+ All Categories
Home > Documents > Potato Association of America Frederiction August 9,...

Potato Association of America Frederiction August 9,...

Date post: 13-Jul-2020
Category:
Upload: others
View: 0 times
Download: 0 times
Share this document with a friend
43
Marker types Potato Association of America Frederiction August 9, 2009 Allen Van Deynze
Transcript
Page 1: Potato Association of America Frederiction August 9, 2009solcap.msu.edu/s/3PAA_marker_types_final.pdfInter MITE Polymorphism (IMP), interSSR, Inter RGA. Marker types… Amplifies DNA

Marker typesPotato Association of America

Frederiction August 9, 2009

Allen Van Deynze

Page 2: Potato Association of America Frederiction August 9, 2009solcap.msu.edu/s/3PAA_marker_types_final.pdfInter MITE Polymorphism (IMP), interSSR, Inter RGA. Marker types… Amplifies DNA

Use of DNA Markers in Breeding

Fingerprinting of germplasmArrangement of diversity (clustering,

PCA, etc.)

Parental Selection

Quality Assurance

Marker Based Parent SimilarityMarker based estimated variance within a populationGenetic distance between parents

Parent-offspring tests, Genetic purity tests, Event tests

Germplasm Analysis

BreedingAlternative or support to selection for traitsIncrease rate of genetic gain:

Selection during off-season cyclesSelection of hybrid traits on inbred individualsEarly selection (e.g. pre-flowering)

Trait AnalysisAssociation of traits with genomic regions Understanding trait relationships (linkage vs. pleiotropy)Understanding causes of variation (aid in gene cloning)Marker Assisted BreedingMarker Assisted Backcrossing

Page 3: Potato Association of America Frederiction August 9, 2009solcap.msu.edu/s/3PAA_marker_types_final.pdfInter MITE Polymorphism (IMP), interSSR, Inter RGA. Marker types… Amplifies DNA

Marker assisted selection

Fruit ripening

DNA marker

Page 4: Potato Association of America Frederiction August 9, 2009solcap.msu.edu/s/3PAA_marker_types_final.pdfInter MITE Polymorphism (IMP), interSSR, Inter RGA. Marker types… Amplifies DNA

The # of Markers Needed Depends on Goals

• Protect varieties: 100s of markers • Classify germplasm: 100s mapped• ID tightly linked QTLs in linkage studies - 100s mapped• ID candidate genes and association studies - saturated map.

• Depends on number of chromosomes • Depends on size of genetic map (cM)

Page 5: Potato Association of America Frederiction August 9, 2009solcap.msu.edu/s/3PAA_marker_types_final.pdfInter MITE Polymorphism (IMP), interSSR, Inter RGA. Marker types… Amplifies DNA

DNA ⇒ RNA ⇒ Protein ⇒ Trait

Image compliments of National Human Genome Research Institute

The “Central Dogma” of molecular biology is that the information in the DNA sequence is transcribed into mRNA, which is then translated into proteins.

Proteins are large molecules that are the enzymes and structural components of living cells = trait

Page 6: Potato Association of America Frederiction August 9, 2009solcap.msu.edu/s/3PAA_marker_types_final.pdfInter MITE Polymorphism (IMP), interSSR, Inter RGA. Marker types… Amplifies DNA

Marker types

• RFLPs• RAPDs• AFLPs• SSRs • SNPs • SFPs• Others

Page 7: Potato Association of America Frederiction August 9, 2009solcap.msu.edu/s/3PAA_marker_types_final.pdfInter MITE Polymorphism (IMP), interSSR, Inter RGA. Marker types… Amplifies DNA

Restriction Fragment Length Polymorphism (RFLPs)

cDNA clonesGenomic clones

Page 8: Potato Association of America Frederiction August 9, 2009solcap.msu.edu/s/3PAA_marker_types_final.pdfInter MITE Polymorphism (IMP), interSSR, Inter RGA. Marker types… Amplifies DNA

RFLPs

☺Co-dominant☺Detect all alleles simultaneously☺Good across related species☺Basis (anchors) of many species maps

Too costly and labor intensive for breeding

Page 9: Potato Association of America Frederiction August 9, 2009solcap.msu.edu/s/3PAA_marker_types_final.pdfInter MITE Polymorphism (IMP), interSSR, Inter RGA. Marker types… Amplifies DNA

