Date post: | 19-Jun-2015 |
Category: |
Education |
Upload: | pat-heslop-harrison |
View: | 1,800 times |
Download: | 2 times |
Chromosomes, Crops and Superdomestication in Katowice
www.molcyt.comUserID/PW ‘visitor’
Pathh1:
Twitter #PMC .
Slideshare pathh1
Genome evolution• How do genomes evolve?
–Gene mutation very rarely (human: 10−8/site/generation)
–Chromosome evolution–Polyploidy and genome duplication (ancient &
modern)–Repetitive sequences: mobility & copy number
(10−4/generation in µsat)–Recombination–Epigenetic aspects: centromeres & expression
Genome evolution• How do genomes evolve?
– Gene mutation very rarely– Chromosome evolution– Polyploidy and genome duplication (ancient and modern)– Repetitive sequences: mobility & copy number– Recombination– Epigenetic aspects – centromeres & expression
• How can we exploit knowledge of genome evolution?– Biodiversity– Chromosome and genome engineering– Breeding– Markers
Musa biodiversity and genomes: x=11Red - AAA 2n=3x=33 – M. acuminata Palayam codan AAB (two bunch yellow, one green) Musa x Peyan ABB (green cooking banana) Njalipoovan AB (yellow) 2n=2x=22 M. acuminata x M. balbisiana Robusta AAA (green ripe) Nendran AAB Poovan AAB (one yellow bunch) Red AAA Peyan ABBVarkala, Kerala, India
RetrotransposonsClass I transposable elementsRNA intermediate
DNA transposonsClass II transposable elements
Cut-and-paste
RetroelementsSequences which amplify through an RNA intermediate
• 50% of all the DNA!
Retroelements
BAC sequences from Musa Calcutta 4 Homologous over the full lengthexcept for a 5kb insert• a Ty1-copia retroelement
Alignment of two homologous Musa BACs shows gaps in both B genome M. balbisiana and A genome M. acuminata
MA4_82I11
MBP_81C12
MuhAT1
MuhAT2a
XX TE (SINGLE)XX TE MITE
XX TE (AGNABI)
MuhAT3 MuhAT4 MITE(MBIR)
XX TE XX TE (MBT)
272 bp 102,190 bp
26, 410 bp 128,068 bp
DNA transposons hAT are particularly frequent
8 bp TSD, and short TIRs of 5–27 bptransposase (sometimes degenerate) including a DDE site.Non-autonomous (MITE) derivatives of hAT with deletion coding sequence
Menzel, Schmidt, Nouroz, HH Chr Res subject minor revision 2015
13/04/2023 12
Sr. No. Primer Pairs Product Size (bp)
Sequence
1. hAT18486hAT19037
560 ACCCACCTGGCTCTTGTGTCAGCGAATGTGTTTTGACCAC
MBP 81C12 (M. balbisiana) x MA4 82I11 (M. acuminata) BACs.
Musa balbisiana (MBP 81C12)M
usa
acu
min
ata
(MA
4 82
I11)
Transposed Element
hAT 1
hAT 2
hAT 4
Microsatellite (AT)
hAT 3621 bp MBT
384 bp TE + 781 MITE
1676 TE
Microsatellite (AT)
4192 bp TE
13/04/2023 13
Sr. No. Primer Pairs Product Size (bp)
Sequence
1. hAT18486hAT19037
560 ACCCACCTGGCTCTTGTGTCAGCGAATGTGTTTTGACCAC
MBP 81C12 (M. balbisiana) x MA4 82I11 (M. acuminata) BACs.
Musa balbisiana (MBP 81C12)M
usa
acu
min
ata
(MA
4 82
I11)
Transposed Element
hAT 1
hAT 2
hAT 4
Microsatellite (AT)
hAT 3621 bp MBT
384 bp TE + 781 MITE
1676 TE
Microsatellite (AT)
4192 bp TE
A-genome specific hAT in three Musa accessions
(2n=3x=33)
Musa ‘WilliamsCavendish’ (AAA)
Musa (ABB)
Musa (ABB)
13/04/2023 15Dot plot showing the complete Inverted repeat.
