1
Short title: Relevance of off-target changes in genome editing 1
2
Co-Corresponding Authors: Peter L. Morrell ([email protected]); Robert M. Stupar 3
([email protected]), Department of Agronomy and Plant Genetics, 1991 Upper Buford Circle, 4
411 Borlaug Hall, St. Paul, MN 55108-6026 USA 5
6
Full title: Plant genome editing and the relevance of off-target changes 7
8
Author Names and Affiliations: Nathaniel Grahama,b, Gunvant B. Patilc,1, David M. Bubeckd, 9
Raymond C. Doberte, Kevin C. Glenne, Annie T. Gutsched, Sandeep Kumard, John A. Lindbof, 10
Luis Maasg, Gregory D. Mayd, Miguel E. Vega-Sancheze, Robert M. Stuparc, Peter L. Morrellc 11
12
a Department of Genetics, Cell Biology and Development, University of Minnesota, St. Paul, MN 13
55108 USA 14
b Pairwise, Durham, NC 27709 USA 15
c Department of Agronomy and Plant Genetics, University of Minnesota, St. Paul, MN 55108 16
USA 17
d Corteva Agriscience™, Johnston, IA 50131, USA 18
e Bayer Crop Science, Chesterfield, MO 63017 USA 19
f HM Clause, Davis, CA 95618 USA 20
g Enza Zaden Research USA, San Juan Bautista, CA 95045 USA 21
1 Present address: Department of Plant and Soil Science, Texas Tech University, Lubbock, TX 22
79409. 23
Plant Physiology Preview. Published on May 26, 2020, as DOI:10.1104/pp.19.01194
Copyright 2020 by the American Society of Plant Biologists
www.plantphysiol.orgon August 23, 2020 - Published by Downloaded from Copyright © 2020 American Society of Plant Biologists. All rights reserved.
2
One Sentence Summary: With well-designed protocols and guide RNAs, off-target changes 24
induced by site-directed nucleases are negligible with fewer genetic differences than from 25
standing variation or induced mutagenesis. 26
27
Conflict of interest statement: Some of the authors are employees of Corteva Agriscience, 28
Bayer Crop Science, HM Clause, Enza Zaden, or Pairwise, which are companies involved in 29
targeted genetic modification of plants. R.M.S. is a co-inventor of a patent in the plant gene-30
editing space. All other authors report no conflicts of interest relevant to this article. 31
32
List of author contributions: The authors contributed equally in conceiving, drafting, editing, 33
and critical review of the text, tables, and figures of this review. 34
35
Abstract 36
Site-directed nucleases (SDNs) used for targeted genome editing are powerful new tools to 37
introduce precise genetic changes into plants. Like traditional approaches, such as conventional 38
crossing and induced mutagenesis, genome editing aims to improve crop yield and nutrition. 39
Next-generation sequencing studies demonstrate that across their genomes, populations of 40
crop species typically carry millions of single nucleotide polymorphisms and many copy number 41
and structural variants. Spontaneous mutations occur at rates of approximately 10-8 to 10-9 per 42
site per generation, while variation induced by chemical treatment or ionizing radiation results in 43
higher mutation rates. In the context of SDNs, an off-target change or edit is an unintended, 44
non-specific mutation occurring at a site with sequence similarity to the targeted edit region. 45
SDN-mediated off-target changes can contribute to a small number of additional genetic 46
variations compared to those that occur naturally in breeding populations or are introduced by 47
induced-mutagenesis methods. Recent studies show that using computational algorithms to 48
design genome editing reagents can mitigate off-target edits in plants. Finally, crops are subject 49
www.plantphysiol.orgon August 23, 2020 - Published by Downloaded from Copyright © 2020 American Society of Plant Biologists. All rights reserved.
3
to strong selection to eliminate off-type plants through well-established multigenerational 50
breeding, selection, and commercial variety development practices. Within this context, off-51
target edits in crops present no new safety concerns compared to other breeding practices. The 52
current generation of genome editing technologies is already proving useful to develop new 53
plant varieties with consumer and farmer benefits. Genome editing will likely undergo improved 54
editing specificity along with new developments in SDN delivery and increasing genomic 55
characterization, further improving reagent design and application. 56
Introduction: Plant Genetic Variability 57
Genetic differences between individuals are the basis of adaptation and evolution. Plant 58
breeding, as a form of directed evolution, has a long history of using genetic diversity for crop 59
improvement. During the process of crop domestication, humans selected individual plants with 60
favorable traits that resulted from novel mutations or standing variation in the ancestral species. 61
The process of selecting plant varieties with favorable characteristics for cultivation and 62
consumption continues to the present day. Modern plant breeding is a more directed process 63
than the crop improvement that occurred through the history and pre-history of most cultivated 64
species, but it continues to involve lengthy development cycles. Progress in our understanding 65
of the genetic basis of traits and refined approaches to select superior progeny have contributed 66
to increased yield for most major crops. Globally, crop yields have increased by greater than 67
one percent each year for much of the past century (Xu et al., 2017). Technological innovations, 68
including those that increased our understanding of nucleic acid sequence and function, have 69
contributed to this progress. Advances have primarily been incremental, with few step changes 70
(Bernardo, 2016). The relatively recent introduction of genome editing, which permits targeted 71
genetic changes, is part of a continuum of development of plant breeding techniques (Lusser et 72
al., 2012). Its primary appeal is that, in contrast to established mutagenesis techniques, 73
changes can be targeted to desired genes. 74
www.plantphysiol.orgon August 23, 2020 - Published by Downloaded from Copyright © 2020 American Society of Plant Biologists. All rights reserved.
4
Over the past several decades, there has been rapid development of genome editing 75
techniques (also referred to as gene editing or genome engineering) (Gaj et al., 2013; 76
Jaganathan et al., 2018; Zhang et al., 2018). These technologies make use of site-directed 77
nucleases (SDNs) and have broad applicability, including applications in many crop plants 78
(Podevin et al., 2013; Voytas, 2013; Weeks et al., 2016). As described in greater detail below, 79
SDNs are enzymes that create DNA double-strand breaks (DSB) at specific, pre-determined 80
nucleotide sequences sites, permitting targeted genetic modifications (Voytas, 2013; Weeks et 81
al., 2016). The most robust and best-characterized SDNs are the Zinc-Finger Nucleases (ZFN), 82
Transcription Activator-Like Effector Nucleases (TALEN), and the type II Clustered Regularly-83
Interspaced Short Palindromic Repeats-CRISPR-associated proteins (e.g., Cas9 or Cas12a) 84
systems, hereafter referred to as “CRISPR” (Gaj et al., 2013; Jaganathan et al., 2018; Zhang et 85
al., 2018). In all cases, the targeted DSBs generated by these precision nucleases are repaired 86
by the cell’s native DNA break repair mechanisms: the non-homologous end-joining (NHEJ) or 87
the homologous recombination (HR) pathways (Danner et al., 2017). 88
One area of consideration for genome editing of plants, animals, and in human therapeutic 89
applications is the potential for “off-target” edits that could lead to unintended mutations at 90
untargeted loci in the genome. An off-target edit is an unintended, non-specific mutation that 91
occurs at a site with sequence similarity to the targeted edit region. Off-target edits are distinct 92
from untargeted mutations that occur at sites without similarity to the target region and that are 93
usually associated with spontaneous or other type of background variation. The fidelity of SDNs 94
to edit only the targeted sequence has been questioned, particularly in mammalian genome 95
editing applications (Carroll, 2011; Pattanayak et al., 2011; Carroll, 2013; Wu et al., 2014; 96
Zhang et al., 2015; Tsai and Joung, 2016; Kosicki et al., 2018). The potential to introduce DNA 97
sequence changes at non-targeted loci in patients undergoing genome editing procedures has 98
become an essential consideration for clinical and disease treatment applications (Araki and 99
www.plantphysiol.orgon August 23, 2020 - Published by Downloaded from Copyright © 2020 American Society of Plant Biologists. All rights reserved.
5
Ishii, 2016). Furthermore, unintended mutations in treated human somatic cells could pose 100
health risks such as unregulated cell proliferation (cancer) (Cox et al., 2015). Off-target edits 101
were detected in the early stages of CRISPR-Cas9 research involving human cancer cell lines 102
(Fu et al., 2013). The off-target edit frequency in human cells ranged from 0 to 150 mutations 103
per genome, and this frequency was closely linked to the single-guide RNA (sgRNA) specificity 104
(Frock et al., 2015). The potential for off-target edits and rate at which they could occur in plants 105
are discussed below. 106
Plants differ from animals in substantive ways that alter the impact of induced changes. First, 107
somatic cell changes in plants differ in consequences from those in mammals. Somatic changes 108
in a portion of the plant are less likely to affect critical (irreplaceable) tissues. Unlike many 109
animals, genetic changes in juvenile plants can be transmitted to reproductive tissues (Schmid-110
Siegert et al., 2017). However, plants frequently develop multiple independent reproductive 111
structures, only a portion of which may be affected by any new mutations. Also, breeding to 112
develop new lines for commercial release involves an intensive process of selection of individual 113
plants with useful phenotypes while eliminating individuals with undesirable mutations or 114
phenotypes (commonly known as “off-types”) (ASTA, 2016; Glenn et al., 2017; Kaiser et al., 115
2020). For these reasons, off-target edits in crops present fewer safety concerns than those that 116
could arise with therapeutic applications of genome editing. 117
The goal of this review is a quantitative comparison of genetic variation that could arise through 118
genome editing with the variation that exists in crop species or is generated by current breeding 119
practices. The review examines our current understanding of the nature and abundance of 120
standing and induced genetic variation in crops and how they compare to the potential for off-121
target changes during genome editing. 122
Sources and Types of Inherent (Standing) Genomic Variation in Plants 123
www.plantphysiol.orgon August 23, 2020 - Published by Downloaded from Copyright © 2020 American Society of Plant Biologists. All rights reserved.
6
Before the identification of DNA as the molecular basis for the transmission of heritable genetic 124
variation, crop domestication and plant breeding involved visible inspection and selection of 125
desired phenotypes. There was limited knowledge of the types and extent of underlying 126
genomic variation in crop plants and their wild relatives (Zohary, 1999). The development of 127
genomic sequencing methodologies has provided an unprecedented understanding of the 128
molecular basis of diversity in plant species, ranging from single nucleotide variants to macro-129
scale events such as genomic rearrangements or whole genome duplication leading to 130
polyploidy and transposon-directed DNA transposition (Wendel et al., 2016; Gabur et al., 2019). 131
Our understanding of the primary sources of genetic diversity, namely mutations and 132
recombination, and the cellular processes involved in generating this variation, have increased 133
as both DNA sequencing technologies and genome assemblies have improved (Bevan et al., 134
2017). Mutation creates new variants while recombination arranges variants into new 135
combinations (Morrell et al., 2006); both processes rely upon endogenous DNA repair 136
mechanisms (see Box 1 on double-strand DNA break repair). Genetic drift and both positive and 137
purifying selection remove variants from populations, maintaining an equilibrium that permits 138
variation to persist at relatively constant levels in stable populations. Much of the process of 139
plant breeding involves the creation of varieties that combine favorable variants from their 140
parental lines. 141
[INSERT TEXT BOX - The Importance of Double-Strand Break Repairs] 142
Reference genomes and assessment of genomic variation 143
Standing variation in a species can be estimated at the whole genome level by comparing a 144
sample of individuals using Next Generation Sequencing (NGS). High-throughput DNA 145
sequencing, whole-genome reference sequences and assembly, and improved bioinformatic 146
tools have provided an unprecedented understanding of the variation in populations of the 147
www.plantphysiol.orgon August 23, 2020 - Published by Downloaded from Copyright © 2020 American Society of Plant Biologists. All rights reserved.
7
world’s major field and vegetable crop species (Morrell et al., 2011; Huang and Han, 2014; 148
Bevan et al., 2017). NGS and reference-based read mapping have also been used to identify de 149
novo sequence variation in lines accumulating induced and spontaneous mutations over several 150
generations (Ossowski et al., 2010; Belfield et al., 2012; Henry et al., 2014). Many of the field 151
crop and vegetable species that constitute a major part of the global diet now have a high-152
quality reference genome sequence (Michael and VanBuren, 2015). Reference genomes have 153
several limitations, the most apparent being that all genes or gene variants are not present in 154
any single accession (Hirsch et al., 2016; Jiao et al., 2017). Means of accounting for structural 155
variation and gene content are rapidly evolving, but generally involve representing multiple 156
genomes of a single species in a graph-like structure (Church et al., 2015; Paten et al., 2017). 157
A list of the classes of variation detected in cultivated plants is presented in Table 1. Single 158
nucleotide variations (SNVs) (referred to as single nucleotide polymorphisms (SNPs) when 159
segregating in populations), are the most abundant class (Innan et al., 1996). Because of their 160
abundance, SNPs are the most commonly genotyped polymorphism for breeding applications 161
and comparative studies in crops (Morrell et al., 2011). Insertion and deletion (indels) changes 162
are also common forms of variation, but because indel events are superimposed over one 163
another, over evolutionary time it becomes increasingly difficult to distinguish the boundaries of 164
individual insertion or deletion events (Clegg and Morrell, 2004). These naturally occurring 165
changes are similar to those induced by SDNs, with SNVs being equivalent to base edits (see 166
below) and indels resembling the gene knockouts induces by CRISPR edits. 167
[INSERT TABLE 1 HERE] 168
It is important to note that most whole genome sequencing studies to date have used short-read 169
sequencing technologies (Gilad et al., 2009). As a result, the diversity in breeding populations 170
due to structural variation such as variation in transposable element location and abundance, 171
www.plantphysiol.orgon August 23, 2020 - Published by Downloaded from Copyright © 2020 American Society of Plant Biologists. All rights reserved.
8
presence-absence variation (PAV) and gene copy number variants (CNV) has been difficult to 172
measure (Muñoz-Diez et al., 2012). PAV and CNV typically refer to changes that include genes 173
and thus are functionally equivalent to SDN-mediated gene insertion or deletion. Although 174
structural variants are less common than SNPs, they are an important source of variation 175
(Gabur et al., 2019; Schiessl et al., 2019). There are many examples of gene presence/absence 176
or copy number differences impacting agronomic traits including submergence tolerance in rice 177
(Oryza sativa) (Xu et al., 2006), high oleic acid content in sunflower oil (Schuppert et al., 2006), 178
soybean cyst nematode resistance (Cook et al., 2012), and seed coat pigmentation in soybean 179
(Glycine max) (Todd and Vodkin, 1996). Because of the density of naturally occurring variation, 180
intra- and inter-specific crosses of plants that occur during plant breeding can introduce millions 181
of SNPs (see Figure 1), in addition to thousands of PAV or CNV sequence variations into 182
resulting progeny. As more long-read sequencing technologies are deployed, more accurate 183
measurements of the CNV and PAV in breeding populations will be possible. 184
Sources of spontaneous de novo genome variation 185
Table 2 reports current estimates of standing genomic variation in select crop species. 186
Environmental conditions and breeding and genetic practices such as tissue culture propagation 187
(described below) can further impact the rate at which mutations occur. The sources, types, and 188
rates of de novo genomic variation are reviewed below. 189
[INSERT TABLE 2 HERE] 190
Spontaneous Nucleotide Variation: 191
De novo mutations arise primarily from errors in the DNA replication process. DNA repair 192
processes (NHEJ and HR) can also result in new mutations, including variants that arise due to 193
environmentally-triggered DNA damage (Jiang et al., 2014; Nisa et al., 2019). Whole-genome 194
sequencing of mutation accumulation lines of Arabidopsis (Arabidopsis thaliana) estimated a 195
www.plantphysiol.orgon August 23, 2020 - Published by Downloaded from Copyright © 2020 American Society of Plant Biologists. All rights reserved.
9
mutation rate of 7 x 10-9 base substitutions per site per sexual generation (Ossowski et al., 196
2010), a rate confirmed in a more recent report (Weng et al., 2019). This rate estimate in 197
Arabidopsis is consistent with earlier estimates of a mutation rate of 5.9 x 10-9 substitutions per 198
site per year based on phylogenetic divergence in monocots (Gaut et al., 1996). Most of the 199
mutations reported by Ossowski et al. (2010) were SNPs, though 1-3 bp indel mutations were 200
also detected at a rate of 4.0 +/-1.6 x 10-10 indels per site per generation. Deletions larger than 3 201
bp occurred at a rate of 0.5 x 10-9 per site per generation, and the average larger deletion size 202
was hundreds of bp per event (Ossowski et al., 2010). In a similar study in rice, the mutation 203
rate was estimated at 5.4 x 10-8 per site per diploid genome (Tang et al., 2018). In maize (Zea 204
mays), the spontaneous mutation rate was reported to be 2.2-3.9 x 10-8 per site per generation 205
(Yang et al., 2017). The general trend for single nucleotide mutation rates in plants is on the 206
order of 10-8 to 10-9 per site per generation, similar to estimates for humans (Nachman and 207
Crowell, 2000; Roach et al., 2010). 208
Transposons as a source of variation: 209
In many plant species, transposable elements (TE) and the remnants of past TE insertion 210
events make up the majority of the genome (Sahebi et al., 2018). For example, TEs make up 211
approximately 85% of the maize genome, 76% of the pepper genome, and between 20-40% of 212
the rice genome, depending upon the rice cultivar (Dubin et al., 2018; Anderson et al., 2019). 213
Transposons are DNA elements that can auto-excise and re-insert in the genome. They have 214
the potential to disrupt genes or create rearrangements. They can also result in complete copies 215
of genetic elements being placed in other areas of the genome. Transposons can have a 216
profound impact on genome structure and gene function (Lisch, 2012). Some types of 217
transposons are known to be activated by environmental conditions (e.g., temperature) and by 218
breeding practices, (e.g., tissue culture, described below) (Vitte et al., 2014; Rey et al., 2016). 219
www.plantphysiol.orgon August 23, 2020 - Published by Downloaded from Copyright © 2020 American Society of Plant Biologists. All rights reserved.
10
Accurate measurements of rates of heritable transposition in a single generation in plants have 220
not been determined. 221
Summary of inherent genomic variation 222
NGS has dramatically improved the estimation of genome-wide standing variation and made it 223
possible to estimate rates of de novo mutations, especially SNVs. Numerous studies have 224
examined the genomic variation between individuals in breeding populations for well-studied 225
crops like maize (Hufford et al., 2012; Lu et al., 2015; Bukowski et al., 2017), soybean (Li et al., 226
2014; Maldonado dos Santos et al., 2016; Valliyodan et al., 2016), and rice (Zhao et al., 2018). 227
To date, short-read sequencing technology has been the principal tool used for resequencing 228
plant genomes. However, short-read sequence technologies are of more limited utility for 229
detection of large structural variants (such as PAV or CNV) (Gilad et al., 2009; Morrell et al., 230
2011; Fuentes et al., 2019). As long-read sequencing becomes a more standard component of 231
comparative studies and additional reference-quality genomes from individual species are 232
reported, diversity due to large structural changes will become more readily accessible (Gabur 233
et al., 2019; Schiessl et al., 2019). 234
Sources of Induced Genomic Variation in Plants 235
Although naturally-occurring genetic variants have been the primary source of plant genetic 236
diversity used for crop domestication and breeding, geneticists have developed approaches to 237
augment natural plant genomic diversity and accelerate the development of improved cultivars. 238
Genetic variation induced by chemical mutagens and ionizing radiation has been used in plant 239
breeding since early in the 20th century (Friedberg et al., 2006). Somaclonal variation induced 240
by tissue culture has also been a source of variation used in plant breeding. Mutation breeding 241
is considered cost-effective, ubiquitously applicable, non-hazardous, environmentally friendly, 242
and continues to benefit plant breeders and consumers globally (Ahloowalia et al., 2004). Many 243
www.plantphysiol.orgon August 23, 2020 - Published by Downloaded from Copyright © 2020 American Society of Plant Biologists. All rights reserved.
11
types of mutagenic and ionizing agents have been evaluated to maximize genomic variation 244
while minimizing detrimental or lethal effects in plants (Sikora et al., 2011). As described below, 245
each type of mutagenic agent tends to have a predominant type of mutation induced across the 246
genome. 247
The mutations induced by chemical and ionizing radiation occur throughout the genome, but at 248
an increased rate compared to spontaneous mutations (Belfield et al., 2012; Henry et al., 2014). 249
It can be difficult to select individuals with mutations for the desired phenotype, yet lacking 250
mutations that produce undesirable phenotypes (Bolon et al., 2011; Saika et al., 2011). Mutant 251
lines that carry numerous new mutations have been developed for genetic studies and breeding 252
improved varieties in many crops (Tables 3 and 4). Over 3,200 mutant varieties, including 253
cereals (1,584; 49.5%), flowers/ornamentals (700; 21.9%), legumes (480; 15%) and others 254
(435; 13.6%), have been released for commercial use in more than 210 plant species in over 70 255
countries (Figure 2). 256
[INSERT TABLES 3 and 4 HERE] 257
Mutant population screening is commonly used in rice breeding, resulting in 828 registered lines 258
in the Mutant Variety Database (Kharkwal et al., 2004; Shu et al., 2012; Wang and Jia, 2014). 259
Most of the wheat (Triticum aestivum) varieties used for making Italian pasta were derived in 260
part through mutation breeding (Micke et al., 1990; Mba, 2013). For some crops, mutation 261
breeding is more widely utilized for crop improvement within specific geographic regions. For 262
example, nearly 50% of the improved soybean cultivars grown in Vietnam are derived from 263
induced mutations (Vinh et al., 2009). Mutagenesis has also been used to introduce desirable 264
traits in horticultural crops. For example, researchers have used induced mutations to develop 265
variation for tomato (Solanum lycopersicum) fruit size (Just et al., 2013; Park et al., 2014), 266
starch content in potato (Solanum tuberosum) (Muth et al., 2008), and virus resistance in 267
www.plantphysiol.orgon August 23, 2020 - Published by Downloaded from Copyright © 2020 American Society of Plant Biologists. All rights reserved.
12
peppers (Capsicum annuum) (Ibiza et al., 2010). Several grapefruit (Citrus x paradisi Macfad.) 268
varieties, including popular red flesh varieties, were developed using induced mutation (Mba, 269
2013). Although induced mutant plant varieties have enjoyed considerable global commercial 270
success and public acceptance, the molecular and physiological basis for the improved 271
characteristics in these varieties is generally unknown (Shu et al., 2012). 272
The genomic changes induced by mutagenesis or tissue culture derived plants have been 273
evaluated in numerous studies using NGS techniques (Tables 3 and 4). In addition to WGRS 274
methods (Table 3), TILLING studies have been used to estimate induced mutation density by 275
collecting sequencing data on a limited number of genes from a large population of individual 276
mutagenized plants (Table 4). Exome capture and whole exome resequencing studies also rely 277
on targeted sequencing of a portion of the genome, namely the protein coding regions (exons), 278
of mutagenized plant populations. 279
For example, mutations induced via fast neutron irradiation generate a wide variety of mutations 280
that differ in size and copy number, including single nucleotide variants, deletions, insertions, 281
inversions, translocations, and duplications (Bolon et al., 2014; Li et al., 2017; Jo and Kim, 282
2019). Li et al. (2017) generated and deep-sequenced a fast neutron mutant population (1,504 283
lines) in the model rice cultivar, Kitaake. The estimated mutation frequency analyzed was 61 284
mutations/plant (1.6 x 10-7 per bp, as shown in Table 3) with varied types of mutations observed 285
in 58% of all known rice genes. Induced mutations can differ from spontaneous mutations in 286
subtle ways. Transversions (a purine base substitutes for a pyrimidine base, or vice versa) were 287
found to be more frequent in fast neutron populations (Belfield et al., 2012). Transitions (purine 288
to purine or pyrimidine to pyrimidine substitutions) are concentrated at pyrimidine dinucleotide 289
sites, suggesting covalent linkages as a molecular mechanism for these mutations (Belfield et 290
al., 2012). Other mutagens may generate a narrower range of mutation types (Tables 3 and 4; 291
Figure 2). For example, EMS primarily creates transitions at guanine sites (Henry et al., 2014). 292
www.plantphysiol.orgon August 23, 2020 - Published by Downloaded from Copyright © 2020 American Society of Plant Biologists. All rights reserved.
13
These changes have a slightly elevated probability of being flanked at the 5' neighboring 293
nucleotide by adenine or guanine and the 3' side by cytosine (Henry et al., 2014). There is also 294
evidence that some plant genomes can tolerate elevated mutation rates better than others. The 295
hexaploid wheat and oat polyploid genomes, possessing multiple redundant alleles, can tolerate 296
a larger number of accumulated mutations without any notable impact on survival or agronomic 297
performance (Stadler, 1929; Krasileva et al., 2017; Hussain et al., 2018). 298
Genome variation induced by conventional tissue culture practices 299
Many modern breeding programs use tissue culture or in vitro culture systems to propagate 300
plants, preserve elite genotypes, or for production of pure lines using double haploidy. Similar to 301
chemical and irradiation-induced mutations, in vitro culture methods can also generate de novo 302
genetic variability (referred to as somaclonal variation) (Neelakandan and Wang, 2012). Several 303
studies have examined the rate of de novo sequence variation of endogenous genes in plants 304
regenerated through tissue culture. Jiang et al. (2011) regenerated 28 Arabidopsis plants from 305
root explants (living cells transferred to culture medium) from a single Columbia (Col-0) 306
laboratory strain (Jiang et al., 2011). Five regenerated plants were sequenced and analyzed, 307
and on average, each plant had ~30 de novo sequence changes (totaling 21 indels of 2 bp or 308
fewer, and 131 single nucleotide variants substitutions across the five plants) (Jiang et al., 309
2011). The calculated somaclonal mutation frequencies of spontaneous mutations in this 310
experiment was between 4 x 10-7 and 24 x 10-7 mutations per nucleotide. Tang et al. (2018) 311
reported a mutation rate of 1.86 x 10-7 in rice plants regenerated through tissue culture. These 312
values are nearly two orders of magnitude higher than the rate Ossowski et al. (2010) estimated 313
from greenhouse-grown plants derived from single seed descent (Shaw et al., 2000). 314
Somaclonal variation provides another source of genomic variability in plants (Krishna et al., 315
2016). Nearly two hundred commercial varieties from approximately 55 plant species (e.g., 316
horticultural crops, cereals, legumes, medicinal, and aromatic plants) were derived through 317
www.plantphysiol.orgon August 23, 2020 - Published by Downloaded from Copyright © 2020 American Society of Plant Biologists. All rights reserved.