Random Amplified Polymorphic DNA (RAPDs)

University of Saskatchewan

Page 10: Potato Association of America Frederiction August 9, 2009solcap.msu.edu/s/3PAA_marker_types_final.pdfInter MITE Polymorphism (IMP), interSSR, Inter RGA. Marker types… Amplifies DNA

RAPDs

☺No sequence information needed☺Universal primer set

Reproducibility problems

Page 11: Potato Association of America Frederiction August 9, 2009solcap.msu.edu/s/3PAA_marker_types_final.pdfInter MITE Polymorphism (IMP), interSSR, Inter RGA. Marker types… Amplifies DNA

Amplified Fragment Length Polymorphism

genomic DNA

Restriction enzyme digestion

Adaptor ligation

Selective PCR amplification

AFLP fingerprint

Page 12: Potato Association of America Frederiction August 9, 2009solcap.msu.edu/s/3PAA_marker_types_final.pdfInter MITE Polymorphism (IMP), interSSR, Inter RGA. Marker types… Amplifies DNA

AFLP® characteristics

☺ multiplex PCR☺ “Competition PCR”: quantitative detection☺ No sequence information required☺ Size-based fragment discrimination☺ Transcript and marker discovery ☺ Transcript and marker detection

Universal technology (proprietary)

Page 13: Potato Association of America Frederiction August 9, 2009solcap.msu.edu/s/3PAA_marker_types_final.pdfInter MITE Polymorphism (IMP), interSSR, Inter RGA. Marker types… Amplifies DNA

Inter MITE Polymorphism (IMP), interSSR, Inter RGA

Marker types…

Amplifies DNA between MITEs (miniature inverted-repeat transposable elements)

MITEs are well distributed throughout most genomes

Template DNA

MITEs

Each end of the MITE is characterized by an inverted

repeat sequenceTerminal inverted

repeats

Inter MITE DNA is amplified by PCR

PCR Amplification

The numerous polymorphic bands create a distinct fingerprint for each line

Page 14: Potato Association of America Frederiction August 9, 2009solcap.msu.edu/s/3PAA_marker_types_final.pdfInter MITE Polymorphism (IMP), interSSR, Inter RGA. Marker types… Amplifies DNA

‘Inter’ markers

☺High multiplexing value15 to 75 loci per reactionHigh throughputCost-effective

☺Distributed throughout the genome☺Good level of intra-species variation☺High level of cross applicability

Dominant markersMay not be in coding regions

Tomato

Page 15: Potato Association of America Frederiction August 9, 2009solcap.msu.edu/s/3PAA_marker_types_final.pdfInter MITE Polymorphism (IMP), interSSR, Inter RGA. Marker types… Amplifies DNA

tcactttgcagtgtgtgtgtgtgtgtgtgtgtgtgtgtgtgtgtcccgttcagtcactttgcagtgtgtgtgtgtgtgtgtgtgtgtgtgtgtgtgtgtgtcccgttcag

Simple Sequence Repeat (microsatellites)

PCR

Page 16: Potato Association of America Frederiction August 9, 2009solcap.msu.edu/s/3PAA_marker_types_final.pdfInter MITE Polymorphism (IMP), interSSR, Inter RGA. Marker types… Amplifies DNA

Simple Sequence Repeats

☺Medium abundance☺Medium throughput☺Available in many crops

Need sequence informationMay or may not be associated with genes

Page 17: Potato Association of America Frederiction August 9, 2009solcap.msu.edu/s/3PAA_marker_types_final.pdfInter MITE Polymorphism (IMP), interSSR, Inter RGA. Marker types… Amplifies DNA

Single-nucleotide polymorphisms (SNPs)

cgtgtactgacctgcatgctatgaatcagtacatcgactagcttcgtgtactgacctgcatgctaggaatcagtacatcgactagctt

☺Highly abundant• roughly 1 per 100-2000 base pairs

☺Distributed throughout genome including genes

☺Genetically stable☺Typically biallelic☺Can be scored as a +/- marker☺Mutation may be diagnostic

Page 18: Potato Association of America Frederiction August 9, 2009solcap.msu.edu/s/3PAA_marker_types_final.pdfInter MITE Polymorphism (IMP), interSSR, Inter RGA. Marker types… Amplifies DNA

