiratory system and later systemic infection through the basolateral
sorting signals of the glycoproteins. Also the immune system suppression plays an
important role in this.
1.3 Phosphorylation in measles proteins
Phosphorylation is one of the post-translational modifications in proteins. It can be done
in three measles protein residues: serine, threonine or tyrosine. There are many possible
phosphorylation sites in the measles proteins the sites in the protein constructs that I
used are shown in Appendix 1. Phosphorylation is done by kinase enzymes and
dephosphorylation by phosphatase enzymes. Phosphorylation of virus proteins often
plays a role in signalling with the host cell and can benefit the virus life cycle. MV is no
exception to this. In fact, a novel strategy to control measles infection could be to target
host kinases. The Akt serine/threonine kinase, also known as protein kinase B (PKB),
has been shown to be important for virulence in many paramyxoviruses and inhibiting
its function reduces measles replication (Sun et al. 2008). Herein, Akt inhibitor drugs
could also work as broad-spectrum antivirals. They are already under vast research for
cancer therapy and herein, it would be easier to bring them to use also as antivirals.
P is heavily phosphorylated with PNT domain containing most of the
phosphorylation sites (Karlin et al. 2002b). It also binds to N0 protein with that
terminus, but their binding together is not due to a phosphorylation since chaperone
activities work also in Escherichia coli (E. coli) bacteria (Kingston et al. 2004b,
Liljeroos, L. & Butcher, S.J., personal communication). Unphosphorylated P also
oligomerizes (Communie et al. 2013b) and N forms helices in E. coli (Liljeroos, L.
& Butcher, S.J., personal communication) so these actions are not due to a
phosphorylation modification at least not in a critical way. Phosphorylation
modifications are not vital to these functions, but have more complex purposes in virus
infection.
20
The phosphorylation of P protein in MV has been hypothesized to work as a switch
between replication of viral genome and transcription of viral mRNA. PNT is
phosphorylated by cellular casein kinase 2 (CK2) at least in serine residues S86, S151
and S180 (Das et al. 1995). Phosphorylation in S86 and S151 downregulates viral
transcription (Sugai et al. 2012). Then again virus infection seems to activate Akt which
directly or indirectly phosphorylate P and leads to favouring of transcription over
replication (Sun et al. 2008). Therefore, different phosphorylation patterns of P seems to
lead in favouring of replication or transcription over the other and they might be
achieved by different kinases. In addition of phosphorylation, also accumulation of N0-P
complex has been speculated to increase viral replication over transcription (Howard &
Wertz 1989, Plumet et al. 2005).
More evidence of this comes from other paramyxoviruses. It has been reported, for
example, that phosphorylation of threonine residue T286 of P increases mRNA
transcription in parainfluenza virus 5 (PIV5) (Sun et al. 2011). But it has been also
shown that phosphorylation of PIV5 P S308 reduces gene expression and prevents
cytokine induction, which might benefit the virus in long term by keeping the host cells
in better condition (Sun et al. 2009). This happens by Polo-like kinase 1 (PLK1) which
is also a serine/threonine kinase that plays a role in regulating the cell cycle. It binds to
S157 and phosphorylates S308. It is also likely that different paramyxoviruses use
different host kinases. Also phosphorylation of S157 reduces gene expression, but it is
not clear if this happens due to phosphorylation in P, V or both since they are
homologous in the N-terminus. All strains do not have this phosphorylation site so it
might contribute to different virulence in different strains. Also, mumps virus
phosphorylation of recombinant P amino acid residue T101 has been reported to
decrease RNA transcription (Pickar et al. 2014). Hence, it may be that phosphorylation
of P and V regulates viral gene expression in the course of the paramyxovirus virus life
cycle. It was hypothesized that phosphorylation of P might change its ability to bind
RNA or to interact with a yet not identified host protein. It seems that phosphorylation
of PNT domain serine or threonine residues usually increases replication over
transcription.
In measles N phosphorylation sites S479 and S510 are reported to be
phosphorylated in the C-terminal tail region as also sites S425, T477, S481, S482 and
S505 depending on the viral strain (Hagiwara et al. 2008, Prodhomme et al. 2010).
Their popularity in different wild type or vaccine strains varies, but the major
phosphorylation sites S479 and S510 are almost always phosphorylated. Herein,
21
different phosphorylation patterns allegedly influence the attenuation of the strains. The
sites are phosphorylated most likely also by CK2 (Prodhomme et al. 2010). N binds to P
with residues 488499 (Bourhis et al. 2004) so only the flanking areas have
phosphorylation. It seems that P and N are mostly phosphorylated in their structurally
disordered regions so phosphorylation probably fine tunes interactions of the viral
proteins with each other and cellular proteins. As more evidence of this, the N
phosphorylation state does not regulate its nuclear trafficking, N-P or N-M interactions
critically, but the binding of P and N reduces phosphorylation of P (Sugai et al. 2012)
and N (Sugai et al. 2013). It has been suggested to increase the stability of viral RNA.
Sugai et al. suggested that phosphorylation of N decreases viral gene expression in the
early phase of the viral life cycle to minimize cytokine induction in the critical first
stages of infection. And later it prevents the excessive phosphorylation of P and
decreases viral transcription and replication (Sugai et al. 2012).
It has been reported that phosphorylation of N is on serine and threonine residues in
RNP-associated N, but only in serine in the free form of N that was not associated with
the transcription machinery (Gombart et al. 1995, Prodhomme et al. 2010). This can
mean that T477 is critical for nucleocapsid assembly. Also, there were no tyrosine
phosphorylation. It has been linked to persistent neuroblastoma infections (Segev et al.
1995). Herein, it is possible that tyrosine phosphorylation is important for SSPE strains
and possibly N to M binding since this is disrupted in SSPE (M binding happens in this
region of N) (Hirano et al. 1993). So it seems that phosphorylation of N has similar
effects than phosphorylation of P: regulating gene expression to a suitable level which
varies in the course of the infection cycle and the differences in phosphorylation
patterns might change the severity of the disease caused by different strains.
M protein phosphorylation has also been reported (Fujinami & Oldstone 1979).