13/04/2023 16
HP-1 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48
1KB800600400200
hAT1 insertion sites in Musa diversity collectionhAT486F and hAT037R
Top bands (560-bp) amplified hAT elementLower bands amplifying the flanking sequences only
Menzel, Nouroz, Heslop-Harrison, Schmidt 2014
Retroelement Markers
Retrotransposon LTRLTR
Retrotransposon LTRLTR
RetrotransposonLTR LTR
Retrotransposon LTRLTR
Insertion
IRAP – InterRetroelement PCR
Retrotransposon LTRLTR
RetrotransposonLTR LTR
IRAP diversity in Musa
Teo, Tan, Ho, Faridah, Othman, HH, Kalendar, Schulman 2005 J Plant BiolNair, Teo, Schwarzacher, HH 2006 Euphytica Teo, Schwarzacher et al. in prep.
13/04/2023 19
Phylogenetic analysis of Musa genomes – separating species. Teo, Schwarzacher et al.
BSV Expression in Banana
Double stranded DNA is infective: Insect vectorUnexpected epidemiology: Appearance after cold or tissue culture
Nuclear Copies of Banana Streak Virus in Banana
Nuclear Copiesof BSV in banana
DNA Fibre in situ hybridization
Harper, HH et al., Virology 1999 … cf D’Hont et al., Nature, 2012
Whole genome shotgun sequencing
• Changing all cytogenomics (.org) work
• Easily obtaining several-fold sequence coverage
D’Hont et al. Nature 2012 doi:10.1038/nature11241
Musa Bananan=11
Sequence:D’Hont, inc HH et al. Nature 2012
Haploid: Nair, HH 2013
Whole genome duplications
• The surprise to the sequencers: conserved synteny and relatively few breakpoints
• The surprise to the cytogeneticists: sequencing shows whole genome duplications (=polyploidy) deep in the phylogenetic tree
• The surprise to everyone: so few genes but multifunctional
A D’Hont et al. Nature 2012doi:10.1038/nature11241
BrachiariaLTR element families
Fabíola Carvalho SantosAndré Luiz Laforga VanzelaSee poster
Forage/pastureUrbanSavanna/cerrado
ForestSugar caneSoybean/corn
Brazil land use
Chromosomal evolution and the organization of repetitive DNA sequences in diploid and polyploid
Brachiaria forage grasses
Some probes show less hybridization to some chromosomes, perhaps indicating genome specificity.
Fabíola Carvalho SantosAndré Luiz Laforga VanzelaSee poster
Wheat evolution and hybridsTriticum uratu
2n=2x=14AA
EinkornTriticum monococcum
2n=2x=14AA
Bread wheatTriticum aestivum
2n=6x=42AABBDD
Durum/SpaghettiTriticum turgidum ssp durum
2n=4x=28AABB
Triticum dicoccoides2n=4x=28
AABB
Aegilops speltoidesrelative
2n=2x=14BB Triticum tauschii
(Aegilops squarrosa)2n=2x=14
DD
TriticalexTriticosecale
2n=6x=42AABBRR
RyeSecale cereale
2n=2x=14RR
Copyright restrictions may apply.
Saeidi, H. et al. Ann Bot 2008 101:855-861; doi:10.1093/aob/mcn042
Inter-retroelement (IRAP) analysis of Triticum tauschii ssp tauschii from Iran
SSR/Microsats: all are different and no tree is supported
Different sequence classes evolve at different rates
Crop standing
Lodging in cereals
Crop fallen
Use of repetitive DNA sequences as chromosome markers
dpTa1pSc119.2Genomic Ae.ventricosa
Inheritance of Chromosome 5DAegilops ventricosaDDNN
ABDN
AABBDDNN MarneAABBDD
CWW1176-4
Rendezvous
Piko
VPM1 Dwarf A
96ST61
Virtue
×
×
×
×
Hobbit
× {Kraka × (Huntsman × Fruhgold)}
Triticum persicum Ac.1510AABB
Wheat Streak Mosaic Virus in North AmericaBob Graybosch, USDA
Wsm-1: only highly effective source of resistance to WSMV
Mace wheatGraybosch et al. 2009In situ: Niaz Ali & Schwarzacher
Chromosome evolution - Polyploidy
• Selected natural– Wheat– Banana – Brachiaria – Proso millet
• Synthetic– Triticale– Nicotiana
Proso millet (Panicum miliaceum): origins, genomic studies and prospects
Pat Heslop-Harrison, Farah Badakshi and Harriet Hunt
Panicum sensu stricto c. 100 species; x=9Evolution of Panicum miliaceum Proso millet
P. miliaceum 2n=4x=36
P. capillare2n=2x=18
P. repens2n=4x=36
also 2n=18 to 54
P. sumatrense2n=2x=18 or 4x=36
Global North-temperateLow genetic diverstiyWeedy forms
P. virgatum2n=4x=36 or 2x=18
? ? ? ? ??