14
somaclonal variation (reviewed by (Neelakandan and Wang, 2012; Krishna et al., 2016)). During 318
the in vitro culture process, many regenerated plants develop differences in appearance relative 319
to the parental genotype. Changes induced can include heritable genetic and epigenetic 320
alterations (Bednarek et al., 2007; Machczyńska et al., 2015; Krishna et al., 2016). As an 321
example, in the popular cultivar of banana (Musa acuminata) ‘Cavendish,’ the occurrence of off-322
types (different from the parental clone) from in vitro cultured plantlets ranges from 6 to 38% 323
(Sahijram et al., 2003). The genomic variation induced during in vitro regeneration is influenced 324
by media composition, length of incubation and subculture, explant origin, and genotype. 325
Genome-wide DNA polymorphisms or structural variations resulting from tissue culture have 326
been observed in soybean (Anderson et al., 2016), barley (Hordeum vulgare) (Bednarek et al., 327
2007), rice (Miyao et al., 2012; Zhang et al., 2014), potato (Fossi et al., 2019), papaya (Carica 328
papaya) (Kaity et al., 2009), banana (Ray et al., 2006), and several other plant species. 329
Bednarek et al. (2007) assessed somaclonal variation in barley and identified 6% gene 330
expression variation (1.7% of this variation was due to nucleotide changes and the balance was 331
due to altered methylation). Recently, Li et al. (2019) performed whole-genome sequencing of 332
cotton plants derived from in vitro culture and CRISPR-Cas9 edited plants. They determined 333
that most of the mutations were induced either by somaclonal variation or were attributable to 334
heterogeneity present in parental plants (Li et al., 2019). Tissue culture and somaclonal 335
variation have been successfully used to generate valuable heritable genomic changes in crops, 336
and have been widely accepted by breeders for germplasm development and release of new 337
varieties. 338
In mutation breeding (i.e., irradiation, chemical, or somaclonal), efforts are focused on 339
identifying beneficial and novel phenotypes. However, in addition to the beneficial mutation(s), 340
other “coincident” mutations or rearrangements can be generated elsewhere in the genome 341
(Figure 3). While most of these mutations will have negligible or no phenotypic effect, it can be 342
www.plantphysiol.orgon August 23, 2020 - Published by Downloaded from Copyright © 2020 American Society of Plant Biologists. All rights reserved.
15
necessary to remove undesirable mutations with observable deleterious effects (off-types) 343
through backcrossing and selection. Each generation of backcrossing is expected to reduce the 344
presence of coincident mutations by 50%. However, given their number and genomic 345
distribution, some mutations may persist through this process. This process of backcrossing and 346
selection is one reason why mutation breeding has been successfully used for decades with a 347
recognized history of safe use (Food and Drug Administration, 1992). 348
Genome Editing as a Source of Variation 349
The advantage of classical mutation breeding is that it allows for the rapid generation of 350
genomic variation that can be used as a source of traits not currently identified in a crop’s 351
germplasm. The drawback of these methods is that variation is induced randomly both at 352
desired locations and across the genome. Because of these factors, screening, isolating, and 353
introgressing desired mutations into elite germplasm requires large populations and lengthy 354
breeding development timelines. Thus, classical mutation breeding as a tool to generate 355
variation is of great value but is relatively inefficient. 356
Genome editing is a targeted and more exact form of mutation breeding. These tools, based on 357
the use of SDNs, provide researchers the ability to modify sequences at specific locations within 358
the genome. SDNs generate targeted DSBs that, regardless of the SDN used, are repaired by 359
the same native DNA break repair mechanisms, the NHEJ or HR pathways described 360
previously. As described below and depicted in Figure 1, these methods generally result in 361
many fewer mutations elsewhere in the genome relative to earlier mutagenic techniques. SDNs 362
continue to be improved to further reduce the likelihood of non-targeted mutations (Zhao and 363
Wolt, 2017; Hahn and Nekrasov, 2018). 364
The genome editing toolbox and its utility 365
www.plantphysiol.orgon August 23, 2020 - Published by Downloaded from Copyright © 2020 American Society of Plant Biologists. All rights reserved.
16
Though still a relatively new technology, genome editing using SDNs has demonstrated great 366
promise as a tool for crop improvement. Recent reviews catalog the increasing number of 367
phenotypes and characteristics in crop plants that have been generated using SDNs 368
(Jaganathan et al., 2018; Zhang et al., 2018; Chen et al., 2019). Some of these traits were 369
derived from loss-of-function mutations within coding regions or gene regulatory regions that 370
resulted from NHEJ-mediated repair leading to mutations (insertions/deletions) at the break site. 371
Other traits were derived from specific nucleotide insertion or substitution, and gene/allele 372
replacement edits, which can be generated by repairing SDN-generated DSBs with a DNA 373
donor template (Townsend et al., 2009; Li et al., 2015; Petolino et al., 2016; Filler Hayut et al., 374
2017; Shi et al., 2017; Yu et al., 2017). Several types of SDNs that have been used in plants 375
rely on either protein/DNA or RNA/DNA binding to provide editing specificity. As shown in Figure 376
4 (Panel A-B), ZFN and TALEN are chimeric proteins consisting of DNA recognition/binding 377
domains fused to the catalytic domain of the FokI nuclease (Christian et al., 2010; Carroll, 2011; 378
Weeks et al., 2016). TALENs are derived from transcription activator-like (TAL) effectors found 379
in the plant pathogen Xanthomonas. TAL effectors bind to specific DNA sequences by using 380
tandem amino acid repeats. Variations in these repeats, knowns as the repeat variable di-381
residues (RVDs), allow for specificity to nucleotide sequences. For both ZFNs and TALENs, 382
specificity for a chosen target sequence is improved by expanding the length of DNA targets 383
(e.g., 18 to 32 bp for the paired nuclease) and the spacer (i.e., the distance between paired 384
nucleases). The designed proteins interact as heteromeric pairs, with DSBs occurring only when 385
both protein halves are bound at the same genomic location, further increasing the specificity of 386
these reagents for creating DSBs only at the desired site. 387
RNA-Guided Endonucleases (RGENs) function as a protein complex that is directed to a 388
genomic target site through a short non-coding guide RNA (gRNA). The nuclease protein and 389
the gRNA are transcribed separately and then form a complex in the cell nucleus. A portion of 390
www.plantphysiol.orgon August 23, 2020 - Published by Downloaded from Copyright © 2020 American Society of Plant Biologists. All rights reserved.
17
the gRNA contains a sequence that is directly complementary to a genomic target site that 391
guides the induction of DSB formation at that location. In the case of the CRISPR system, Cas9 392
or another Cas or Cpf nuclease recognizes the gRNA-DNA pair, thus targeting this site for a 393
DSB (Figure 4, Panel C) (Jinek et al., 2012; Cong et al., 2013; Weeks et al., 2016). The gRNA 394
of the most widely used Cas9, Streptococcus pyogenes Cas9 (SpCas9), binds to a 20 bp 395
genomic site, termed the protospacer, that is adjacent to a triplet DNA sequence known as the 396
protospacer adjacent motif (PAM). Unlike complex protein engineering needed for DNA binding 397
using ZFNs and TALENs, Cas9 can be programmed to new target sites by changing the spacer 398
sequence of the guide RNA, which simplifies vector design and construction while substantially 399
reducing the cost. Due to this ease of design and greater efficiency, CRISPR has become the 400
SDN of choice for genome editing (Globus and Qimron, 2018). 401
Recently developed CRISPR editing systems do not rely on DSB formation to induce targeted 402
changes, but instead involve chimeric protein units consisting of a disabled nuclease and an 403
additional protein domain. In these systems, the disabled nuclease is used to target the 404
additional protein units to specific genomic locations for different applications. Applications 405
include targeted base editing with deaminase domains (Komor et al., 2016; Gaudelli et al., 406
2017; Adli, 2018), transcriptional knock down using repressors (Qi et al., 2013; Thakore et al., 407
2015), targeted DNA methylation and histone modification (Kearns et al., 2015; Stepper et al., 408
2016), gene activation using strong transcriptional activators (Cheng et al., 2013), activation of 409
developmentally silent endogenous loci through chromatin looping (Deng et al., 2014; Morgan et 410
al., 2017), DNA transposition (Strecker et al., 2019), site-specific recombination (Standage-411
Beier et al., 2019), and prime editing (Anzalone et al., 2019). The targeting components of the 412
nucleases are still intact, allowing for nucleotide changes in a site-directed manner. For 413
example, cytosine and adenine base editors (converts C to T and A to G, respectively) fuse a 414
nickase-type Cas9 with a deaminase domain and thus do not induce DSBs. Both are useful 415
www.plantphysiol.orgon August 23, 2020 - Published by Downloaded from Copyright © 2020 American Society of Plant Biologists. All rights reserved.
18
genome editing tools, however the cytosine base editor has been reported to induce off-target 416
editing both in animal cells (Zuo et al., 2019) and in plants ((Jin et al., 2019); discussed in more 417
detail below). 418
Designing genome editing protocols and methods to optimize editing specificity and 419
reduce the potential for off-target edits 420
Optimizing the specificity of genome editing methods can be achieved in multiple ways, often 421
through altering SDNs delivery into plants. At present, the most common practice involves 422
stably integrating a transgene into the plant genome that expresses the SDN “reagents” (protein 423
or protein/guide RNA complex that is encoded by the transgene) and template DNA molecule 424
for HR edits. The transgene(s) encoding the SDN components are typically integrated at a locus 425
that is unlinked to the gene(s) being edited. A subsequent outcross or selfing generation results 426
in the independent assortment of unlinked genes to segregate the SDN-encoding transgene 427
away from the edited target sequence. Resulting progeny plants can be screened to select non-428
transgenic plants carrying the targeted edit and lacking the SDN-encoding insert (Gao et al., 429
2016; Char et al., 2017). The resulting plant variety is often molecularly indistinguishable from 430
varieties with mutations that either occur naturally or are produced by induced mutagenic 431
techniques. It should be noted that chromosomal re-arrangements due to T-DNA insertions 432
have been observed (Clark and Krysan, 2010; Hu et al., 2017), but these can generally be 433
detected by next-generation sequencing-based methods and removed by segregation and 434
selection. Transient delivery methods, which seek to limit the overall exposure of the genome to 435
the SDN and avoid the stable integration of a transgene, have also been developed in plants 436
(Woo et al., 2015; Kelliher et al., 2019). The most common transient delivery method uses a 437
ribonucleoprotein (RNP) complex that consists of a purified RGEN protein bound to a guide 438
RNA (Kim et al., 2017; Andersson et al., 2018). The complex is delivered directly to plant cells, 439
www.plantphysiol.orgon August 23, 2020 - Published by Downloaded from Copyright © 2020 American Society of Plant Biologists. All rights reserved.
19
through bombardment or other means (Ran et al., 2017), so that the active protein can cause a 440
DSB, but the SDN-encoding DNA is not integrated into the genome (Chen et al., 2018). 441
Off-target edits, and the means to reduce such edits, have received a great deal of attention in 442
the human therapeutic and medical fields (Cho et al., 2014; Shen et al., 2014; Lee et al., 2016; 443
Akcakaya et al., 2018; Lee et al., 2018; Moon et al., 2019) and are also of interest in the plant 444
science community (Feng et al., 2014; Wolt et al., 2016; Tang et al., 2018; Jin et al., 2019; Li et 445
al., 2019; Young et al., 2019). As described in the Introduction, changes observed following 446
genome editing protocols can be split into those that occur at sites without similarity to the 447
targeted region, referred to as untargeted mutations, and “off-target edits” that occur at sites 448
with sequences similar to the targeted region. Numerous studies discussed below have found 449
that the potential for and level of off-target activity in plants can be predicted by comparing the 450
sequence of the target site to the rest of the genome. SDNs bind to specific nucleotide 451
sequences, with the most likely location of potential off-target editing to occur at sites with 452
nucleotide-sequence level similarity to the intended target (Jiang and Doudna, 2017). 453
Bioinformatics prediction tools have been designed to predict sites that may result in an off-454
target edit. Programs have been developed for all of the major SDNs [PROGNOS (Fine et al., 455
2014); TALE-NT (Doyle et al., 2012); CAS-OFF Finder (Bae et al., 2014)], and are routinely 456
included in the design of SDN-based editing protocols (Liu et al., 2017; Listgarten et al., 2018; 457
Minkenberg et al., 2019). Prediction algorithms are useful for identifying potential off-target sites 458
in well-sequenced genomes. Plant species with limited reference genome sequence data may 459
be poorly assessed by these tools. For plant species without a comprehensive genome 460
sequence, it may be difficult to predict potential off-target SDN activity. However, the amount of 461
variation introduced would likely be less than traditional mutagenesis techniques classically 462
utilized in plant breeding strategies (Figure 1). As described in more detail below, it can also be 463
www.plantphysiol.orgon August 23, 2020 - Published by Downloaded from Copyright © 2020 American Society of Plant Biologists. All rights reserved.
20
difficult to assess and discriminate between bona fide off-target SDN activity versus variation 464
attributable to transformation or standing variation. 465
Off-target Edit Evaluation and Frequency 466
The approaches reported for the identification of off-target edits vary widely and can impact the 467
level of off-target activity observed. As noted above, many studies rely on algorithms to predict 468
the optimal on-target activity and potential off-target edit sites based on similarity with the gRNA 469
sequence. The most common method used to assess whether the off-target activity has 470
occurred at these site(s) is PCR amplification, followed by amplicon sequencing. PCR 471
approaches provide a rapid method for determining if SDN-mediated off-target edits have 472
occurred at a predicted or suspected site. However, it is reliant on accurate predictions of 473
potential off-target sites, which in turn relies on a well-sequenced source or reference genome 474
for thorough analysis. Several alternative, “non-biased” methods to assess and detect DSB and 475
edits have been developed for off-target edit analysis (reviewed in (Zischewski et al., 2017)), 476
although few have been evaluated in plants. 477
Recently, high-throughput whole genome resequencing (WGRS) has been used to evaluate off-478
target edits and untargeted mutations in plants. While WGRS is the most comprehensive 479
strategy currently available, it requires that researchers carefully control for differences between 480
the reference genome and the experimental line, heterogeneity in experimental lines, and 481
sequencing errors (Michno and Stupar, 2018). WGRS cannot always distinguish between 482
standing variants and de novo untargeted mutations generated by tissue culture or SDN 483
treatments or attributable to sequencing miscalls. Several recent studies have used WGRS to 484
examine genome-wide mutational profiles in genome-edited rice (Tang et al., 2018), maize (Lee 485
et al., 2019), and cotton (Li et al., 2019). A large-scale study examined the amount of variation 486
that occurs due to various genome editing techniques (i.e., RGENs, CRISPR-Cas9 and Cpf1) 487
(Tang et al., 2018). The study reported WGRS of 69 individual plants that had been regenerated 488
www.plantphysiol.orgon August 23, 2020 - Published by Downloaded from Copyright © 2020 American Society of Plant Biologists. All rights reserved.
21
via tissue culture (with and without Agrobacterium treatment), edited with various SDNs 489
reagents, or received no treatment (field grown). WGRS analysis revealed the presence of 490
variation (e.g., SNPs, indels) throughout the genome in all plants, though more so in plants that 491
had gone through the tissue culture process. Relative to plants that went through tissue culture, 492
there was no increase in the variation observed from the plants that had been exposed to SDN 493
treatment. The exception was in plants edited with a gRNA purposefully designed to be more 494
likely to elicit off-target edits (Tang et al., 2018). The detected off-target edits in these plants 495
were predicted by the program Cas-OFFinder (Bae et al., 2014), confirming that intentionally 496
inadequate guide design led to the observed off-target activity. A recent study in maize 497
determined that regardless of the SDN delivery method (Agrobacterium, particle bombardment, 498
or RNP), proper design of gRNAs leads to undetectable levels of off-target edits (Young et al., 499
2019). Studies examining rice (Tang et al., 2018), cotton (Li et al., 2019), and maize (Lee et al., 500
2019; Young et al., 2019) report that nearly all of the observed variation from RGEN 501
experiments is attributable to tissue culture or natural variation, and not the delivered nucleases. 502
Tang et al. (2018) found that plants regenerated via tissue culture contained ~100-150 SNVs 503
and ~40-80 indels. The number of de novo variants attributable to tissue-culture and SDN 504
delivery is small relative to standing variation that differentiates individual lines (Table 2). 505
A recent study has applied the WGRS approach to evaluate the off-target edit frequency of base 506
editors in rice (Jin et al., 2019). For potential off-target edits, the authors found that SNVs were 507
not significantly different between control plants (exposed to tissue culture with no editing 508
machinery) and adenine base edited plants. The rate of off-target edits was significantly higher 509
only in plants generated with cytosine (C to T) base editors, irrespective of whether a gRNA was 510
supplied. The percentage of changes that were C to T transitions was higher in plants 511
containing cytosine base editing constructs, suggesting these reagents were inducing 512
background variation. A larger number of off-target mutations suggests that the source of off-513
www.plantphysiol.orgon August 23, 2020 - Published by Downloaded from Copyright © 2020 American Society of Plant Biologists. All rights reserved.
22
target variation was not the SDN, but the enzymatic domain of the cytosine base editing 514
complex. Previous studies had found that the cytosine deaminase domain, and the additional 515
uracil glycosylase inhibitor domain used in cytosine base editors, generate higher background 516
levels of C to T changes (Radany et al., 2000; Harris et al., 2002). The studies suggest that 517
increased optimization of the cytosine base editor would be necessary to minimize off-target 518
activity. However, it is worth noting that when compared to the frequencies of mutagenesis 519
reported in rice for somaclonal variation (Miyao et al., 2011, Tang et al, 2018) or other forms of 520
induced mutagenesis (see Tables 3 and 4), mutation rates with the cytosine base editor are 521
comparable to methods used in conventional and mutation breeding. This study suggests that, 522
as new protein motifs and editing strategies are developed, the intended activity and potential 523
for off-target activity should be evaluated. 524
WGRS studies (Tang et al., 2018; Jin et al., 2019; Li et al., 2019) show that the amount of 525
induced background variation as a result of introducing editing enzymes into plants is generally 526
low, especially for editing applications with SDNs. The identification of high background 527
mutation rates for C-to-T base editor enzymes (Jin et al., 2019) suggests the need for careful 528
screening of the effects of new approaches. Taken together, these results suggest that WGRS 529
is best applied to new approaches and may not be necessary for routine application of SDNs, 530
as unintended activity will generally be predictable by computational algorithms that allow for the 531
optimal design of gRNAs (Tang et al., 2018; Lee et al., 2019; Young et al., 2019). Indeed, 532
conventional mutagenesis methods have been found to be safe using existing agronomic 533
evaluations, generally in the absence of WGRS evaluation. 534
Conclusions 535
Whole-genome examinations of variability in plants and improvements in understanding of gene 536
function are occurring concurrently with advances in genome editing technology. Targeted 537
genome editing utilizing SDN techniques are the most recent option for the introduction of 538
www.plantphysiol.orgon August 23, 2020 - Published by Downloaded from Copyright © 2020 American Society of Plant Biologists. All rights reserved.
23
precise genetic variation for crop improvement (Figure 5). SDNs are designed to introduce 539
mutations with a high degree of sequence specificity, resulting in fewer unintended genomic 540
changes than earlier mutagenesis techniques. As the understanding of nuclease activity has 541
increased, SDN protocols and associated prediction algorithms to more specifically target 542
intended sequences have improved and been aided by the increasing number of well-annotated 543
and sequenced genomes. NGS has facilitated a more thorough understanding of plant genomes 544
and the genetic changes that accompany the development of new plant varieties. These 545
methods allow more accurate estimations of de novo genomic variation. Each plant generation 546
has new genetic variants that are the result of a range of naturally-occurring processes. The 547
potential for, and possible effects of, SDN-mediated off-target changes must be put in the 548
context of naturally occurring standing variation in crops and mutations induced or introduced 549
during plant breeding practices (Table 5). 550
[INSERT TABLE 5 HERE] 551
The history of safe consumption of foods from plants has been built on the fact that many 552
mutations, regardless of origin, have no phenotypic effect such that breeders cannot remove 553
these “neutral” genetic changes from plant populations. By comparison, plants displaying off-554
type phenotypes due to unintended mutations are eliminated or ameliorated through well-555
established, multigenerational breeding, selection, and commercial variety development 556
practices (Figure 5). Varieties developed through genome editing will be subjected to the same 557
screening and selection practices as is used for improved varieties developed using other 558
sources of genetic variation (Figure 5). While off-target edits are deemed to be unacceptable for 559
therapeutic applications of genome editing, off-target edits in the context of crops are smaller in 560
magnitude than that of current crop improvement methods, such as conventional or mutation 561
breeding (see Outstanding Questions). The current generation of genome editing technologies 562
has facilitated the efficient generation of desirable genomic variation and new plant varieties that 563
www.plantphysiol.orgon August 23, 2020 - Published by Downloaded from Copyright © 2020 American Society of Plant Biologists. All rights reserved.
24
would have been more challenging to achieve through other breeding or molecular approaches. 564
Genome editing technology continues to be refined, with improved editing specificity, 565
developments in the delivery of editing enzymes, and ever-increasing genomic characterization. 566
Acknowledgments 567
The authors wish to acknowledge Wayne A. Parrott for comments on an earlier version of the 568
manuscript and Emily E. Vonderharr for copy editing of the text. We also thank Allison Devitre 569
and Emily Turnbough for their help with figure art. Funding provided by USDA / National 570
Institute of Food and Agriculture to Robert M. Stupar and Peter L. Morrell (2015-33522-24096 571
and 2019-33522-30200). 572
573
Box 1: The importance of double-strand break repairs 574
Box 1 cited articles: Pacher and Puchta, 2017; Puchta, 2005; Schuermann et al., 2005; 575
Waterworth et al., 2010; Waterworth et al., 2011; Waterworth et al., 2016; Friedberg et al., 2006; 576
Voytas, 2013; Pacher et al., 2017; Brunet and Jasin, 2018; Čermák et al., 2017; Knoll et al., 577
2014; Gaut et al., 2007; Hajjar and Hodgkin, 2007 578
579
580
581
582
583
584
585
www.plantphysiol.orgon August 23, 2020 - Published by Downloaded from Copyright © 2020 American Society of Plant Biologists. All rights reserved.
25
586
TABLES 587
Table 1. Common types of genomic variation in the breeding populations of field crops 588
and vegetables. 589
www.plantphysiol.orgon August 23, 2020 - Published by Downloaded from Copyright © 2020 American Society of Plant Biologists. All rights reserved.
26
Variant type Variation Description/comment
Nucleotide
polymorphisms
SNP
Single Nucleotide
Polymorphism
A variant at a single position where one base
replaces another base. SNPs arise from errors
during DNA replication or repair. Also referred to
as single nucleotide variant (SNV) or single base
substitution (SBS).
MNP
Multi-nucleotide
polymorphisms
Changes at 2 or more adjacent nucleotides MNPs
are relatively rare.
Structural
variants
Indel
Insertion/deletions
Sites where DNA is lost (deletion) or gained
(insertion) typically describing relatively small (1-
20 bp but up to 1000 bp) changes. Usually
classified as sequence differences smaller than
PAV.
SSR
Simple sequence repeats
SSRs are repeats of 2 to 6 nucleotides that vary
in the number of repeat motifs present. Also
referred to as short tandem repeats (STRs) or
microsatellites.
Can be considered a type of CNV
CNV
Copy number variation
Sequences with variable copy number between
individuals. The term CNV generally applies genic
regions. Can be due to duplications, deletions or
insertions. Simple sequence repeats (SSR) can
be considered as very small CNVs. Typically,
www.plantphysiol.orgon August 23, 2020 - Published by Downloaded from Copyright © 2020 American Society of Plant Biologists. All rights reserved.
27
CNVs refer to larger sequence repeats (>1kb for
example) and may encompass one or more
genes or parts of genes.
PAV
Presence/Absence
Variation
Large sequence block (>1 kb) present in one
line/individual but completely missing in another
line. Like CNV, PAV typically refers to a region
containing genes and can be thought of as the
extreme example of CNV.
TE
Transposable elements
Mobile genetic elements. The number and
location of each element frequently differ from the
reference genome.
Large Structural Variation
(SV) and ploidy (whole
and partial genome
duplication)
Includes DNA rearrangements such as
chromosomal inversions, translocations, partial
genome duplications, duplications, etc.
590
591
592
www.plantphysiol.orgon August 23, 2020 - Published by Downloaded from Copyright © 2020 American Society of Plant Biologists. All rights reserved.
28
Table 2: Estimated genomic diversity in the breeding populations of select field and 593
vegetable crops. Not all forms of genomic variation were assessed for all species listed. This is 594
denoted by ND (Not Determined). In addition, because of the short-read sequencing technologies used, 595
the number of PAV/CNV structural variants, representing large deletions, inversions and duplications, is 596
likely underestimated. 597
598
www.plantphysiol.orgon August 23, 2020 - Published by Downloaded from Copyright © 2020 American Society of Plant Biologists. All rights reserved.