1.4 Phosphate affinity electrophoresis as a method for studying
phosphorylation
Phosphorylation is usually studied by mass spectrometry (Karlin et al. 2002b),
radiolabelling with 32P (Vidal et al. 1988) or by using antibodies for different
phosphorylated amino acids. Radiolabelling and the use of antibodies are most suitable
when the sample is homogeneous and only one site is phosphorylated. Recently,
alternative methods have been introduced for determining phosphorylation status of
22
proteins. There is, for example, a stain for phosphorylated proteins in SDS-PAGE gel
that recognizes all the three possibly phosphorylated amino acid residues (Life
TechnologiesTM, Pro-Q diamond phosphoprotein gel stain 2014). However, it does not
separate different isoforms of phosphorylated proteins, where a protein has varying
amount of phosphorylated protein residues in the sample. The phosphate affinity
electrophoresis does this.
The phosphate affinity electrophoresis method uses Phos-tagTM phosphate-binding
molecules to bind to phosphorylated amino acid residues in proteins. Phos-tagTM
molecules were first discovered in 2002 at Hiroshima University. Now there are four
different kinds of kits available that uses the Phos-tagTM molecule: acrylamide, agarose,
biotin, and mass analytical kit (Wako Pure Chemical Industries, Ltd). Phos-tagTM
electrophoresis uses acrylamide-bound Phos-tagTM molecules (Figure 7) that bind
reversibly to phosphate groups in proteins and retard their running in electrophoresis
when compared to unphosphorylated ones. There are many advantages in Phos-tagTM
electrophoresis: it is non-radioactive, non-denaturing so it allows downstream
applications such as mass spectrometry and that it recognizes all phosphorylated sites
without having to use three different antibodies for phosphorylated serine, threonine and
tyrosine separately. Phos-tagTM electrophoresis also recognizes different isoforms of
phosphorylated proteins and thus it is possible to follow the time course of the
phosphorylation. Another advantage is that one can determine different isoform ratios
from the sample. A disadvantage is that the method does not identify the
phosphorylation site unless it is coupled with mass spectrometry.
Figure 7. Acrylamide-pendant Phos-tagTM ligand and its reversible binding to
phosphomonoester dianion (ROPO32-) by Mn2+ Phos-tagTM (M2+ = Mn2+) (Kinoshita et
al. 2006).
23
2 RESEARCH OBJECTIVE
The purpose of this thesis was to produce phosphorylated versions of the MV proteins:
P, N and M. The phosphorylation status was determined in the proteins individually and
also in the P-N complex. The phosphorylation status of recombinant proteins produced
in bacterial or mammalian cells was compared to the viral proteins. The differences
between the phosphorylation modifications of cellular and released virus were
compared. The results could possibly shed more light to what roles phosphorylation of
these proteins play in the virus life cycle.
3 MATERIALS AND METHODS
3.1 Cloning
New England BioLabs NEBcutter tool confirmed that there are no NotI or EcoRI
restriction enzyme sites in the middle of the P gene (see Appendix 2 for links of the
sites used) and primers were planned accordingly. Primers P-Forward-His-NotI and
P1-48-Reverse-EcoRI were used for cloning truncated version of the P gene that
expresses amino acids 148 out of 507 (primers are listed in Table 1). Same forward
primer and P-Reverse-EcoRI were used for the whole protein. P1-48 in a pET41(a)-
vector and P in a pTT5SH8Q2-vector (both kindly provided by Liljeroos, L.) were used
as templates (Liljeroos, L. and Butcher, S.J., personal communication). Composition of
the plasmid is presented in Appendix 3. P was cloned again to pTT5SH8Q2-plasmid to
get the His-tag at the N-terminus as in truncated P1-48. I amplified a P1-48 gene and a
whole P gene with polymerase chain reaction. The PCR program used is in Appendix 4.
24
Table 1. Primers.
Name Sequence
P-Forward-His-NotI 5-AATGCGGCCGCACCATGGAACATCATCATCATCAT
CATGCAGAAGAGCAGGCACG-3
P1-48-Reverse-EcoRI 5-GGGGGGG GAATTCTTAGGCTCGCTCCTGTCCTG -3
P-Reverse-EcoRI
(provided by
Liljeroos, L.)
5-GGGGGGGGAATTCCTACTTCATTATTATCTTCATCA
GCATCTGG-3
P-Forward-NotI
(provided by
Liljeroos, L.)
5-AATGCGGCCGCCATGGGCAGCAGCCATCATC
Restriction enzyme sites are underlined
The amplified DNA products were run electrophoretically in 0.8% (w/v) low
electroendosmosis agarose (Supplied by BioNordika, manufactured in EU) with 120 V
for 20 min in 1 TAE buffer: 40 mM Tris, 20 mM acetic acid, and 1 mM
ethylenediaminetetraacetic acid (EDTA), pH 8.0. Amplified products were purified
from the agarose gel with PCR-purification kit (Roche). Restriction enzyme digestion
was done separately to 425 ng of P1-48 gene and 505 ng of P gene with 286 U/ml NotI
and EcoRI restriction enzymes for 2 h 50 min at 37C. The pTT5SH8Q2-vector was
purified with a Qiagens midiprep kit according to manufacturers instructions and
3.3 g was digested with 340 U/ml NotI and EcoRI restriction enzymes 2 h 40 min at
37C. NEBuffer 4 and BSA were used in restriction enzyme digestions according to
NEBs Double digest finders suggestions (link in Appendix 2). The small overhang
DNA fragments cleaved in the reaction were removed from the restriction enzyme
digestion products with PCR-purification kit (Roche). Ligation was done separately to
31 ng of P1-48 gene and 19 ng of P gene with 100 ng of restriction enzyme digested
pTT5SH8Q2-vector using 10 000 U/ml T4 DNA ligase (NEB) and incubated for 10 min
at room temperature. One fourth of the volume of the ligation reaction mixes were
transformed into DH5 strain of CaCl2 competent E. coli by mixing the constructs with
bacteria and keeping them on ice for 20 minutes, giving a heat shock for a minute at
42C and incubating on ice for a minute. As controls 1 ng of ligated vector without
insert and the 25 ng of restriction enzyme digested vector were transformed.
Transformed bacteria were plated on Luria (L) culture plates with ampicillin (100
g/l) as the selection factor. Untransformed DH5 were also plated onto L-plates for
transfection efficiency determination. All the plates were incubated at 37C overnight.
