+ All Categories
Home > Documents > Pluripotency Markers in Stem Cells of Bats - Onjourn · 2019-07-04 · development. Other positive...

Pluripotency Markers in Stem Cells of Bats - Onjourn · 2019-07-04 · development. Other positive...

Date post: 06-Jul-2020
Category:
Upload: others
View: 0 times
Download: 0 times
Share this document with a friend
12
Journal of Stem Cell and Developmental Biology Volume 1, Issue 1 Article ID: 100001 Page 1 of 12 Volume 1, Issue 1, Article ID: 100001 Research Article Pluripotency Markers in Stem Cells of Bats Cornelio Sánchez-Hernández 1 , Martha Martínez-Cisneros 2 , María de Lourdes Romero-Almaraz 3 , Gary D. Schnell 4 , Elizabeth Morales-Sanchez 5 , Marco Cerbón 5,6 , and Luz E. Alcántara-Quintana 7* 1 Department of Zoology, Institute of Biology, National Autonomous University of Mexico, México 2 Department of Embryology, Faculty of Medicine, National Autonomous University of Mexico, México 3 Escuinapa No. 92 bis. Col. Pedregal de Santo Domingo, México 4 Sam Noble Oklahoma Museum of Natural History and Department of Zoology, University of Oklahoma, USA 5 Department of Biology, Faculty of Chemistry, National Autonomous University of Mexico, México 6 Research Unit of Human Reproduction, National Institute of Perinatology, México 7 Faculty of Nursing and Nutrition, The Autonomous University of San Luis Potosí, Mexico *Corresponding author: Luz E. Alcántara-Quintana, Faculty of Nursing and Nutrition, The Autonomous University of San Luis Potosí, Mexico, E-mail: [email protected] Received: January 03, 2018; Accepted: February 08, 2018; Published: February 15, 2018 Copyright: ©2018 Sánchez-Hernández C, et al. This is an open access article distributed under the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited. Citation: Sánchez-Hernández C, Martínez-Cisneros M, Romero-Almaraz ML, Schnell GD, Morales-Sanchez E, et al. (2018) Pluripotency Markers in Stem Cells of Bats. J Stem Cell Dev Biol 1(1): 100001. Abstract Stem cells, a special kind of undifferentiated cells, are able indefinitely to go through mitotic cell division without losing their properties and produce differentiated cell lines. Due to their potential use in medicine, there is considerable research interest focusing in the study of embryonic stem cells and adult stem cells. Special emphasis has been placed on the study of embryonic germ cells, which characterized by expressing stem cell markers SSEA-1, SSEA-3, SSEA-4, TRA1-60, TRA1-8, alkaline phosphatase, periodic acid-Schiff and others. Stem cell research in bats could be the guide for further embryologic studies in other wild mammal species. We used SSEA-1, Oct-4, Stella, Sox- 9 and Nanog stem cells markers (immunohistochemistry and RT-PCR) and observed the mRNA expression in bat embryos of A. jamaicensis and adult tissues of A. jamaicensis and B. plicata bats. An AP+ cell population and SSEA- 1+ (primitive intestine) population were identified using markers during stages, 9, 10, 11 and 12 -the beginning of development. Other positive cell populations were identified (stages 11 and 12) using two other markers: PAS and Oct- 4. On the other hand, we observed higher levels of mRNA expression of Oct-4 and Nanog in the first stages but not in more advances stages of development, and the expression of Stella and Sox-9 showed levels of expression alternating times along of stages. This is the first report of pluripotency markers of stem cells in A. jamaicensis, Oct-4 presence in functional gametes of B. plicata adults and the presence of Stella, Nanog and Sox-9 in bat embryonic and adult tissues. Keywords: germinal cells, alkaline phosphatase, periodic acid-schiff, Stage-Specific Embryonic Antigen-1, Octamer- 4, bats
Transcript
Page 1: Pluripotency Markers in Stem Cells of Bats - Onjourn · 2019-07-04 · development. Other positive cell populations were identified (stages 11 and 12) using two other markers: PAS

Journal of Stem Cell and Developmental Biology Volume 1, Issue 1 Article ID: 100001

Page 1 of 12 Volume 1, Issue 1, Article ID: 100001

Research Article

Pluripotency Markers in Stem Cells of Bats

Cornelio Sánchez-Hernández1, Martha Martínez-Cisneros2, María de Lourdes

Romero-Almaraz3, Gary D. Schnell4, Elizabeth Morales-Sanchez5, Marco Cerbón5,6,

and Luz E. Alcántara-Quintana7*

1Department of Zoology, Institute of Biology, National Autonomous University of Mexico, México

2Department of Embryology, Faculty of Medicine, National Autonomous University of Mexico, México

3Escuinapa No. 92 bis. Col. Pedregal de Santo Domingo, México

4Sam Noble Oklahoma Museum of Natural History and Department of Zoology, University of Oklahoma, USA

5Department of Biology, Faculty of Chemistry, National Autonomous University of Mexico, México

6Research Unit of Human Reproduction, National Institute of Perinatology, México

7Faculty of Nursing and Nutrition, The Autonomous University of San Luis Potosí, Mexico

*Corresponding author: Luz E. Alcántara-Quintana, Faculty of Nursing and Nutrition, The Autonomous University of

San Luis Potosí, Mexico, E-mail: [email protected]

Received: January 03, 2018; Accepted: February 08, 2018; Published: February 15, 2018

Copyright: ©2018 Sánchez-Hernández C, et al. This is an open access article distributed under the Creative Commons

Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original

work is properly cited.