29
Plant
Species
Evaluated
sample size
and description
Estimate
d
Genome
Sizea
(Mbp)
Estimate
d SNPs
present
(million)
Average
Pairwise
Diversityb
Estimate
d Indels
(million)
Structur
al
Variants
(CNV &
PAV)
References
Bean
(Phaseolus
vulgaris)
37 521 45.0 ~5.0 x 10-
3
Mesoame
rican
~1.7 x 10-
3 Andean
2.1 18.5 k (Schmutz et
al., 2014;
Lobaton et al.,
2018)
Wild
Cabbage
(Brassica
oleracea)
10 (1 wild
species)
489 4.8 ND ND 11.5 k
(Golicz et al.,
2016)
Chickpea
(Cicer
arietinum)
35 738 2.0 ND 0.3
9.9 k (Thudi et al.,
2016)
Cucumber
(Cucumis
sativus)
115 194 3.3 ND 0.03 0.8 k (Zhang et al.,
2015)
(Qi et al.,
2013)
www.plantphysiol.orgon August 23, 2020 - Published by Downloaded from Copyright © 2020 American Society of Plant Biologists. All rights reserved.
30
Maize
(Zea mays)
2815 accessions
13 lines
2,400 0.7
2.91
~6.0 x 10-
3
ND
0.4
1.1 M (Gore et al.,
2009; Romay
et al., 2013;
Wang et al.,
2017)
Rice (Oryza
sativa ssp.
Japonica)
3010 375 29.0 ~1.0 x 10-
3
2.4 94 k (Liu et al.,
2017; Wang et
al., 2018)
Soybean
(Glycine
max)
106 (Landraces,
US cultivars and
wild)
978 10.4 1.8 x 10-3
0.7 7.9 k (Valliyodan et
al., 2016)
Tomato
(Solanum
lycopersicu
m)
69 (incl 12 wild
species)
950 17.0
~2 x 10-4
3.6 1.7 k (Causse et al.,
2013; Sauvage
et al., 2017)
Pepper
(Capsicum
annuum)
20 (3 wild
species)
3,500 9.8 ~2.6 x 10-
3
0.24 ND (Aguilar-
Meléndez et
al., 2009; Qin
et al., 2014)
599
a Estimated genome sizes from references or https://plants.ensemble.org April 2019. 600
b Pairwise diversity (also referred to as nucleotide diversity) is the average number of nucleotide 601
differences per site between any two DNA sequences in all possible pairs in the sample population 602
www.plantphysiol.orgon August 23, 2020 - Published by Downloaded from Copyright © 2020 American Society of Plant Biologists. All rights reserved.
31
(Tajima, 1983). It is a measure that allows for diversity/variation to be compared across organisms that 603
vary widely in genome size. 604
605
www.plantphysiol.orgon August 23, 2020 - Published by Downloaded from Copyright © 2020 American Society of Plant Biologists. All rights reserved.
32
Table 3: Examples of induced mutation types and frequency in food crops and plant model species evaluated via whole 606
genome resequencing (WGRS) analyses 607
Plant
[Assembled
Genome Size] a
Mutagen
No. Plants
analyzed
Mean mutations
per plant b (per
diploid genome)
Total mutation
frequency c
(mutations per
nucleotide site per
experiment)
Reference
Rice
(Oryza sativa)
[375 Mb]
FN
1,504
29 SNPs
26 Indels
3 translocations
3 inversion
/duplications
61 total
[1.6 x 10-7
]
(Li et al., 2017)
GR 6
2,419 SNPs
452 Indels
69 SV
383 CNV
3,323 total
[8.86 x 10-6
] (Li et al., 2016)
Tissue culture 2
114 SNPs
36 Indels
150 total
1.86 x 10-7
(Tang et al., 2018)
www.plantphysiol.orgon August 23, 2020 - Published by Downloaded from Copyright © 2020 American Society of Plant Biologists. All rights reserved.
33
Sorghum
(Sorghum
bicolor)
[708 Mb]
EMS 256 7,660 SNPs [1.1 x 10-5
] (Jiao et al., 2016)
Soybean
(Glycine max)
[978 Mb]
EMS 12 12,796 SNPs
12,854 SNPs (Md) [1.3 x 10
-5] (Tsuda et al., 2015)
Tomato
(Solanum
lycopersicum)
[950 Mb]d
EMS 4
1348 SNPs
17 Indels
1365 total
[1.4 x 10-6
]
(Shirasawa et al., 2016)
GR 3 137 SNPs
40 Indels
177 total
[1.9 x 10-7
]
Lotus japonica
[472 Mb] d
EMS 2 2,201 SNPs [4.7 x 10-6
] (Mohd-Yusoff et al.,
2015)
Arabidopsis
thaliana
[135 Mb]
GR 6
11 SNPs (8.5 Md)
7 Indels (6.5 Md)
18 total
3.6×10 -7
(Belfield et al., 2012)
Tissue culture 5
26 SNP (18 Md)
4 Indels (5 Md)
30 total
4.2×10−7
-24.2×10−7
(Jiang et al., 2011)
608
www.plantphysiol.orgon August 23, 2020 - Published by Downloaded from Copyright © 2020 American Society of Plant Biologists. All rights reserved.
34
Abbreviations: EMS: Ethyl Methanesulphonate; FN: Fast Neutron; NaN3-MNU: sodium azide-methyl-nitro urea; GR: Gamma Ray; Indel: 609
Insertion/deletion; SNP: single nucleotide polymorphism; SV: structural variant; CNV: copy number variation; WGRS: whole genome 610
resequencing; kb: kilobase; Mb: Megabase. 611
a Assembled genome size based on EnsemblPlants database (http://plants.ensembl.org) unless otherwise noted. 612
b Mean number of mutations per analyzed plant are either values as published or calculated based on total mutations observed across all 613
plants divided by the number of plants analyzed. All plants listed are diploids and studies confirmed full (>90%) genomic coverage unless 614
otherwise noted in footnote c. For some studies, median values (Md) for number of mutations per plant could also be calculated. 615
c Total mutation frequency represents total mutations per nucleotide site per experiment as published or numbers in brackets were calculated by 616
dividing total mutations per plant by the assembled genome size. As noted, total mutation frequency was not limited to a single type of mutation. 617
d Average genome sequence coverage was <90% for tomato (86% coverage; 815 Mb) and Lotus japonica (67% coverage; 315 Mb); partial 618
genomic coverage values were used in normalizing number of mutations per diploid genome and in calculating total mutation frequency. 619
620
621
622
623
624
625
www.plantphysiol.orgon August 23, 2020 - Published by Downloaded from Copyright © 2020 American Society of Plant Biologists. All rights reserved.
35
Table 4: Examples of induced mutation types and frequency in food crops using TILLING or exome resequencing genomic 626
analyses 627
Plant
[Assembled
Genome Size] a
Mutagen
No. Plants
analyzed
Reported mutation
density
[calculated mutation
frequency] b
Number of
genes/genomic
region analyzed c
[total Mb
analyzed]
Reference
Rice
(Oryza sativa)
[375 Mb]
NaN3-MNU 768 1 SNP/265 kb
[3.8×10-6
]
10 genes
[7.9 Mb total] (Till et al., 2007)
Maize
(Zea mays)
[2,400 Mb]
EMS 1,086 1 SNP/774 kb
[1.3 x 10-6
]
Whole exome
resequence
[139 Mb/plant]
(Lu et al., 2018)
Wheat
(Triticum
aestivum)
[14,540 Mb]
EMS 1,535 tetraploid
1,200 hexaploid
23 SNPs/Mb (4n)
[2.3 x 10-5
]
33 SNPs/Mb (6n)
[3.3 x 10-5
]
Whole exome
resequence
[119 Mb/plant (4n)
162 Mb/plant (6n)]
(Krasileva et al.,
2017)
Barley
(Hordeum NaN3 3,148
1 SNP/374 kb
[2.7 x 10-6
]
4 genes
[8.2 Mb total]
(Talamè et al.,
2008)
www.plantphysiol.orgon August 23, 2020 - Published by Downloaded from Copyright © 2020 American Society of Plant Biologists. All rights reserved.
36
vulgare)
[8,050 Mb]
Cotton
(Gossypium
hirsutum)
[2,100 Mb]
EMS 8,000 M2 lines
(2 varieties)
1 SNP/153 kb
[6.5 x 10-6
]
1 SNP/326 kb
[3.1 x 10-6
]
8 genes
[58.1 Mb/variety]
(Aslam et al.,
2016)
Tomato
(Solanum
lycopersicum)
[950 Mb]
EMS 1,352 M3 lines 1 SNP/322 kb
[3.1 x 10-6
]
7 genes
[10.9 Mb total]
(Minoia et al.,
2010)
628
629
Abbreviations: EMS: Ethyl Methanesulphonate; NaN3-MNU: sodium azide-methyl-nitro urea; TILLING: Targeting Induced Local Lesions In 630
Genomes; SNP: single nucleotide polymorphism; kb: kilobase; Mb: Megabase. 631
a Assembled genome size based on EnsemblPlants database (http://plants.ensembl.org). 632
b Mutation density (mutations/kb or Mb) is as reported and was determined by dividing the total genomic region evaluated (kb) by the number of 633
nucleotide changes observed. Calculated mutation frequency is the arithmetic calculation of the mutations per nucleotide site per experiment. 634
c Number of gene or genomic regions analyzed in mutagenized plants are as reported. The total DNA length analyzed across all plants and 635
genes (for TILLING) or per plant (for exome sequencing) is also included. 636
www.plantphysiol.orgon August 23, 2020 - Published by Downloaded from Copyright © 2020 American Society of Plant Biologists. All rights reserved.
37
637
Table 5. Examples of genetic variation introduced by different breeding methods, as 638
reported in recent studies in rice. 639
a Wang et al., 2018 640
b Tang et al., 2018 641
c Li et al., 2017 642
643
Variation Type Breeding Method
Re-mixing standing
variants
de novo variants
Cross pollinationa Self pollinationb
Classical
mutagenesis
(Fast
neutron)c
Tissue
cultureb
Genome
editingb
Number of single
nucleotide variants
introduced
2 × 106 23 43 114 0
Number of
insertions/deletions
introduced
> 5 × 103 18 48 36 1
Total number of
mutations
introduced
> 2 × 106 41 91 150 1
www.plantphysiol.orgon August 23, 2020 - Published by Downloaded from Copyright © 2020 American Society of Plant Biologists. All rights reserved.
38
Figure Legends 644
Figure 1: Comparison of the average number of SNPs and indels per genome (individual) 645
introduced into tomato by different breeding strategies. The data represents approximate 646
number of SNPs between the genome sequence of S. lycopersicum (Hz 1706 reference 647
genome) and other cultivars or wild relatives which have been used in breeding of modern 648
tomato cultivars. After selfing (X Self), each individual plant in the next generation will have (on 649
average) approximately 6 random single nucleotide polymorphisms (SNPs) (assuming the de 650
novo rate of spontaneous heritable SNP formation in tomato is similar to that of lab-grown 651
Arabidopsis (Ossowski et al., 2010). Most modern elite tomato lines commercially grown 652
typically have four or more disease resistance genes that have been introgressed by crossing 653
with wild tomato species such as (Solanum pennellii or S. pimpinellifolium) (Foolad, 654
2007). These initial elite x wild species hybridization events introduced millions to tens of 655
millions of SNPs in addition to indels, copy number (CNV) and presence/absence variation 656
(PAV) (Aflitos et al., 2014). Crosses with more closely related domestic tomato lines or 657
landraces (i.e., cultivar [cv.] San Marzano) will introduce (on average) hundreds of thousands of 658
SNPs/indels (Ercolano et al., 2014). Creating random variation by treating seeds with the 659
chemical mutagen ethyl methanesulphonate (EMS) typically introduces thousands of SNPs per 660
individual (Minoia et al., 2010). Treating cells with a well-designed gene editing reagent 661
(including a guide RNA homologous to target sequence and adjacent protospacer adjacent 662
motif [PAM]) can create a single SNP or indel at a precise, pre-determined location. Crossing 663
with wild or closely related species can also introduce additional indels, CNV and PAV into the 664
genome, which is not considered in this figure. 665
Figure 2. Number of officially released mutant varieties (top 20 countries) showing direct 666
release of improved varieties (orange bars) and mutants used as breeding material (blue 667
www.plantphysiol.orgon August 23, 2020 - Published by Downloaded from Copyright © 2020 American Society of Plant Biologists. All rights reserved.
39
bars). Note: European Union countries denoted by asterisks. Data Source: Mutant Variety 668
Database, https://mvd.iaea.org. 669
Figure 3: Overview of sources genomic variation in crop plants. The simplified gene 670
models depict observed variation among individual crop species. The comparison of 671
inherent/standing (genotype X and Y) and induced variation (chemical and irradiation) with the 672
reference genome shows a range of intended and unintended mutations, including single 673
nucleotide polymorphisms (SNPs), small indels, transposon insertions/movement, or a large 674
segmental deletion. However, the intended edit induced via a site-directed nuclease (SDN) 675
occurs at the target site. Note: not drawn to the scale; intergenic variation not shown. 676
Figure 4. Most widely used SDNs. A. TALENs are composed of a DNA binding domain and 677
the nuclease Fok1; the DNA binding domain contains an array of nearly identical protein 678
subdomains each varying at two specific amino acids, known as the repeat variable di-residues 679
(RVDs); specific RVDs recognize unique bases on the target DNA molecule. B. ZFNs are also 680
composed of DNA binding domains and the Fok1 nuclease; each ZFN is composed of three 681
zinc-finger domains that are custom designed to recognize a triplet of DNA bases on the target 682
sequence. For TALENs and ZFNs, two subunits are needed per target region, each binding 683
closely spaced DNA sequences. C. The Cas9 nuclease binds to the target sequence via an 684
RNA molecule, known as the sgRNA; the 5’ region of the sgRNA, the proto-spacer, is typically 685
20 nucleotides long and is complementary to the target DNA; a PAM sequence is also required 686
for recognition (shown here in bold and underlined). 687
Figure 5: An overview of conventional and modern mutation breeding approaches for 688
crop improvement. The figure illustrates the systematic approach for introducing intended and 689
unintended genomic variation in crops for trait discovery, germplasm development and 690
commercial release of new crop varieties. After the introduction of genomic variation, the 691
www.plantphysiol.orgon August 23, 2020 - Published by Downloaded from Copyright © 2020 American Society of Plant Biologists. All rights reserved.
40
mutant populations go through a series of selection and testing to remove undesirable 692
mutations and phenotypic variations. The best performing line is selected for subsequent 693
commercial release. This breeding process is common to all methods used for crop product 694
development (Kaiser et al., 2020). 695
696
697
Literature Cited 698
Adli M (2018) The CRISPR tool kit for genome editing and beyond. Nature Communications 9: 1911 699 Aflitos S, Schijlen E, de Jong H, de Ridder D, Smit S, Finkers R, Wang J, Zhang G, Li N, Mao L, Bakker F, 700
Dirks R, Breit T, Gravendeel B, Huits H, Struss D, Swanson-Wagner R, van Leeuwen H, van Ham 701 RC, Fito L, Guignier L, Sevilla M, Ellul P, Ganko E, Kapur A, Reclus E, de Geus B, van de Geest H, 702 Te Lintel Hekkert B, van Haarst J, Smits L, Koops A, Sanchez-Perez G, van Heusden AW, Visser 703 R, Quan Z, Min J, Liao L, Wang X, Wang G, Yue Z, Yang X, Xu N, Schranz E, Smets E, Vos R, 704 Rauwerda J, Ursem R, Schuit C, Kerns M, van den Berg J, Vriezen W, Janssen A, Datema E, 705 Jahrman T, Moquet F, Bonnet J, Peters S (2014) Exploring genetic variation in the tomato 706 (Solanum section Lycopersicon) clade by whole-genome sequencing. Plant J 80: 136-148 707
Aguilar-Meléndez A, Morrell PL, Roose ML, Kim S-C (2009) Genetic diversity and structure in semiwild 708 and domesticated chiles (Capsicum annuum; Solanaceae) from Mexico. American Journal of 709 Botany 96: 1190-1202 710
Ahloowalia B, Maluszynski M, Nichterlein K (2004) Global impact of mutation-derived varieties. 711 Euphytica 135: 187-204 712
Akcakaya P, Bobbin ML, Guo JA, Malagon-Lopez J, Clement K, Garcia SP, Fellows MD, Porritt MJ, Firth 713 MA, Carreras A, Baccega T, Seeliger F, Bjursell M, Tsai SQ, Nguyen NT, Nitsch R, Mayr LM, 714 Pinello L, Bohlooly-Y M, Aryee MJ, Maresca M, Joung JK (2018) In vivo CRISPR editing with no 715 detectable genome-wide off-target mutations. Nature 561: 416-419 716
Anderson JE, Michno J-M, Kono TJ, Stec AO, Campbell BW, Curtin SJ, Stupar RM (2016) Genomic 717 variation and DNA repair associated with soybean transgenesis: a comparison to cultivars and 718 mutagenized plants. BMC biotechnology 16: 41 719
Anderson SN, Stitzer MC, Brohammer AB, Zhou P, Noshay JM, O'Connor CH, Hirsch CD, Ross-Ibarra J, 720 Hirsch CN, Springer NM (2019) Transposable elements contribute to dynamic genome content 721 in maize. The Plant Journal 100: 1052-1065 722
Andersson M, Turesson H, Olsson N, Fält A-S, Ohlsson P, Gonzalez MN, Samuelsson M, Hofvander P 723 (2018) Genome editing in potato via CRISPR-Cas9 ribonucleoprotein delivery. Physiologia 724 Plantarum 164: 378-384 725
Anzalone AV, Randolph PB, Davis JR, Sousa AA, Koblan LW, Levy JM, Chen PJ, Wilson C, Newby GA, 726 Raguram A, Liu DR (2019) Search-and-replace genome editing without double-strand breaks or 727 donor DNA. Nature 576: 149-157 728
Araki M, Ishii T (2016) Providing Appropriate Risk Information on Genome Editing for Patients. Trends 729 Biotechnol 34: 86-90 730
www.plantphysiol.orgon August 23, 2020 - Published by Downloaded from Copyright © 2020 American Society of Plant Biologists. All rights reserved.
41
Aslam U, Cheema HMN, Ahmad S, Khan IA, Malik W, Khan AA (2016) COTIP: Cotton TILLING Platform, a 731 Resource for Plant Improvement and Reverse Genetic Studies. Frontiers in Plant Science 7 732
ASTA (2016) Common practices of plant breeders. In. American Seed Trade Association, Alexandria, VA 733 Bae S, Park J, Kim JS (2014) Cas-OFFinder: a fast and versatile algorithm that searches for potential off-734
target sites of Cas9 RNA-guided endonucleases. Bioinformatics 30: 1473-1475 735 Bednarek PT, Orłowska R, Koebner RM, Zimny J (2007) Quantification of the tissue-culture induced 736
variation in barley (Hordeum vulgare L.). BMC plant biology 7: 10 737 Belfield EJ, Gan X, Mithani A, Brown C, Jiang C, Franklin K, Alvey E, Wibowo A, Jung M, Bailey K, 738
Kalwani S, Ragoussis J, Mott R, Harberd NP (2012) Genome-wide analysis of mutations in 739 mutant lineages selected following fast-neutron irradiation mutagenesis of Arabidopsis thaliana. 740 Genome Research 22: 1306-1315 741
Bernardo R (2016) Bandwagons I, too, have known. Theoretical and Applied Genetics 129: 2323-2332 742 Bevan MW, Uauy C, Wulff BBH, Zhou J, Krasileva K, Clark MD (2017) Genomic innovation for crop 743
improvement. Nature 543: 346-354 744 Bolon Y-T, Haun WJ, Xu WW, Grant D, Stacey MG, Nelson RT, Gerhardt DJ, Jeddeloh JA, Stacey G, 745
Muehlbauer GJ, Orf JH, Naeve SL, Stupar RM, Vance CP (2011) Phenotypic and genomic 746 analyses of a fast neutron mutant population resource in soybean. Plant Physiology 156: 240-747 253 748
Bolon Y-T, Stec AO, Michno J-M, Roessler J, Bhaskar PB, Ries L, Dobbels AA, Campbell BW, Young NP, 749 Anderson JE, Grant DM, Orf JH, Naeve SL, Muehlbauer GJ, Vance CP, Stupar RM (2014) 750 Genome Resilience and Prevalence of Segmental Duplications Following Fast Neutron Irradiation 751 of Soybean. Genetics 198: 967-981 752
Brunet E, Jasin M (2018) Induction of Chromosomal Translocations with CRISPR-Cas9 and Other 753 Nucleases: Understanding the Repair Mechanisms That Give Rise to Translocations. In Y Zhang, 754 ed, Chromosome Translocation. Springer Singapore, Singapore, pp 15-25 755
Bukowski R, Sun Q, Romay MC, Buckler ES, Lai J, Yang B, He B, Wang B, Xu D, Zhang G, Xu X, Li Y, Rong 756 Z, Guo X, Gao S, Lu Y, Zou C, Xie C, Xu Y, Fan L, Ware D, Jiao Y, Doebley JF, Lorant A, Ross-757 Ibarra J, Buffalo V (2017) Construction of the third-generation Zea mays haplotype map. 758 GigaScience 7 759
Carroll D (2011) Genome engineering with zinc-finger nucleases. Genetics 188: 773-782 760 Carroll D (2013) Staying on target with CRISPR-Cas. Nat Biotechnol 31: 807-809 761 Causse M, Desplat N, Pascual L, Le Paslier M-C, Sauvage C, Bauchet G, Bérard A, Bounon R, 762
Tchoumakov M, Brunel D, Bouchet J-P (2013) Whole genome resequencing in tomato reveals 763 variation associated with introgression and breeding events. BMC Genomics 14: 791 764
Čermák T, Curtin SJ, Gil-Humanes J, Čegan R, Kono TJY, Konečná E, Belanto JJ, Starker CG, Mathre JW, 765 Greenstein RL, Voytas DF (2017) A Multipurpose Toolkit to Enable Advanced Genome 766 Engineering in Plants. The Plant Cell 29: 1196-1217 767
Char SN, Neelakandan AK, Nahampun H, Frame B, Main M, Spalding MH, Becraft PW, Meyers BC, 768 Walbot V, Wang K, Yang B (2017) An Agrobacterium-delivered CRISPR/Cas9 system for high-769 frequency targeted mutagenesis in maize. Plant Biotechnology Journal 15: 257-268 770
Chen K, Wang Y, Zhang R, Zhang H, Gao C (2019) CRISPR/Cas Genome Editing and Precision Plant 771 Breeding in Agriculture. Annual Review of Plant Biology 70: 667-697 772
Chen L, Li W, Katin-Grazzini L, Ding J, Gu X, Li Y, Gu T, Wang R, Lin X, Deng Z, McAvoy RJ, Gmitter FG, 773 Deng Z, Zhao Y, Li Y (2018) A method for the production and expedient screening of 774 CRISPR/Cas9-mediated non-transgenic mutant plants. Horticulture Research 5: 13 775
Cheng AW, Wang H, Yang H, Shi L, Katz Y, Theunissen TW, Rangarajan S, Shivalila CS, Dadon DB, 776 Jaenisch R (2013) Multiplexed activation of endogenous genes by CRISPR-on, an RNA-guided 777 transcriptional activator system. Cell Research 23: 1163-1171 778
www.plantphysiol.orgon August 23, 2020 - Published by Downloaded from Copyright © 2020 American Society of Plant Biologists. All rights reserved.