25
Ten colonies were inoculated separately from culture plates of P1-48/pTT5SH8Q2
and P/pTT5SH8Q2 in DH5 to 3 ml of L media with 100 g/l ampicillin and grown
3 h 30 min at 37C 220 rpm. From those subclone cultures colony-PCR were done with
same primers as previously (Table 1, p. 24) and 1 l of culture was used as a template.
The PCR program used is in Appendix 4. Positive subclones according to
electrophoresis were confirmed by restriction digestion analysis as follows: Plasmids
from 2 ml of saturated cultures were purified with Thermo Scientific GeneJET plasmid
miniprep kit according to the manufacturers instructions. After purification, 3 g of
plasmids were digested with 333 U/ml NotI and EcoRI restriction enzymes 1 h 30 min
at 37C and results analysed with agarose gel electrophoresis. Plasmids from two
subclones of P1-48/pTT5SH8Q2 and P/pTT5SH8Q2 were sent for sequencing with
primers P-Forward-NotI and P-Reverse-EcoRI (both provided by Liljeroos, L., Table 1,
p. 24). P1-48 was sequenced with only forward primer and P with both forward and
reverse primers.
The provided sequences were analysed by Blast (National Center for Biotechnology
Information (NCBI)) and LALIGN (ExPASy, SIB Bioinformatics Resource Portal). The
sequences were translated by Translation tool and compared with ClustalW to P gene of
MV Edmonston strain (GenBank code: GU327676.1) and to Helsinki strain sequences
(Liljeroos et al. 2011). Links to all sites are in Appendix 2.
3.2 Protein overexpression in HEK293EBNA1 tissue culture
Subclones 8 from both P1-48/pTT5SH8Q2 and P/pTT5SH8Q2 in DH5 were cultivated
in quantity of 2 ml in L media with 100 g/l ampicillin 8 h at 37C 220 rpm. The
cultures were then diluted 1:500 to 50 ml and grown 16 h in similar conditions. The
plasmids were purified from the cultures with a Qiagens midipreparation kit. Also
other plasmids (kindly provided by Liljeroos, L.) were transformed and produced
similarly. All of them are listed in Table 2 with concentrations and purity measured by
NanoDrop.
26
Table 2. All the constructs used in the work and their concentrations and purity.
DNA construct Concentration
(ng/l)*
Purity,
A260/A280*
YFP/pTT5SH8Q2 535.3 1.91
pTT5SH8Q2-vector 481.1 1.91
P1-48(His-tag in N-terminus)/pTT5SH8Q2 299.8 1.92
P(His-tag in N-terminus)/pTT5SH8Q2 346.4 1.92
N(His-tag in C-terminus)/pTT5SH8Q2 394.5 1.92
N/pTT5SH8Q2 383.0 1.91
M/pTT5SH8Q2 265.6 1.92
*Concentration and purity measured by NanoDrop
Human Embryonic Kidney cell line 293EBNA1 (HEK293EBNA1), where EBNA1
stands for Epstein-Barr virus nuclear antigen 1, was used for protein expression. The
cells were always cultured at 37C and 5% CO2 in a humidified incubator with
Dulbeccos Modified Eagles medium (DMEM), pH 7.4 with 10% (v/v) foetal calf
serum (inactivated at 54C for 30 min with mixing to inactivate the complement), 1 mM
sodium pyruvate, 1 MEM non-essential amino acids, 100 U penicillin and 0.1 mg/ml
streptomycin. Media was always at room temperature when added to cells. The cells
were passaged four times before transfection in order to let them recover from the
thawing procedure.
Polyethylenimine (PEI) transfection method was used. Transfection conditions
were optimised with 3 ml of media in 3.5 cm cluster plates as follows: At first 300 l
serum and other additive free media and 3g of YFP/pTT5SH8Q2 gene construct as
the transfected DNA (YFP is a yellow fluorescent protein) was incubated at room
temperature for 510 min for assuring complete mixing. Different amounts of PEI were
added for screening the best amount, mixed well by shaking the tube and incubated 10
20 min at room temperature (in Table 3 are the used DNA to PEI ratios). As a control,
mock transfected cells were treated without DNA and just PEI was added. The
HEK293EBNA1 cells were washed with room temperature phosphate-buffered saline
(PBS: 137 mM NaCl, 2.7 mM KCl, 10 mM disodium hydrogen phosphate (Na2HPO4)
and 1.8 mM monopotassium phosphate (KH2PO4)), finally mixed with DNA-PEI mixes
or just PEI and 2.7 ml culture media and incubated 24 h. The cells were 80% confluent
27
when transfected. The best DNA to PEI ratio was assessed by fluorescence microscopy
and used when transfecting cells afterwards.
Table 3. Transfection optimization: DNA to PEI ratios in a 6-well cluster plate.
1:1 1:2.5 1:3
1:4 1:5 15 g PEI as a control
After optimization 7080% confluent, HEK293EBNA1 cells were transfected
separately with 10 g of the constructs in Table 2 (p. 26) except pTT5SH8Q2-vector
alone. In addition, following constructs were transfected to make protein complexes: P1-
48 (His-tag in N-terminus) and N (without His-tag) together and also P (His-tag in N-
terminus) and N (without His-tag) together. YFP/pTT5SH8Q2 were used again as a
control for the determination of the transfection efficiency. Transfection was allowed to
continue 48 h (24 h longer than in optimization) to get a better protein yield. The cells
were 70% confluent when harvested at a passage number 22.
Second transfection was done to check the results and corrected DNA amount in
complexes to be altogether 10 g and not 10 g of every construct. The cells were 70
90% confluent depending on different plate when transfected. Protein production was
allowed to continue 49 h. The cells were 100% confluent at a passage number 28 when
harvested. The cell cultures were tested for mycoplasma contamination by using
PromoKines PCR Mycoplasma test kit II as should be done routinely for these cells.
3.3 Protein purification from HEK293EBNA1 cells
The transfected HEK293EBNA1 cells were washed two times with ice cold PBS and
lysed with ice cold cell lysis buffer (1 ml per 100 mm culture dish) containing: 0.5%
(v/v) Triton-X and 20 mM imidazole, protease inhibitors (EDTA free tablets, 1 tablet /
10 ml solution, Roche) and phosphatase inhibitors (phosSTOP 1 tablet / 10 ml solution,
Roche) in PBS, pH 8.3 (filtered with pore size 0.2 m). The first batch of transfectant
cell lysates were frozen at 80C overnight. The second batch were just incubated
30 min on ice in the cold room with shaking the tubes a few times during the incubation.