• Hunt , HH et al. 2014. Reticulate evolution in Panicum (Poaceae): the origin of tetraploid broomcorn millet, P. miliaceum. J Exp Bot. 2014
• P. miliaceum: allotetraploid with maternal ancestor P. capillare and one genome shared with P. repens (also allotetraploid)
Hunt , HH et al. 2014. Reticulate evolution in Panicum (Poaceae): the origin of tetraploid broomcorn millet, P. miliaceum. J Exp Bot. March 2014
Chromosome and genome engineering
Cell fusionhybrid of two4x tetraploidtobaccospecies
Patel, Badakshi, HH, Davey et al 2011 Annals of Botany
Nicotiana hybrid4x + 4x
cell fusions
Each of 4chromosome
sets hasdistinctiverepetitiveDNA when
probed withgenomic DNA
Patel et alAnn Bot 2011
Cell fusionhybrid of two4x tetraploidtobaccospecies
Four genomesdifferentiallylabelled
Patel, Badakshi, HH, Davey et al 2011 Annals Botany
Arachis hypogaea - PeanutTetraploid of recent origin,
ancestors separated only 3 My ago
• Ana Claudia Araujo, David Bertioli, TS & PHH EMBRAPA, Brasília. Annals Botany 2013
•Arachis hypogea 2n=4x=40 probed with •(green) A. duranensis; (red) A. ipaënsis
Bertioli et al. Annals of Botany 2013
BAC in situ hybridization
Primula BAC mapping
Gilmartin, Lu, HH & Badakshi 2015?
Size and location of chromosome regions from radish (Raphanus sativus) carrying the fertility restorer Rfk1 gene and transfer to spring turnip rape (Brassica rapa)
DAPI metaphase blueRadish genomic red (2 radish chromosomes) far-red 45S rDNARfk1 carrying BAC green labels sites on radish and homoeologous pair in Brassica
Tarja Niemelä, Seppänen, Badakshi, Rokka HHChromosome Research 2012
BACs from different species have different repeat distributions – and hence different patterns of hybridization
Organelle sequencesfrom chloroplasts or
mitochondria
Sequences from viruses, Agrobacterium or other
vectors
Transgenes introduced with molecular biology
methods
Genes, regulatory and non-coding single copy sequences
Dispersed repeats:Transposable Elements
Repetitive DNA sequences
Nuclear Genome
Tandem repeats
DNA transposons copied and
moved via DNA
Retrotransposons amplifying via an RNA intermediate
Centromeric repeats
Structural components of chromosomes
Telomeric repeats
Simple sequence repeats or
microsatellites
Repeated genes
Subtelomeric repeats
45S and 5S rRNA genes
Blocks of tandem repeats at discrete chromosomal loci
DNA sequence components of the nuclear genomeHeslop-Harrison & Schmidt 2012. Encyclopedia of Life Sciences
Other genes
X MuTRR
MuTRF220 bp
• The original 177bp repeat fits nicely around the nucleosome allowing a tight coiling
• The repeat unit with the retroelement foot print, the 63bp box, has a much more open configuration
• It is maintained as it brings a CG and CNG site that allows control via methylation
MuTRR
MuTRF180 bp
Insertion and subsequent loss
Monkey retroelement
C.H Teo and Schwarzacher
A
B
C
Centromere
DNA sequenceTE
Tandem repeat monomerTE Transposable element
Single copy DNA
Spindle microtubules pulling apart chromatids
Metaphase chromosome
147bp plus 5-70bp linker = 150-220bp
100bp plus 55bp linker = 155bp
D
E
F
G
H
I
Kinetochore
Heslop-Harrison & Schwarzacher 2013. Nucleosomes and centromeric DNA packaging. Proc Nat Acad Sci USA. http://dx.doi.org/10.1073/pnas.1319945110. See also http://wp.me/p2Ewqp-7h
Henikoff et al 2013
C: antibody to CENH3 variant
Domestication