Citation: Sánchez-Hernández C, Martínez-Cisneros M, Romero-Almaraz ML, Schnell GD, Morales-Sanchez E, et al.

(2018) Pluripotency Markers in Stem Cells of Bats. J Stem Cell Dev Biol 1(1): 100001.

Abstract

Stem cells, a special kind of undifferentiated cells, are able indefinitely to go through mitotic cell division

without losing their properties and produce differentiated cell lines. Due to their potential use in medicine, there is

considerable research interest focusing in the study of embryonic stem cells and adult stem cells. Special emphasis

has been placed on the study of embryonic germ cells, which characterized by expressing stem cell markers SSEA-1,

SSEA-3, SSEA-4, TRA1-60, TRA1-8, alkaline phosphatase, periodic acid-Schiff and others. Stem cell research in bats

could be the guide for further embryologic studies in other wild mammal species. We used SSEA-1, Oct-4, Stella, Sox-

9 and Nanog stem cells markers (immunohistochemistry and RT-PCR) and observed the mRNA expression in bat

embryos of A. jamaicensis and adult tissues of A. jamaicensis and B. plicata bats. An AP+ cell population and SSEA-

1+ (primitive intestine) population were identified using markers during stages, 9, 10, 11 and 12 -the beginning of

development. Other positive cell populations were identified (stages 11 and 12) using two other markers: PAS and Oct-

4. On the other hand, we observed higher levels of mRNA expression of Oct-4 and Nanog in the first stages but not in

more advances stages of development, and the expression of Stella and Sox-9 showed levels of expression alternating

times along of stages. This is the first report of pluripotency markers of stem cells in A. jamaicensis, Oct-4 presence in

functional gametes of B. plicata adults and the presence of Stella, Nanog and Sox-9 in bat embryonic and adult

tissues.

Keywords: germinal cells, alkaline phosphatase, periodic acid-schiff, Stage-Specific Embryonic Antigen-1, Octamer-

4, bats

Page 2: Pluripotency Markers in Stem Cells of Bats - Onjourn · 2019-07-04 · development. Other positive cell populations were identified (stages 11 and 12) using two other markers: PAS

Journal of Stem Cell and Developmental Biology

Page 2 of 12 Volume 1, Issue 1, Article ID: 100001

Abbreviations: GCs: Germinal Cells; AP: Alkaline Phosphatase; PAS: Periodic Acid-Schiff; SSEA-1: Stage-Specific

Embryonic Antigen-1; Oct-4: Octamer-4; Dppa3: Developmental Pluripotency-Associated Protein 3; Sox-9: SRY-box

containing gene 9; Nanog: Homeobox protein-nanog

Introduction

In mammals, germinal cells (GCs) are segregated in an asymmetric form during each cell division of the

embryo, and in each case a different cell line is generated. There is evidence that GC inherently have all of the

machinery needed to determine their germinal-cell status. Their expression is influenced by extracellular factors and

cell-cell interactions, which induce these precursors of cell to divide [1-5].

GCs have been studied and identified during the first embryogenesis stages in mice [1,2,4], rats [6] and

chickens [7]. These cells migrate through the hindgut to the gonadal ridges, where they differentiate in pro-

spermatogonia in the testes and oocytes in the ovaries, eventually becoming gametes [8]. Given that GCs show

significant alkaline phosphatase (AP) activity it has been possible to use markers for this enzyme to identify GCs

during early stages of embryogenesis (chicken and mice) near the yolk sac in the extraembryonic region [9,10]. Other

markers used to characterize GCs in chicken embryos are Periodic Acid-Schiff (PAS) [7,11,12] and the stage-specific

embryonic antigen SSEA-1 which has also been used in turkey embryos [13].

SSEA-1 is considered one of the best antibodies used to identify GCs in embryos of mice [14-16], chickens

[17,18] and pigs [19]. It also has been used as a marker for other germinal cell lines during embryonic development of

the rat [20]. SSEA-1 positive (SSEA-1+) cells have been identified in the dorsal spine of chicken embryos [21], in

mouse and chicken embryonic stem cells, and in embryonic carcinoma cells of mice and chickens [22-24] For these

reasons, SSEA-1 has been considered as a pluripotency marker [25]. Oct-4 (a transcription factor also known as

Pou5f1), as with SSEA-1, is an excellent pluripotency marker, and these two immunohistochemical markers are the

most frequently used in the characterization of germinal cell lines, such as embryonic stem cells. Oct-4 has been

found in mouse oocytes, the ectoderm of recently implanted mouse embryos, GCs, and embryonic stem cells. Oct-4

has similar functions to other pluripotency genes like Sox-9, Nanog and Esg-1 [26]. Stella, also known as PGC7 or

Dppa3, is another gene that is expressed in GCs and their descendants, including oocites [27-29]. Given that Oct-4

and Stella are specifically expressed in germinal cell lines, they have been considered as key molecules in the

differentiation and development of germinal cells [30,31]. Oct-4 is a transcription factor necessary for the survival

and migration of GCs during the last stages of embryo development [32]. This is contrary to the Stella gene, which is

responsible for the specification of germinal cells when the embryo is in the epiblast phase or during its first stages of

development [33].

Nanog is other transcription factor, overall with Sox2, factors critical for the pluripotency and self-renewal of

embryonic stem cells. Their down regulations lead to differentiation, accompanied with changes in cell motility [34].