28
Unphosphorylated P protein from E. coli (kindly provided by Liljeroos, L.) was added
to the YFP cell lysate as a phosphorylation control.
The cell lysates were centrifuged 13 000 rpm 5 min at + 4C in cold room on a
tabletop centrifuge. The supernatant was saved as a cytosolic fraction. Nuclei was lysed
from the cell debris pellet with modified radioimmunoprecipitation assay (RIPA) buffer
(1 ml per pellet) containing: 150 mM NaCl, 0.5% (v/v) Triton-X 100, 1.0% (w/v)
sodium deoxycholate, 0.1% (w/v) SDS in 25 mM, protease inhibitors (EDTA free
tablets, 1 tablet / 10 ml solution, Roche) and phosphatase inhibitors (phosSTOP 1 tablet
/ 10 ml solution, Roche) in Tris-HCl, pH 7.7 (0.2 m filtered). The lysis of the nuclei
was allowed to continue 30 min on ice in the cold room with shaking the tubes a few
times and nuclear fraction were collected by centrifuging 13 000 rpm 5 min in the cold
room on a tabletop centrifuge and saving the supernatant.
Ni2+-affinity chromatography was used for purification since Ni2+-beads (IMAC
SepharoseTM 6 Fast Flow, GE Healthcare) bind the His-tags in the proteins. Ni2+-beads
were prepared by washing beads with MQ water three times, adding 0.1 M nickel
sulphate solution two times the volume of the beads and washing with MQ six times.
Centrifuging was always done under 500 g 1 min and the Ni2+-beads where stored in
20% (v/v) ethanol and washed three times with MQ before use.
M protein was only divided to cytosolic and nuclear fractions as explained above,
but P1-48, P, N, P1-48+N and P+N complex and also YFP + bacterial P control were
further purified with Ni2+-affinity chromatography from cytosolic and nuclear fractions:
50 l of 50% (v/v) bead slurry were added per sample tube. The nickel beads were
allowed to bind to proteins for 30 min in the cold room with agitation and let to settle on
their own or centrifuged lightly before wash fractions were collected. The beads were
then washed two times with the lysis buffer in PBS and once with buffer without
inhibitors to avoid them from showing in electrophoresis gels later. The beads were
always washed with 200 l of buffer per tube. After removing the last wash fraction
SDS-PAGE loading buffer (0.083 M Tris-HCl, pH 6.8, 3% (w/v) SDS, 10% (v/v)
glycerol, 0.007% (w/v) bromophenol blue at final concentration) was added to the beads
and to samples of wash fractions, boiled 6 min in 9597C and stored in 20C. All the
remaining wash fractions were frozen with liquid nitrogen and stored at 80C.
29
3.4 Virus production in Vero/SLAM tissue culture
Vero/SLAM cells (kindly provided by Liljeroos, L. (Liljeroos et al. 2011)) derived from
kidney cells of African green monkey, were cultured with media containing: DMEM
high glucose, HEPES modification (4.5 g/L glucose, L-glutamine, and 25 mM HEPES),
3.7 g/l sodium bicarbonate, 2.0 g/l sodium chloride, 7.5% (v/v) foetal bovine serum,
10 000 U penicillin, 10 mg/ml streptomycin and 200 g/ml geneticin, pH 7.3. Wild type
Helsinki strain MV (kindly provided by Liljeroos, L. (Liljeroos et al. 2011)) was diluted
to Vero/SLAM media without antibiotics or foetal calf serum but additionally 0.2%
(v/v) BSA and used to infect Vero/SLAM cells at 60% confluency at passage number
52 with multiplicity of infection (m.o.i.) 0.1 in 175 cm2 culture flasks. Only infection
media without the virus was added to mock infected cells. Infection was allowed to start
for 2 h at 37C 5% CO2 before replacing the infection media with Vero/SLAM media
without geneticin. Infection was then allowed to continue 48 h at 37C 5% CO2.
Culture media was collected from infected cells and the cells washed two times
with ice cold PBS and lysed with lysis buffer (3 ml per flask) containing: 0.5% (v/v)
Triton-X, 20 mM imidazole, 2 mM EDTA, protease inhibitors (1 tablet/ 10 ml solution,
Roche) and phosphatase inhibitors (phosSTOP 1 tablet/ 10 ml solution, Roche) in PBS,
pH 8.3 (0.2 m filtered). Lysis was allowed to continue 2.5 h on ice and the cell debris
was collected by centrifuging 4000 rpm 5 min at + 4C on a tabletop centrifuge. Nuclei
were lysed from the debris by modified RIPA buffer (see p. 28, the protease inhibitors
and phosphatase inhibitors added as before and in addition 2 mM EDTA), pH 7.7
(0.2 m filtered). Lysis was allowed to continue 1.5 h on ice and the cell debris was
removed by centrifuging 4000 rpm 5 min + 4C on a tabletop centrifuge.
Virus from the infected media was concentrated and roughly purified by differential
centrifugation: Cells were removed from the infected media by centrifuging 5000 rpm
5 min at + 4C in a SS34 rotor. Virus was pelleted by ultracentrifuging 28 000 rpm 2 h
at + 4C in a SW28 rotor through a 15% (v/v) OptiPrepTM cushion in a buffer
containing 20 mM Tris-HCl, 180 mM NaCl, 2 mM MgCl2, pH 7.5 (0.2 m filtered). 28
ml of infected media were used per 10 ml of 15% (v/v) OptiPrepTM solution. Virus
pellet were resuspended and collected. Samples were taken also from the media and
OptiPrepTM layer. The samples were diluted to SDS-PAGE loading buffer, boiled 6 min
at 97C and stored at 20C. Vero/SLAM cells were also tested for mycoplasma
contamination by using PromoKines PCR Mycoplasma test kit II.
30
3.5 Phosphate affinity electrophoresis
The phosphate-binding tag tool developed by Kinoshita et al. (2006) was used to
analyse phosphorylation modifications in purified protein and viral samples. Self-casted
acrylamide gels were used with resolving gels without SDS, but with 50 or 100 M
Phos-tagTM (Wako Pure Chemical Industries, Ltd) and 100 or 200 M MnCl2 instead.