SNPs

Limited information per locusNeed sequence information

Page 19: Potato Association of America Frederiction August 9, 2009solcap.msu.edu/s/3PAA_marker_types_final.pdfInter MITE Polymorphism (IMP), interSSR, Inter RGA. Marker types… Amplifies DNA

Single Feature Polymorphisms

A

Genotype 1Genotype 2

BC

DE

F

GH

IJ

KL

MN

A B C D E F G H I J K

SFP

L M N

Pro

be In

tens

ity

Page 20: Potato Association of America Frederiction August 9, 2009solcap.msu.edu/s/3PAA_marker_types_final.pdfInter MITE Polymorphism (IMP), interSSR, Inter RGA. Marker types… Amplifies DNA

SFPs

☺Based on SNPs and Insertion/deletions• Abundant

☺Distributed throughout genome including genes

☺Genetically stable☺Highly multiplexable

DominantNeed sequence information

Page 21: Potato Association of America Frederiction August 9, 2009solcap.msu.edu/s/3PAA_marker_types_final.pdfInter MITE Polymorphism (IMP), interSSR, Inter RGA. Marker types… Amplifies DNA

Diversity array technology

Page 22: Potato Association of America Frederiction August 9, 2009solcap.msu.edu/s/3PAA_marker_types_final.pdfInter MITE Polymorphism (IMP), interSSR, Inter RGA. Marker types… Amplifies DNA

DARTs

☺Medium throughput☺Multiplex

Dominant markersSemi-Fixed assays

UseSNPs

Page 23: Potato Association of America Frederiction August 9, 2009solcap.msu.edu/s/3PAA_marker_types_final.pdfInter MITE Polymorphism (IMP), interSSR, Inter RGA. Marker types… Amplifies DNA

Why move to SNP maps?

Microsatellite markers create maps with large gaps- appropriate for within family studies

SNPs

SNPs create dense maps to pinpoint regions across the population

Page 24: Potato Association of America Frederiction August 9, 2009solcap.msu.edu/s/3PAA_marker_types_final.pdfInter MITE Polymorphism (IMP), interSSR, Inter RGA. Marker types… Amplifies DNA

Marker Detection

• Hybridization• Amplification

• Electrophoresis• Fluorescence

Page 25: Potato Association of America Frederiction August 9, 2009solcap.msu.edu/s/3PAA_marker_types_final.pdfInter MITE Polymorphism (IMP), interSSR, Inter RGA. Marker types… Amplifies DNA

Polymerase Chain Reaction

Taken from the National Health Museum gallery

Page 26: Potato Association of America Frederiction August 9, 2009solcap.msu.edu/s/3PAA_marker_types_final.pdfInter MITE Polymorphism (IMP), interSSR, Inter RGA. Marker types… Amplifies DNA

SNP technologies

Hybridization

Single base pair extension

Allele-specific PCR

Page 27: Potato Association of America Frederiction August 9, 2009solcap.msu.edu/s/3PAA_marker_types_final.pdfInter MITE Polymorphism (IMP), interSSR, Inter RGA. Marker types… Amplifies DNA

Agarose Gel Electrophoresis☺Easy☺Universal

ExpensiveLow throughput

UseRAPDsSSRsSNPs• RFLPs• AFLPs

Page 28: Potato Association of America Frederiction August 9, 2009solcap.msu.edu/s/3PAA_marker_types_final.pdfInter MITE Polymorphism (IMP), interSSR, Inter RGA. Marker types… Amplifies DNA

Automated Gel Electrophoresis

☺Easy☺High resolution☺Automated☺High throughput

Expensive equip

UseSSRsAFLPsSNPsIMPs

Page 29: Potato Association of America Frederiction August 9, 2009solcap.msu.edu/s/3PAA_marker_types_final.pdfInter MITE Polymorphism (IMP), interSSR, Inter RGA. Marker types… Amplifies DNA

Real Time PCR

Page 30: Potato Association of America Frederiction August 9, 2009solcap.msu.edu/s/3PAA_marker_types_final.pdfInter MITE Polymorphism (IMP), interSSR, Inter RGA. Marker types… Amplifies DNA

Real-Time PCR cont’d

☺Easy☺Automated☺High throughput

Expensive equip

UseSNPs

Page 32: Potato Association of America Frederiction August 9, 2009solcap.msu.edu/s/3PAA_marker_types_final.pdfInter MITE Polymorphism (IMP), interSSR, Inter RGA. Marker types… Amplifies DNA