• Most species domesticated 10,000 years ago: cereals, legumes/pulses, brassicas, fruits, cows/sheep/pigs, silkworm/bees)
• Few species more recently (rabbits, fish; trees, biofuel crops)
• A few dropped out of production
• First steps: productive, reproduce easily, disease-free, edible/tasty, harvestable …
Heslop-Harrison & Schwarzacher Domestication genomics www.tinyurl.com/domest and review of rabbits www.tinyurl.com/rabdom
Domestication
• …• A few dropped out of production
• Second steps: more productive, harvestable
• Third step: fitting for sustainable intensification• Proso millet: the most water-efficient cereal• Superdomestication and design of crops
Heslop-Harrison & Schwarzacher Domestication genomics www.tinyurl.com/domest and review of rabbits www.tinyurl.com/rabdom www.tinyurl.com/superdom
Outputs–CROPS
– Fixed energy Inputs
–Light–Heat–Water–Gasses–Nutrients
–Light–Heat
–Water–Gasses
–Nutrients
(Ecosystem services)
Conventional Breeding
Superdomestication
• Cross the best with the best and hope for something better
• Decide what is wanted and then plan how to get it– Variety crosses– Mutations– Hybrids (sexual or cell-fusion)– Genepool– Transformation
Economic growth
• Separate into increases in inputs (resources, labour and capital) and technical progress
• 90% of the growth in US output per worker is attributable to technical progress
Robert Solow – Economist
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 530
200000000
400000000
600000000
800000000
1000000000
1200000000
Maize Rice, paddy
Wheat Population /10
1961 1970 1980 1990 2000 2010 2013
52 years of plant breeding progress
Agronomy
Genetics
GM maize
United Nations Millennium Development Goals-MDGs1990 to 2015
• Goal 1 – Eradicate extreme poverty and hunger
•Goal 2 – Achieve universal primary education
• Goal 3 – Promote gender equity and empower women
• Goal 4 – Reduce child mortality•
Goal 5 – Improve maternal health •
Goal 6- Combat HIV/AIDS, malaria and other diseases
• Goal 7 - Ensure environmental sustainability
• Goal 8 - Develop a global partnership for development
Genome evolution• How do genomes evolve?
– Gene mutation very rarely – Chromosome evolution– Polyploidy and genome duplication (ancient and modern)– Repetitive sequences: mobility & copy number– Recombination– Epigenetic aspects – centromeres & expression
• How can we exploit knowledge of genome evolution?– Biodiversity– Chromosome and genome engineering– Breeding– Markers Pat Heslop-Harrison & Trude Schwarzacher
www.molcyt.comPathh1 on slideshare
Chromosomes, Crops and Superdomestication in Katowice
www.molcyt.comUserID/PW ‘visitor’
Pathh1:
Twitter #PMC .
Slideshare pathh1
Major Genomic Components
• Tandem Repeats• Simple Sequence Repeats• Dispersed Repeats• Functional Repeats• Retroelements• Genes
Typical Fraction10%5%10%15%50%10%
A D’Hont et al. Nature 2012
doi:10.1038/nature11241
Whole-genome duplication events.
Satellite DNA probe green
• 45S rDNA
Differences between genomesMajor differences in the nature and amount of repetitive DNA
• dpTa1 tandem repeat
146 bp around histones
• Three copies of the Arabidopsis 180 bp repeat showing (dark purple, stepped line) GC content of the sequence and (red, smooth line) sequence curvature. While GC and AT rich regions of a sequence generally correlate with curvature, the kinked region shows curvature with low GC content.