For N and P proteins 0.5% (w/v) low electroendosmosis agarose (Supplied by
BioNordika, manufactured in EU) was used to strengthen the gels according to
Kinoshita et al. (2009) protocol. The gel and running buffer compositions are presented
in more detail in Appendix 5. Sample band shifts in Phos-tagTM gels were compared to
shifts in normal SDS-PAGE gels. E. coli P in a HEK293EBNA1 cell lysate was used as
a negative phosphorylation control. For matrix protein ovalbumin was used as a positive
phosphorylation control and dephosphorylated ovalbumin as negative control. Naturally
phosphorylated ovalbumin was dephosphorylated with 20 U/ml FastAPTM alkaline
phosphatase enzyme (Thermo Scientific) according to Thermo Scientifics protocol.
3.6 Immunoblotting
After gel electrophoresis, manganese ions were removed from the Phos-tagTM gels by
incubating the gels 10 min in 1 mM EDTA in western blot transfer buffer (10 mM
3-(cyclohexylamino)-1-propanesulfonic acid (CAPS), 10% (v/v) methanol, pH 10.5).
The samples were transferred to polyvinylidene fluoride (PVDF) membranes
(Millipore) with 200 mA for 1 h in wet tank at room temperature with cooled + 4C
transfer buffer. Membranes were blocked for 1 h at room temperature or overnight at +
4C in cold room with 2% (w/v) non-fat milk powder in PBS-T buffer (0.05% (v/v)
Tween 20 in PBS). After blocking, membranes were incubated with primary antibodies
for 1 h at room temperature in an agitator. Primary antibodies used were: anti-P (9H4)
mouse monoclonal ascites (Santa Cruz Biotechnology, Inc.), anti-N (2F3) mouse
monoclonal ascites (Santa Cruz Biotechnology, Inc.) or anti-M (ab101015) rabbit
polyclonal serum (Abcam, Plc) diluted in PBS-T buffer. The proteins were visualized
with ECLTM anti-mouse or anti-rabbit sheep IgG horseradish peroxidase(HRP)-
conjugated whole antibody (GE Healthcare) for 1 h at room temperature in an agitator.
LuminataTM Classico Western HRP substrate (Millipore) was used as substrate for the
HRP enzyme.
31
4 RESULTS
4.1 Cloning
The aim was to clone a truncated P1-48 gene and a whole P gene into a pTT5SH8Q2-
vector so that the proteins they express have His-tags at the N-terminus. The truncated
version was cloned for studying the P-N interaction the N-terminus of the P protein is
responsible for binding to N0 (Liljeroos, L. & Butcher, S.J., personal communication,
Harty et al. 1995).
In ligation reaction the undigested vector control gave three bands as expected:
nicked, linear and supercoiled forms of the plasmid of which the supercoiled form was
the most abundant (Figure 8, lane 3). The linearized vector and the inserts all had the
expected sizes: The linearized vector (lane 4) was 4.5 kb (Appendix 3: pTT5SHQ2-
plasmid), P1-48 was 200 bp (lanes 5 and 6) and P was 1.5 kb (lanes 8 and 9).
Purifications of the inserts and vector succeeded because only one band was seen. In
ligation reactions (lanes 7 and 10) many bands were seen, as expected, since there
should be many different ligation products in the mix.
32
Figure 8. DNA constructs used in ligation reaction. Run with 0.8% (w/v) low
electroendosmosis agarose (BioNordika) with 120 V for 20 min in 1 TAE buffer.
Lane and sample:
1 GeneRulerTM 1 kb DNA standard, Thermo Scientific
2 GeneRulerTM 100 bp DNA standard, Thermo Scientific
3 Undigested vector pTT5SH8Q2
4 NotI and EcoRI digested and purified vector pTT5SH8Q2, 4413 bp
5 Purified insert P1-48, 192 bp
6 NotI and EcoRI digested and purified insert P1-48, 182 bp
7 Ligation reaction of insert P1-48 and vector pTT5SH8Q2
8 Purified insert P, 1559 bp
9 NotI and EcoRI digested and purified insert P, 1572 bp
10 Ligation reaction of insert P and vector pTT5SH8Q2
33
Transformation efficiencies for the P1-48/pTT5SH8Q2 and P/pTT5SH8Q2 constructs
were 3.8 102 and 4.4 102 per g of DNA transformed (Table 4). Transformation
frequency was calculated by dividing the number of colonies with the number of cells
used in transformation. Transformation efficiencies were calculated by dividing number
of colonies with the amount of DNA used for transformation. The number of unspecific
ligation reactions were subtracted. In unspecific ligation reactions vectors had ligated to
themselves and were able to produce colonies, because ampicillin resistance gene was
read from circular DNA (Digested & ligated vector -row in the table). The
transformation efficiencies of the P1-48/pTT5SH8Q2 and P/pTT5SH8Q2 constructs are,
however, estimations since it is impossible to know the exact ligated DNA amount.
Table 4. Transformation efficiencies after 15 h of transformation.
number
of
colonies
Media
used
Transformation
frequency
Transformation
efficiency / g of
DNA
DH5 10-5 plate dilution 65 L
Undigested vector 405 L + Amp* 6.2 10-4 4.1 105
Digested & ligated vector 15 L + Amp* 2.3 10-5 6.0 102
P1-48/pTT5SH8Q2 32 L + Amp* 2.6 10-5 3.8 102
P/pTT5SH8Q2 31 L + Amp* 2.5 10-5 4.4 102 *Amp = 100 g/l ampicillin
The colony-PCR gave 7 and 3 positive subclones out of the ten tested per P1-48 or P
gene construct (Figure 9 and 10). With P1-48/pTT5SH8Q2 there were two bands in most
of the PCR results. The 200 bp band was the expected product and the other was
unspecific product where primers had bound to somewhere else in the genome.
Subclones number 7, 8 and 10 were chosen for digestion analysis (Figure 9, lanes 9, 10
and 12). P/pTT5SH8Q2 gave three positive subclones numbered 8, 9 and 10 that were
all taken for digestion analysis (Figure 10, lanes 911).