42
Cho SW, Kim S, Kim Y, Kweon J, Kim HS, Bae S, Kim J-S (2014) Analysis of off-target effects of 779 CRISPR/Cas-derived RNA-guided endonucleases and nickases. Genome research 24: 132-141 780
Christian M, Cermak T, Doyle EL, Schmidt C, Zhang F, Hummel A, Bogdanove AJ, Voytas DF (2010) 781 Targeting DNA double-strand breaks with TAL effector nucleases. Genetics 186: 757-761 782
Church DM, Schneider VA, Steinberg KM, Schatz MC, Quinlan AR, Chin C-S, Kitts PA, Aken B, Marth GT, 783 Hoffman MM, Herrero J, Mendoza MLZ, Durbin R, Flicek P (2015) Extending reference assembly 784 models. Genome Biology 16: 13 785
Clark KA, Krysan PJ (2010) Chromosomal translocations are a common phenomenon in Arabidopsis 786 thaliana T-DNA insertion lines. The Plant Journal 64: 990-1001 787
Clegg MT, Morrell P (2004) Mutational Processes. In RM Goodman, ed, Encyclopedia of Plant and Crop 788 Science. Marcel Dekker, New York, pp 760-762 789
Cong L, Ran FA, Cox D, Lin S, Barretto R, Habib N, Hsu PD, Wu X, Jiang W, Marraffini LA, Zhang F (2013) 790 Multiplex genome engineering using CRISPR/Cas systems. Science 339: 819-823 791
Cook DE, Lee TG, Guo X, Melito S, Wang K, Bayless AM, Wang J, Hughes TJ, Willis DK, Clemente TE, 792 Diers BW, Jiang J, Hudson ME, Bent AF (2012) Copy Number Variation of Multiple Genes at 793 <em>Rhg1</em> Mediates Nematode Resistance in Soybean. Science 338: 1206-1209 794
Cox DBT, Platt RJ, Zhang F (2015) Therapeutic genome editing: prospects and challenges. Nature 795 Medicine 21: 121-131 796
Danner E, Bashir S, Yumlu S, Wurst W, Wefers B, Kühn R (2017) Control of gene editing by manipulation 797 of DNA repair mechanisms. Mammalian Genome 28: 262-274 798
Deng W, Rupon Jeremy W, Krivega I, Breda L, Motta I, Jahn Kristen S, Reik A, Gregory Philip D, Rivella 799 S, Dean A, Blobel Gerd A (2014) Reactivation of Developmentally Silenced Globin Genes by 800 Forced Chromatin Looping. Cell 158: 849-860 801
Doyle EL, Booher NJ, Standage DS, Voytas DF, Brendel VP, Vandyk JK, Bogdanove AJ (2012) TAL 802 Effector-Nucleotide Targeter (TALE-NT) 2.0: tools for TAL effector design and target prediction. 803 Nucleic Acids Res 40: W117-122 804
Dubin MJ, Mittelsten Scheid O, Becker C (2018) Transposons: a blessing curse. Curr Opin Plant Biol 42: 805 23-29 806
Ercolano MR, Sacco A, Ferriello F, D’Alessandro R, Tononi P, Traini A, Barone A, Zago E, Chiusano ML, 807 Buson G, Delledonne M, Frusciante L (2014) Patchwork sequencing of tomato San Marzano and 808 Vesuviano varieties highlights genome-wide variations. BMC Genomics 15: 138 809
Feng Z, Mao Y, Xu N, Zhang B, Wei P, Yang DL, Wang Z, Zhang Z, Zheng R, Yang L, Zeng L, Liu X, Zhu JK 810 (2014) Multigeneration analysis reveals the inheritance, specificity, and patterns of CRISPR/Cas-811 induced gene modifications in Arabidopsis. Proc Natl Acad Sci U S A 111: 4632-4637 812
Filler Hayut S, Melamed Bessudo C, Levy AA (2017) Targeted recombination between homologous 813 chromosomes for precise breeding in tomato. Nature Communications 8: 15605 814
Fine EJ, Cradick TJ, Zhao CL, Lin Y, Bao G (2014) An online bioinformatics tool predicts zinc finger and 815 TALE nuclease off-target cleavage. Nucleic Acids Res 42: e42 816
Food and Drug Administration (1992) Food for human consumption and animal drugs, feeds, and 817 related products: foods derived from new plant varieties; policy statement, 22984. In FDA 818 Federal Register, Department of Health and Human Services, Vol 57, p 22984 819
Foolad MR (2007) Genome mapping and molecular breeding of tomato. International journal of plant 820 genomics 2007: 64358-64358 821
Fossi M, Amundson K, Kuppu S, Britt A, Comai L (2019) Regeneration of Solanum tuberosum Plants 822 from Protoplasts Induces Widespread Genome Instability. Plant Physiology 180: 78-86 823
Friedberg EC, Walker GC, Siede W, Wood RD, Schultz RA, T. E (2006) DNA repair and mutagenesis, Ed 2. 824 ASM Press, Washington, DC 825
www.plantphysiol.orgon August 23, 2020 - Published by Downloaded from Copyright © 2020 American Society of Plant Biologists. All rights reserved.
43
Frock RL, Hu J, Meyers RM, Ho YJ, Kii E, Alt FW (2015) Genome-wide detection of DNA double-stranded 826 breaks induced by engineered nucleases. Nat Biotechnol 33: 179-186 827
Fu Y, Foden JA, Khayter C, Maeder ML, Reyon D, Joung JK, Sander JD (2013) High-frequency off-target 828 mutagenesis induced by CRISPR-Cas nucleases in human cells. Nat Biotechnol 31: 822-826 829
Fuentes RR, Chebotarov D, Duitama J, Smith S, De la Hoz JF, Mohiyuddin M, Wing RA, McNally KL, 830 Tatarinova T, Grigoriev A, Mauleon R, Alexandrov N (2019) Structural variants in 3000 rice 831 genomes. Genome research 29: 870-880 832
Gabur I, Chawla HS, Snowdon RJ, Parkin IAP (2019) Connecting genome structural variation with 833 complex traits in crop plants. Theoretical and Applied Genetics 132: 733-750 834
Gaj T, Gersbach CA, Barbas CF (2013) ZFN, TALEN, and CRISPR/Cas-based methods for genome 835 engineering. Trends in Biotechnology 31: 397-405 836
Gao X, Chen J, Dai X, Zhang D, Zhao Y (2016) An Effective Strategy for Reliably Isolating Heritable and 837 Cas9-Free Arabidopsis Mutants Generated by CRISPR/Cas9-Mediated Genome Editing. Plant 838 Physiology 171: 1794-1800 839
Gaudelli NM, Komor AC, Rees HA, Packer MS, Badran AH, Bryson DI, Liu DR (2017) Programmable base 840 editing of A•T to G•C in genomic DNA without DNA cleavage. Nature 551: 464-471 841
Gaut BS, Morton BR, McCaig BC, Clegg MT (1996) Substitution rate comparisons between grasses and 842 palms: synonymous rate differences at the nuclear gene Adh parallel rate differences at the 843 plastid gene rbcL. Proceedings of the National Academy of Sciences 93: 10274-10279 844
Gaut BS, Wright SI, Rizzon C, Dvorak J, Anderson LK (2007) Recombination: an underappreciated factor 845 in the evolution of plant genomes. Nat Rev Genet 8: 77-84 846
Gilad Y, Pritchard JK, Thornton K (2009) Characterizing natural variation using next-generation 847 sequencing technologies. Trends in Genetics 25: 463-471 848
Glenn KC, Alsop B, Bell E, Goley M, Jenkinson J, Liu B, Martin C, Parrott W, Souder C, Sparks O, 849 Urquhart W, Ward JM, Vicini JL (2017) Bringing New Plant Varieties to Market: Plant Breeding 850 and Selection Practices Advance Beneficial Characteristics while Minimizing Unintended 851 Changes. Crop Science 57: 2906-2921 852
Globus R, Qimron U (2018) A technological and regulatory outlook on CRISPR crop editing. Journal of 853 Cellular Biochemistry 119: 1291-1298 854
Golicz AA, Bayer PE, Barker GC, Edger PP, Kim H, Martinez PA, Chan CKK, Severn-Ellis A, McCombie 855 WR, Parkin IAP, Paterson AH, Pires JC, Sharpe AG, Tang H, Teakle GR, Town CD, Batley J, 856 Edwards D (2016) The pangenome of an agronomically important crop plant Brassica oleracea. 857 Nature Communications 7: 13390 858
Gore MA, Chia J-M, Elshire RJ, Sun Q, Ersoz ES, Hurwitz BL, Peiffer JA, McMullen MD, Grills GS, Ross-859 Ibarra J, Ware DH, Buckler ES (2009) A First-Generation Haplotype Map of Maize. Science 326: 860 1115-1117 861
Hahn F, Nekrasov V (2018) CRISPR/Cas precision: do we need to worry about off-targeting in plants? 862 Plant Cell Reports 38: 437-441 863
Hajjar R, Hodgkin T (2007) The use of wild relatives in crop improvement: a survey of developments 864 over the last 20 years. Euphytica 156: 1-13 865
Harris RS, Petersen-Mahrt SK, Neuberger MS (2002) RNA Editing Enzyme APOBEC1 and Some of Its 866 Homologs Can Act as DNA Mutators. Molecular Cell 10: 1247-1253 867
Henry IM, Nagalakshmi U, Lieberman MC, Ngo KJ, Krasileva KV, Vasquez-Gross H, Akhunova A, 868 Akhunov E, Dubcovsky J, Tai TH, Comai L (2014) Efficient genome-wide detection and 869 cataloging of EMS-induced mutations using exome capture and next-generation sequencing. The 870 Plant Cell 26: 1382-1397 871
Hirsch CN, Hirsch CD, Brohammer AB, Bowman MJ, Soifer I, Barad O, Shem-Tov D, Baruch K, Lu F, 872 Hernandez AG, Fields CJ, Wright CL, Koehler K, Springer NM, Buckler E, Buell CR, de Leon N, 873
www.plantphysiol.orgon August 23, 2020 - Published by Downloaded from Copyright © 2020 American Society of Plant Biologists. All rights reserved.
44
Kaeppler SM, Childs KL, Mikel MA (2016) Draft Assembly of Elite Inbred Line PH207 Provides 874 Insights into Genomic and Transcriptome Diversity in Maize. The Plant Cell 28: 2700-2714 875
Hu Y, Chen Z, Zhuang C, Huang J (2017) Cascade of chromosomal rearrangements caused by a 876 heterogeneous T-DNA integration supports the double-stranded break repair model for T-DNA 877 integration. The Plant Journal 90: 954-965 878
Huang X, Han B (2014) Natural Variations and Genome-Wide Association Studies in Crop Plants. Annual 879 Review of Plant Biology 65: 531-551 880
Hufford MB, Xu X, van Heerwaarden J, Pyhäjärvi T, Chia J-M, Cartwright RA, Elshire RJ, Glaubitz JC, 881 Guill KE, Kaeppler SM, Lai J, Morrell PL, Shannon LM, Song C, Springer NM, Swanson-Wagner 882 RA, Tiffin P, Wang J, Zhang G, Doebley J, McMullen MD, Ware D, Buckler ES, Yang S, Ross-883 Ibarra J (2012) Comparative population genomics of maize domestication and improvement. 884 Nature Genetics 44: 808-811 885
Hussain M, Iqbal MA, Till BJ (2018) Identification of induced mutations in hexaploid wheat genome 886 using exome capture assay. PloS One 13: e0201918 887
Ibiza VP, Cañizares J, Nuez F (2010) EcoTILLING in Capsicum species: searching for new virus resistances. 888 BMC genomics 11: 631 889
Innan H, Tajima F, Terauchi R, Miyashita NT (1996) Intragenic Recombination in the Adh Locus of the 890 Wild Plant Arabidopsis thaliana. Genetics 143: 1761-1770 891
Jaganathan D, Ramasamy K, Sellamuthu G, Jayabalan S, Venkataraman G (2018) CRISPR for Crop 892 Improvement: An Update Review. Frontiers in Plant Science 9: 985 893
Jiang C, Mithani A, Belfield EJ, Mott R, Hurst LD, Harberd NP (2014) Environmentally responsive 894 genome-wide accumulation of de novo Arabidopsis thaliana mutations and epimutations. 895 Genome research 24: 1821-1829 896
Jiang C, Mithani A, Gan X, Belfield EJ, Klingler JP, Zhu J-K, Ragoussis J, Mott R, Harberd NP (2011) 897 Regenerant Arabidopsis lineages display a distinct genome-wide spectrum of mutations 898 conferring variant phenotypes. Current Biology 21: 1385-1390 899
Jiang F, Doudna JA (2017) CRISPR–Cas9 Structures and Mechanisms. Annual Review of Biophysics 46: 900 505-529 901
Jiao Y, Burke JJ, Chopra R, Burow G, Chen J, Wang B, Hayes C, Emendack Y, Ware D, Xin Z (2016) A 902 sorghum mutant resource as an efficient platform for gene discovery in grasses. The Plant Cell 903 28: 1551-1562 904
Jiao Y, Peluso P, Shi J, Liang T, Stitzer MC, Wang B, Campbell MS, Stein JC, Wei X, Chin C-S, Guill K, 905 Regulski M, Kumari S, Olson A, Gent J, Schneider KL, Wolfgruber TK, May MR, Springer NM, 906 Antoniou E, McCombie WR, Presting GG, McMullen M, Ross-Ibarra J, Dawe RK, Hastie A, Rank 907 DR, Ware D (2017) Improved maize reference genome with single-molecule technologies. 908 Nature 546: 524 909
Jin S, Zong Y, Gao Q, Zhu Z, Wang Y, Qin P, Liang C, Wang D, Qiu J-L, Zhang F, Gao C (2019) Cytosine, 910 but not adenine, base editors induce genome-wide off-target mutations in rice. Science 364: 911 292-295 912
Jinek M, Chylinski K, Fonfara I, Hauer M, Doudna JA, Charpentier E (2012) A programmable dual-RNA-913 guided DNA endonuclease in adaptive bacterial immunity. Science 337: 816-821 914
Jo YD, Kim J-B (2019) Frequency and Spectrum of Radiation-Induced Mutations Revealed by Whole-915 Genome Sequencing Analyses of Plants. Quantum Beam Science 3: 7 916
Just D, Garcia V, Fernandez L, Bres C, Mauxion J-P, Petit J, Jorly J, Assali J, Bournonville C, Ferrand C 917 (2013) Micro-Tom mutants for functional analysis of target genes and discovery of new alleles in 918 tomato. Plant Biotechnology 30: 225-231 919
www.plantphysiol.orgon August 23, 2020 - Published by Downloaded from Copyright © 2020 American Society of Plant Biologists. All rights reserved.
45
Kaiser N, Douches D, Dhingra A, Glenn KC, Herzig PR, Stowe EC, Swarup S (2020) The role of 920 conventional plant breeding in ensuring safe levels of naturally occurring toxins in food crops. 921 Trends in Food Science & Technology 100: 51-66 922
Kaity A, Ashmore S, Drew R (2009) Field performance evaluation and genetic integrity assessment of 923 cryopreserved papaya clones. Plant Cell Reports 28: 1421-1430 924
Kearns NA, Pham H, Tabak B, Genga RM, Silverstein NJ, Garber M, Maehr R (2015) Functional 925 annotation of native enhancers with a Cas9–histone demethylase fusion. Nature Methods 12: 926 401-403 927
Kelliher T, Starr D, Su X, Tang G, Chen Z, Carter J, Wittich PE, Dong S, Green J, Burch E, McCuiston J, Gu 928 W, Sun Y, Strebe T, Roberts J, Bate NJ, Que Q (2019) One-step genome editing of elite crop 929 germplasm during haploid induction. Nature Biotechnology 37: 287-292 930
Kharkwal M, Pandey R, Pawar S (2004) Mutation breeding for crop improvement. In Plant Breeding. 931 Springer, pp 601-645 932
Kim H, Kim ST, Ryu J, Kang BC, Kim JS, Kim SG (2017) CRISPR/Cpf1-mediated DNA-free plant genome 933 editing. Nat Commun 8: 14406 934
Knoll A, Fauser F, Puchta H (2014) DNA recombination in somatic plant cells: mechanisms and 935 evolutionary consequences. Chromosome Research 22: 191-201 936
Komor AC, Kim YB, Packer MS, Zuris JA, Liu DR (2016) Programmable editing of a target base in 937 genomic DNA without double-stranded DNA cleavage. Nature 533: 420-424 938
Kosicki M, Tomberg K, Bradley A (2018) Repair of double-strand breaks induced by CRISPR–Cas9 leads 939 to large deletions and complex rearrangements. Nature Biotechnology 36: 765 940
Krasileva KV, Vasquez-Gross HA, Howell T, Bailey P, Paraiso F, Clissold L, Simmonds J, Ramirez-941 Gonzalez RH, Wang X, Borrill P (2017) Uncovering hidden variation in polyploid wheat. 942 Proceedings of the National Academy of Sciences 114: E913-E921 943
Krishna H, Alizadeh M, Singh D, Singh U, Chauhan N, Eftekhari M, Sadh RK (2016) Somaclonal 944 variations and their applications in horticultural crops improvement. 3 Biotech 6: 54 945
Lee CM, Cradick TJ, Fine EJ, Bao G (2016) Nuclease Target Site Selection for Maximizing On-target 946 Activity and Minimizing Off-target Effects in Genome Editing. Molecular Therapy 24: 475-487 947
Lee JK, Jeong E, Lee J, Jung M, Shin E, Kim Y-h, Lee K, Jung I, Kim D, Kim S, Kim J-S (2018) Directed 948 evolution of CRISPR-Cas9 to increase its specificity. Nature Communications 9: 3048 949
Lee K, Zhang Y, Kleinstiver BP, Guo JA, Aryee MJ, Miller J, Malzahn A, Zarecor S, Lawrence-Dill CJ, 950 Joung JK, Qi Y, Wang K (2019) Activities and specificities of CRISPR/Cas9 and Cas12a nucleases 951 for targeted mutagenesis in maize. Plant Biotechnology Journal 17: 362-372 952
Li G, Jain R, Chern M, Pham NT, Martin JA, Wei T, Schackwitz WS, Lipzen AM, Duong PQ, Jones KC, 953 Jiang L, Ruan D, Bauer D, Peng Y, Barry KW, Schmutz J, Ronald PC (2017) The Sequences of 954 1504 Mutants in the Model Rice Variety Kitaake Facilitate Rapid Functional Genomic Studies. 955 The Plant Cell 29: 1218-1231 956
Li J, Manghwar H, Sun L, Wang P, Wang G, Sheng H, Zhang J, Liu H, Qin L, Rui H, Li B, Lindsey K, Daniell 957 H, Jin S, Zhang X (2019) Whole genome sequencing reveals rare off-target mutations and 958 considerable inherent genetic or/and somaclonal variations in CRISPR/Cas9-edited cotton 959 plants. Plant Biotechnology Journal 17: 858-868 960
Li S, Zheng Y-c, Cui H-r, Fu H-w, Shu Q-y, Huang J-z (2016) Frequency and type of inheritable mutations 961 induced by γ rays in rice as revealed by whole genome sequencing. Journal of Zhejiang 962 University-SCIENCE B 17: 905-915 963
Li YH, Zhou G, Ma J, Jiang W, Jin LG, Zhang Z, Guo Y, Zhang J, Sui Y, Zheng L, Zhang SS, Zuo Q, Shi XH, Li 964 YF, Zhang WK, Hu Y, Kong G, Hong HL, Tan B, Song J, Liu ZX, Wang Y, Ruan H, Yeung CK, Liu J, 965 Wang H, Zhang LJ, Guan RX, Wang KJ, Li WB, Chen SY, Chang RZ, Jiang Z, Jackson SA, Li R, Qiu 966
www.plantphysiol.orgon August 23, 2020 - Published by Downloaded from Copyright © 2020 American Society of Plant Biologists. All rights reserved.
46
LJ (2014) De novo assembly of soybean wild relatives for pan-genome analysis of diversity and 967 agronomic traits. Nat Biotechnol 32: 1045-1052 968
Li Z, Liu ZB, Xing A, Moon BP, Koellhoffer JP, Huang L, Ward RT, Clifton E, Falco SC, Cigan AM (2015) 969 Cas9-Guide RNA Directed Genome Editing in Soybean. Plant Physiology 169: 960-970 970
Lisch D (2012) How important are transposons for plant evolution? Nature Reviews Genetics 14: 49-61 971 Listgarten J, Weinstein M, Kleinstiver BP, Sousa AA, Joung JK, Crawford J, Gao K, Hoang L, Elibol M, 972
Doench JG, Fusi N (2018) Prediction of off-target activities for the end-to-end design of CRISPR 973 guide RNAs. Nature Biomedical Engineering 2: 38-47 974
Liu H, Ding Y, Zhou Y, Jin W, Xie K, Chen L-L (2017) CRISPR-P 2.0: An Improved CRISPR-Cas9 Tool 975 for Genome Editing in Plants. Molecular Plant 10: 530-532 976
Liu Q, Zhou Y, Gaut BS, Morrell PL (2017) Deleterious Variants in Asian Rice and the Potential Cost of 977 Domestication. Molecular Biology and Evolution 34: 908-924 978
Lobaton JD, Miller T, Gil J, Ariza D, de la Hoz JF, Soler A, Beebe S, Duitama J, Gepts P, Raatz B (2018) 979 Resequencing of Common Bean Identifies Regions of Inter-Gene Pool Introgression and Provides 980 Comprehensive Resources for Molecular Breeding. Plant Genome 11 981
Lu F, Romay MC, Glaubitz JC, Bradbury PJ, Elshire RJ, Wang T, Li Y, Li Y, Semagn K, Zhang X, Hernandez 982 AG, Mikel MA, Soifer I, Barad O, Buckler ES (2015) High-resolution genetic mapping of maize 983 pan-genome sequence anchors. Nature Communications 6: 6914 984
Lu X, Liu J, Ren W, Yang Q, Chai Z, Chen R, Wang L, Zhao J, Lang Z, Wang H, Fan Y, Zhao J, Zhang C 985 (2018) Gene-Indexed Mutations in Maize. Molecular Plant 11: 496-504 986
Lusser M, Parisi C, Plan D, Rodriguez-Cerezo E (2012) Deployment of new biotechnologies in plant 987 breeding. Nat Biotechnol 30: 231-239 988
Machczyńska J, Zimny J, Bednarek PT (2015) Tissue culture-induced genetic and epigenetic variation in 989 triticale (× Triticosecale spp. Wittmack ex A. Camus 1927) regenerants. Plant molecular biology 990 89: 279-292 991
Maldonado dos Santos JV, Valliyodan B, Joshi T, Khan SM, Liu Y, Wang J, Vuong TD, Oliveira MFd, 992 Marcelino-Guimarães FC, Xu D, Nguyen HT, Abdelnoor RV (2016) Evaluation of genetic 993 variation among Brazilian soybean cultivars through genome resequencing. BMC Genomics 17: 994 110 995
Mba C (2013) Induced mutations unleash the potentials of plant genetic resources for food and 996 agriculture. Agronomy 3: 200-231 997
Michael TP, VanBuren R (2015) Progress, challenges and the future of crop genomes. Current Opinion in 998 Plant Biology 24: 71-81 999
Michno JM, Stupar RM (2018) The importance of genotype identity, genetic heterogeneity, and 1000 bioinformatic handling for properly assessing genomic variation in transgenic plants. BMC 1001 Biotechnol 18: 38 1002
Micke A, Donini B, Maluszynski M (1990) Induced mutations for crop improvement. In: Mutation 1003 Breeding Review, FAO/IAEA, No. 7. p. 41. International Atomic Energy Agency, Vienna, Austria. 1004
Minkenberg B, Zhang J, Xie K, Yang Y (2019) CRISPR-PLANT v2: an online resource for highly specific 1005 guide RNA spacers based on improved off-target analysis. Plant Biotechnology Journal 17: 5-8 1006
Minoia S, Petrozza A, D'Onofrio O, Piron F, Mosca G, Sozio G, Cellini F, Bendahmane A, Carriero F 1007 (2010) A new mutant genetic resource for tomato crop improvement by TILLING technology. 1008 BMC Research Notes 3: 69 1009
Miyao A, Nakagome M, Ohnuma T, Yamagata H, Kanamori H, Katayose Y, Takahashi A, Matsumoto T, 1010 Hirochika H (2012) Molecular spectrum of somaclonal variation in regenerated rice revealed by 1011 whole-genome sequencing. Plant and Cell Physiology 53: 256-264 1012
www.plantphysiol.orgon August 23, 2020 - Published by Downloaded from Copyright © 2020 American Society of Plant Biologists. All rights reserved.
47
Mohd-Yusoff N, Ruperao P, Tomoyoshi N, Edwards D, Gresshoff P, Biswas B, Batley J (2015) Scanning 1013 the effects of ethyl methanesulfonate on the whole genome of Lotus japonicus using 1014 secondgeneration sequencing analysis. G3 5: 559-567 1015
Moon SB, Kim DY, Ko J-H, Kim J-S, Kim Y-S (2019) Improving CRISPR Genome Editing by Engineering 1016 Guide RNAs. Trends in Biotechnology 37: 870-881 1017
Morgan SL, Mariano NC, Bermudez A, Arruda NL, Wu F, Luo Y, Shankar G, Jia L, Chen H, Hu J-F, 1018 Hoffman AR, Huang C-C, Pitteri SJ, Wang KC (2017) Manipulation of nuclear architecture 1019 through CRISPR-mediated chromosomal looping. Nature Communications 8: 15993 1020
Morrell PL, Buckler ES, Ross-Ibarra J (2011) Crop genomics: advances and applications. Nature Reviews 1021 Genetics 13: 85-96 1022
Morrell PL, Toleno DM, Lundy KE, Clegg MT (2006) Estimating the Contribution of Mutation, 1023 Recombination and Gene Conversion in the Generation of Haplotypic Diversity. Genetics 173: 1024 1705-1723 1025
Muñoz-Diez C, Vitte C, Ross-Ibarra J, Gaut BS, Tenaillon MI (2012) Using Nextgen Sequencing to 1026 Investigate Genome Size Variation and Transposable Element Content. In M-A Grandbastien, JM 1027 Casacuberta, eds, Plant Transposable Elements: Impact on Genome Structure and Function. 1028 Springer Berlin Heidelberg, Berlin, Heidelberg, pp 41-58 1029
Muth J, Hartje S, Twyman RM, Hofferbert HR, Tacke E, Prüfer D (2008) Precision breeding for novel 1030 starch variants in potato. Plant biotechnology journal 6: 576-584 1031
Nachman MW, Crowell SL (2000) Estimate of the Mutation Rate per Nucleotide in Humans. Genetics 1032 156: 297-304 1033
Neelakandan AK, Wang K (2012) Recent progress in the understanding of tissue culture-induced 1034 genome level changes in plants and potential applications. Plant cell reports 31: 597-620 1035
Nisa M-U, Huang Y, Benhamed M, Raynaud C (2019) The Plant DNA Damage Response: Signaling 1036 Pathways Leading to Growth Inhibition and Putative Role in Response to Stress Conditions. 1037 Frontiers in Plant Science 10 1038
Ossowski S, Schneeberger K, Lucas-Lledo JI, Warthmann N, Clark RM, Shaw RG, Weigel D, Lynch M 1039 (2010) The rate and molecular spectrum of spontaneous mutations in Arabidopsis thaliana. 1040 Science 327: 92-94 1041
Pacher M, Puchta H (2017) From classical mutagenesis to nuclease-based breeding – directing natural 1042 DNA repair for a natural end-product. The Plant Journal 90: 819-833 1043
Park SJ, Jiang K, Tal L, Yichie Y, Gar O, Zamir D, Eshed Y, Lippman ZB (2014) Optimization of crop 1044 productivity in tomato using induced mutations in the florigen pathway. Nature Genetics 46: 1045 1337 1046
Paten B, Novak AM, Eizenga JM, Garrison E (2017) Genome graphs and the evolution of genome 1047 inference. Genome Research 27: 665-676 1048
Pattanayak V, Ramirez CL, Joung JK, Liu DR (2011) Revealing off-target cleavage specificities of zinc-1049 finger nucleases by in vitro selection. Nat Methods 8: 765-770 1050
Petolino JF, Srivastava V, Daniell H (2016) Editing Plant Genomes: a new era of crop improvement. Plant 1051 biotechnology Journal 14: 435-436 1052
Podevin N, Davies HV, Hartung F, Nogue F, Casacuberta JM (2013) Site-directed nucleases: a paradigm 1053 shift in predictable, knowledge-based plant breeding. Trends Biotechnol 31: 375-383 1054
Puchta H (2005) The repair of double-strand breaks in plants: mechanisms and consequences for 1055 genome evolution. J Exp Bot 56: 1-14 1056
Qi J, Liu X, Shen D, Miao H, Xie B, Li X, Zeng P, Wang S, Shang Y, Gu X, Du Y, Li Y, Lin T, Yuan J, Yang X, 1057 Chen J, Chen H, Xiong X, Huang K, Fei Z, Mao L, Tian L, Stadler T, Renner SS, Kamoun S, Lucas 1058 WJ, Zhang Z, Huang S (2013) A genomic variation map provides insights into the genetic basis of 1059 cucumber domestication and diversity. Nat Genet 45: 1510-1515 1060
www.plantphysiol.orgon August 23, 2020 - Published by Downloaded from Copyright © 2020 American Society of Plant Biologists. All rights reserved.
