Date post: | 12-Apr-2017 |
Category: |
Science |
Upload: | natalio-krasnogor |
View: | 75 times |
Download: | 0 times |
60IWBDA 2016 - Newcastle Upon Tyne /
Accelerating Synthetic Biology via Software and Hardware
AdvancesProf.NatalioKrasnogor
Interdisciplinary Computing and Complex BioSystems (ICOS) Research GroupCentre for Bacterial Cell Biology
Centre for Synthetic Biology and the BioeconomyNewcastle University
Natalio.Krasnogor@newcastlehttp://homepages.cs.ncl.ac.uk/natalio.krasnogor/
twitter: @NKrasnogor
1
Tuesday, 6 September 16
60IWBDA 2016 - Newcastle Upon Tyne /
Outline
• Computational & Hardware support for designing and manufacturing Combinatorial DNA at your Desk
• Machine Intelligence for Synthetic Biology
•Conclusions
2
Tuesday, 6 September 16
60IWBDA 2016 - Newcastle Upon Tyne /
N
• Different scales require different “programming languages”, e.g. DNALD, SBOL, IBL, etc for modularity, hierarchical abstraction, reusability & standardisation across scales
• Microfluidics for writing DNA but also as a “wind-tunnel” on your desktop, e.g.,:
• to try out multiple designs and gather data• to optimise cell-free kits for ad-hoc
applications• to combinatorial stress-test synthetic cell
systems
• Machine Intelligence & data analytics across scales
3
Tuesday, 6 September 16
60IWBDA 2016 - Newcastle Upon Tyne /
Reading and Writing DNA at your Desk• The study of biology has accelerated rapidly thanks to methods for massively parallel cell-free cloning and DNA sequencing in desktop next generation sequencing (NGS) machines• The engineering of biology is still largely restrained by limitations of gene synthesis and cloning methodologies• Off-the-shelf Microfluidic is about to supercharge synthetic biology by:
• increasing the throughput of gene synthesis• reducing cost through miniaturization• handle complexity of more ambitious designs through autonomous liquid handling at source.
5
Tuesday, 6 September 16
60IWBDA 2016 - Newcastle Upon Tyne /
Combinatorial DNA Synthesis on your DesktopParts
Library Targets
OperatorsPlaner Assembly Plan
Instrument Instructions
Programable Order Polymerization (POP)
Microfluidics Combinatorial Assembly of DNA (M-CAD)
Microfluidics In Vitro Cloning (MIC)
Key challenge is to enable precise design, editing and
manufacturing of combinatorial DNA libraries at your desk.
CAD
CAM
6
Tuesday, 6 September 16
60IWBDA 2016 - Newcastle Upon Tyne /
Combinatorial DNA Synthesis on your DesktopParts
Library Targets
OperatorsPlaner Assembly Plan
Instrument Instructions
Programable Order Polymerization (POP)
Microfluidics Combinatorial Assembly of DNA (M-CAD)
Microfluidics In Vitro Cloning (MIC)
Key challenge is to enable precise design, editing and
manufacturing of combinatorial DNA libraries at your desk.
CAD
CAM
and then find out what the
heck just happened!?!?