34
Figure 9. Colony-PCR of P1-48/pTT5SH8Q2. Run with 0.8% (w/v) low
electroendosmosis agarose (BioNordika) with 120 V for 20 min in 1 TAE buffer.
GeneRulerTM 1 kb (Thermo Scientific) in the first lane and GeneRulerTM 100 bp
(Thermo Scientific) in the second. Subclones 110 in lanes 312. The P1-48 insert is 192
bp in size. The expected band is the top most of the two bands in the lanes 312, sized
approximately 200 bp.
Figure 10. Colony-PCR of P/pTT5SH8Q2. Run with 0.8% (w/v) low electroendosmosis
agarose (BioNordika) with 120 V for 20 min in 1 TAE buffer. GeneRulerTM 1 kb
(Thermo Scientific) in the first lane. Subclones 110 in lanes 211. The P insert is
1572 bp in size.
35
All the six selected subclones that were positive according to colony-PCR, were also
positive according to the restriction enzyme digestion analysis (Figure 11). Digested
vector was 4.5 kb (lanes 13 and 68), digested P1-48 insert was 200 bp (lanes 13) and
P insert was 1.6 kb (lanes 68). Two subclones of both P1-48/pTT5SH8Q2 and
P/pTT5SH8Q2 were sent to sequencing.
Figure 11. Digestion analysis of six positive subclones from colony-PCR. Run with
0.8% (w/v) low electroendosmosis agarose (BioNordika) with 120 V for 20 min in 1
TAE buffer. Digested vector is 4413 bp, digested P1-48 insert is 182 bp and digested P
insert is 1559 bp. Lane and sample:
1 P1-48/pTT5SH8Q2, subclone number 7
2 subclone number 8
3 subclone number 10
4 GeneRulerTM 100 bp (Thermo Scientific)
5 GeneRulerTM 1 kb (Thermo Scientific)
6 P/pTT5SH8Q2, subclone number 8
7 subclone number 9
8 subclone number 10
36
The sequencing covered the whole genes P1-48 and P. In case of the P gene, forward and
reverse primer produced sequences overlapped by 47 bp. The results of sequencing
confirmed the success of cloning (Appendix 6: Sequencing results). Subclones 8 from
both of the cloned DNA constructs were chosen for use because they had produced
more sequencing data and contained no mutations (like the one in the P subclone 9 that
was missing C849 from the sequence).
The sequences of the both clones used later in the work matched with the Helsinki
strain. Comparing to Edmonston strain there was one point mutation from A to G in
residues 1474. It changed 492nd amino acid from asparagine to aspartic acid. The
protein was still functional because although the mutation was rare there was at least
one documented strain that had the same mutation in the GenBank of National
Institutes of Health (NIH) genetic sequence database: Measles strain NC1/95 (GenBank
ID: FN668724.1). According to the protein data bank the mutation was in the beginning
of the third and last -helixes at the end of the P protein (Protein data bank ID: 1T6O).
4.2 Tissue culture
4.2.1 Transfection optimization with PEI
The best DNA to PEI ratio for transfecting HEK293EBNA1 cells was 1:5 (Figure 12).
There was no transfection without PEI and DNA to PEI ratio 1:1 worked really poorly;
only a few cells in the plate got transfected. Transfection efficiency was 50% at its best
(Table 5). PEI, though being toxic to cells, did not affect cell growth significantly,
because there were about the same amount of cells growing in all of the cluster plates
regardless of the amount of PEI used.
The transfected cells had different fluorescence levels in a culture. If the
fluorescence was low the cell was able to survive but protein production was also low.
37
Figure 12. Transfection optimization test of HEK293EBNA1 cells with
YFP/pTT5SH8Q2 control plasmid. The pictures show the amount of fluorescent cells in
the transfected cultures that differ by PEI amounts. DNA to PEI ratios are shown in the
upper left corners. Pictures are taken by UV- and visible light at the same time. No
picture of 1:1 ratio or PEI control are presented. Cells were 80% confluent when
transfected and the passage number was 20.
Table 5. Transfection efficiencies of the optimization test.
DNA : PEI ratio Transfection efficiency - Amount of
fluorescent cells per all the cells
1 : 1 0.01%
1 : 2.5 20%
1 : 3 30%
1 : 4 40%
1 : 5 50%
PEI control 0
1:4 1:5
1:2.5 1:3
38
4.2.2 Transfection with measles gene constructs to create heterologous
overexpression
The HEK293EBNA1 cells were transfected, in two sets for comparison, with
P1-48/pTT5SH8Q2, P/pTT5SH8Q2, N/pTT5SH8Q2, P1-48/pTT5SH8Q2 +
N/pTT5SH8Q2 and P/pTT5SH8Q2 + N/pTT5SH8Q2, M/pTT5SH8Q2 and also
YFP/pTT5SH8Q2 separately. The cells were 70% and 100% confluent when harvested.
Transfection efficiencies were 60% and 70% (Figure 13). Transfection efficiencies were
higher in measles gene construct transfections than in the PEI optimization. Also, it was
10% better when the cells were more confluent during the second transfection.
Figure 13. Transfection efficiencies with YFP/pTT5SH8Q2 control plasmid.
Transfection efficiencies are 60% in the left panel and 70% in the right panel. In the
first transfections cells were 70% confluent and in the second transfection they were
100% confluent after two days of transfection. The passage numbers were 22 and 28.
4.3 Protein purification from mammalian cells with Ni-NTA beads
The results were similar for the two sets of purifications and are only shown for the
second one. Protein production for the other proteins except for P was very low with
HEK293EBNA1 cells (Figures 14 and 15). The 75 kDa P was clearly seen in SDS-
PAGE electrophoresis (Figure 14, lanes 57 and Figure 15, lanes 25). Also the 30 kDa
YFP protein purified well with the beads and clearly had a His-tag (Figure 15, lanes 10
12). There were also a lot of unspecific protein binding so the E. coli produced P was
not clearly seen in gel and western blotting had to be used. Also N and M were only
1. Transfection 2. Transfection
39
seen sufficiently enough with western blotting. P1-48 was not seen even with blotting
(data not presented). Perhaps it did not bind the P antibody as the protein was so
truncated, containing only the first 48 amino acids of the full-length protein. However, it
was not seen either with antibodies for His-tag. RIPA buffer used for purifying proteins
from nuclei did not work with the beads (Figures 14 and 15, all nuclear fractions).