48
Qi Lei S, Larson Matthew H, Gilbert Luke A, Doudna Jennifer A, Weissman Jonathan S, Arkin Adam P, 1061 Lim Wendell A (2013) Repurposing CRISPR as an RNA-Guided Platform for Sequence-Specific 1062 Control of Gene Expression. Cell 152: 1173-1183 1063
Qin C, Yu C, Shen Y, Fang X, Chen L, Min J, Cheng J, Zhao S, Xu M, Luo Y, Yang Y, Wu Z, Mao L, Wu H, 1064 Ling-Hu C, Zhou H, Lin H, Gonzalez-Morales S, Trejo-Saavedra DL, Tian H, Tang X, Zhao M, 1065 Huang Z, Zhou A, Yao X, Cui J, Li W, Chen Z, Feng Y, Niu Y, Bi S, Yang X, Li W, Cai H, Luo X, 1066 Montes-Hernandez S, Leyva-Gonzalez MA, Xiong Z, He X, Bai L, Tan S, Tang X, Liu D, Liu J, 1067 Zhang S, Chen M, Zhang L, Zhang L, Zhang Y, Liao W, Zhang Y, Wang M, Lv X, Wen B, Liu H, 1068 Luan H, Zhang Y, Yang S, Wang X, Xu J, Li X, Li S, Wang J, Palloix A, Bosland PW, Li Y, Krogh A, 1069 Rivera-Bustamante RF, Herrera-Estrella L, Yin Y, Yu J, Hu K, Zhang Z (2014) Whole-genome 1070 sequencing of cultivated and wild peppers provides insights into Capsicum domestication and 1071 specialization. Proc Natl Acad Sci U S A 111: 5135-5140 1072
Radany EH, Dornfeld KJ, Sanderson RJ, Savage MK, Majumdar A, Seidman MM, Mosbaugh DW (2000) 1073 Increased spontaneous mutation frequency in human cells expressing the phage PBS2-encoded 1074 inhibitor of uracil-DNA glycosylase. Mutation Research/DNA Repair 461: 41-58 1075
Ran Y, Liang Z, Gao C (2017) Current and future editing reagent delivery systems for plant genome 1076 editing. Science China Life Sciences 60: 490-505 1077
Ray T, Dutta I, Saha P, Das S, Roy S (2006) Genetic stability of three economically important 1078 micropropagated banana (Musa spp.) cultivars of lower Indo-Gangetic plains, as assessed by 1079 RAPD and ISSR markers. Plant Cell, Tissue and Organ Culture 85: 11-21 1080
Rey O, Danchin E, Mirouze M, Loot C, Blanchet S (2016) Adaptation to Global Change: A Transposable 1081 Element–Epigenetics Perspective. Trends in Ecology & Evolution 31: 514-526 1082
Roach JC, Glusman G, Smit AFA, Huff CD, Hubley R, Shannon PT, Rowen L, Pant KP, Goodman N, 1083 Bamshad M, Shendure J, Drmanac R, Jorde LB, Hood L, Galas DJ (2010) Analysis of Genetic 1084 Inheritance in a Family Quartet by Whole-Genome Sequencing. Science 328: 636-639 1085
Romay MC, Millard MJ, Glaubitz JC, Peiffer JA, Swarts KL, Casstevens TM, Elshire RJ, Acharya CB, 1086 Mitchell SE, Flint-Garcia SA, McMullen MD, Holland JB, Buckler ES, Gardner CA (2013) 1087 Comprehensive genotyping of the USA national maize inbred seed bank. Genome Biology 14: 1088 R55 1089
Sahebi M, Hanafi MM, van Wijnen AJ, Rice D, Rafii MY, Azizi P, Osman M, Taheri S, Bakar MFA, Isa 1090 MNM, Noor YM (2018) Contribution of transposable elements in the plant's genome. Gene 665: 1091 155-166 1092
Sahijram L, Soneji JR, Bollamma K (2003) Analyzing somaclonal variation in micropropagated bananas 1093 (Musa spp.). In Vitro Cellular & Developmental Biology-Plant 39: 551-556 1094
Saika H, Oikawa A, Matsuda F, Onodera H, Saito K, Toki S (2011) Application of gene targeting to 1095 designed mutation breeding of high-tryptophan rice. Plant Physiology 156: 1269-1277 1096
Sauvage C, Rau A, Aichholz C, Chadoeuf J, Sarah G, Ruiz M, Santoni S, Causse M, David J, Glémin S 1097 (2017) Domestication rewired gene expression and nucleotide diversity patterns in tomato. The 1098 Plant Journal 91: 631-645 1099
Schiessl S-V, Katche E, Ihien E, Chawla HS, Mason AS (2019) The role of genomic structural variation in 1100 the genetic improvement of polyploid crops. The Crop Journal 7: 127-140 1101
Schmid-Siegert E, Sarkar N, Iseli C, Calderon S, Gouhier-Darimont C, Chrast J, Cattaneo P, Schütz F, 1102 Farinelli L, Pagni M, Schneider M, Voumard J, Jaboyedoff M, Fankhauser C, Hardtke CS, Keller 1103 L, Pannell JR, Reymond A, Robinson-Rechavi M, Xenarios I, Reymond P (2017) Low number of 1104 fixed somatic mutations in a long-lived oak tree. Nature Plants 3: 926-929 1105
Schmutz J, McClean PE, Mamidi S, Wu GA, Cannon SB, Grimwood J, Jenkins J, Shu S, Song Q, Chavarro 1106 C, Torres-Torres M, Geffroy V, Moghaddam SM, Gao D, Abernathy B, Barry K, Blair M, Brick 1107 MA, Chovatia M, Gepts P, Goodstein DM, Gonzales M, Hellsten U, Hyten DL, Jia G, Kelly JD, 1108
www.plantphysiol.orgon August 23, 2020 - Published by Downloaded from Copyright © 2020 American Society of Plant Biologists. All rights reserved.
49
Kudrna D, Lee R, Richard MMS, Miklas PN, Osorno JM, Rodrigues J, Thareau V, Urrea CA, Wang 1109 M, Yu Y, Zhang M, Wing RA, Cregan PB, Rokhsar DS, Jackson SA (2014) A reference genome for 1110 common bean and genome-wide analysis of dual domestications. Nature Genetics 46: 707 1111
Schuermann D, Molinier J, Fritsch O, Hohn B (2005) The dual nature of homologous recombination in 1112 plants. Trends in Genetics 21: 172-181 1113
Schuppert GF, Tang S, Slabaugh MB, Knapp SJ (2006) The Sunflower High-oleic Mutant Ol Carries 1114 Variable Tandem Repeats of FAD2-1, a Seed-specific Oleoyl-phosphatidyl Choline Desaturase. 1115 Molecular Breeding 17: 241-256 1116
Shaw RG, Byers DL, Darmo E (2000) Spontaneous Mutational Effects on Reproductive Traits of 1117 Arabidopsis thaliana. Genetics 155: 369-378 1118
Shen B, Zhang W, Zhang J, Zhou J, Wang J, Chen L, Wang L, Hodgkins A, Iyer V, Huang X, Skarnes WC 1119 (2014) Efficient genome modification by CRISPR-Cas9 nickase with minimal off-target effects. 1120 Nature Methods 11: 399-402 1121
Shi J, Gao H, Wang H, Lafitte HR, Archibald RL, Yang M, Hakimi SM, Mo H, Habben JE (2017) ARGOS8 1122 variants generated by CRISPR-Cas9 improve maize grain yield under field drought stress 1123 conditions. Plant Biotechnology Journal 15: 207-216 1124
Shirasawa K, Hirakawa H, Nunome T, Tabata S, Isobe S (2016) Genome‐wide survey of artificial 1125 mutations induced by ethyl methanesulfonate and gamma rays in tomato. Plant biotechnology 1126 journal 14: 51-60 1127
Shu Q-Y, Forster BP, Nakagawa H (2012) Plant mutation breeding and biotechnology. CABI 1128 Sikora P, Chawade A, Larsson M, Olsson J, Olsson O (2011) Mutagenesis as a tool in plant genetics, 1129
functional genomics, and breeding. International journal of plant genomics 2011: 1-13 1130 Stadler LJ (1929) Chromosome number and the mutation rate in Avena and Triticum. Proceedings of the 1131
National Academy of Sciences 15: 876-881 1132 Standage-Beier K, Brookhouser N, Balachandran P, Zhang Q, Brafman DA, Wang X (2019) RNA-Guided 1133
Recombinase-Cas9 Fusion Targets Genomic DNA Deletion and Integration. The CRISPR journal 2: 1134 209-222 1135
Stepper P, Kungulovski G, Jurkowska RZ, Chandra T, Krueger F, Reinhardt R, Reik W, Jeltsch A, 1136 Jurkowski TP (2016) Efficient targeted DNA methylation with chimeric dCas9–Dnmt3a–Dnmt3L 1137 methyltransferase. Nucleic Acids Research 45: 1703-1713 1138
Strecker J, Ladha A, Gardner Z, Schmid-Burgk JL, Makarova KS, Koonin EV, Zhang F (2019) RNA-guided 1139 DNA insertion with CRISPR-associated transposases. Science 365: 48-53 1140
Tajima F (1983) Evolutionary relationship of DNA sequences in finite populations. Genetics 105: 437-460 1141 Talamè V, Bovina R, Sanguineti MC, Tuberosa R, Lundqvist U, Salvi S (2008) TILLMore, a resource for 1142
the discovery of chemically induced mutants in barley. Plant Biotechnology Journal 6: 477-485 1143 Tang X, Liu G, Zhou J, Ren Q, You Q, Tian L, Xin X, Zhong Z, Liu B, Zheng X, Zhang D, Malzahn A, Gong Z, 1144
Qi Y, Zhang T, Zhang Y (2018) A large-scale whole-genome sequencing analysis reveals highly 1145 specific genome editing by both Cas9 and Cpf1 (Cas12a) nucleases in rice. Genome Biol 19: 84 1146
Thakore PI, D'Ippolito AM, Song L, Safi A, Shivakumar NK, Kabadi AM, Reddy TE, Crawford GE, 1147 Gersbach CA (2015) Highly specific epigenome editing by CRISPR-Cas9 repressors for silencing of 1148 distal regulatory elements. Nature Methods 12: 1143-1149 1149
Thudi M, Khan AW, Kumar V, Gaur PM, Katta K, Garg V, Roorkiwal M, Samineni S, Varshney RK (2016) 1150 Whole genome re-sequencing reveals genome-wide variations among parental lines of 16 1151 mapping populations in chickpea (Cicer arietinum L.). BMC Plant Biol 16 Suppl 1: 10 1152
Till BJ, Cooper J, Tai TH, Colowit P, Greene EA, Henikoff S, Comai L (2007) Discovery of chemically 1153 induced mutations in rice by TILLING. BMC Plant Biology 7: 19 1154
Todd JJ, Vodkin LO (1996) Duplications That Suppress and Deletions That Restore Expression from a 1155 Chalcone Synthase Multigene Family. The Plant Cell 8: 687-699 1156
www.plantphysiol.orgon August 23, 2020 - Published by Downloaded from Copyright © 2020 American Society of Plant Biologists. All rights reserved.
50
Townsend JA, Wright DA, Winfrey RJ, Fu F, Maeder ML, Joung JK, Voytas DF (2009) High-frequency 1157 modification of plant genes using engineered zinc-finger nucleases. Nature 459: 442-445 1158
Tsai SQ, Joung JK (2016) Defining and improving the genome-wide specificities of CRISPR-Cas9 1159 nucleases. Nature Reviews Genetics 17: 300-312 1160
Tsuda M, Kaga A, Anai T, Shimizu T, Sayama T, Takagi K, Machita K, Watanabe S, Nishimura M, 1161 Yamada N, Mori S, Sasaki H, Kanamori H, Katayose Y, Ishimoto M (2015) Construction of a 1162 high-density mutant library in soybean and development of a mutant retrieval method using 1163 amplicon sequencing. BMC Genomics 16: 1014 1164
Valliyodan B, Dan Q, Patil G, Zeng P, Huang J, Dai L, Chen C, Li Y, Joshi T, Song L, Vuong TD, Musket TA, 1165 Xu D, Shannon JG, Shifeng C, Liu X, Nguyen HT (2016) Landscape of genomic diversity and trait 1166 discovery in soybean. Scientific Reports 6: 23598 1167
Vinh M, Thinh D, Bang D, At D, Ham L, Shu Q (2009) Current status and research directions of induced 1168 mutation application to seed crops improvement in Vietnam. In Q-Y Shu, ed, Induced Plant 1169 Mutations in the Genomics Era. Food and Agirculture Organization of the United Nations, pp 1170 341-345 1171
Vitte C, Fustier M-A, Alix K, Tenaillon MI (2014) The bright side of transposons in crop evolution. 1172 Briefings in Functional Genomics 13: 276-295 1173
Voytas DF (2013) Plant genome engineering with sequence-specific nucleases. Annu Rev Plant Biol 64: 1174 327-350 1175
Wang L, Beissinger TM, Lorant A, Ross-Ibarra C, Ross-Ibarra J, Hufford MB (2017) The interplay of 1176 demography and selection during maize domestication and expansion. Genome Biology 18: 215 1177
Wang W, Mauleon R, Hu Z, Chebotarov D, Tai S, Wu Z, Li M, Zheng T, Fuentes RR, Zhang F, Mansueto 1178 L, Copetti D, Sanciangco M, Palis KC, Xu J, Sun C, Fu B, Zhang H, Gao Y, Zhao X, Shen F, Cui X, 1179 Yu H, Li Z, Chen M, Detras J, Zhou Y, Zhang X, Zhao Y, Kudrna D, Wang C, Li R, Jia B, Lu J, He X, 1180 Dong Z, Xu J, Li Y, Wang M, Shi J, Li J, Zhang D, Lee S, Hu W, Poliakov A, Dubchak I, Ulat VJ, 1181 Borja FN, Mendoza JR, Ali J, Li J, Gao Q, Niu Y, Yue Z, Naredo MEB, Talag J, Wang X, Li J, Fang X, 1182 Yin Y, Glaszmann JC, Zhang J, Li J, Hamilton RS, Wing RA, Ruan J, Zhang G, Wei C, Alexandrov 1183 N, McNally KL, Li Z, Leung H (2018) Genomic variation in 3,010 diverse accessions of Asian 1184 cultivated rice. Nature 557: 43-49 1185
Wang Z-h, Jia Y (2014) Development and characterization of rice mutants for functional genomic studies 1186 and breeding. In Mutagenesis: exploring novel genes and pathways. Wageningen Academic 1187 Publishers, pp 604-612 1188
Waterworth WM, Drury GE, Bray CM, West CE (2011) Repairing breaks in the plant genome: the 1189 importance of keeping it together. New Phytol 192: 805-822 1190
Waterworth WM, Footitt S, Bray CM, Finch-Savage WE, West CE (2016) DNA damage checkpoint kinase 1191 ATM regulates germination and maintains genome stability in seeds. Proceedings of the 1192 National Academy of Sciences 113: 9647-9652 1193
Waterworth WM, Masnavi G, Bhardwaj RM, Jiang Q, Bray CM, West CE (2010) A plant DNA ligase is an 1194 important determinant of seed longevity. The Plant Journal 63: 848-860 1195
Weeks DP, Spalding MH, Yang B (2016) Use of designer nucleases for targeted gene and genome editing 1196 in plants. Plant Biotechnol J 14: 483-495 1197
Wendel JF, Jackson SA, Meyers BC, Wing RA (2016) Evolution of plant genome architecture. Genome 1198 Biology 17: 37 1199
Weng M-L, Becker C, Hildebrandt J, Neumann M, Rutter MT, Shaw RG, Weigel D, Fenster CB (2019) 1200 Fine-Grained Analysis of Spontaneous Mutation Spectrum and Frequency in Arabidopsis 1201 thaliana. Genetics 211: 703-714 1202
Wolt JD, Wang K, Sashital D, Lawrence-Dill CJ (2016) Achieving Plant CRISPR Targeting that Limits Off-1203 Target Effects. The Plant Genome 9 1204
www.plantphysiol.orgon August 23, 2020 - Published by Downloaded from Copyright © 2020 American Society of Plant Biologists. All rights reserved.
51
Woo JW, Kim J, Kwon SI, Corvalan C, Cho SW, Kim H, Kim SG, Kim ST, Choe S, Kim JS (2015) DNA-free 1205 genome editing in plants with preassembled CRISPR-Cas9 ribonucleoproteins. Nat Biotechnol 1206 33: 1162-1164 1207
Wu X, Kriz AJ, Sharp PA (2014) Target specificity of the CRISPR-Cas9 system. Quant Biol 2: 59-70 1208 Xu K, Xu X, Fukao T, Canlas P, Maghirang-Rodriguez R, Heuer S, Ismail AM, Bailey-Serres J, Ronald PC, 1209
Mackill DJ (2006) Sub1A is an ethylene-response-factor-like gene that confers submergence 1210 tolerance to rice. Nature 442: 705-708 1211
Xu Y, Li P, Zou C, Lu Y, Xie C, Zhang X, Prassanna BM, Olsen MS (2017) Enhancing genetic gain in the era 1212 of molecular breeding. Journal of Experimental Botany 68: 2641-2666 1213
Yang N, Xu X-W, Wang R-R, Peng W-L, Cai L, Song J-M, Li W, Luo X, Niu L, Wang Y, Jin M, Chen L, Luo J, 1214 Deng M, Wang L, Pan Q, Liu F, Jackson D, Yang X, Chen L-L, Yan J (2017) Contributions of Zea 1215 mays subspecies mexicana haplotypes to modern maize. Nature Communications 8: 1874 1216
Young J, Zastrow-Hayes G, Deschamps S, Svitashev S, Zaremba M, Acharya A, Paulraj S, Peterson-1217 Burch B, Schwartz C, Djukanovic V, Lenderts B, Feigenbutz L, Wang L, Alarcon C, Siksnys V, May 1218 G, Chilcoat ND, Kumar S (2019) CRISPR-Cas9 Editing in Maize: Systematic Evaluation of Off-1219 target Activity and Its Relevance in Crop Improvement. Scientific Reports 9: 6729 1220
Yu Q-h, Wang B, Li N, Tang Y, Yang S, Yang T, Xu J, Guo C, Yan P, Wang Q, Asmutola P (2017) 1221 CRISPR/Cas9-induced Targeted Mutagenesis and Gene Replacement to Generate Long-shelf Life 1222 Tomato Lines. Scientific Reports 7: 11874 1223
Zhang H, Zhang J, Wei P, Zhang B, Gou F, Feng Z, Mao Y, Yang L, Zhang H, Xu N, Zhu JK (2014) The 1224 CRISPR/Cas9 system produces specific and homozygous targeted gene editing in rice in one 1225 generation. Plant Biotechnol J 12: 797-807 1226
Zhang XH, Tee LY, Wang XG, Huang QS, Yang SH (2015) Off-target Effects in CRISPR/Cas9-mediated 1227 Genome Engineering. Mol Ther Nucleic Acids 4: e264 1228
Zhang Y, Massel K, Godwin ID, Gao C (2018) Applications and potential of genome editing in crop 1229 improvement. Genome Biology 19: 210 1230
Zhang Z, Mao L, Chen H, Bu F, Li G, Sun J, Li S, Sun H, Jiao C, Blakely R, Pan J, Cai R, Luo R, Van de Peer 1231 Y, Jacobsen E, Fei Z, Huang S (2015) Genome-Wide Mapping of Structural Variations Reveals a 1232 Copy Number Variant That Determines Reproductive Morphology in Cucumber. The Plant Cell 1233 27: 1595-1604 1234
Zhao H, Wolt JD (2017) Risk associated with off-target plant genome editing and methods for its 1235 limitation. Emerging Topics in Life Sciences 1: 231-240 1236
Zhao Q, Feng Q, Lu H, Li Y, Wang A, Tian Q, Zhan Q, Lu Y, Zhang L, Huang T, Wang Y, Fan D, Zhao Y, 1237 Wang Z, Zhou C, Chen J, Zhu C, Li W, Weng Q, Xu Q, Wang ZX, Wei X, Han B, Huang X (2018) 1238 Pan-genome analysis highlights the extent of genomic variation in cultivated and wild rice. Nat 1239 Genet 50: 278-284 1240
Zischewski J, Fischer R, Bortesi L (2017) Detection of on-target and off-target mutations generated by 1241 CRISPR/Cas9 and other sequence-specific nucleases. Biotechnol Adv 35: 95-104 1242
Zohary D (1999) Monophyletic vs. polyphyletic origin of the crops on which agriculture was founded in 1243 the Near East. Genetic Resources and Crop Evolution 46: 133-142 1244
Zuo E, Sun Y, Wei W, Yuan T, Ying W, Sun H, Yuan L, Steinmetz LM, Li Y, Yang H (2019) Cytosine base 1245 editor generates substantial off-target single-nucleotide variants in mouse embryos. Science 1246 364: 289-292 1247
1248
www.plantphysiol.orgon August 23, 2020 - Published by Downloaded from Copyright © 2020 American Society of Plant Biologists. All rights reserved.
ADVANCES
• The importance and potential impact of “off-target” genetic changes during genome editing are subjects of ongoing debate.
• Recent studies have demonstrated that with appropriate design of genome editing reagents, off-target edits in plants are nearly undetectable.
• Off-target edits with base editing proteins can be minimized through optimization of the base-editing enzyme domain.
www.plantphysiol.orgon August 23, 2020 - Published by Downloaded from Copyright © 2020 American Society of Plant Biologists. All rights reserved.
OUTSTANDING QUESTIONS
• What additional technical and non-technical roadblocks will need to be overcome to facilitate further research and commercial use of plant genome editing tools?
• As new genome editing tools and more facile reagent delivery methods are developed, what is an appropriate level of evaluation for potential off-target activity in plants?
• How can the plant science community effectively convey to society at large the relevance of potential off-target genomic changes when placed in the context of highly variable and dynamic plant genomes?
www.plantphysiol.orgon August 23, 2020 - Published by Downloaded from Copyright © 2020 American Society of Plant Biologists. All rights reserved.
BOX 1. The Importance of Double-Strand Break Repairs Double-strand breaks (DSB) in DNA occur as a part of routine biological functions in all organisms (Pacher and Puchta, 2017). DNA DSB repair is crucial to many ordinary cellular functions such as DNA replication, homologous recombination, and in response to transposon replication and movement (Puchta, 2005; Schuermann et al., 2005; Waterworth et al., 2011). DSBs also occur during the seed dormancy process and subsequent seed germination is dependent on the effective repair of DSBs (Waterworth et al., 2010; Waterworth et al., 2011; Waterworth et al., 2016). Mutagenesis (including radiation-based techniques such as fast-neutron mutagenesis) and genome editing with SDNs generate DSBs (Friedberg et al., 2006; Voytas, 2013) which are repaired by endogenous repair mechanisms. Regardless of their origin, DSB in a somatic plant cell typically initiate break repair by one of two primary mechanisms; NHEJ or homology-dependent repair (HDR) (Pacher and Puchta, 2017). NHEJ is the predominant repair mechanism in plant somatic cells, accounting
for nearly all repair events (Puchta, 2005). Repair typically results in restoration of the original sequence, but small (typically 1-20 base pair (bp)) insertions or deletions (indels) also occur (Waterworth et al., 2011; Brunet and Jasin, 2018). It has been recently shown in plants that only 15% of DSBs generated by CRISPR-Cas9 are repaired imperfectly, leading to mutations (Čermák et al., 2017). HDR in plant somatic cells is rare (Knoll et al., 2014) but is of critical importance during meiosis leading to recombination between intact homologous regions. Sequences used as templates in HDR can be allelic (from homologous chromosomes), ectopic (from non-homologous chromosomes), or intrachromosomal (from the same chromosome) (Puchta, 2005). Homologous and non-homologous recombination following DSB repair contributes to genomic rearrangements and has allowed the introgression of many beneficial traits from crop wild relatives into modern cultivars by conventional cross-breeding (Gaut et al., 2007; Hajjar and Hodgkin, 2007).
www.plantphysiol.orgon August 23, 2020 - Published by Downloaded from Copyright © 2020 American Society of Plant Biologists. All rights reserved.