6
Tuesday, 6 September 16
60IWBDA 2016 - Newcastle Upon Tyne /
A Programming Language for Sequences:DNALD (DNA Library Design)
A specification language that produces a set of target DNAsequences as a function of operations on a set of inputs
To maximise impact the specification process must be:• user friendly and debuggable • but expressively powerful enough to:
• define non-trivial combinatorial constructs• communicate degrees of freedom
7
Tuesday, 6 September 16
60IWBDA 2016 - Newcastle Upon Tyne /
Background validation
evaluationconstraints
syntaxerrors
errornavigation
errorsmarked
9
Tuesday, 6 September 16
60IWBDA 2016 - Newcastle Upon Tyne /
Suggests quick fixes
resolve names
correct indices
10
Tuesday, 6 September 16
60IWBDA 2016 - Newcastle Upon Tyne /
Search across projects
searchresults
navigateworkspace
11
Tuesday, 6 September 16
60IWBDA 2016 - Newcastle Upon Tyne /
Compare differences between files and versions
duplicate each orevery change
highlights insertions and deletions
12
Tuesday, 6 September 16
60IWBDA 2016 - Newcastle Upon Tyne /
Graphical Representation of Complex DNA Libraries
Assembly plan
13
Tuesday, 6 September 16
60IWBDA 2016 - Newcastle Upon Tyne /
And Paired Visualisations
l Emphasises reuse with shared nodes and provides indication of library's combinatorial degree
l Every path from 5' to 3' is an output
Graphical Representation of Complex DNA Libraries
14
Tuesday, 6 September 16
60IWBDA 2016 - Newcastle Upon Tyne /
How can DNALD be extended?• Plug-ins could be added to add semantics to variants, eg:
• different codon usage or codon tables for same protein sequence• different coded protein sequence with same physico-chemical properties
•Equivalent/Reduced Alphabets
for Contact Number preservationEquivalent/Reduced Alphabets
for solvent accessibility preservation
Text
Automated Alphabet Reduction for Protein Datasets. BMC Bioinformatics, 2009, 10:6
15
Tuesday, 6 September 16
60IWBDA 2016 - Newcastle Upon Tyne /
How can DNALD be extended?• Plug-ins could be added to use eg:
• Statistical or machine learning driven design of experiments
Text
16
Tuesday, 6 September 16
60IWBDA 2016 - Newcastle Upon Tyne /
How can DNALD be extended?
Planning heuristics adaptable to other assembly protocols
17
Tuesday, 6 September 16
60IWBDA 2016 - Newcastle Upon Tyne /
StemCellReprogramming(UKB)Frank Edenhofer
19
Tuesday, 6 September 16
60IWBDA 2016 - Newcastle Upon Tyne /
Operons Rewiring (UEVE)François Képès
20
Tuesday, 6 September 16
60IWBDA 2016 - Newcastle Upon Tyne /
From the DNA Library to the Synthesis Plan
l When O={+} & P=unrestricted è Planning problem
l Related computational problem bounded-depth min-cost string production (BDMSP) is NP-hard and APX-hard by reduction from vertex cover
21
Tuesday, 6 September 16
60IWBDA 2016 - Newcastle Upon Tyne /
Combinatorial DNA Synthesis on your DesktopParts
Library Targets
OperatorsPlaner Assembly Plan
Instrument Instructions
Programable Order Polymerization (POP)
Microfluidics Combinatorial Assembly of DNA (M-CAD)
Microfluidics In Vitro Cloning (MIC)
Key challenge is to enable precise design, editing and
manufacturing of combinatorial DNA libraries at your desk.