SOX-9 recognizes the sequence CCTTGAG along with other members of the HMG-box class DNA-binding proteins. It

acts during chondrocyte differentiation and, with steroidogenic factor 1, regulates transcription of the anti-Müllerian

hormone (AMH) gene. SOX-9 also plays a pivotal role in male sexual development; by working with Sf1, SOX-9 can

produce AMH in Sertoli cells to inhibit the creation of a female reproductive system [35,36].

Even though germinal cell line studies are numerous, most research to date has been limited to laboratory

animals (birds, mice, rats, pigs). On occasion, we work has been done on human cells due to the clinical importance of

such research [37].

However, similar research projects on wild animals such as bats (which are the second most diverse

mammalian order and represent more than 20 % of known mammalian species [38] are practically non-existent, with

Page 3: Pluripotency Markers in Stem Cells of Bats - Onjourn · 2019-07-04 · development. Other positive cell populations were identified (stages 11 and 12) using two other markers: PAS

Journal of Stem Cell and Developmental Biology

Page 3 of 12 Volume 1, Issue 1, Article ID: 100001

exception of recent projects for example, identification of cortical germ cells in adult ovaries from three phyllostomid

bats [39], the generation and characterization of bat-induced pluripotent stem cells [40] and the characterization of

gametes in two phyllostomid bat species [41]. But not emphasis in pluripotency markers.

The purpose of the current work was to identify pluripotency markers and characterize germinal cells in

embryos of the bat Artibeus jamaicensis and in testes and tissues of adult Artibeus jamaicensis and Balantiopteryx

plicata using AP, PAS, SSEA-1 immunohistochemical and genetic expression markers like, Oct-4, Stella, Sox-9 and

Nanog.

Materials and Methods

Due to the difficulty of breeding and keeping bats in captivity, embryos were taken from pregnant females

collected in the wild from the state of Colima and Jalisco, Mexico. In total, 18 A. jamaicensis embryos and 1 male

adult as well as 6 B. plicata adult males were available; all of which were preserved in 70 % ethanol soon after

capture. All animal maintenance and handling were carried out in accordance with the Guidelines of the Mexican Law

of Animal Protection (NOM-062-ZOO-1999), and under the Institutional Committee for the Care and Handling of

Laboratory Animals from the Faculty of Chemistry (CICUAL programme), from the National Autonomous University

of México. Appropriate permits were obtained from the Instituto Nacional de Ecología, Dirección General de Vida

Silvestre FAUT.0103 to C. Sánchez-Hernández.

Embryo size for A. jamaicensis varied from stages 9 to 20 (2 × 2 to 30 × 15 mm) and were homologized with

the defined stages for Carollia perspicillata [42] based mainly on embryo size and organ histological development.

One embryo corresponded to stage 9 (2 × 2 mm), stage 10 (3 × 4 mm), stage 11 (9 × 7 mm), another to stage 12 (10 ×

12 mm) and 14 embryos to stages 17 to 20 (14 × 12 to 30 × 15 mm).

Artibeus jamaicencis embryo histology

In order to describe histologically and determine the location of developing organs in A. jamaicensis

embryos, the two specimens of stages 11 and 12 (9 × 7 and 10 × 12 mm) were selected and used as a point of

comparison with older and larger embryos. Embryos were fixed using buffered formalin for 60 min or Bouin’s for 120

min. They were dehydrated in an alcohol gradual series of 80, 90, 96, and 100 %, with a 40- min period at each step.

Xylene was used as a clearing agent for another 40 min, and embryos were embedded in Paraplast overnight. The

next day they were included in histology cassettes, and 5-µm sagittal and horizontal histological sections were

prepared using a Leica RM2125R microtome. The sections were stained with haematoxylin and eosin (H&E). For

further morphological analyses, sections were microphotographed using a Leica DMLB microscope in conjunction

with the Pixe Link software.

SSEA-1, Oct-4 and Stella immunohistochemistry

All slides of the 18 A. jamaicensis embryos and 6 B. plicata adults were incubated with primary antibodies

for SSEA-1, Oct-4 or Stella (Santa Cruz Biotechnology), in a 1:200 dilution at 4°C overnight. The following day the

samples were incubated with anti-goat, anti-mice or anti-rabbit secondary antibodies, respectively at 4°C overnight;

all secondary antibodies were horseradish peroxidase (HRP) conjugates. The next day the signal was developed using

3,3’-diaminobenzidine (DAB, Vector).

Alkaline phosphatase and periodic acid-Schiff treatment

For AP treatment, the 18 embryo slides were immersed in acetone for 5 min at 4°C, after which they were

incubated in a 5-bromo-4-chloro-3-indolyl phosphate nitro blue tetrazolium (NBT-BCIP) solution for 1 hour at 37°C.

The samples were fixed in sucrose-buffered formalin for 5 min, washed in running water and counterstained with

eosin for 5 min. After washing the samples, a second time in running water, they were embedded in resin. As a

Page 4: Pluripotency Markers in Stem Cells of Bats - Onjourn · 2019-07-04 · development. Other positive cell populations were identified (stages 11 and 12) using two other markers: PAS

Journal of Stem Cell and Developmental Biology

Page 4 of 12 Volume 1, Issue 1, Article ID: 100001

positive control to corroborate the presence of GCs, three mouse embryos with a 12-day gestation period were used

for the AP reaction, and three chicken embryos in primitive streak stage were used for the PAS reaction. For PAS

reactions the paraffin was removed from the sections and they were rehydrated. They then were submerged for 5 min

in periodic acid, washed for 3 min in running water, and placed in Schiff reagent for 15 min. Samples were washed,

dehydrated and embedded for further observation and microscopic analysis.