Figure 14. Protein purification for HEK293EBNA1 produced proteins: cell lysate,
cytosolic and nuclear fractions are shown separately. Run with Mini-Protean TGXTM
420% gradient gel (Bio-Rad) with 20 mA for 1h in 1 Laemmli buffer. Lane and
sample:
1 Protein marker, broad range 2-212 kDa (NEB)
2 lysate P1-48 3 cytosolic P1-48
4 nuclear P1-48
5 lysate P 6 cytosolic P
7 nuclear P
8 lysate N 9 cytosolic N
10 nuclear N
11 lysate P1-48+N 12 cytosolic P1-48+N
13 nuclear P1-48+N
14
15
40
Figure 15. Protein purification for HEK293EBNA1 produced proteins: cell lysate,
cytosolic and nuclear fractions are shown separately. Run with Mini-Protean TGXTM
420% gradient gel (Bio-Rad) with 20 mA for 1h in 1 Laemmli buffer. Lane and
sample:
1 Protein marker, broad range 2-212 kDa (NEB)
2 lysate P+N 3 cytosolic P+N
4 nuclear P+N
5 lysate P 6 lysate N
7 lysate M 8 cytosolic M
9 nuclear M
10 lysate YFP control + E. coli produced P phosphorylation control 11 cytosolic YFP control + E. coli produced P phosphorylation control
12 nuclear YFP control + E. coli produced P phosphorylation control
13
14 Protein marker, broad range 2-212 kDa (NEB)
15
4.4 Virus production
After two days of infection, Vero/SLAM cells formed large syncytia (Figure 16 and 17).
Virus was recovered from cytosol, nuclei and culture media separately and P, N and M
proteins were detected from them with western blotting (Figure 18). Mock infected cells
gave no signal.
41
Figure 16. Cells in a less confluent cell layer after two days of infection. Still normal
looking cells in the bottom half of the picture and a large syncytium in the middle of the
picture (shown with arrows).
Figure 17. Syncytia in a more confluent cell layer after two days of infection. The
outlines of individual cells are hard to see. The cells are gradually forming a one giant
multinucleated cell.
42
Figure 18. Western blot from virus purification with anti-P, anti-N and anti-M
antibodies. Samples are blotted from 420% Mini-ProteanTGXTM precasted gel
(Bio-Rad). Gels were run with 30 mA in 1 Laemmli buffer for 1 h 20 min (P and N
samples) and 45 min (M samples). Primary antibody dilutions used were 1:4,000 for
anti-P and anti-N and 1:2,000 for anti-M. Secondary antibody dilution used was
1:2,000. Lane and sample:
1 E. coli produced P, N or M (kindly provided by Liljeroos, L.)
2 Virus from cytosolic fraction
3 Mock infected cytosolic fraction
4 Virus from nuclear fraction
5 Mock infected nuclear fraction
6 Culture media from OptiPrepTM purification with virus supernatant
7 Culture media from OptiPrepTM purification with mock infected cell supernatant
8 OptiPrepTM layer sample from OptiPrepTM purification with virus supernatant
9 OptiPrepTM layer sample from OptiPrepTM purification from mock infected cell
supernatant
10 Released virus from OptiPrepTM purification
11 Sample from bottom of the tube from OptiPrepTM purification with mock infected
cell supernatant
1 2 3 4 5 6 7 8 9 10 11 1 2 3 4 5 6 7 8 9 10 11 1 2 3 4 5 6 7 8 9 10 11
P N M
43
4.5 Mycoplasma test
There was no mycoplasma contamination in the mammalian cell cultures according to
PromoKines PCR Mycoplasma test kit II as shown in Figure 19.
Figure 19. Mycoplasma test. Positive result would give 270 bp band. Run with 2%
(w/v) low electroendosmosis agarose (BioNordika) with 120 V for 30 min in 1 TAE
buffer. Lane and sample:
1 GeneRulerTM 100 bp (Thermo Scientific)
2 Positive control provided by the test kit
3 Negative control without template
4 Sample from HEK293EBNA1 culture media
5 Sample from Vero/SLAM culture media
44
4.6 Phosphorylation analysis
4.6.1 Phosphoprotein has three predominant phosphate isoforms
E. coli produced P added to the HEK293EBNA1 cell lysate was not phosphorylated
even though no kinase inhibitor was used in protein purification (Figure 20). Therefore
recombinant proteins in the samples were still in their natural phosphorylation state as
they had been when produced from the cells. Protein standards were poorly seen in the
developed films, but some main standard bands were seen and the sizes of the proteins
were also checked by comparing immediately to the blotted membranes.
Figure 20. E. coli P added to the HEK293EBNA1 cell lysate is not phosphorylated. On
the left is blotted Phos-tagTM gel (5% (w/v) acrylamide, 0.5% (w/v) agarose, 50 M
Phos-tagTM) and on the right is blotted normal SDS-PAGE gel (7.5% (w/v) acrylamide).
Both were run with 30 mA in 1 Laemmli buffer for 1 h 25 min. Antibody dilutions
used were 1:6,000 for primary antibody and 1:3,000 for secondary antibody. Lane and
sample:
1 E. coli P added to the HEK293EBNA1 cell lysate
2 E. coli P
P was phosphorylated when produced in mammalian cells as a recombinant protein and
also in virus as expected (Figures 21 and 22). P shifted only lightly when compared to
E. coli produced unphosphorylated protein. There was one unphosphorylated and two
predominant phosphorylated isoforms. They were seen in all samples except the viral
nuclear fraction that produced too distorted sample bands (Figures 21 and 22, lanes 26
and 8). Also there seemed to be at least one additional phosphorylated isoform in
recombinant P produced with N (Figure 21, lane 4). With high exposure time of the film
at least three faint additional sample bands were also seen (Figure 22). No difference
was detected between cytosolic or nuclear fractions in mammalian recombinant
proteins. Phosphorylated isoform ratios were different in the samples: In recombinant P
the least phosphorylated isoform was predominant in all samples (the middle sample
band in Figures 21 and 22, lanes 25). However, in a complex with N, P had more of
1 2 1 2
45
the second phosphorylated isoform (the upper most predominant sample band in Figure
21 and 22, lanes 4 and 5). In virus, then however, the unphosphorylated form was
predominant and released virus had very little of the most phosphorylated isoform.