CAD
CAM
22
Tuesday, 6 September 16
60IWBDA 2016 - Newcastle Upon Tyne /
One Pot VS Generic Protocols
Microfluidic gene synthesis is advancing fast to:• overcome the limitation of strictly assembling genes in one pot reactions & accommodate a range of assembly methods.• be able to execute ad hoc gene synthesis via programmability over droplet routing. • enable the implementation of complex & parallel schemes (which are challenging to execute both manually and on liquid handling robots) • able to accommodate different construction protocols.•More reproducible
Zhou,X et al. Microfluidic PicoArray synthesis of oligodeoxynucleotides and simultaneous assembling of multiple DNA sequences. Nucleic Acids Res., 32, 5409–5417. 2004
Tian,J., et al. . Advancinghigh-throughput gene synthesis technology. Mol. Biosyst., 5, 714–722. 2009
Quan,J.,et al. Parallel on-chip gene synthesis and application to optimization of protein expression. Nat. Biotechnol., 29, 449–452. 2011
24
Tuesday, 6 September 16
60IWBDA 2016 - Newcastle Upon Tyne /
What Can Be Done• Synthesis of Genes de novo ==> POP assembly• Construction of Rationally Designed (DNALD) Combinatorial Gene Libraries ==> M-CAD• Cell-free cloning of assembled synthetic DNA ==> M-IC
• Sequenced validation• Downstream (application) validation
on-chip
off-chip
27
Tuesday, 6 September 16
60IWBDA 2016 - Newcastle Upon Tyne /
Post-transcriptional regulation of Azurin, a bacterial QS-activated gene (Nottingham & Newcastle)
Koch, Heeb, Camara, Dubern, Krasnogor
28
Tuesday, 6 September 16
60IWBDA 2016 - Newcastle Upon Tyne /
Combinatorial Library Design (DNALD) & Construction (EWD): the Azurin example
• Bacteria regulate gene expression at the transcriptional and post- transcriptional level• RsmA global post-transcriptional regulator, modulates switch between acute and chronic infection (p. aeruginosa @ cystic fibrosis) • RsmA positively and negatively regulates target mRNAs by binding to mRNA secondary structures (stem loops-palindromic sequences)•RsmA homologues (CsrA) present in a variety of bacteria, Gram-positive and Gram-negative
29
Tuesday, 6 September 16
60IWBDA 2016 - Newcastle Upon Tyne /
It is postulated that RmsA positively regulates Azurin
Three hypothetical loops in the mRNA
2nd and 3rd AGGA is in the loop of the stem
30
Tuesday, 6 September 16
60IWBDA 2016 - Newcastle Upon Tyne /
It is postulated that RrmsA positively regulates Azurin
31
Tuesday, 6 September 16
60IWBDA 2016 - Newcastle Upon Tyne /
It is postulated that RrmsA positively regulates Azurin
32
Tuesday, 6 September 16
60IWBDA 2016 - Newcastle Upon Tyne /
It is postulated that RrmsA positively regulates Azurin
33
Tuesday, 6 September 16
60IWBDA 2016 - Newcastle Upon Tyne /
Post-transcriptional regulation of Azurin, a bacterial QS-activated gene (Nottingham & Newcastle)
Koch, Heeb, Camara, Dubern, Krasnogor
34Tuesday, 6 September 16
60IWBDA 2016 - Newcastle Upon Tyne /
Results•Gel electrophoresis analysis of a representative set of 16 of the Azurin library targets shows that all constructs are of the expected size with no spurious assembly products
•Western blot from extracts of Pseudomonas aeruginosa expressing the azurine gene incubated with anti-azurin polyclonal antibodies
37
Tuesday, 6 September 16
60IWBDA 2016 - Newcastle Upon Tyne /
Outline
• Computational & Hardware support for designing and manufacturing Combinatorial DNA at your Desk
• Machine Intelligence for Synthetic Biology
•Conclusions
38
Tuesday, 6 September 16
60IWBDA 2016 - Newcastle Upon Tyne /
Synthetic Polymers For Controlling QS Dependent Phenotypes
Bacterial Sequestrant
Dual action
QS Quencher
39
Tuesday, 6 September 16
60IWBDA 2016 - Newcastle Upon Tyne /
On Roll Royces & Ford Ts: an analogy
• Hand-crafted • + Comfortable• + Reliable/Robust• Faster• + Expensive • Selective
• Assembly Line Product• - Comfortable• - Reliable/Robust• Slower• Cheaper• Ubiquitous/Popular
41
Tuesday, 6 September 16
60IWBDA 2016 - Newcastle Upon Tyne /
Modular models for SynBio design
http://www.virtualparts.org42
Tuesday, 6 September 16
60IWBDA 2016 - Newcastle Upon Tyne /
What does the VPR do?