RNA preparation, dna synthesis and reverse transcription-polymerase chain reaction

RNA was extracted from adult tissue of Artibeus and Balantiopteryx, and embryo tissue of Artibeus samples

previously stored in AM7020 RNAlater® (Applied Biosystems) via the Tripure® method (11667165001, Roche Applied

Science). Prepared RNA sample quality was analyzed with NanoDrop® and Bioanalyzer® (Agilent Technologies).

Total RNA was transcribed to complementary DNA (cDNA) according to the SuperScript First-Strand Synthesis

System for RT-PCR protocol (Catalog No. 11904-018, Invitrogen). Briefly, 1 μg of total RNA, 1 μl dNTPs mix, 1 μl

Oligo(dT)12-18 (0.5 μg/μl) were brought to a final volume of 10 μl with DEPC-treated water. The mixture was pre-

incubated for 5 min at 65°C, and chilled on ice for 5 min. We added 2 μl 10x RT buffer, 4 μl 25 mM MgCl2, 2 μl 0.1 M

DTT, 1 μl RNAse inhibitor, and incubated at 42°C for 2 min. Then we added 1 μl SuperScript® II RT to each tube,

mixed and incubated the mixture at 42°C for 50 min, completing the reaction at 70°C for 15 min. We collected

reaction material after brief centrifugation at 4°C. Finally, we added 1 μl of RNase H to each tube and incubated for

20 min at 37°C before proceeding to blank DNA amplification, five microliters of cDNA were amplified with Oct-4,

Stella, Sox9, Nanog and β-actin oligonucleotides in a Palm-Cycler® thermal cycler (Corbett Life Science CG1-96) in a

total volume of 50 μl containing 5 μl 10X PCR buffer, 1.5 μl 50 mM MgCl2, 1 μl 10 mM dNTP mix, 1 μl sense

oligonucleotide at 10 mM concentration, 1 μl antisense oligonucleotide at 10 mM concentration, 0.3 μl Taq DNA

polymerase (5 units/μl), 5 μl complementary DNA (from the earlier reaction) and lastly 35.2 μl DEPC-treated water.

The Oct-4 oligonucleotide were the following: sense (5’-3’) GAG GAG TCC CAG GAC ATG AA and antisense

(5’-3’) GTG GTC TGG CTG AAC ACC TT, Stella 5' TAG CCT GGG GGT AGA CTC GGC TGT AT 3' and 5' AAC GAG

AAG AGA AGG GAG GGC TTC 3´. Sox-9 oligonucleotide were the following: sense (5’-3’) AAT CTC CTG GAC CCC

TTC AT and antisense (5’-3’) GTC CTC CTC GCT CTC CTT CT, Nanog oligonucleotide were the following: sense (5’-3’)

TCC CCAAAG CTT TTG and antisense (5’-3’) GGC CAG TTG TTT TTC TGC C.

There were amplification cycles with the following characteristics: 94°C for 2 min, (94°C for 30 s, 57°C for 1

min, 68°C for 1 min), 68°C for 7 min, and the pairs of bases results were 151, 30, 264 and 458 respectively. The

following oligonucleotides were utilized for β-actin: sense CCAAGGCCAACCGCGAGAAGATGAC and antisense

AGGGTACATGGTGGTGCCGCCAGAC. There were 35 amplification cycles for β-actin with the following

characteristics: 94°C for 5 min, (94°C for 30 sec, 66°C for 30 sec, 68°C for 1 min), 68°C for 7 min. Is 587 pb the result

fragment by these gene. The amplified samples were run through electrophoresis in 2 % agarose gel; the PCR

products were stained with 2.5 μl GelRed® (41002, Biotium). Gel photographs were taken with an ultraviolet light

transilluminator coupled to a computer running Dolphin-1D® software (Wealtec). Densitometry was performed

according to the parameters established by the software and t student test was applicable.

Results

Histology and stage assignation of Artibeus jamaicensis embryos

Stage 11 and 12 embryos (9 × 7 and 10 × 12 mm) of A. jamaicensis were stained with haematoxylin and eosin

(H&E). This allowed for ready identification of the fore (FB), middle (MB) and hind brain (HB), pharyngeal arches

(PA), ear (Ea), heart (H), lung (L), bladder (B), liver (Li), stomach (S), intestines (I), vertebrate column (VC), forelimb

Page 5: Pluripotency Markers in Stem Cells of Bats - Onjourn · 2019-07-04 · development. Other positive cell populations were identified (stages 11 and 12) using two other markers: PAS

Journal of Stem Cell and Developmental Biology

Page 5 of 12 Volume 1, Issue 1, Article ID: 100001

(FL) buds and hind limbs (HL) (Figures 1A-1C). These organs show a degree of development similar to C.

perspicillata embryos of stage 11 and 12.