7,000,000
4,000,000
170,000 ~3,000~6
X Self X S. pennelli X S. pimpin-ellifolium
X cv. SanMarzano
EMS Genome Editing
1
Target Sequence
Genomic DNA Cas9
Guide RNA
PAM
H3C
O
S OO
CH3
I I
I I
Appr
oxim
ate N
umbe
r of
SNPs
Crossing Plants Treat in Lab
Random, Unknown and Uncharacterized Genetic Changes Precise Change www.plantphysiol.orgon August 23, 2020 - Published by Downloaded from
Copyright © 2020 American Society of Plant Biologists. All rights reserved.
0
100
200
300
400
500
600
700
800No
. of m
utan
t var
ieties
Direct use of an induced mutant
Breeding material
www.plantphysiol.orgon August 23, 2020 - Published by Downloaded from Copyright © 2020 American Society of Plant Biologists. All rights reserved.
Reference genome
Inherent Variation (genotype X)
Inherent Variation (genotype Y)
Mutation breeding (chemical)
Mutation breeding (irradiation)
Genome Editing (SDN)
GOI
Gene SNP Small InDel Space between genes Large deletion Transposons GOI: Gene of Interest www.plantphysiol.orgon August 23, 2020 - Published by Downloaded from Copyright © 2020 American Society of Plant Biologists. All rights reserved.
Fokl
Fokl
5 ` -ACGTAGCGTCATCGCCACTAGCGTATGATCGTACTGTGCAGTTGTGGTTTGTCTACCGTA3 ` -TGCATCGCAGTAGCGGTGATCGCATACTAGCATCAGACGTCAACACCAAACAGATGGCAT
Fokl
HD NI NG HD NN HD HD NI HD NG NI NN HD NN NGRepeat Variable Di-residues
Target DNA
DNA-binding domain nuclease
C A T C G C C A C T A G C G T
A. TAL effector nucleases (TALENs)
Fokl
5 ` -CGCCACTAGCGTATGATCGTACTGTGCAGTTGTGGTTTG3 ` -CGCGTGATCGCATACTAGCATCAGACGTCAACACCAAAC
DNA-binding domainnuclease
B. Zinc-finger nucleases (ZFN)Fokl
C. Clustered Regularly-Interspaced Short Palindromic Repeats (CRISPR) Associated Protein 9 (Cas9)
5 ` -ACGTAGCGT
5 `-CATCGCCACTAGCGTATGAT
CATCGCCACTAGCGTATGAT
GTAGCGGTGATCGCATACTA3 ` -TGCATCGCA
CGGACTG- 3´GCCTCAG- 5´
-3´
Cas9 nuclease
Proto-spacer Adjacent Motif (PAM)
sgRNA proto-spacersequence
sgRNA
www.plantphysiol.orgon August 23, 2020 - Published by Downloaded from Copyright © 2020 American Society of Plant Biologists. All rights reserved.
Introduction of genetic variation for crop improvement
Conventional breeding Genome editingChemical/radiation mutagenesis
Nucleotidepolymorphisms
Gene content polymorphisms
Chromosomalchanges
SNPs Indels CNV/PAV Deletions Duplications InversionsTranslocations
Selection & testing• Removal of off-types• Phenotypic characteristics• Performance attributes• Processing features• End-user attributes
Genotyping & Inbreeding Small-scale field trials
Large-scale field trials
Crosses & multi-year, multi-location field trials
Commercial release
www.plantphysiol.orgon August 23, 2020 - Published by Downloaded from Copyright © 2020 American Society of Plant Biologists. All rights reserved.
Parsed CitationsAdli M (2018) The CRISPR tool kit for genome editing and beyond. Nature Communications 9: 1911
Pubmed: Author and TitleGoogle Scholar: Author Only Title Only Author and Title
Aflitos S, Schijlen E, de Jong H, de Ridder D, Smit S, Finkers R, Wang J, Zhang G, Li N, Mao L, Bakker F, Dirks R, Breit T, GravendeelB, Huits H, Struss D, Swanson-Wagner R, van Leeuwen H, van Ham RC, Fito L, Guignier L, Sevilla M, Ellul P, Ganko E, Kapur A, ReclusE, de Geus B, van de Geest H, Te Lintel Hekkert B, van Haarst J, Smits L, Koops A, Sanchez-Perez G, van Heusden AW, Visser R,Quan Z, Min J, Liao L, Wang X, Wang G, Yue Z, Yang X, Xu N, Schranz E, Smets E, Vos R, Rauwerda J, Ursem R, Schuit C, Kerns M, vanden Berg J, Vriezen W, Janssen A, Datema E, Jahrman T, Moquet F, Bonnet J, Peters S (2014) Exploring genetic variation in the tomato(Solanum section Lycopersicon) clade by whole-genome sequencing. Plant J 80: 136-148
Pubmed: Author and TitleGoogle Scholar: Author Only Title Only Author and Title
Aguilar-Meléndez A, Morrell PL, Roose ML, Kim S-C (2009) Genetic diversity and structure in semiwild and domesticated chiles(Capsicum annuum; Solanaceae) from Mexico. American Journal of Botany 96: 1190-1202
Pubmed: Author and TitleGoogle Scholar: Author Only Title Only Author and Title
Ahloowalia B, Maluszynski M, Nichterlein K (2004) Global impact of mutation-derived varieties. Euphytica 135: 187-204Pubmed: Author and TitleGoogle Scholar: Author Only Title Only Author and Title
Akcakaya P, Bobbin ML, Guo JA, Malagon-Lopez J, Clement K, Garcia SP, Fellows MD, Porritt MJ, Firth MA, Carreras A, Baccega T,Seeliger F, Bjursell M, Tsai SQ, Nguyen NT, Nitsch R, Mayr LM, Pinello L, Bohlooly-Y M, Aryee MJ, Maresca M, Joung JK (2018) In vivoCRISPR editing with no detectable genome-wide off-target mutations. Nature 561: 416-419
Pubmed: Author and TitleGoogle Scholar: Author Only Title Only Author and Title
Anderson JE, Michno J-M, Kono TJ, Stec AO, Campbell BW, Curtin SJ, Stupar RM (2016) Genomic variation and DNA repair associatedwith soybean transgenesis: a comparison to cultivars and mutagenized plants. BMC biotechnology 16: 41
Pubmed: Author and TitleGoogle Scholar: Author Only Title Only Author and Title
Anderson SN, Stitzer MC, Brohammer AB, Zhou P, Noshay JM, O'Connor CH, Hirsch CD, Ross-Ibarra J, Hirsch CN, Springer NM (2019)Transposable elements contribute to dynamic genome content in maize. The Plant Journal 100: 1052-1065
Pubmed: Author and TitleGoogle Scholar: Author Only Title Only Author and Title
Andersson M, Turesson H, Olsson N, Fält A-S, Ohlsson P, Gonzalez MN, Samuelsson M, Hofvander P (2018) Genome editing in potatovia CRISPR-Cas9 ribonucleoprotein delivery. Physiologia Plantarum 164: 378-384
Pubmed: Author and TitleGoogle Scholar: Author Only Title Only Author and Title
Anzalone AV, Randolph PB, Davis JR, Sousa AA, Koblan LW, Levy JM, Chen PJ, Wilson C, Newby GA, Raguram A, Liu DR (2019) Search-and-replace genome editing without double-strand breaks or donor DNA. Nature 576: 149-157
Pubmed: Author and TitleGoogle Scholar: Author Only Title Only Author and Title
Araki M, Ishii T (2016) Providing Appropriate Risk Information on Genome Editing for Patients. Trends Biotechnol 34: 86-90Pubmed: Author and TitleGoogle Scholar: Author Only Title Only Author and Title
Aslam U, Cheema HMN, Ahmad S, Khan IA, Malik W, Khan AA (2016) COTIP: Cotton TILLING Platform, a Resource for PlantImprovement and Reverse Genetic Studies. Frontiers in Plant Science 7
Pubmed: Author and TitleGoogle Scholar: Author Only Title Only Author and Title
ASTA (2016) Common practices of plant breeders. In. American Seed Trade Association, Alexandria, VAPubmed: Author and TitleGoogle Scholar: Author Only Title Only Author and Title
Bae S, Park J, Kim JS (2014) Cas-OFFinder: a fast and versatile algorithm that searches for potential off-target sites of Cas9 RNA-guided endonucleases. Bioinformatics 30: 1473-1475
Pubmed: Author and TitleGoogle Scholar: Author Only Title Only Author and Title
Bednarek PT, Orłowska R, Koebner RM, Zimny J (2007) Quantification of the tissue-culture induced variation in barley (Hordeumvulgare L.). BMC plant biology 7: 10
Pubmed: Author and TitleGoogle Scholar: Author Only Title Only Author and Title
Belfield EJ, Gan X, Mithani A, Brown C, Jiang C, Franklin K, Alvey E, Wibowo A, Jung M, Bailey K, Kalwani S, Ragoussis J, Mott R, www.plantphysiol.orgon August 23, 2020 - Published by Downloaded from Copyright © 2020 American Society of Plant Biologists. All rights reserved.
Harberd NP (2012) Genome-wide analysis of mutations in mutant lineages selected following fast-neutron irradiation mutagenesis ofArabidopsis thaliana. Genome Research 22: 1306-1315
Pubmed: Author and TitleGoogle Scholar: Author Only Title Only Author and Title
Bernardo R (2016) Bandwagons I, too, have known. Theoretical and Applied Genetics 129: 2323-2332Pubmed: Author and TitleGoogle Scholar: Author Only Title Only Author and Title
Bevan MW, Uauy C, Wulff BBH, Zhou J, Krasileva K, Clark MD (2017) Genomic innovation for crop improvement. Nature 543: 346-354Pubmed: Author and TitleGoogle Scholar: Author Only Title Only Author and Title
Bolon Y-T, Haun WJ, Xu WW, Grant D, Stacey MG, Nelson RT, Gerhardt DJ, Jeddeloh JA, Stacey G, Muehlbauer GJ, Orf JH, Naeve SL,Stupar RM, Vance CP (2011) Phenotypic and genomic analyses of a fast neutron mutant population resource in soybean. PlantPhysiology 156: 240-253
Pubmed: Author and TitleGoogle Scholar: Author Only Title Only Author and Title
Bolon Y-T, Stec AO, Michno J-M, Roessler J, Bhaskar PB, Ries L, Dobbels AA, Campbell BW, Young NP, Anderson JE, Grant DM, OrfJH, Naeve SL, Muehlbauer GJ, Vance CP, Stupar RM (2014) Genome Resilience and Prevalence of Segmental Duplications FollowingFast Neutron Irradiation of Soybean. Genetics 198: 967-981
Pubmed: Author and TitleGoogle Scholar: Author Only Title Only Author and Title
Brunet E, Jasin M (2018) Induction of Chromosomal Translocations with CRISPR-Cas9 and Other Nucleases: Understanding the RepairMechanisms That Give Rise to Translocations. In Y Zhang, ed, Chromosome Translocation. Springer Singapore, Singapore, pp 15-25
Pubmed: Author and TitleGoogle Scholar: Author Only Title Only Author and Title
Bukowski R, Sun Q, Romay MC, Buckler ES, Lai J, Yang B, He B, Wang B, Xu D, Zhang G, Xu X, Li Y, Rong Z, Guo X, Gao S, Lu Y, ZouC, Xie C, Xu Y, Fan L, Ware D, Jiao Y, Doebley JF, Lorant A, Ross-Ibarra J, Buffalo V (2017) Construction of the third-generation Zeamays haplotype map. GigaScience 7
Pubmed: Author and TitleGoogle Scholar: Author Only Title Only Author and Title
Carroll D (2011) Genome engineering with zinc-finger nucleases. Genetics 188: 773-782Pubmed: Author and TitleGoogle Scholar: Author Only Title Only Author and Title
Carroll D (2013) Staying on target with CRISPR-Cas. Nat Biotechnol 31: 807-809Pubmed: Author and TitleGoogle Scholar: Author Only Title Only Author and Title
Causse M, Desplat N, Pascual L, Le Paslier M-C, Sauvage C, Bauchet G, Bérard A, Bounon R, Tchoumakov M, Brunel D, Bouchet J-P(2013) Whole genome resequencing in tomato reveals variation associated with introgression and breeding events. BMC Genomics14: 791
Pubmed: Author and TitleGoogle Scholar: Author Only Title Only Author and Title
Čermák T, Curtin SJ, Gil-Humanes J, Čegan R, Kono TJY, Konečná E, Belanto JJ, Starker CG, Mathre JW, Greenstein RL, Voytas DF(2017) A Multipurpose Toolkit to Enable Advanced Genome Engineering in Plants. The Plant Cell 29: 1196-1217
Pubmed: Author and TitleGoogle Scholar: Author Only Title Only Author and Title
Char SN, Neelakandan AK, Nahampun H, Frame B, Main M, Spalding MH, Becraft PW, Meyers BC, Walbot V, Wang K, Yang B (2017) AnAgrobacterium-delivered CRISPR/Cas9 system for high-frequency targeted mutagenesis in maize. Plant Biotechnology Journal 15: 257-268
Pubmed: Author and TitleGoogle Scholar: Author Only Title Only Author and Title
Chen K, Wang Y, Zhang R, Zhang H, Gao C (2019) CRISPR/Cas Genome Editing and Precision Plant Breeding in Agriculture. AnnualReview of Plant Biology 70: 667-697
Pubmed: Author and TitleGoogle Scholar: Author Only Title Only Author and Title
Chen L, Li W, Katin-Grazzini L, Ding J, Gu X, Li Y, Gu T, Wang R, Lin X, Deng Z, McAvoy RJ, Gmitter FG, Deng Z, Zhao Y, Li Y (2018) Amethod for the production and expedient screening of CRISPR/Cas9-mediated non-transgenic mutant plants. Horticulture Research 5:13
Pubmed: Author and TitleGoogle Scholar: Author Only Title Only Author and Title
Cheng AW, Wang H, Yang H, Shi L, Katz Y, Theunissen TW, Rangarajan S, Shivalila CS, Dadon DB, Jaenisch R (2013) Multiplexedactivation of endogenous genes by CRISPR-on, an RNA-guided transcriptional activator system. Cell Research 23: 1163-1171
www.plantphysiol.orgon August 23, 2020 - Published by Downloaded from Copyright © 2020 American Society of Plant Biologists. All rights reserved.
Pubmed: Author and TitleGoogle Scholar: Author Only Title Only Author and Title
Cho SW, Kim S, Kim Y, Kweon J, Kim HS, Bae S, Kim J-S (2014) Analysis of off-target effects of CRISPR/Cas-derived RNA-guidedendonucleases and nickases. Genome research 24: 132-141
Pubmed: Author and TitleGoogle Scholar: Author Only Title Only Author and Title
Christian M, Cermak T, Doyle EL, Schmidt C, Zhang F, Hummel A, Bogdanove AJ, Voytas DF (2010) Targeting DNA double-strand breakswith TAL effector nucleases. Genetics 186: 757-761
Pubmed: Author and TitleGoogle Scholar: Author Only Title Only Author and Title
Church DM, Schneider VA, Steinberg KM, Schatz MC, Quinlan AR, Chin C-S, Kitts PA, Aken B, Marth GT, Hoffman MM, Herrero J,Mendoza MLZ, Durbin R, Flicek P (2015) Extending reference assembly models. Genome Biology 16: 13
Pubmed: Author and TitleGoogle Scholar: Author Only Title Only Author and Title
Clark KA, Krysan PJ (2010) Chromosomal translocations are a common phenomenon in Arabidopsis thaliana T-DNA insertion lines. ThePlant Journal 64: 990-1001
Pubmed: Author and TitleGoogle Scholar: Author Only Title Only Author and Title
Clegg MT, Morrell P (2004) Mutational Processes. In RM Goodman, ed, Encyclopedia of Plant and Crop Science. Marcel Dekker, NewYork, pp 760-762
Pubmed: Author and TitleGoogle Scholar: Author Only Title Only Author and Title
Cong L, Ran FA, Cox D, Lin S, Barretto R, Habib N, Hsu PD, Wu X, Jiang W, Marraffini LA, Zhang F (2013) Multiplex genome engineeringusing CRISPR/Cas systems. Science 339: 819-823
Pubmed: Author and TitleGoogle Scholar: Author Only Title Only Author and Title
Cook DE, Lee TG, Guo X, Melito S, Wang K, Bayless AM, Wang J, Hughes TJ, Willis DK, Clemente TE, Diers BW, Jiang J, Hudson ME,Bent AF (2012) Copy Number Variation of Multiple Genes at Rhg1 Mediates Nematode Resistance in Soybean. Science 338: 1206-1209
Pubmed: Author and TitleGoogle Scholar: Author Only Title Only Author and Title
Cox DBT, Platt RJ, Zhang F (2015) Therapeutic genome editing: prospects and challenges. Nature Medicine 21: 121-131Pubmed: Author and TitleGoogle Scholar: Author Only Title Only Author and Title
Danner E, Bashir S, Yumlu S, Wurst W, Wefers B, Kühn R (2017) Control of gene editing by manipulation of DNA repair mechanisms.Mammalian Genome 28: 262-274
Pubmed: Author and TitleGoogle Scholar: Author Only Title Only Author and Title
Deng W, Rupon Jeremy W, Krivega I, Breda L, Motta I, Jahn Kristen S, Reik A, Gregory Philip D, Rivella S, Dean A, Blobel Gerd A (2014)Reactivation of Developmentally Silenced Globin Genes by Forced Chromatin Looping. Cell 158: 849-860
Pubmed: Author and TitleGoogle Scholar: Author Only Title Only Author and Title
Doyle EL, Booher NJ, Standage DS, Voytas DF, Brendel VP, Vandyk JK, Bogdanove AJ (2012) TAL Effector-Nucleotide Targeter (TALE-NT) 2.0: tools for TAL effector design and target prediction. Nucleic Acids Res 40: W117-122
Pubmed: Author and TitleGoogle Scholar: Author Only Title Only Author and Title
Dubin MJ, Mittelsten Scheid O, Becker C (2018) Transposons: a blessing curse. Curr Opin Plant Biol 42: 23-29Pubmed: Author and TitleGoogle Scholar: Author Only Title Only Author and Title
Ercolano MR, Sacco A, Ferriello F, D'Alessandro R, Tononi P, Traini A, Barone A, Zago E, Chiusano ML, Buson G, Delledonne M,Frusciante L (2014) Patchwork sequencing of tomato San Marzano and Vesuviano varieties highlights genome-wide variations. BMCGenomics 15: 138
Pubmed: Author and TitleGoogle Scholar: Author Only Title Only Author and Title
Feng Z, Mao Y, Xu N, Zhang B, Wei P, Yang DL, Wang Z, Zhang Z, Zheng R, Yang L, Zeng L, Liu X, Zhu JK (2014) Multigenerationanalysis reveals the inheritance, specificity, and patterns of CRISPR/Cas-induced gene modifications in Arabidopsis. Proc Natl AcadSci U S A 111: 4632-4637
Pubmed: Author and TitleGoogle Scholar: Author Only Title Only Author and Title
Filler Hayut S, Melamed Bessudo C, Levy AA (2017) Targeted recombination between homologous chromosomes for precise breedingin tomato. Nature Communications 8: 15605 www.plantphysiol.orgon August 23, 2020 - Published by Downloaded from
Copyright © 2020 American Society of Plant Biologists. All rights reserved.
Pubmed: Author and TitleGoogle Scholar: Author Only Title Only Author and Title
Fine EJ, Cradick TJ, Zhao CL, Lin Y, Bao G (2014) An online bioinformatics tool predicts zinc finger and TALE nuclease off-targetcleavage. Nucleic Acids Res 42: e42
Pubmed: Author and TitleGoogle Scholar: Author Only Title Only Author and Title
Food and Drug Administration (1992) Food for human consumption and animal drugs, feeds, and related products: foods derived fromnew plant varieties; policy statement, 22984. In FDA Federal Register, Department of Health and Human Services, Vol 57, p 22984
Pubmed: Author and TitleGoogle Scholar: Author Only Title Only Author and Title
Foolad MR (2007) Genome mapping and molecular breeding of tomato. International journal of plant genomics 2007: 64358-64358Pubmed: Author and TitleGoogle Scholar: Author Only Title Only Author and Title
Fossi M, Amundson K, Kuppu S, Britt A, Comai L (2019) Regeneration of Solanum tuberosum Plants from Protoplasts InducesWidespread Genome Instability. Plant Physiology 180: 78-86
Pubmed: Author and TitleGoogle Scholar: Author Only Title Only Author and Title
Friedberg EC, Walker GC, Siede W, Wood RD, Schultz RA, T. E (2006) DNA repair and mutagenesis, Ed 2. ASM Press, Washington, DCPubmed: Author and TitleGoogle Scholar: Author Only Title Only Author and Title
Frock RL, Hu J, Meyers RM, Ho YJ, Kii E, Alt FW (2015) Genome-wide detection of DNA double-stranded breaks induced by engineerednucleases. Nat Biotechnol 33: 179-186
Pubmed: Author and TitleGoogle Scholar: Author Only Title Only Author and Title
Fu Y, Foden JA, Khayter C, Maeder ML, Reyon D, Joung JK, Sander JD (2013) High-frequency off-target mutagenesis induced byCRISPR-Cas nucleases in human cells. Nat Biotechnol 31: 822-826
Pubmed: Author and TitleGoogle Scholar: Author Only Title Only Author and Title
Fuentes RR, Chebotarov D, Duitama J, Smith S, De la Hoz JF, Mohiyuddin M, Wing RA, McNally KL, Tatarinova T, Grigoriev A, MauleonR, Alexandrov N (2019) Structural variants in 3000 rice genomes. Genome research 29: 870-880
Pubmed: Author and TitleGoogle Scholar: Author Only Title Only Author and Title
Gabur I, Chawla HS, Snowdon RJ, Parkin IAP (2019) Connecting genome structural variation with complex traits in crop plants.Theoretical and Applied Genetics 132: 733-750
Pubmed: Author and TitleGoogle Scholar: Author Only Title Only Author and Title
Gaj T, Gersbach CA, Barbas CF (2013) ZFN, TALEN, and CRISPR/Cas-based methods for genome engineering. Trends inBiotechnology 31: 397-405
Pubmed: Author and TitleGoogle Scholar: Author Only Title Only Author and Title
Gao X, Chen J, Dai X, Zhang D, Zhao Y (2016) An Effective Strategy for Reliably Isolating Heritable and Cas9-Free Arabidopsis MutantsGenerated by CRISPR/Cas9-Mediated Genome Editing. Plant Physiology 171: 1794-1800
Pubmed: Author and TitleGoogle Scholar: Author Only Title Only Author and Title
Gaudelli NM, Komor AC, Rees HA, Packer MS, Badran AH, Bryson DI, Liu DR (2017) Programmable base editing of A•T to G•C ingenomic DNA without DNA cleavage. Nature 551: 464-471
Pubmed: Author and TitleGoogle Scholar: Author Only Title Only Author and Title
Gaut BS, Morton BR, McCaig BC, Clegg MT (1996) Substitution rate comparisons between grasses and palms: synonymous ratedifferences at the nuclear gene Adh parallel rate differences at the plastid gene rbcL. Proceedings of the National Academy ofSciences 93: 10274-10279
Pubmed: Author and TitleGoogle Scholar: Author Only Title Only Author and Title
Gaut BS, Wright SI, Rizzon C, Dvorak J, Anderson LK (2007) Recombination: an underappreciated factor in the evolution of plantgenomes. Nat Rev Genet 8: 77-84
Pubmed: Author and TitleGoogle Scholar: Author Only Title Only Author and Title
Gilad Y, Pritchard JK, Thornton K (2009) Characterizing natural variation using next-generation sequencing technologies. Trends inGenetics 25: 463-471
Pubmed: Author and Title www.plantphysiol.orgon August 23, 2020 - Published by Downloaded from Copyright © 2020 American Society of Plant Biologists. All rights reserved.