•Provides modular, composable, dynamic models of genetic components
•AND includes models of the upper layers of molecular biology they encode (mRNA, proteins, metabolites etc.)•AND their interactions
•SBML and Rule Based•Facilitates model-based design•Supports automated design
•e.g. Computational Intelligence•Supports CAD tools and languages
G. Misirli, J. Hallinan, and A. Wipat, “Composable modular models for synthetic biology,” ACM J. Emerging Technologies in Computing Systems, vol. 11, iss. 3, pp. 1-19, 2014
43Tuesday, 6 September 16
60IWBDA 2016 - Newcastle Upon Tyne /
Synthetic Biology Open Language (SBOL)•Synthetic biology standard (currently Version 2.0):
•Designed to allow for the exchange of descriptions of genetic parts, devices, modules, and systems.
•Facilitates storage of genetic designs in repositories.
•Allows for designs of genetic parts and systems to be embedded in publications.
•SBOL can be used to create workflows between different tools Galdzicki et al., Nature Biotechnology (2014)
Six independent groups collaborated on the design of a set of genetic toggle switches. using several SBOL enabled tools.
44
Tuesday, 6 September 16
60IWBDA 2016 - Newcastle Upon Tyne /45
An Environment for Augmented Biodesign Using Integrated Data Resources James McLaughlin, Goksel Misirli, Matthew Pocock, and Anil WipatIWBDA 2016
Tuesday, 6 September 16
60IWBDA 2016 - Newcastle Upon Tyne /
User
create data-informed designData augmenteddesign AmBiT
Data enrichment:BLASTEMBOSSdatabase cross refs
Other SBOL Stackinstances
46
An Environment for Augmented Biodesign Using Integrated Data Resources James McLaughlin, Goksel Misirli, Matthew Pocock, and Anil WipatIWBDA 2016
Tuesday, 6 September 16
60IWBDA 2016 - Newcastle Upon Tyne /
Meta-Stochastic Simulationssapredict - Web application using classifiers as a tool for biologists to deduce the best stochastic simulation algorithm for their model
User simply clicks to upload stochastic model in SBML format
Fast model property analysis is performed (C++ and igraph)
Algorithm prediction performed using biomodels analysis. (Linear SVC using python sklearn)
Results displayed. User can then download preconfigured simulator to execute their model
47
Tuesday, 6 September 16
60IWBDA 2016 - Newcastle Upon Tyne /
Automated Model Analysis forSimulations Reaction & species
dependency graphs generated from models
Clocks identify fast to compute properties
48
Tuesday, 6 September 16
60IWBDA 2016 - Newcastle Upon Tyne /
•Model checking: Exhaustively, verifies whether a property holds by a model of a system. Statistical model checking (SMC) integrates the simulation technique with model checking by generating and verifying a number of simulation paths to determine an “approximate correctness” of queried properties.
•Machine Learning method for selecting the most appropriate Stochastic Simulation Algorithms (SSAs) has been extended to Statistical Model Checkers (SMCs) selection.
•However, there are intrinsic differences between simulation algorithms and model checkers; model checkers require both the model & property specifications.
•Our methodology is illustrated for frequently used properties in the literature, called property patterns.
Automated Model Analysis forFormal Verification
In collaboration with Prof. M. Gheorghe, Dr. Savas Konur (Bradford University) & Mehmet E. Bakir (Sheffield University)
50Tuesday, 6 September 16
60IWBDA 2016 - Newcastle Upon Tyne /
Verification Patterns•Patterns are frequently used property types for querying features of models (e.g., something is always the case, something will eventually be the case)•Below are 8 frequently used patterns represented in natural language and using existing temporal logic operators
51
Tuesday, 6 September 16
60IWBDA 2016 - Newcastle Upon Tyne /
SMCs Prediction•The SSAs prediction method has been extended by allowing parallel edges for species and reaction dependency graphs and some non-graph properties such as, the number of updated variables involved in a reaction - min, mean, max and sum of the update values.
•Support Vector Machine (SVM) prediction of the fastest SMC presented below.