Figure 1: Artibeus jamaicensis embryo histology. (A) Longitudinal section of one embryo length 9 × 7 mm (stage 11)

stained with H&E; this allowed to easily identify the fore (FB), middle (MB) and hind brain (HB), pharyngeal arches

(PA), ear (Ea), heart (H), bud lung (BL), liver (Li), intestines (I), vertebral column with 24 to 25 somite’s (SC), hind

limbs (hl). (B) Longitudinal section of one embryo length 12 × 10 mm (stage 12) shows the eye (Ey), stomach (S),

lower and upper jawbone (J), umbilical vein (UV), bladder (B), lung (L), and sacrum (Sa). (C) Increased magnification

(20x) of the same longitudinal section of embryo (12 × 10 mm, stage 12), making visible the primitive gut zone (GZ).

SSEA-1 antibody immunohistochemistry

For the same sections (stage 11 and 12 embryos), SSEA-1 immunolabel was found in the germinal centers of

heart (H), liver (Li), and forelimb buds (fb), hind limbs (hl) and chondrogenesis sites (C) localized in vertebral column

(SC). (Figure 2A). At greater resolution (40x, Figure 2B), the germinal cells are identifiable in the primitive intestine

zone (PI), along the germinal line, where germinal cells have been observed migrating towards the gonadal ridges in

mice. Thus, the presence of germinal cells at this location has been corroborated for bats. Figure 2C shows a negative

control for the primitive intestine zone for bat embryos.

Figure 2: Artibeus jamaicensis embryo SSEA-1 immunohistochemistry. (A) Longitudinal section of A. jamaicensis

embryo of 9 × 7 mm (stage 11) shows immunolabel in the germinal centers of heart (H), liver (Li), forelimb buds (fb),

hind limbs (hl) and chondrogenesis sites (C) localized in vertebral column (SC). Bar 20 µm. (B) At greater resolution

(40x), embryo of length 9 × 7 mm (stage 11) depicts germinal cells (GC) located in the primitive intestine (PI) zone,

along the germinal line, where they have been observed migrating towards the gonadal ridges in bats. (C) SSEA-1

negative control in longitudinal section for the primitive intestine zone (PI) for bat embryo (stage 12).

Oct-4 antibody immunohistochemistry

Page 6: Pluripotency Markers in Stem Cells of Bats - Onjourn · 2019-07-04 · development. Other positive cell populations were identified (stages 11 and 12) using two other markers: PAS

Journal of Stem Cell and Developmental Biology

Page 6 of 12 Volume 1, Issue 1, Article ID: 100001

The adult sections of testes of. B. plicata (Figure 3A) show the seminiferous tubules surrounded by

interstitial cells (IC). In the interior of the tubules, Sertoli (SeC) and spermatogenic cells (SC) can be identified. Some

cells in the series are Oct-4 positive (Figure 3B). In contrast, the Oct-4 label in A. jamaicensis embryos was observed

in chondrogenesis sites in the vertebral column (SC), as well as liver (Li) and lung (L) germinal centers (Figure 3C).

Figure 3D depicts an Oct-4 negative control for an A. jamaicensis embryo.

Figure 3: Localization of embryo Oct-4 immunohistochemistry. (A) Haematoxylin and eosin (H&E) of sections of adult

testes belonging to B. plicata show the seminiferous tubules surrounded by interstitial cells (IC). In the tubules interior,

Sertoli (SeC) and spermatogenic cells (SC) can be identified. (B) Oct-4 immunohistochemistry of adult testes shows

that some cells in the seminiferous tubules are Oct-4 positive. (C) Oct-4 label in A. jamaicensis embryos was

recorded at chondrogenesis sites of the vertebral column (SC) and at liver (Li) and lung (L) germinal centers. (D) Oct-

4 negative control for an A. jamaicensis embryo of length 12x10 mm (stage 12).

Stella antibody immunohistochemistry

In A. jamaicensis embryo sections (stages 9 and 10), no tissue was found to be positive for Stella (Figure 4A).

In contrast, Stella-positive cells, which probably belong to a germinal line given their location, were present in the

primitive intestine of mouse embryo positive control tissue (Figure 4B). Figure 4C shows a negative control that

consists of a 12-day gestation of mouse embryo.

Page 7: Pluripotency Markers in Stem Cells of Bats - Onjourn · 2019-07-04 · development. Other positive cell populations were identified (stages 11 and 12) using two other markers: PAS

Journal of Stem Cell and Developmental Biology

Page 7 of 12 Volume 1, Issue 1, Article ID: 100001

Figure 4: Localization in embryo Stella immunohistochemistry. (A) A. jamaicensis bat embryo in which no tissue is

positive for Stella. (B) In contrast, mouse embryo 12-day gestation (positive control tissue), exhibits Stella-positive

cells. (C) Negative control (40x) of 12-days of gestation mouse embryo.

Alkaline phosphatase treatment

The adult sections of testes of B. plicata were treated so as to make AP presence evident. Germinal cells can

be clearly distinguished in the seminiferous tubules (ST), due to their ovoid shape and clear cytoplasm. Furthermore,

their size is significantly larger than that of other cell types (Figure 5A). As a positive control, sections of a 12-day

gestation mouse embryo were used. In the control, AP activity can be observed in the dorsal mesentery (Figure 5B).

The AP label is evident in chondrogenesis (C) sites along the vertebral column in A. jamaicensis embryos (Figures 5C

& 5D).

Figure 5: Alkaline phosphatase treatment (AP). (A) Adult testes sections of B. plicata were treated in order to make

evident AP presence. Germinal cells can be distinguished clearly in the seminiferous tubules (ST) due to their ovoid

shape and clear cytoplasm. (B) As a positive control, sections of a 12-days gestation mouse embryo were used. AP

activity is seen in the dorsal mesentery (DM). (C, D) AP label is evident at chondrogenesis sites (C) along the

vertebral column in A. jamaicensis embryos.