Google Scholar: Author Only Title Only Author and Title
Glenn KC, Alsop B, Bell E, Goley M, Jenkinson J, Liu B, Martin C, Parrott W, Souder C, Sparks O, Urquhart W, Ward JM, Vicini JL (2017)Bringing New Plant Varieties to Market: Plant Breeding and Selection Practices Advance Beneficial Characteristics while MinimizingUnintended Changes. Crop Science 57: 2906-2921
Pubmed: Author and TitleGoogle Scholar: Author Only Title Only Author and Title
Globus R, Qimron U (2018) A technological and regulatory outlook on CRISPR crop editing. Journal of Cellular Biochemistry 119: 1291-1298
Pubmed: Author and TitleGoogle Scholar: Author Only Title Only Author and Title
Golicz AA, Bayer PE, Barker GC, Edger PP, Kim H, Martinez PA, Chan CKK, Severn-Ellis A, McCombie WR, Parkin IAP, Paterson AH,Pires JC, Sharpe AG, Tang H, Teakle GR, Town CD, Batley J, Edwards D (2016) The pangenome of an agronomically important cropplant Brassica oleracea. Nature Communications 7: 13390
Pubmed: Author and TitleGoogle Scholar: Author Only Title Only Author and Title
Gore MA, Chia J-M, Elshire RJ, Sun Q, Ersoz ES, Hurwitz BL, Peiffer JA, McMullen MD, Grills GS, Ross-Ibarra J, Ware DH, Buckler ES(2009) A First-Generation Haplotype Map of Maize. Science 326: 1115-1117
Pubmed: Author and TitleGoogle Scholar: Author Only Title Only Author and Title
Hahn F, Nekrasov V (2018) CRISPR/Cas precision: do we need to worry about off-targeting in plants? Plant Cell Reports 38: 437-441Pubmed: Author and TitleGoogle Scholar: Author Only Title Only Author and Title
Hajjar R, Hodgkin T (2007) The use of wild relatives in crop improvement: a survey of developments over the last 20 years. Euphytica156: 1-13
Pubmed: Author and TitleGoogle Scholar: Author Only Title Only Author and Title
Harris RS, Petersen-Mahrt SK, Neuberger MS (2002) RNA Editing Enzyme APOBEC1 and Some of Its Homologs Can Act as DNAMutators. Molecular Cell 10: 1247-1253
Pubmed: Author and TitleGoogle Scholar: Author Only Title Only Author and Title
Henry IM, Nagalakshmi U, Lieberman MC, Ngo KJ, Krasileva KV, Vasquez-Gross H, Akhunova A, Akhunov E, Dubcovsky J, Tai TH,Comai L (2014) Efficient genome-wide detection and cataloging of EMS-induced mutations using exome capture and next-generationsequencing. The Plant Cell 26: 1382-1397
Pubmed: Author and TitleGoogle Scholar: Author Only Title Only Author and Title
Hirsch CN, Hirsch CD, Brohammer AB, Bowman MJ, Soifer I, Barad O, Shem-Tov D, Baruch K, Lu F, Hernandez AG, Fields CJ, WrightCL, Koehler K, Springer NM, Buckler E, Buell CR, de Leon N, Kaeppler SM, Childs KL, Mikel MA (2016) Draft Assembly of Elite InbredLine PH207 Provides Insights into Genomic and Transcriptome Diversity in Maize. The Plant Cell 28: 2700-2714
Pubmed: Author and TitleGoogle Scholar: Author Only Title Only Author and Title
Hu Y, Chen Z, Zhuang C, Huang J (2017) Cascade of chromosomal rearrangements caused by a heterogeneous T-DNA integrationsupports the double-stranded break repair model for T-DNA integration. The Plant Journal 90: 954-965
Pubmed: Author and TitleGoogle Scholar: Author Only Title Only Author and Title
Huang X, Han B (2014) Natural Variations and Genome-Wide Association Studies in Crop Plants. Annual Review of Plant Biology 65:531-551
Pubmed: Author and TitleGoogle Scholar: Author Only Title Only Author and Title
Hufford MB, Xu X, van Heerwaarden J, Pyhäjärvi T, Chia J-M, Cartwright RA, Elshire RJ, Glaubitz JC, Guill KE, Kaeppler SM, Lai J,Morrell PL, Shannon LM, Song C, Springer NM, Swanson-Wagner RA, Tiffin P, Wang J, Zhang G, Doebley J, McMullen MD, Ware D,Buckler ES, Yang S, Ross-Ibarra J (2012) Comparative population genomics of maize domestication and improvement. Nature Genetics44: 808-811
Pubmed: Author and TitleGoogle Scholar: Author Only Title Only Author and Title
Hussain M, Iqbal MA, Till BJ (2018) Identification of induced mutations in hexaploid wheat genome using exome capture assay. PloSOne 13: e0201918
Pubmed: Author and TitleGoogle Scholar: Author Only Title Only Author and Title
Ibiza VP, Cañizares J, Nuez F (2010) EcoTILLING in Capsicum species: searching for new virus resistances. BMC genomics 11: 631Pubmed: Author and TitleGoogle Scholar: Author Only Title Only Author and Title www.plantphysiol.orgon August 23, 2020 - Published by Downloaded from
Copyright © 2020 American Society of Plant Biologists. All rights reserved.
Google Scholar: Author Only Title Only Author and Title
Innan H, Tajima F, Terauchi R, Miyashita NT (1996) Intragenic Recombination in the Adh Locus of the Wild Plant Arabidopsis thaliana.Genetics 143: 1761-1770
Pubmed: Author and TitleGoogle Scholar: Author Only Title Only Author and Title
Jaganathan D, Ramasamy K, Sellamuthu G, Jayabalan S, Venkataraman G (2018) CRISPR for Crop Improvement: An Update Review.Frontiers in Plant Science 9: 985
Pubmed: Author and TitleGoogle Scholar: Author Only Title Only Author and Title
Jiang C, Mithani A, Belfield EJ, Mott R, Hurst LD, Harberd NP (2014) Environmentally responsive genome-wide accumulation of denovo Arabidopsis thaliana mutations and epimutations. Genome research 24: 1821-1829
Pubmed: Author and TitleGoogle Scholar: Author Only Title Only Author and Title
Jiang C, Mithani A, Gan X, Belfield EJ, Klingler JP, Zhu J-K, Ragoussis J, Mott R, Harberd NP (2011) Regenerant Arabidopsis lineagesdisplay a distinct genome-wide spectrum of mutations conferring variant phenotypes. Current Biology 21: 1385-1390
Pubmed: Author and TitleGoogle Scholar: Author Only Title Only Author and Title
Jiang F, Doudna JA (2017) CRISPR–Cas9 Structures and Mechanisms. Annual Review of Biophysics 46: 505-529Pubmed: Author and TitleGoogle Scholar: Author Only Title Only Author and Title
Jiao Y, Burke JJ, Chopra R, Burow G, Chen J, Wang B, Hayes C, Emendack Y, Ware D, Xin Z (2016) A sorghum mutant resource as anefficient platform for gene discovery in grasses. The Plant Cell 28: 1551-1562
Pubmed: Author and TitleGoogle Scholar: Author Only Title Only Author and Title
Jiao Y, Peluso P, Shi J, Liang T, Stitzer MC, Wang B, Campbell MS, Stein JC, Wei X, Chin C-S, Guill K, Regulski M, Kumari S, Olson A,Gent J, Schneider KL, Wolfgruber TK, May MR, Springer NM, Antoniou E, McCombie WR, Presting GG, McMullen M, Ross-Ibarra J,Dawe RK, Hastie A, Rank DR, Ware D (2017) Improved maize reference genome with single-molecule technologies. Nature 546: 524
Pubmed: Author and TitleGoogle Scholar: Author Only Title Only Author and Title
Jin S, Zong Y, Gao Q, Zhu Z, Wang Y, Qin P, Liang C, Wang D, Qiu J-L, Zhang F, Gao C (2019) Cytosine, but not adenine, base editorsinduce genome-wide off-target mutations in rice. Science 364: 292-295
Pubmed: Author and TitleGoogle Scholar: Author Only Title Only Author and Title
Jinek M, Chylinski K, Fonfara I, Hauer M, Doudna JA, Charpentier E (2012) A programmable dual-RNA-guided DNA endonuclease inadaptive bacterial immunity. Science 337: 816-821
Pubmed: Author and TitleGoogle Scholar: Author Only Title Only Author and Title
Jo YD, Kim J-B (2019) Frequency and Spectrum of Radiation-Induced Mutations Revealed by Whole-Genome Sequencing Analyses ofPlants. Quantum Beam Science 3: 7
Pubmed: Author and TitleGoogle Scholar: Author Only Title Only Author and Title
Just D, Garcia V, Fernandez L, Bres C, Mauxion J-P, Petit J, Jorly J, Assali J, Bournonville C, Ferrand C (2013) Micro-Tom mutants forfunctional analysis of target genes and discovery of new alleles in tomato. Plant Biotechnology 30: 225-231
Pubmed: Author and TitleGoogle Scholar: Author Only Title Only Author and Title
Kaiser N, Douches D, Dhingra A, Glenn KC, Herzig PR, Stowe EC, Swarup S (2020) The role of conventional plant breeding in ensuringsafe levels of naturally occurring toxins in food crops. Trends in Food Science & Technology 100: 51-66
Pubmed: Author and TitleGoogle Scholar: Author Only Title Only Author and Title
Kaity A, Ashmore S, Drew R (2009) Field performance evaluation and genetic integrity assessment of cryopreserved papaya clones.Plant Cell Reports 28: 1421-1430
Pubmed: Author and TitleGoogle Scholar: Author Only Title Only Author and Title
Kearns NA, Pham H, Tabak B, Genga RM, Silverstein NJ, Garber M, Maehr R (2015) Functional annotation of native enhancers with aCas9–histone demethylase fusion. Nature Methods 12: 401-403
Pubmed: Author and TitleGoogle Scholar: Author Only Title Only Author and Title
Kelliher T, Starr D, Su X, Tang G, Chen Z, Carter J, Wittich PE, Dong S, Green J, Burch E, McCuiston J, Gu W, Sun Y, Strebe T,Roberts J, Bate NJ, Que Q (2019) One-step genome editing of elite crop germplasm during haploid induction. Nature Biotechnology37: 287-292
www.plantphysiol.orgon August 23, 2020 - Published by Downloaded from Copyright © 2020 American Society of Plant Biologists. All rights reserved.
Pubmed: Author and TitleGoogle Scholar: Author Only Title Only Author and Title
Kharkwal M, Pandey R, Pawar S (2004) Mutation breeding for crop improvement. In Plant Breeding. Springer, pp 601-645Pubmed: Author and TitleGoogle Scholar: Author Only Title Only Author and Title
Kim H, Kim ST, Ryu J, Kang BC, Kim JS, Kim SG (2017) CRISPR/Cpf1-mediated DNA-free plant genome editing. Nat Commun 8: 14406Pubmed: Author and TitleGoogle Scholar: Author Only Title Only Author and Title
Knoll A, Fauser F, Puchta H (2014) DNA recombination in somatic plant cells: mechanisms and evolutionary consequences.Chromosome Research 22: 191-201
Pubmed: Author and TitleGoogle Scholar: Author Only Title Only Author and Title
Komor AC, Kim YB, Packer MS, Zuris JA, Liu DR (2016) Programmable editing of a target base in genomic DNA without double-strandedDNA cleavage. Nature 533: 420-424
Pubmed: Author and TitleGoogle Scholar: Author Only Title Only Author and Title
Kosicki M, Tomberg K, Bradley A (2018) Repair of double-strand breaks induced by CRISPR–Cas9 leads to large deletions andcomplex rearrangements. Nature Biotechnology 36: 765
Pubmed: Author and TitleGoogle Scholar: Author Only Title Only Author and Title
Krasileva KV, Vasquez-Gross HA, Howell T, Bailey P, Paraiso F, Clissold L, Simmonds J, Ramirez-Gonzalez RH, Wang X, Borrill P (2017)Uncovering hidden variation in polyploid wheat. Proceedings of the National Academy of Sciences 114: E913-E921
Pubmed: Author and TitleGoogle Scholar: Author Only Title Only Author and Title
Krishna H, Alizadeh M, Singh D, Singh U, Chauhan N, Eftekhari M, Sadh RK (2016) Somaclonal variations and their applications inhorticultural crops improvement. 3 Biotech 6: 54
Pubmed: Author and TitleGoogle Scholar: Author Only Title Only Author and Title
Lee CM, Cradick TJ, Fine EJ, Bao G (2016) Nuclease Target Site Selection for Maximizing On-target Activity and Minimizing Off-targetEffects in Genome Editing. Molecular Therapy 24: 475-487
Pubmed: Author and TitleGoogle Scholar: Author Only Title Only Author and Title
Lee JK, Jeong E, Lee J, Jung M, Shin E, Kim Y-h, Lee K, Jung I, Kim D, Kim S, Kim J-S (2018) Directed evolution of CRISPR-Cas9 toincrease its specificity. Nature Communications 9: 3048
Pubmed: Author and TitleGoogle Scholar: Author Only Title Only Author and Title
Lee K, Zhang Y, Kleinstiver BP, Guo JA, Aryee MJ, Miller J, Malzahn A, Zarecor S, Lawrence-Dill CJ, Joung JK, Qi Y, Wang K (2019)Activities and specificities of CRISPR/Cas9 and Cas12a nucleases for targeted mutagenesis in maize. Plant Biotechnology Journal 17:362-372
Pubmed: Author and TitleGoogle Scholar: Author Only Title Only Author and Title
Li G, Jain R, Chern M, Pham NT, Martin JA, Wei T, Schackwitz WS, Lipzen AM, Duong PQ, Jones KC, Jiang L, Ruan D, Bauer D, Peng Y,Barry KW, Schmutz J, Ronald PC (2017) The Sequences of 1504 Mutants in the Model Rice Variety Kitaake Facilitate Rapid FunctionalGenomic Studies. The Plant Cell 29: 1218-1231
Pubmed: Author and TitleGoogle Scholar: Author Only Title Only Author and Title
Li J, Manghwar H, Sun L, Wang P, Wang G, Sheng H, Zhang J, Liu H, Qin L, Rui H, Li B, Lindsey K, Daniell H, Jin S, Zhang X (2019)Whole genome sequencing reveals rare off-target mutations and considerable inherent genetic or/and somaclonal variations inCRISPR/Cas9-edited cotton plants. Plant Biotechnology Journal 17: 858-868
Pubmed: Author and TitleGoogle Scholar: Author Only Title Only Author and Title
Li S, Zheng Y-c, Cui H-r, Fu H-w, Shu Q-y, Huang J-z (2016) Frequency and type of inheritable mutations induced by γ rays in rice asrevealed by whole genome sequencing. Journal of Zhejiang University-SCIENCE B 17: 905-915
Pubmed: Author and TitleGoogle Scholar: Author Only Title Only Author and Title
Li YH, Zhou G, Ma J, Jiang W, Jin LG, Zhang Z, Guo Y, Zhang J, Sui Y, Zheng L, Zhang SS, Zuo Q, Shi XH, Li YF, Zhang WK, Hu Y, KongG, Hong HL, Tan B, Song J, Liu ZX, Wang Y, Ruan H, Yeung CK, Liu J, Wang H, Zhang LJ, Guan RX, Wang KJ, Li WB, Chen SY, ChangRZ, Jiang Z, Jackson SA, Li R, Qiu LJ (2014) De novo assembly of soybean wild relatives for pan-genome analysis of diversity andagronomic traits. Nat Biotechnol 32: 1045-1052
Pubmed: Author and TitleGoogle Scholar: Author Only Title Only Author and Title www.plantphysiol.orgon August 23, 2020 - Published by Downloaded from
Copyright © 2020 American Society of Plant Biologists. All rights reserved.
Li Z, Liu ZB, Xing A, Moon BP, Koellhoffer JP, Huang L, Ward RT, Clifton E, Falco SC, Cigan AM (2015) Cas9-Guide RNA DirectedGenome Editing in Soybean. Plant Physiology 169: 960-970
Pubmed: Author and TitleGoogle Scholar: Author Only Title Only Author and Title
Lisch D (2012) How important are transposons for plant evolution? Nature Reviews Genetics 14: 49-61Pubmed: Author and TitleGoogle Scholar: Author Only Title Only Author and Title
Listgarten J, Weinstein M, Kleinstiver BP, Sousa AA, Joung JK, Crawford J, Gao K, Hoang L, Elibol M, Doench JG, Fusi N (2018)Prediction of off-target activities for the end-to-end design of CRISPR guide RNAs. Nature Biomedical Engineering 2: 38-47
Pubmed: Author and TitleGoogle Scholar: Author Only Title Only Author and Title
Liu H, Ding Y, Zhou Y, Jin W, Xie K, Chen L-L (2017) CRISPR-P 2.0: An Improved CRISPR-Cas9 Tool for Genome Editing in Plants.Molecular Plant 10: 530-532
Pubmed: Author and TitleGoogle Scholar: Author Only Title Only Author and Title
Liu Q, Zhou Y, Gaut BS, Morrell PL (2017) Deleterious Variants in Asian Rice and the Potential Cost of Domestication. MolecularBiology and Evolution 34: 908-924
Pubmed: Author and TitleGoogle Scholar: Author Only Title Only Author and Title
Lobaton JD, Miller T, Gil J, Ariza D, de la Hoz JF, Soler A, Beebe S, Duitama J, Gepts P, Raatz B (2018) Resequencing of Common BeanIdentifies Regions of Inter-Gene Pool Introgression and Provides Comprehensive Resources for Molecular Breeding. Plant Genome11
Pubmed: Author and TitleGoogle Scholar: Author Only Title Only Author and Title
Lu F, Romay MC, Glaubitz JC, Bradbury PJ, Elshire RJ, Wang T, Li Y, Li Y, Semagn K, Zhang X, Hernandez AG, Mikel MA, Soifer I, BaradO, Buckler ES (2015) High-resolution genetic mapping of maize pan-genome sequence anchors. Nature Communications 6: 6914
Pubmed: Author and TitleGoogle Scholar: Author Only Title Only Author and Title
Lu X, Liu J, Ren W, Yang Q, Chai Z, Chen R, Wang L, Zhao J, Lang Z, Wang H, Fan Y, Zhao J, Zhang C (2018) Gene-Indexed Mutations inMaize. Molecular Plant 11: 496-504
Pubmed: Author and TitleGoogle Scholar: Author Only Title Only Author and Title
Lusser M, Parisi C, Plan D, Rodriguez-Cerezo E (2012) Deployment of new biotechnologies in plant breeding. Nat Biotechnol 30: 231-239
Pubmed: Author and TitleGoogle Scholar: Author Only Title Only Author and Title
Machczyńska J, Zimny J, Bednarek PT (2015) Tissue culture-induced genetic and epigenetic variation in triticale (× Triticosecale spp.Wittmack ex A. Camus 1927) regenerants. Plant molecular biology 89: 279-292
Pubmed: Author and TitleGoogle Scholar: Author Only Title Only Author and Title
Maldonado dos Santos JV, Valliyodan B, Joshi T, Khan SM, Liu Y, Wang J, Vuong TD, Oliveira MFd, Marcelino-Guimarães FC, Xu D,Nguyen HT, Abdelnoor RV (2016) Evaluation of genetic variation among Brazilian soybean cultivars through genome resequencing.BMC Genomics 17: 110
Pubmed: Author and TitleGoogle Scholar: Author Only Title Only Author and Title
Mba C (2013) Induced mutations unleash the potentials of plant genetic resources for food and agriculture. Agronomy 3: 200-231Pubmed: Author and TitleGoogle Scholar: Author Only Title Only Author and Title
Michael TP, VanBuren R (2015) Progress, challenges and the future of crop genomes. Current Opinion in Plant Biology 24: 71-81Pubmed: Author and TitleGoogle Scholar: Author Only Title Only Author and Title
Michno JM, Stupar RM (2018) The importance of genotype identity, genetic heterogeneity, and bioinformatic handling for properlyassessing genomic variation in transgenic plants. BMC Biotechnol 18: 38
Pubmed: Author and TitleGoogle Scholar: Author Only Title Only Author and Title
Micke A, Donini B, Maluszynski M (1990) Induced mutations for crop improvement. In: Mutation Breeding Review, FAO/IAEA, No. 7. p.41. International Atomic Energy Agency, Vienna, Austria.
Pubmed: Author and TitleGoogle Scholar: Author Only Title Only Author and Title
www.plantphysiol.orgon August 23, 2020 - Published by Downloaded from Copyright © 2020 American Society of Plant Biologists. All rights reserved.
Minkenberg B, Zhang J, Xie K, Yang Y (2019) CRISPR-PLANT v2: an online resource for highly specific guide RNA spacers based onimproved off-target analysis. Plant Biotechnology Journal 17: 5-8
Pubmed: Author and TitleGoogle Scholar: Author Only Title Only Author and Title
Minoia S, Petrozza A, D'Onofrio O, Piron F, Mosca G, Sozio G, Cellini F, Bendahmane A, Carriero F (2010) A new mutant geneticresource for tomato crop improvement by TILLING technology. BMC Research Notes 3: 69
Pubmed: Author and TitleGoogle Scholar: Author Only Title Only Author and Title
Miyao A, Nakagome M, Ohnuma T, Yamagata H, Kanamori H, Katayose Y, Takahashi A, Matsumoto T, Hirochika H (2012) Molecularspectrum of somaclonal variation in regenerated rice revealed by whole-genome sequencing. Plant and Cell Physiology 53: 256-264
Pubmed: Author and TitleGoogle Scholar: Author Only Title Only Author and Title
Mohd-Yusoff N, Ruperao P, Tomoyoshi N, Edwards D, Gresshoff P, Biswas B, Batley J (2015) Scanning the effects of ethylmethanesulfonate on the whole genome of Lotus japonicus using secondgeneration sequencing analysis. G3 5: 559-567
Pubmed: Author and TitleGoogle Scholar: Author Only Title Only Author and Title
Moon SB, Kim DY, Ko J-H, Kim J-S, Kim Y-S (2019) Improving CRISPR Genome Editing by Engineering Guide RNAs. Trends inBiotechnology 37: 870-881
Pubmed: Author and TitleGoogle Scholar: Author Only Title Only Author and Title
Morgan SL, Mariano NC, Bermudez A, Arruda NL, Wu F, Luo Y, Shankar G, Jia L, Chen H, Hu J-F, Hoffman AR, Huang C-C, Pitteri SJ,Wang KC (2017) Manipulation of nuclear architecture through CRISPR-mediated chromosomal looping. Nature Communications 8:15993
Pubmed: Author and TitleGoogle Scholar: Author Only Title Only Author and Title
Morrell PL, Buckler ES, Ross-Ibarra J (2011) Crop genomics: advances and applications. Nature Reviews Genetics 13: 85-96Pubmed: Author and TitleGoogle Scholar: Author Only Title Only Author and Title
Morrell PL, Toleno DM, Lundy KE, Clegg MT (2006) Estimating the Contribution of Mutation, Recombination and Gene Conversion inthe Generation of Haplotypic Diversity. Genetics 173: 1705-1723
Pubmed: Author and TitleGoogle Scholar: Author Only Title Only Author and Title
Muñoz-Diez C, Vitte C, Ross-Ibarra J, Gaut BS, Tenaillon MI (2012) Using Nextgen Sequencing to Investigate Genome Size Variationand Transposable Element Content. In M-A Grandbastien, JM Casacuberta, eds, Plant Transposable Elements: Impact on GenomeStructure and Function. Springer Berlin Heidelberg, Berlin, Heidelberg, pp 41-58
Pubmed: Author and TitleGoogle Scholar: Author Only Title Only Author and Title
Muth J, Hartje S, Twyman RM, Hofferbert HR, Tacke E, Prüfer D (2008) Precision breeding for novel starch variants in potato. Plantbiotechnology journal 6: 576-584
Pubmed: Author and TitleGoogle Scholar: Author Only Title Only Author and Title
Nachman MW, Crowell SL (2000) Estimate of the Mutation Rate per Nucleotide in Humans. Genetics 156: 297-304Pubmed: Author and TitleGoogle Scholar: Author Only Title Only Author and Title
Neelakandan AK, Wang K (2012) Recent progress in the understanding of tissue culture-induced genome level changes in plants andpotential applications. Plant cell reports 31: 597-620
Pubmed: Author and TitleGoogle Scholar: Author Only Title Only Author and Title
Nisa M-U, Huang Y, Benhamed M, Raynaud C (2019) The Plant DNA Damage Response: Signaling Pathways Leading to GrowthInhibition and Putative Role in Response to Stress Conditions. Frontiers in Plant Science 10
Pubmed: Author and TitleGoogle Scholar: Author Only Title Only Author and Title
Ossowski S, Schneeberger K, Lucas-Lledo JI, Warthmann N, Clark RM, Shaw RG, Weigel D, Lynch M (2010) The rate and molecularspectrum of spontaneous mutations in Arabidopsis thaliana. Science 327: 92-94
Pubmed: Author and TitleGoogle Scholar: Author Only Title Only Author and Title
Pacher M, Puchta H (2017) From classical mutagenesis to nuclease-based breeding – directing natural DNA repair for a natural end-product. The Plant Journal 90: 819-833
Pubmed: Author and TitleGoogle Scholar: Author Only Title Only Author and Title
www.plantphysiol.orgon August 23, 2020 - Published by Downloaded from Copyright © 2020 American Society of Plant Biologists. All rights reserved.