Patterns AccuracyEventually 0.945Always 0.927Follows 0.961Precedes 0.967Never 0.942Steady-State 0.939Until 0.941Infinitely-Often 0.961
54
Tuesday, 6 September 16
60IWBDA 2016 - Newcastle Upon Tyne /
Outline
• Computational & Hardware support for designing and manufacturing Combinatorial DNA at your Desk
• Machine Intelligence for Synthetic Biology
•Conclusions
55
Tuesday, 6 September 16
60IWBDA 2016 - Newcastle Upon Tyne /
u domain specific language for synthetic biology
u SB entities (genes, proteins, promoters) first class entities
u implemented as Eclipse RCP
Synthetic Biology Life CycleDesign
u emphasis on high performanceu 9 different stochastic simulation
algorithm variantsu automated algorithm selectionu MPI support
Simulation
VerificationBiocompilationu quasi-natural language for
definition of propertiesu automatic translation into
temporal logicsu automated algorithm
selection
u links to sequence repositories u design completion with terminators,
RBS, spacers, ...u consideration of custom constraints
VERIFY [ GFP > 0 uM ] EVENTUALLY HOLDSVERIFY [ GFP > 0 uM ] ALWAYS HOLDSVERIFY [ GFP > 2*RFP ] NEVER HOLDS
GTATAATTACGGCTACAATGCGCCGTTATT
56
Tuesday, 6 September 16
60IWBDA 2016 - Newcastle Upon Tyne /
Synthetic Biology Life Cycle
Design Simulation
VerificationBiocompilation
Data Analytics &Machine
Intelligence
“Wind Tunneling” via desktop
microfluidics
57
Tuesday, 6 September 16
60IWBDA 2016 - Newcastle Upon Tyne /
Synthetic Biology Life Cycle
SBOL filesDSL filesComputational logsEngineering Protocols Experimental logs(seq, proteomics, metabolomics, optical, etc)etc
58
Tuesday, 6 September 16
60IWBDA 2016 - Newcastle Upon Tyne /
Synthetic Biology Life Cycle
SBOL filesDSL filesComputational logsEngineering Protocols Experimental logs(seq, proteomics, metabolomics, optical, etc)etc
SBOL filesDSL filesComputational logsEngineering Protocols Experimental logs(seq, proteomics, metabolomics, optical, etc)etc
58
Tuesday, 6 September 16
60IWBDA 2016 - Newcastle Upon Tyne /
Synthetic Biology Life Cycle
SBOL filesDSL filesComputational logsEngineering Protocols Experimental logs(seq, proteomics, metabolomics, optical, etc)etc
SBOL filesDSL filesComputational logsEngineering Protocols Experimental logs(seq, proteomics, metabolomics, optical, etc)etc
SBOL filesDSL filesComputational logsEngineering Protocols Experimental logs(seq, proteomics, metabolomics, optical, etc)etc
58
Tuesday, 6 September 16
60IWBDA 2016 - Newcastle Upon Tyne /
Synthetic Biology Life Cycle
SBOL filesDSL filesComputational logsEngineering Protocols Experimental logs(seq, proteomics, metabolomics, optical, etc)etc
SBOL filesDSL filesComputational logsEngineering Protocols Experimental logs(seq, proteomics, metabolomics, optical, etc)etc
SBOL filesDSL filesComputationally logsEngineering Protocols Experimental logs(seq, proteomics, metabolomics, optical, etc)etc
SBOL filesDSL filesComputational logsEngineering Protocols Experimental logs(seq, proteomics, metabolomics, optical, etc)etc
58
Tuesday, 6 September 16
60IWBDA 2016 - Newcastle Upon Tyne /
Synthetic Biology Life Cycle
SBOL filesDSL filesComputational logsEngineering Protocols Experimental logs(seq, proteomics, metabolomics, optical, etc)etc