Periodic acid-Schiff treatment

The periodic acid-Schiff treatment showed positive cells in the same chondrogenesis sites as the AP reaction

in vertebral column and zones with hyaline cartilage (hC) (Figures 6A & 6B). In addition, other PAS+ cells were

found in lung tissue (L) belonging to larger-size embryos (30 × 15 mm; Figure 6C).

Page 8: Pluripotency Markers in Stem Cells of Bats - Onjourn · 2019-07-04 · development. Other positive cell populations were identified (stages 11 and 12) using two other markers: PAS

Journal of Stem Cell and Developmental Biology

Page 8 of 12 Volume 1, Issue 1, Article ID: 100001

Figure 6: Periodic acid-Schiff treatment (PAS). (A, B) A. jamaicensis embryos (stages 17-20) showed positive cells

in the same chondrogenesis sites as did the AP reaction in vertebral column (arrow heads) and zones with hyaline

cartilage (C). (C) PAS+ cells were found in lung tissue (L) belonging to larger-sized embryos (30 × 15 mm, stage 20).

mRNA expression

The analysis of mRNA expression levels by semi-quantitative RT-PCR of Oct-4, Nanog, Sox9, Stella and β-

actin in bats embryos of A. jamaicensis and skin, testicle, liver and lung adult tissue of the same species, reveals

significant differences in embryos tissues for Oct4 (p ≤ 0.001), and Nanog (p ≤ 0.04) with relation to the adult tissue

(Figures 7A & 7B), as well as lower levels of mRNA expression for Sox-9 (p ≤ 0.54) and Stella (p ≤ 0.4) with no

significant differences for these genes. Significantly, the gene expression pattern Stella has an on and off in stages

analyzed. It is on in stages 12 and 14 and off at 9 and 10. On the other hand, it is observed that in the case of control

tissue expression of genes Oct4, Nanog and Stella remains constant at 0.5 optical density units (Figure 8).

Figure 7: Reverse transcription-polymerase chain reaction in adult tissue of Artibeus and Balantiopteryx. (A) Germ

cell specific gene primers were used. (B) Densitometry analysis of expression of Oct-4, Nanog, Stella and SOX-9

(relative to a beta-actin internal control) in testicle, skin, liver and lung adult tissue. Data are presented as mean ±

S.D. of three independent experiments.

Page 9: Pluripotency Markers in Stem Cells of Bats - Onjourn · 2019-07-04 · development. Other positive cell populations were identified (stages 11 and 12) using two other markers: PAS

Journal of Stem Cell and Developmental Biology

Page 9 of 12 Volume 1, Issue 1, Article ID: 100001

Figure 8: Gene expression (9, 10, 12 and 14 days of gestation) of the stem cell genes presented by RT-PCR analysis.

(A). Variation in the expression of differentiation genes was found along the time. (B) The graphic representing the

quantitative determinations (normalized to beta actin) of the expression of stem cell or differentiation genes. Data are

presented as mean ± S.D. of three independent experiments.

Discussion

Morphological, physiological and molecular comparisons among species have provided additional insight

with respect to embryo development in mammals. A particular stage of development can be assigned to A.

jamaicensis embryos by comparing them with C. perspicillata embryos (a partially sympatric species of the same

family and similar size) given morphological and histological similarities of the two species. However, studies of

germinal cell lines, allow for a better understanding of embryonic development in this mammal group.

In our project, SSEA-1+ and Oct-4+ cells belonging to germinal lines were identified in tissue buds of the

liver, lung and vertebral column of A. jamaicensis embryos. The fact that these are specific markers for pluripotent

cells and were AP+ and PAS+ for the same regions, may indicate that these cells belong to the embryonic stem-cell

(ESC) line. However, in order to be confirm this statement, other specific genes were used Oct-4, Nanog, Sox-9 and

Stella to differentiate them from other positive cells as well as other adult bats tissues (testes, skin, liver and lung).

In order to be sure of the pluripotency of Oct-4+ cells, testes from adult bats were used as a positive control.

In this case, the label indicated that cells belonged to a GCs line due to the fact that this tissue was Oct-4+

(immunohistochemistry) for a few cells inside the seminiferous tubules. This finding and the gene expression we

found in all embryos stages further indicates that these cells are potentially pluripotent, information that agrees with

Okamura et al. [43]. Okamura et al. [43] indicated that stem cells in spermatogonia express Oct-4, although the exact

function of Oct-4 in spermatogenic germinal cells is still unknown. Besides the expression of Nanog, Stella and Sox-9

confirms the pluripotency of these cells.

Page 10: Pluripotency Markers in Stem Cells of Bats - Onjourn · 2019-07-04 · development. Other positive cell populations were identified (stages 11 and 12) using two other markers: PAS

Journal of Stem Cell and Developmental Biology

Page 10 of 12 Volume 1, Issue 1, Article ID: 100001

Mise et al. [44] and collaborators proposed that there is a difference in target genes expression located

downstream of the Oct-4 transcription factor. In these target genes are activated by this transcription factor, the cells

are related to pluripotency, if they are negatively regulated by Oct-4, a differentiation to a specific cell line takes place.