• How do genomes evolve?• How can we exploit knowledge of genome
evolution?– Biodiversity– Chromosome engineering– Markers
Genome engineering
• Introgression of chromosomes– Brassica – Raphanus– Wheat – Thinopyrum
Chromatin
• Packaging
UK Wheat 1948-200752,909 data points, 308 varieties
From Ian Mackay, NIAB, UK. 2009. Re-analyses of historical series of variety trials: lessons from the past and opportunities for the future. SCRI website.
Rules for successful domestication
• There aren’t any!
• Crops come from anywhere (new/old world; temperate/tropical; dry/humid)
• They might be grown worldwide• Polyploids and diploids (big genomes-small
genomes, many chromosomes-few chromosomes)
• Seeds, stems, tubers, fruits, leaves
10 m
DNA methylation is unevenly distributed on Musa chromosomes
copia elements
in methylated regions, but also in some low methylated regions (arrows)
5MeC
10 m
C.H Teo and Schwarzacher
5MeC
DNA methylation is unevenly distributed on Musa chromosomes
gypsy elements
in methylated regions, but also in some low methylated regions (arrows)
Teo & Schwarzacher in prep 2013
Genome evolution• How do genomes evolve?
– Mutation very rarely (human: 10−8/site/generation)
– Chromosome evolution– Polyploidy and genome duplication (ancient and modern)– Repetitive sequences – mobility & copy number (10−4 µsat)
– Recombination– Epigenetic aspects – centromeres & expression
• How can we exploit knowledge of genome evolution?– Biodiversity– Chromosome engineering– Breeding– Markers
Outputs
– Crops(Chemical energy)
– Food– Feed– Fuel
– Fibre– Flowers
– Pharmaceuticals– Fun 85
Molecular cytogenetics …
The genepool has the diversity to address these challenges …
New methods to exploit and characterize germplasm let use make better and sustainable use of the genepool
How to use diversity• Cross two varieties
• Genome manipulations• Cross two species and make a new one• Cell fusion hybrids• Chromosome manipulation• Backcross a new species
• Generate recombinants• Chromosome recombinations
• Transgenic approaches
• Use a new species
Nothing special about crop genomes?Crop Genome size 2n Ploidy Food
Rice 400 Mb 24 2 3x endosperm
Wheat 17,000 Mbp 42 6 3x endosperm
Maize 950 Mbp 10 4 (palaeo-tetraploid) 3x endosperm
Rapeseed B. napus
1125 Mbp 38 4 Cotyledon oil/protein
Sugar beet 758 Mbp 18 2 Modified root
Cassava 770 Mbp 36 2 Tuber
Soybean 1,100 Mbp 40 4 Seed cotyledon
Oil palm 3,400 Mbp 32 2 Fruit mesocarp
Banana 500 Mbp 33 3 Fruit mesocarp
Heslop-Harrison & Schwarzacher 2012. Genetics and genomics of crop domestication. In Altman & Hasegawa Plant Biotech & Agriculture. 10.1016/B978-0-12-381466-1.00001-8 Tinyurl.com/domest
Centromere
DNA sequenceTE
Tandem repeat monomerTE Transposable element
Single copy DNA
Spindle microtubules pulling apart chromatids
Metaphase chromosome
147bp plus 5-70bp linker = 150-220bp
Kinetochore
Heslop-Harrison JS, Schwarzacher T. 2013. Nucleosomes and centromeric DNA packaging. Proc Nat Acad Sci USA. http://dx.doi.org/10.1073/pnas.1319945110. See also http://molcyt.org (Dec 2013)
Genes!
EvolutionEpigeneticsDevelopment
PhenotypeMultiple abnormalities
Genetic changes non-reverting
Changes seen, some reverting
(Male/Female)Normal Differentiation
CauseChromosomal loss, deletion or
translocationGene mutation / base pair
changesTelomere shortening
(Retro)transposon insertion Retrotransposon activation
SSR expansionMethylation
HeterochromatinizationChromatin remodelling
Histone modification
Outputs–CROPS
– Fixed energy Inputs
–Light–Heat–Water–Gasses–Nutrients
Outputs–CROPS
– Fixed energy
93
Inputs
–Light–Heat–Water–Gasses–Nutrients
– Light– Heat
– Water– Gasses
– Nutrients
Chromosomes, Crops and
Superdomestication What do we want?
What have we done?