SBOL filesDSL filesComputationally logsEngineering Protocols Experimental logs(seq, proteomics, metabolomics, optical, etc)etc
SBOL filesDSL filesComputational logsEngineering Protocols Experimental logs(seq, proteomics, metabolomics, optical, etc)etc
SBOL filesDSL filesComputationally logsEngineering Protocols Experimental logs(seq, proteomics, metabolomics, optical, etc)etc SBOL files
DSL filesComputationally logsEngineering Protocols Experimental logs(seq, proteomics, metabolomics, optical, etc)etc
SBOL filesDSL filesComputational logsEngineering Protocols Experimental logs(seq, proteomics, metabolomics, optical, etc)etc
58
Tuesday, 6 September 16
60IWBDA 2016 - Newcastle Upon Tyne /
Synthetic Biology Life Cycle
SBOL filesDSL filesComputational logsEngineering Protocols Experimental logs(seq, proteomics, metabolomics, optical, etc)etc
SBOL filesDSL filesComputationally logsEngineering Protocols Experimental logs(seq, proteomics, metabolomics, optical, etc)etc
SBOL filesDSL filesComputationally logsEngineering Protocols Experimental logs(seq, proteomics, metabolomics, optical, etc)etc
SBOL filesDSL filesComputational logsEngineering Protocols Experimental logs(seq, proteomics, metabolomics, optical, etc)etc
SBOL filesDSL filesComputational logsEngineering Protocols Experimental logs(seq, proteomics, metabolomics, optical, etc)etc
SBOL filesDSL filesComputationally logsEngineering Protocols Experimental logs(seq, proteomics, metabolomics, optical, etc)etc
SBOL filesDSL filesComputational logsEngineering Protocols Experimental logs(seq, proteomics, metabolomics, optical, etc)etc
SBOL filesDSL filesComputationally logsEngineering Protocols Experimental logs(seq, proteomics, metabolomics, optical, etc)etc SBOL files
DSL filesComputationally logsEngineering Protocols Experimental logs(seq, proteomics, metabolomics, optical, etc)etc
SBOL filesDSL filesComputational logsEngineering Protocols Experimental logs(seq, proteomics, metabolomics, optical, etc)etcSBOL files
DSL filesComputationally logsEngineering Protocols Experimental logs(seq, proteomics, metabolomics, optical, etc)etc
58
Tuesday, 6 September 16
60IWBDA 2016 - Newcastle Upon Tyne /
Synthetic Biology Life Cycledisrupted by machine learning, data analytic and peer-to-peer
data-driven bio-manufacturing
so we can finally find out what the heck
just happened!?!?
Like “Neural Grafting” for BioRobots
59
Tuesday, 6 September 16
My colleagues at the ICOS and CSBB in Newcastle
Prof. A. Wipat (Newcastle U.)Dr. M. Gheorghe (Bradford U.) Dr. J. Bacardit (Newcastle U.)Prof. P. Wright (Newcastle U.)Prof. C. Alexander (U. Nottingham)Dr. F. Fernandez-Trillo (U. Birmingham)Prof. M. Camara (U. Nottingham)Dr. S. Heeb (U. Nottingham)Dr. J. Dubern (U. Nottingham)Prof. C. Biggs (U. Sheffield)Dr. S. Konur (Bradford U.)Dr. S. Kalvala (Warwick U.)Dr. C. Ladrou (Warwick U.)Dr. C. Delattre (Illumina)Dr. A. Rivald (Illumina)Prof. E. Shapiro (Weizmann Institute)Dr. T. Ben Yehezquel (Weizmann Institute)Prof. U. Feigel (Weizmann Institute)
!
60IWBDA 2016 - Newcastle Upon Tyne /
Acknowledgements
EP/N031962/1
EP/J004111/2
EP/D021847/2
EP/I031642/2
BB/F01855X/1
BB/D019613/1
5 Years Research Managing Directorfor a new £8M grant:
http://tinyurl.com/h99vl3h
closing date: 5/September/2016
60
Tuesday, 6 September 16