In the case for Stella, its expression was verified in GCs belonging to mouse embryos (12-day gestation

period; these cells were located in the intermediate mesoderm) due to their analogy with AP+ embryos, where GCs

are clearly visible and identifiable because of their morphology. In addition, we found the mRNA expression of Stella

in stages 12, 14 as well as in the testes and somatic tissues of the adult bat. Stella formerly considered as a marker of

lineage in chick and mouse GCs (8,16), but is now established as a marker of pluripotency for any germ lineage [45].

The increased expression of Nanog gene and Oct-4 in the embryonic stages 9 to 12, consistent with the evidence that

Nanog is a transcription factor than supports the embryonic stem (ES) cell self-renewal, as Oct-4 with a similar

expression (stages 9-12), maintaining both proliferation and are essential for pluripotency [25].

Ours is the first report of immunohistochemistry of pluripotency markers in embryonic tissues of A.

jamaicensis and the Oct-4 presence in functional gametes of B. plicata adults. Also, we were able to demonstrate by

RT-PCR, the presence of Oct-4, Stella, Nanog and Sox-9 in bat embryonic and adult somatic tissues is reported by

first time.

Acknowledgement

This project was carried out in facilities of CMN 20 de Noviembre, ISSSTE, and in the School of Chemistry,

and Medicine of Universidad Nacional Autónoma de México.

Funding

This research received no specific grant from any funding agency in the public, commercial or not-for-profit

sectors.

References

1. Lawson KA, Hage WJ (1994) Clonal analysis of the origin of primordial germ cells in the mouse. Ciba Found

Symp 182: 68-84.

2. Tam PPL, Zhou SX (1996) The allocation of epiblast cells to ectodermal and germ-line lineages is influenced

by the position of the cells in the gastrulating mouse embryo. Dev Biol 178: 124-132.

3. Gardner RL (1998) Contributions of blastocyst micromanipulation to the study of mammalian development.

Bioessays 20: 168-180.

4. Hübner K, Fuhrmann G, Christenson LK, Kehler J, Reinbold R, et al. (2003) Derivation of oocytes from

mouse embryonic stem cells. Science 300: 1251-1256.

5. Dyce PW, Li J (2006) From skin cells to ovarian follicles? Cell Cycle 5: 1371-1375.

6. Bandyopadhyay S, Banerjee S, Pal AK, Goswami SK, Chakravarty B, et al. (2004). Primordial germ cell

migration in the rat: preliminary evidence for a role of galactosyltransferase. Biol Reprod 71: 1822-1827.

7. Jung JG, Kim DK, Park TS, Lee SD, Lim JM, et al. (2005) Development of novel markers for the

characterization of chicken primordial germ cells. Stem Cells 23: 689-698.

8. De Felici M (2000) Regulation of primordial germ cell development in the mouse. Int J Dev Biol 44: 575-

580.

9. Ginsburg M, Snow MH, McLaren A (1990) Primordial germ cells in the mouse embryo during gastrulation.

Development 110: 521-528.

Page 11: Pluripotency Markers in Stem Cells of Bats - Onjourn · 2019-07-04 · development. Other positive cell populations were identified (stages 11 and 12) using two other markers: PAS

Journal of Stem Cell and Developmental Biology

Page 11 of 12 Volume 1, Issue 1, Article ID: 100001

10. Buehr M (1997) The primordial germ cells of mammals: some current perspectives. Exp Cell Res 232: 194-

207.

11. Meyer DB (1960) Application of the periodic acid-Schiff technique to whole chick embryos. Biotechnic &

Histochemistry 35: 83-89.

12. Meyer DB (1964) The migration of primordial germ cells in the chick embryo. Dev Biol 10: 154-190.

13. D’Costa S, Petitte JN (1999) Characterization of stage-specific embryonic antigen-1 (SSEA-1) expression

during early development of the turkey embryo. Int J Dev Biol 43: 349-356.

14. Solter D, Knowles BB (1978) Monoclonal antibody defining a stage-specific mouse embryonic antigen

(SSEA-1). Proc Natl Acad Sci USA 75: 5565-5569.

15. Fox N, Damjanov I, Martinez-Hernandez A, Knowles BB, Solter D (1981) Immunohistochemical localization

of the early embryonic antigen (SSEA-1) in postimplantation mouse embryos and fetal and adult tissues. Dev

Biol 83: 391-398.

16. Donovan PJ, Stott D, Cairns LA, Heasman J, Wylie CC (1986) Migratory and postmigratory mouse

primordial germ cells behave differently in culture. Cell 44: 831-838.

17. Halfter W, Schurer B, Hasselhorn HM, Christ B, Gimpel E, et al. (1996) An ovomucin-like protein on the

surface of migrating primordial germ cells of the chick and rat. Development 122: 915-923.

18. Karagenç L, Cinnamon Y, Ginsburg M, Petitte JN (1996) Origin of primordial germ cells in the prestreak

chick embryo. Dev Genet 19: 290-301.

19. Takagi Y, Talbot NC, Rexroad CE Jr, Pursel VG (1997) Identification of pig primordial germ cells by

immunocytochemistry and lectin binding. Mol Reprod Dev 46: 567-580.

20. Oudega M, Marani E, Thomeer RTWM (1992) Transient expression of stage-specific embryonic antigen-1

(CD-15) in the developing dorsal rat spinal cord. Histochem J 24: 869-877.

21. Streit A, Yuen CT, Loveless RW, Lawson AM, Finne J, et al. (1996) The Lex carbohydrate sequence is

recognized by antibody to L5, a functional antigen in early neural development. J Neurochem 66: 834-844.