Mock transfected or infected cells gave no signal in normal or Phos-tagTM gels.
Figure 21. Bacterial and mammalian produced P compared to viral P. Upper Figure is
blotted from Phos-tagTM gel (5% (w/v) acrylamide, 0.5% (w/v) agarose, 50 M Phos-
tagTM) and bottom from normal SDS-PAGE gel (7.5% (w/v) acrylamide). Both were run
with 30 mA in 1 Laemmli buffer for 1 h 25 min. Antibody dilutions used were
1:6,000 for primary antibody and 1:3,000 for secondary antibody. In lane one the upper
band is polymerized P protein and the bottom one is a breakdown product also seen in
other sources for example in Huber et al. 1991. Lane and sample:
1 E. coli P
2 HEK P cytosolic
3 HEK P nuclear
4 HEK P+N cytosolic
5 HEK P+N nuclear
6 Viral P cytosolic
7 Viral P nuclear
8 Viral P released
1 2 3 4 5 6 7 8
46
Figure 22. Bacterial and mammalian produced P compared to viral P. The upper two
panels are blotted from Phos-tagTM gel (5% (w/v) acrylamide, 0.5% (w/v) agarose, 50
M Phos-tagTM) and the bottom panel from normal SDS-PAGE gel (7.5% (w/v)
acrylamide). Both were run with 30 mA in 1 Laemmli buffer for 1 h 25 min. Antibody
dilutions used were 1:4,000 for primary antibody and 1:2,000 for secondary antibody.
Two different exposure times are shown for the Phos-tagTM samples. Lane and sample:
1 E. coli P
2 HEK P cytosolic
3 HEK P nuclear
4 HEK P+N cytosolic
5 HEK P+N nuclear
6 Viral P cytosolic
7 Viral P nuclear
8 Viral P released
1 2 3 4 5 6 7 8
47
4.6.2 Nucleoprotein is the most phosphorylated as a recombinant protein
when expressed alone and otherwise very scarcely
The shift between phosphorylated isoform of N and unphosphorylated E. coli produced
N was again narrow. N was phosphorylated with three predominant isoforms and
possibly three other scarce isoforms (light bands) when produced alone in mammalian
cells (Figure 23 and 24, lanes 2 and 3). Other samples were predominantly
unphosphorylated, but had one scarce phosphorylated isoform. In addition, there might
had been an additional band right above the predominant sample band in the viral
cytosolic sample (Figure 23 and 24, lane 6). An oligomerized protein band in the E. coli
control was unfortunate (Figures 23 and 24, lane 1). There seemed to be two
phosphorylated bands in the viral samples, but the other one was a polymerized protein,
since it was seen also in the standard SDS-PAGE gel (Figure 23 and 24, lanes 68, the
bottom most gel picture). No difference was detected between cytosolic or nuclear
fractions in mammalian recombinant proteins. Mock transfected or infected cells gave
no signal in normal or Phos-tagTM gels (data not shown).
Sample bands were smeared so second blot was done with a lot smaller sample
amounts and long exposure time for the film had to be used to see them. Because of the
conditions some sample bands got distorted and the nuclear sample of N in complex
with P run differently than the cytosolic one (Figure 24, lane 5), when earlier they had
run similarly (Figure 23, lanes 4 and 5). Also the recombinant N in complex with P
seemed to be predominantly phosphorylated (Figure 24, lane 5) and also the E. coli
produced N sample band was distorted. However, the phosphorylated isoforms of the
recombinant N produced alone were now nicely visible (Figure 24, lane 2).
48
Figure 23. Bacterial and mammalian produced N compared to viral N. The upper two
panels are blotted from Phos-tagTM gel (5% (w/v) acrylamide, 0.5% (w/v) agarose, 100
M Phos-tagTM) and the bottom panel from normal SDS-PAGE gel (10% (w/v)
acrylamide). Both were run with 30 mA in 1 Laemmli buffer for 1 h 20 min and 1 h
30 min respectively. Antibody dilutions used were 1:4,000 for primary antibody and
1:2,000 for secondary antibody. Two different exposure times are shown for the Phos-
tagTM samples. In lane one the upper band is polymerized N and the bottom one is a
breakdown product also seen in other sources for example in Huber et al. 1991. Lane
and sample:
1 E. coli N
2 HEK N cytosolic
3 HEK N nuclear
4 HEK P+N cytosolic
5 HEK P+N nuclear
6 Viral N cytosolic
7 Viral N nuclear
8 Viral N released
1 2 3 4 5 6 7 8
49
Figure 24. Bacterial and mammalian produced N compared to viral N: Smaller sample
amounts with long exposure time. Upper Figure is blotted from Phos-tagTM gel (5%
(w/v) acrylamide, 0.5% (w/v) agarose, 100 M Phos-tagTM) and bottom from normal
SDS-PAGE gel (10% (w/v) acrylamide). Both were run with 30 mA in 1 Laemmli
buffer for 1 h 11 min. Antibody dilutions used were 1:6,000 for primary antibody and
1:3,000 for secondary antibody. Lane and sample:
1 E. coli N
2 HEK N cytosolic
3 HEK N nuclear
4 HEK P+N cytosolic
5 HEK P+N nuclear
6 Viral N cytosolic
7 Viral N nuclear
8 Viral N released
4.6.3 Matrix protein is unphosphorylated
No phosphorylation was detected in M protein (Figure 25). M 37 kDa was even smaller
than 45 kDa ovalbumin which shifted always well (Figure 26) so if M was
phosphorylated the shift should had been well seen in Mn2+Phos-tagTM gels. M
proteins were prone to self-aggregation and aggregates were seen as bands on the top of
the gel with mammalian produced protein and also as two bands in E. coli produced
protein (not shown). Mock transfected or infected cells gave no signal in normal or
Phos-tagTM gels.
1 2 3 4 5 6 7 8
50
Figure 25. Bacterial and mammalian produced M compared to viral M. Upper Figure is
blotted from Phos-tagTM gel (7.5% (w/v) acrylamide, 100 M Phos-tagTM) and bottom
from normal SDS-PAGE gel (10% (w/v) acrylamide). Both were run with 30 mA i