Park SJ, Jiang K, Tal L, Yichie Y, Gar O, Zamir D, Eshed Y, Lippman ZB (2014) Optimization of crop productivity in tomato using inducedmutations in the florigen pathway. Nature Genetics 46: 1337
Pubmed: Author and TitleGoogle Scholar: Author Only Title Only Author and Title
Paten B, Novak AM, Eizenga JM, Garrison E (2017) Genome graphs and the evolution of genome inference. Genome Research 27: 665-676
Pubmed: Author and TitleGoogle Scholar: Author Only Title Only Author and Title
Pattanayak V, Ramirez CL, Joung JK, Liu DR (2011) Revealing off-target cleavage specificities of zinc-finger nucleases by in vitroselection. Nat Methods 8: 765-770
Pubmed: Author and TitleGoogle Scholar: Author Only Title Only Author and Title
Petolino JF, Srivastava V, Daniell H (2016) Editing Plant Genomes: a new era of crop improvement. Plant biotechnology Journal 14:435-436
Pubmed: Author and TitleGoogle Scholar: Author Only Title Only Author and Title
Podevin N, Davies HV, Hartung F, Nogue F, Casacuberta JM (2013) Site-directed nucleases: a paradigm shift in predictable,knowledge-based plant breeding. Trends Biotechnol 31: 375-383
Pubmed: Author and TitleGoogle Scholar: Author Only Title Only Author and Title
Puchta H (2005) The repair of double-strand breaks in plants: mechanisms and consequences for genome evolution. J Exp Bot 56: 1-14Pubmed: Author and TitleGoogle Scholar: Author Only Title Only Author and Title
Qi J, Liu X, Shen D, Miao H, Xie B, Li X, Zeng P, Wang S, Shang Y, Gu X, Du Y, Li Y, Lin T, Yuan J, Yang X, Chen J, Chen H, Xiong X,Huang K, Fei Z, Mao L, Tian L, Stadler T, Renner SS, Kamoun S, Lucas WJ, Zhang Z, Huang S (2013) A genomic variation map providesinsights into the genetic basis of cucumber domestication and diversity. Nat Genet 45: 1510-1515
Pubmed: Author and TitleGoogle Scholar: Author Only Title Only Author and Title
Qi Lei S, Larson Matthew H, Gilbert Luke A, Doudna Jennifer A, Weissman Jonathan S, Arkin Adam P, Lim Wendell A (2013)Repurposing CRISPR as an RNA-Guided Platform for Sequence-Specific Control of Gene Expression. Cell 152: 1173-1183
Pubmed: Author and TitleGoogle Scholar: Author Only Title Only Author and Title
Qin C, Yu C, Shen Y, Fang X, Chen L, Min J, Cheng J, Zhao S, Xu M, Luo Y, Yang Y, Wu Z, Mao L, Wu H, Ling-Hu C, Zhou H, Lin H,Gonzalez-Morales S, Trejo-Saavedra DL, Tian H, Tang X, Zhao M, Huang Z, Zhou A, Yao X, Cui J, Li W, Chen Z, Feng Y, Niu Y, Bi S,Yang X, Li W, Cai H, Luo X, Montes-Hernandez S, Leyva-Gonzalez MA, Xiong Z, He X, Bai L, Tan S, Tang X, Liu D, Liu J, Zhang S, ChenM, Zhang L, Zhang L, Zhang Y, Liao W, Zhang Y, Wang M, Lv X, Wen B, Liu H, Luan H, Zhang Y, Yang S, Wang X, Xu J, Li X, Li S, Wang J,Palloix A, Bosland PW, Li Y, Krogh A, Rivera-Bustamante RF, Herrera-Estrella L, Yin Y, Yu J, Hu K, Zhang Z (2014) Whole-genomesequencing of cultivated and wild peppers provides insights into Capsicum domestication and specialization. Proc Natl Acad Sci U S A111: 5135-5140
Pubmed: Author and TitleGoogle Scholar: Author Only Title Only Author and Title
Radany EH, Dornfeld KJ, Sanderson RJ, Savage MK, Majumdar A, Seidman MM, Mosbaugh DW (2000) Increased spontaneous mutationfrequency in human cells expressing the phage PBS2-encoded inhibitor of uracil-DNA glycosylase. Mutation Research/DNA Repair461: 41-58
Pubmed: Author and TitleGoogle Scholar: Author Only Title Only Author and Title
Ran Y, Liang Z, Gao C (2017) Current and future editing reagent delivery systems for plant genome editing. Science China LifeSciences 60: 490-505
Pubmed: Author and TitleGoogle Scholar: Author Only Title Only Author and Title
Ray T, Dutta I, Saha P, Das S, Roy S (2006) Genetic stability of three economically important micropropagated banana (Musa spp.)cultivars of lower Indo-Gangetic plains, as assessed by RAPD and ISSR markers. Plant Cell, Tissue and Organ Culture 85: 11-21
Pubmed: Author and TitleGoogle Scholar: Author Only Title Only Author and Title
Rey O, Danchin E, Mirouze M, Loot C, Blanchet S (2016) Adaptation to Global Change: A Transposable Element–EpigeneticsPerspective. Trends in Ecology & Evolution 31: 514-526
Pubmed: Author and TitleGoogle Scholar: Author Only Title Only Author and Title
Roach JC, Glusman G, Smit AFA, Huff CD, Hubley R, Shannon PT, Rowen L, Pant KP, Goodman N, Bamshad M, Shendure J, DrmanacR, Jorde LB, Hood L, Galas DJ (2010) Analysis of Genetic Inheritance in a Family Quartet by Whole-Genome Sequencing. Science 328:636-639 www.plantphysiol.orgon August 23, 2020 - Published by Downloaded from
Copyright © 2020 American Society of Plant Biologists. All rights reserved.
Pubmed: Author and TitleGoogle Scholar: Author Only Title Only Author and Title
Romay MC, Millard MJ, Glaubitz JC, Peiffer JA, Swarts KL, Casstevens TM, Elshire RJ, Acharya CB, Mitchell SE, Flint-Garcia SA,McMullen MD, Holland JB, Buckler ES, Gardner CA (2013) Comprehensive genotyping of the USA national maize inbred seed bank.Genome Biology 14: R55
Pubmed: Author and TitleGoogle Scholar: Author Only Title Only Author and Title
Sahebi M, Hanafi MM, van Wijnen AJ, Rice D, Rafii MY, Azizi P, Osman M, Taheri S, Bakar MFA, Isa MNM, Noor YM (2018) Contributionof transposable elements in the plant's genome. Gene 665: 155-166
Pubmed: Author and TitleGoogle Scholar: Author Only Title Only Author and Title
Sahijram L, Soneji JR, Bollamma K (2003) Analyzing somaclonal variation in micropropagated bananas (Musa spp.). In Vitro Cellular &Developmental Biology-Plant 39: 551-556
Pubmed: Author and TitleGoogle Scholar: Author Only Title Only Author and Title
Saika H, Oikawa A, Matsuda F, Onodera H, Saito K, Toki S (2011) Application of gene targeting to designed mutation breeding of high-tryptophan rice. Plant Physiology 156: 1269-1277
Pubmed: Author and TitleGoogle Scholar: Author Only Title Only Author and Title
Sauvage C, Rau A, Aichholz C, Chadoeuf J, Sarah G, Ruiz M, Santoni S, Causse M, David J, Glémin S (2017) Domestication rewiredgene expression and nucleotide diversity patterns in tomato. The Plant Journal 91: 631-645
Pubmed: Author and TitleGoogle Scholar: Author Only Title Only Author and Title
Schiessl S-V, Katche E, Ihien E, Chawla HS, Mason AS (2019) The role of genomic structural variation in the genetic improvement ofpolyploid crops. The Crop Journal 7: 127-140
Pubmed: Author and TitleGoogle Scholar: Author Only Title Only Author and Title
Schmid-Siegert E, Sarkar N, Iseli C, Calderon S, Gouhier-Darimont C, Chrast J, Cattaneo P, Schütz F, Farinelli L, Pagni M, SchneiderM, Voumard J, Jaboyedoff M, Fankhauser C, Hardtke CS, Keller L, Pannell JR, Reymond A, Robinson-Rechavi M, Xenarios I, ReymondP (2017) Low number of fixed somatic mutations in a long-lived oak tree. Nature Plants 3: 926-929
Pubmed: Author and TitleGoogle Scholar: Author Only Title Only Author and Title
Schmutz J, McClean PE, Mamidi S, Wu GA, Cannon SB, Grimwood J, Jenkins J, Shu S, Song Q, Chavarro C, Torres-Torres M, GeffroyV, Moghaddam SM, Gao D, Abernathy B, Barry K, Blair M, Brick MA, Chovatia M, Gepts P, Goodstein DM, Gonzales M, Hellsten U,Hyten DL, Jia G, Kelly JD, Kudrna D, Lee R, Richard MMS, Miklas PN, Osorno JM, Rodrigues J, Thareau V, Urrea CA, Wang M, Yu Y,Zhang M, Wing RA, Cregan PB, Rokhsar DS, Jackson SA (2014) A reference genome for common bean and genome-wide analysis ofdual domestications. Nature Genetics 46: 707
Pubmed: Author and TitleGoogle Scholar: Author Only Title Only Author and Title
Schuermann D, Molinier J, Fritsch O, Hohn B (2005) The dual nature of homologous recombination in plants. Trends in Genetics 21:172-181
Pubmed: Author and TitleGoogle Scholar: Author Only Title Only Author and Title
Schuppert GF, Tang S, Slabaugh MB, Knapp SJ (2006) The Sunflower High-oleic Mutant Ol Carries Variable Tandem Repeats of FAD2-1, a Seed-specific Oleoyl-phosphatidyl Choline Desaturase. Molecular Breeding 17: 241-256
Pubmed: Author and TitleGoogle Scholar: Author Only Title Only Author and Title
Shaw RG, Byers DL, Darmo E (2000) Spontaneous Mutational Effects on Reproductive Traits of Arabidopsis thaliana. Genetics 155:369-378
Pubmed: Author and TitleGoogle Scholar: Author Only Title Only Author and Title
Shen B, Zhang W, Zhang J, Zhou J, Wang J, Chen L, Wang L, Hodgkins A, Iyer V, Huang X, Skarnes WC (2014) Efficient genomemodification by CRISPR-Cas9 nickase with minimal off-target effects. Nature Methods 11: 399-402
Pubmed: Author and TitleGoogle Scholar: Author Only Title Only Author and Title
Shi J, Gao H, Wang H, Lafitte HR, Archibald RL, Yang M, Hakimi SM, Mo H, Habben JE (2017) ARGOS8 variants generated by CRISPR-Cas9 improve maize grain yield under field drought stress conditions. Plant Biotechnology Journal 15: 207-216
Pubmed: Author and TitleGoogle Scholar: Author Only Title Only Author and Title
Shirasawa K, Hirakawa H, Nunome T, Tabata S, Isobe S (2016) Genome‐wide survey of artificial mutations induced by ethylmethanesulfonate and gamma rays in tomato. Plant biotechnology journal 14: 51-60 www.plantphysiol.orgon August 23, 2020 - Published by Downloaded from
Copyright © 2020 American Society of Plant Biologists. All rights reserved.
methanesulfonate and gamma rays in tomato. Plant biotechnology journal 14: 51-60Pubmed: Author and TitleGoogle Scholar: Author Only Title Only Author and Title
Shu Q-Y, Forster BP, Nakagawa H (2012) Plant mutation breeding and biotechnology. CABIPubmed: Author and TitleGoogle Scholar: Author Only Title Only Author and Title
Sikora P, Chawade A, Larsson M, Olsson J, Olsson O (2011) Mutagenesis as a tool in plant genetics, functional genomics, andbreeding. International journal of plant genomics 2011: 1-13
Pubmed: Author and TitleGoogle Scholar: Author Only Title Only Author and Title
Stadler LJ (1929) Chromosome number and the mutation rate in Avena and Triticum. Proceedings of the National Academy of Sciences15: 876-881
Pubmed: Author and TitleGoogle Scholar: Author Only Title Only Author and Title
Standage-Beier K, Brookhouser N, Balachandran P, Zhang Q, Brafman DA, Wang X (2019) RNA-Guided Recombinase-Cas9 FusionTargets Genomic DNA Deletion and Integration. The CRISPR journal 2: 209-222
Pubmed: Author and TitleGoogle Scholar: Author Only Title Only Author and Title
Stepper P, Kungulovski G, Jurkowska RZ, Chandra T, Krueger F, Reinhardt R, Reik W, Jeltsch A, Jurkowski TP (2016) Efficienttargeted DNA methylation with chimeric dCas9–Dnmt3a–Dnmt3L methyltransferase. Nucleic Acids Research 45: 1703-1713
Pubmed: Author and TitleGoogle Scholar: Author Only Title Only Author and Title
Strecker J, Ladha A, Gardner Z, Schmid-Burgk JL, Makarova KS, Koonin EV, Zhang F (2019) RNA-guided DNA insertion with CRISPR-associated transposases. Science 365: 48-53
Pubmed: Author and TitleGoogle Scholar: Author Only Title Only Author and Title
Tajima F (1983) Evolutionary relationship of DNA sequences in finite populations. Genetics 105: 437-460Pubmed: Author and TitleGoogle Scholar: Author Only Title Only Author and Title
Talamè V, Bovina R, Sanguineti MC, Tuberosa R, Lundqvist U, Salvi S (2008) TILLMore, a resource for the discovery of chemicallyinduced mutants in barley. Plant Biotechnology Journal 6: 477-485
Pubmed: Author and TitleGoogle Scholar: Author Only Title Only Author and Title
Tang X, Liu G, Zhou J, Ren Q, You Q, Tian L, Xin X, Zhong Z, Liu B, Zheng X, Zhang D, Malzahn A, Gong Z, Qi Y, Zhang T, Zhang Y (2018)A large-scale whole-genome sequencing analysis reveals highly specific genome editing by both Cas9 and Cpf1 (Cas12a) nucleases inrice. Genome Biol 19: 84
Pubmed: Author and TitleGoogle Scholar: Author Only Title Only Author and Title
Thakore PI, D'Ippolito AM, Song L, Safi A, Shivakumar NK, Kabadi AM, Reddy TE, Crawford GE, Gersbach CA (2015) Highly specificepigenome editing by CRISPR-Cas9 repressors for silencing of distal regulatory elements. Nature Methods 12: 1143-1149
Pubmed: Author and TitleGoogle Scholar: Author Only Title Only Author and Title
Thudi M, Khan AW, Kumar V, Gaur PM, Katta K, Garg V, Roorkiwal M, Samineni S, Varshney RK (2016) Whole genome re-sequencingreveals genome-wide variations among parental lines of 16 mapping populations in chickpea (Cicer arietinum L.). BMC Plant Biol 16Suppl 1: 10
Pubmed: Author and TitleGoogle Scholar: Author Only Title Only Author and Title
Till BJ, Cooper J, Tai TH, Colowit P, Greene EA, Henikoff S, Comai L (2007) Discovery of chemically induced mutations in rice byTILLING. BMC Plant Biology 7: 19
Pubmed: Author and TitleGoogle Scholar: Author Only Title Only Author and Title
Todd JJ, Vodkin LO (1996) Duplications That Suppress and Deletions That Restore Expression from a Chalcone Synthase MultigeneFamily. The Plant Cell 8: 687-699
Pubmed: Author and TitleGoogle Scholar: Author Only Title Only Author and Title
Townsend JA, Wright DA, Winfrey RJ, Fu F, Maeder ML, Joung JK, Voytas DF (2009) High-frequency modification of plant genes usingengineered zinc-finger nucleases. Nature 459: 442-445
Pubmed: Author and TitleGoogle Scholar: Author Only Title Only Author and Title
Tsai SQ, Joung JK (2016) Defining and improving the genome-wide specificities of CRISPR-Cas9 nucleases. Nature Reviews Genetics17: 300-312 www.plantphysiol.orgon August 23, 2020 - Published by Downloaded from
Copyright © 2020 American Society of Plant Biologists. All rights reserved.
Pubmed: Author and TitleGoogle Scholar: Author Only Title Only Author and Title
Tsuda M, Kaga A, Anai T, Shimizu T, Sayama T, Takagi K, Machita K, Watanabe S, Nishimura M, Yamada N, Mori S, Sasaki H, KanamoriH, Katayose Y, Ishimoto M (2015) Construction of a high-density mutant library in soybean and development of a mutant retrievalmethod using amplicon sequencing. BMC Genomics 16: 1014
Pubmed: Author and TitleGoogle Scholar: Author Only Title Only Author and Title
Valliyodan B, Dan Q, Patil G, Zeng P, Huang J, Dai L, Chen C, Li Y, Joshi T, Song L, Vuong TD, Musket TA, Xu D, Shannon JG, ShifengC, Liu X, Nguyen HT (2016) Landscape of genomic diversity and trait discovery in soybean. Scientific Reports 6: 23598
Pubmed: Author and TitleGoogle Scholar: Author Only Title Only Author and Title
Vinh M, Thinh D, Bang D, At D, Ham L, Shu Q (2009) Current status and research directions of induced mutation application to seedcrops improvement in Vietnam. In Q-Y Shu, ed, Induced Plant Mutations in the Genomics Era. Food and Agirculture Organization of theUnited Nations, pp 341-345
Pubmed: Author and TitleGoogle Scholar: Author Only Title Only Author and Title
Vitte C, Fustier M-A, Alix K, Tenaillon MI (2014) The bright side of transposons in crop evolution. Briefings in Functional Genomics 13:276-295
Pubmed: Author and TitleGoogle Scholar: Author Only Title Only Author and Title
Voytas DF (2013) Plant genome engineering with sequence-specific nucleases. Annu Rev Plant Biol 64: 327-350Pubmed: Author and TitleGoogle Scholar: Author Only Title Only Author and Title
Wang L, Beissinger TM, Lorant A, Ross-Ibarra C, Ross-Ibarra J, Hufford MB (2017) The interplay of demography and selection duringmaize domestication and expansion. Genome Biology 18: 215
Pubmed: Author and TitleGoogle Scholar: Author Only Title Only Author and Title
Wang W, Mauleon R, Hu Z, Chebotarov D, Tai S, Wu Z, Li M, Zheng T, Fuentes RR, Zhang F, Mansueto L, Copetti D, Sanciangco M, PalisKC, Xu J, Sun C, Fu B, Zhang H, Gao Y, Zhao X, Shen F, Cui X, Yu H, Li Z, Chen M, Detras J, Zhou Y, Zhang X, Zhao Y, Kudrna D, WangC, Li R, Jia B, Lu J, He X, Dong Z, Xu J, Li Y, Wang M, Shi J, Li J, Zhang D, Lee S, Hu W, Poliakov A, Dubchak I, Ulat VJ, Borja FN,Mendoza JR, Ali J, Li J, Gao Q, Niu Y, Yue Z, Naredo MEB, Talag J, Wang X, Li J, Fang X, Yin Y, Glaszmann JC, Zhang J, Li J, HamiltonRS, Wing RA, Ruan J, Zhang G, Wei C, Alexandrov N, McNally KL, Li Z, Leung H (2018) Genomic variation in 3,010 diverse accessions ofAsian cultivated rice. Nature 557: 43-49
Pubmed: Author and TitleGoogle Scholar: Author Only Title Only Author and Title
Wang Z-h, Jia Y (2014) Development and characterization of rice mutants for functional genomic studies and breeding. In Mutagenesis:exploring novel genes and pathways. Wageningen Academic Publishers, pp 604-612
Pubmed: Author and TitleGoogle Scholar: Author Only Title Only Author and Title
Waterworth WM, Drury GE, Bray CM, West CE (2011) Repairing breaks in the plant genome: the importance of keeping it together. NewPhytol 192: 805-822
Pubmed: Author and TitleGoogle Scholar: Author Only Title Only Author and Title
Waterworth WM, Footitt S, Bray CM, Finch-Savage WE, West CE (2016) DNA damage checkpoint kinase ATM regulates germination andmaintains genome stability in seeds. Proceedings of the National Academy of Sciences 113: 9647-9652
Pubmed: Author and TitleGoogle Scholar: Author Only Title Only Author and Title
Waterworth WM, Masnavi G, Bhardwaj RM, Jiang Q, Bray CM, West CE (2010) A plant DNA ligase is an important determinant of seedlongevity. The Plant Journal 63: 848-860
Pubmed: Author and TitleGoogle Scholar: Author Only Title Only Author and Title
Weeks DP, Spalding MH, Yang B (2016) Use of designer nucleases for targeted gene and genome editing in plants. Plant Biotechnol J14: 483-495
Pubmed: Author and TitleGoogle Scholar: Author Only Title Only Author and Title
Wendel JF, Jackson SA, Meyers BC, Wing RA (2016) Evolution of plant genome architecture. Genome Biology 17: 37Pubmed: Author and TitleGoogle Scholar: Author Only Title Only Author and Title
Weng M-L, Becker C, Hildebrandt J, Neumann M, Rutter MT, Shaw RG, Weigel D, Fenster CB (2019) Fine-Grained Analysis ofSpontaneous Mutation Spectrum and Frequency in Arabidopsis thaliana. Genetics 211: 703-714
www.plantphysiol.orgon August 23, 2020 - Published by Downloaded from Copyright © 2020 American Society of Plant Biologists. All rights reserved.
Pubmed: Author and TitleGoogle Scholar: Author Only Title Only Author and Title
Wolt JD, Wang K, Sashital D, Lawrence-Dill CJ (2016) Achieving Plant CRISPR Targeting that Limits Off-Target Effects. The PlantGenome 9
Pubmed: Author and TitleGoogle Scholar: Author Only Title Only Author and Title
Woo JW, Kim J, Kwon SI, Corvalan C, Cho SW, Kim H, Kim SG, Kim ST, Choe S, Kim JS (2015) DNA-free genome editing in plants withpreassembled CRISPR-Cas9 ribonucleoproteins. Nat Biotechnol 33: 1162-1164
Pubmed: Author and TitleGoogle Scholar: Author Only Title Only Author and Title
Wu X, Kriz AJ, Sharp PA (2014) Target specificity of the CRISPR-Cas9 system. Quant Biol 2: 59-70Pubmed: Author and TitleGoogle Scholar: Author Only Title Only Author and Title
Xu K, Xu X, Fukao T, Canlas P, Maghirang-Rodriguez R, Heuer S, Ismail AM, Bailey-Serres J, Ronald PC, Mackill DJ (2006) Sub1A is anethylene-response-factor-like gene that confers submergence tolerance to rice. Nature 442: 705-708
Pubmed: Author and TitleGoogle Scholar: Author Only Title Only Author and Title
Xu Y, Li P, Zou C, Lu Y, Xie C, Zhang X, Prassanna BM, Olsen MS (2017) Enhancing genetic gain in the era of molecular breeding.Journal of Experimental Botany 68: 2641-2666
Pubmed: Author and TitleGoogle Scholar: Author Only Title Only Author and Title
Yang N, Xu X-W, Wang R-R, Peng W-L, Cai L, Song J-M, Li W, Luo X, Niu L, Wang Y, Jin M, Chen L, Luo J, Deng M, Wang L, Pan Q, LiuF, Jackson D, Yang X, Chen L-L, Yan J (2017) Contributions of Zea mays subspecies mexicana haplotypes to modern maize. NatureCommunications 8: 1874
Pubmed: Author and TitleGoogle Scholar: Author Only Title Only Author and Title
Young J, Zastrow-Hayes G, Deschamps S, Svitashev S, Zaremba M, Acharya A, Paulraj S, Peterson-Burch B, Schwartz C, Djukanovic V,Lenderts B, Feigenbutz L, Wang L, Alarcon C, Siksnys V, May G, Chilcoat ND, Kumar S (2019) CRISPR-Cas9 Editing in Maize:Systematic Evaluation of Off-target Activity and Its Relevance in Crop Improvement. Scientific Reports 9: 6729
Pubmed: Author and TitleGoogle Scholar: Author Only Title Only Author and Title
Yu Q-h, Wang B, Li N, Tang Y, Yang S, Yang T, Xu J, Guo C, Yan P, Wang Q, Asmutola P (2017) CRISPR/Cas9-induced TargetedMutagenesis and Gene Replacement to Generate Long-shelf Life Tomato Lines. Scientific Reports 7: 11874
Pubmed: Author and TitleGoogle Scholar: Author Only Title Only Author and Title
Zhang H, Zhang J, Wei P, Zhang B, Gou F, Feng Z, Mao Y, Yang L, Zhang H, Xu N, Zhu JK (2014) The CRISPR/Cas9 system producesspecific and homozygous targeted gene editing in rice in one generation. Plant Biotechnol J 12: 797-807
Pubmed: Author and TitleGoogle Scholar: Author Only Title Only Author and Title
Zhang XH, Tee LY, Wang XG, Huang QS, Yang SH (2015) Off-target Effects in CRISPR/Cas9-mediated Genome Engineering. Mol TherNucleic Acids 4: e264
Pubmed: Author and TitleGoogle Scholar: Author Only Title Only Author and Title
Zhang Y, Massel K, Godwin ID, Gao C (2018) Applications and potential of genome editing in crop improvement. Genome Biology 19:210
Pubmed: Author and TitleGoogle Scholar: Author Only Title Only Author and Title
Zhang Z, Mao L, Chen H, Bu F, Li G, Sun J, Li S, Sun H, Jiao C, Blakely R, Pan J, Cai R, Luo R, Van de Peer Y, Jacobsen E, Fei Z, HuangS (2015) Genome-Wide Mapping of Structural Variations Reveals a Copy Number Variant That Determines Reproductive Morphology inCucumber. The Plant Cell 27: 1595-1604
Pubmed: Author and TitleGoogle Scholar: Author Only Title Only Author and Title
Zhao H, Wolt JD (2017) Risk associated with off-target plant genome editing and methods for its limitation. Emerging Topics in LifeSciences 1: 231-240
Pubmed: Author and TitleGoogle Scholar: Author Only Title Only Author and Title
Zhao Q, Feng Q, Lu H, Li Y, Wang A, Tian Q, Zhan Q, Lu Y, Zhang L, Huang T, Wang Y, Fan D, Zhao Y, Wang Z, Zhou C, Chen J, Zhu C, LiW, Weng Q, Xu Q, Wang ZX, Wei X, Han B, Huang X (2018) Pan-genome analysis highlights the extent of genomic variation in cultivatedand wild rice. Nat Genet 50: 278-284
Pubmed: Author and TitleGoogle Scholar: Author Only Title Only Author and Title www.plantphysiol.orgon August 23, 2020 - Published by Downloaded from
Copyright © 2020 American Society of Plant Biologists. All rights reserved.
Zischewski J, Fischer R, Bortesi L (2017) Detection of on-target and off-target mutations generated by CRISPR/Cas9 and othersequence-specific nucleases. Biotechnol Adv 35: 95-104
Pubmed: Author and TitleGoogle Scholar: Author Only Title Only Author and Title
Zohary D (1999) Monophyletic vs. polyphyletic origin of the crops on which agriculture was founded in the Near East. GeneticResources and Crop Evolution 46: 133-142
Pubmed: Author and TitleGoogle Scholar: Author Only Title Only Author and Title
Zuo E, Sun Y, Wei W, Yuan T, Ying W, Sun H, Yuan L, Steinmetz LM, Li Y, Yang H (2019) Cytosine base editor generates substantial off-target single-nucleotide variants in mouse embryos. Science 364: 289-292
Pubmed: Author and TitleGoogle Scholar: Author Only Title Only Author and Title
www.plantphysiol.orgon August 23, 2020 - Published by Downloaded from Copyright © 2020 American Society of Plant Biologists. All rights reserved.