22. Martin GR, Lock LF (1983) Pluripotent cell lines derived from early mouse embryos cultured in medium

conditioned by teratocarcinoma stem cells. LM Silver, GR Martin, S Strickland, editors. In: Teratocarcinoma

Stem Cells. Cold Spring Harbor Laboratory, USA pp: 635-646.

23. Resnick JL, Bixler LS, Cheng L, Donovan PJ (1992) Long-term proliferation of mouse primordial germ cells

in culture. Nature 359: 550-551.

24. Pain B, Clark ME, Nakazawa H, Sakurai M, Samarut J, et al. (1996) Long term culture and characterization

of avian embryonic stem cells with multiple morphogenetic capabilities. Development 122: 2339-2348.

25. Wei W, Qing T, Ye X, Liu H, Zhang D, et al. (2008) Primordial germ cell specification from embryonic stem

cells. PLoS One 3: e4013.

26. Western P, Maldonado-Saldivia J, Van Den Bergen J, Hajkova P, Saitou M, et al. (2005) Analysis of Esg1

expression in pluripotent cells and the germline reveals similarities with Oct4 and Sox2 and differences

between human pluripotent cell lines. Stem Cells 23: 1436-1442.

27. Saitou M, Barton SC, Surani MA (2002) A molecular programme for the specification of germ cell fate in

mice. Nature 418: 293-300.

28. Sato M, Kimura T, Kurokawa K, Fujita Y, Abe K, et al. (2002) Identification of PGC7, a new gene expressed

specifically in preimplantation embryos and germ cells. Mech Dev 113: 91-94.

29. Bortvin A, Eggan K, Skaletsky H, Akutsu H, Berry Dl, et al. (2003) Incomplete reactivation of Oct4-related

genes in mouse embryos cloned from somatic nuclei. Development 130: 1673-1680.

Page 12: Pluripotency Markers in Stem Cells of Bats - Onjourn · 2019-07-04 · development. Other positive cell populations were identified (stages 11 and 12) using two other markers: PAS

Journal of Stem Cell and Developmental Biology

Page 12 of 12 Volume 1, Issue 1, Article ID: 100001

30. Pesce M, Gross MK, Schöler HR (1998) In line with our ancestors: Oct-4 and the mammalian germ.

Bioessays 20: 722-732.

31. Pesce M, Schöler HR (2000) Oct-4: Control of totipotency and germline determination. Mol Reprod Dev 55:

452-457.

32. Kehler J, Tolkunova E, Koschorz B, Pesce M, Gentile L, et al. (2004) Oct4 is required for primordial germ

cell survival. EMBO Rep 5: 1078-1083.

33. Tres LL, Rosselot C, Kierszenbaum AL (2004) Primordial germ cells: what does it take to be alive? Mol

Reprod Dev 68: 1-4.

34. Zhou Y, Li S, Huang Q, Xie L, Zhu X (2013) Nanog suppresses cell migration by downregulating thymosin β

and Rnd3. J Mol Cell Biol 5: 239-249.

35. Koopman P (1999) Sry and Sox9: mammalian testis-determining genes. Cell Mol Life Sci 55: 839-856.

36. Harley VR (2002) The molecular action of testis-determining factors SRY and SOX9. Novartis Found Symp

244: 57-66.

37. Benítez-Arvizu G, Gutiérrez-Iglesias G, Cerbón Cervantes M, Rodríguez-Fuentes N, Tapia-Ramírez, et al.

(2016) Skin Regeneration After Scalp Trauma Through Autologous Transplant of Acellular Dermis: A

Mexican Case Study. Int J Recent Sci Res 7: 8789-8793.

38. Wilson D, Reeder Dam (2005) Mammal species of the world: a taxonomic and geographic reference.

Baltimore: The Johns Hopkins University Press.

39. Antonio-Rubio N, Porras-Gómez T, Moreno-Mendoza N (2012) Identification of cortical germ cells in adult

ovaries from three phyllostomid bats: Artibeus jamaicensis, Glossophaga soricina and Sturnira lilium.

Reprod Fertil Dev 25: 825-836.

40. Mo X, Li N, Wu S (2014) Generation and characterization of bat-induced pluripotent stem cells.

Theriogenology 82: 283-293.

41. Alvárez-Guerrero A, Medrano A, Moreno-Mendoza N (2014) Characterization of gametes in two

phyllostomid bat species: Artibeus jamaicensis and Sturnira lilium. Anim Reprod Sci 145: 170-181.

42. Cretekos CJ, Weatherbee SD, Chen CH, Badwaik NK, Niswander L, et al. (2005) Embryonic staging system

for the short-tailed fruit bat, Carollia perspicillata, a model organism for the mammalian order Chiroptera,

based upon timed pregnancies in captive-bred animals. Dev Dyn 233: 721-738.

43. Okamura D, Tokitake Y, Niwa H, Matsui Y (2008) Requirement of Oct3/4 function for germ cell

specification. Dev Biol 317: 576-584.

44. Mise N, Fuchikami T, Sugimoto M, Kobayakawa S, Ike F, et al. (2008) Differences and similarities in the

developmental status of embryo-derived stem cells and primordial germ cells revealed by global expression

profiling. Genes Cells 13: 863-877.

45. Mikedis MM, Downs KM (2012) STELLA-positive subregions of the primitive streak contribute to posterior

tissues of the mouse gastrula. Dev Biol 363: 201-218.


Recommended