Pyrosequencing☺Automated☺Medium throughput

Expensive equip

UseSNPs

Page 33: Potato Association of America Frederiction August 9, 2009solcap.msu.edu/s/3PAA_marker_types_final.pdfInter MITE Polymorphism (IMP), interSSR, Inter RGA. Marker types… Amplifies DNA

Invader® Assay for SNP DetectionBiplex FRET Format

A

T

C

G

A

A

C

C

F1 Q F2 Q

F1 F2

Invader® OligoWT Probe Mut Probe

FRET Cassette 1 FRET Cassette 2

Released 5´ Flap

CleavageSite

Target Target

CleavageSite

Invader® Oligo

Released 5´ Flap

CleavageSite

CleavageSite

Page 34: Potato Association of America Frederiction August 9, 2009solcap.msu.edu/s/3PAA_marker_types_final.pdfInter MITE Polymorphism (IMP), interSSR, Inter RGA. Marker types… Amplifies DNA

Invader

☺Automated☺High throughput☺Highly sensitive☺Flexible☺Quantitative

Minimum amount reagents required

UseSNPs

Page 35: Potato Association of America Frederiction August 9, 2009solcap.msu.edu/s/3PAA_marker_types_final.pdfInter MITE Polymorphism (IMP), interSSR, Inter RGA. Marker types… Amplifies DNA

Mass Spec

Page 36: Potato Association of America Frederiction August 9, 2009solcap.msu.edu/s/3PAA_marker_types_final.pdfInter MITE Polymorphism (IMP), interSSR, Inter RGA. Marker types… Amplifies DNA

Mass Spec

☺Medium throughput☺Multiplex☺Inexpensive reagents☺Automated

Need amplificationExpensive equipment

Page 37: Potato Association of America Frederiction August 9, 2009solcap.msu.edu/s/3PAA_marker_types_final.pdfInter MITE Polymorphism (IMP), interSSR, Inter RGA. Marker types… Amplifies DNA

Melting Curve Analysis

homos

het

Page 38: Potato Association of America Frederiction August 9, 2009solcap.msu.edu/s/3PAA_marker_types_final.pdfInter MITE Polymorphism (IMP), interSSR, Inter RGA. Marker types… Amplifies DNA

“Liquid” Arrays

☺Automated☺High throughput☺Highly sensitive☺Multiplex☺Flexible

Expensive equip

UseSNPs

Page 39: Potato Association of America Frederiction August 9, 2009solcap.msu.edu/s/3PAA_marker_types_final.pdfInter MITE Polymorphism (IMP), interSSR, Inter RGA. Marker types… Amplifies DNA

Illumina

2-60,000 SNPs x 96 samples $<0.01-0.15/dp

Page 40: Potato Association of America Frederiction August 9, 2009solcap.msu.edu/s/3PAA_marker_types_final.pdfInter MITE Polymorphism (IMP), interSSR, Inter RGA. Marker types… Amplifies DNA

Experimental Procedure

Page 41: Potato Association of America Frederiction August 9, 2009solcap.msu.edu/s/3PAA_marker_types_final.pdfInter MITE Polymorphism (IMP), interSSR, Inter RGA. Marker types… Amplifies DNA
Page 42: Potato Association of America Frederiction August 9, 2009solcap.msu.edu/s/3PAA_marker_types_final.pdfInter MITE Polymorphism (IMP), interSSR, Inter RGA. Marker types… Amplifies DNA

SNP technologiesTechnology Samples SNPs Cost/SNPAgarose Gels 10‐384 10‐384 highPolyacrylamide Gels 10‐384 10‐384 highReal Time PCR 96‐1,500 1‐100 lowFluidigm 12‐15,000 12‐96 low‐very lowInvader 96‐1000s 96+ very lowPyrosequencing 96‐384 100s medMass Spec 96‐384 100s medMelting curve 10‐384 100s medIllumina Bead Express 480 1‐384 medIllumina Golden Gate 480 384‐1536 lowIllumina Infinium 1152 7,600‐100k very low

Page 43: Potato Association of America Frederiction August 9, 2009solcap.msu.edu/s/3PAA_marker_types_final.pdfInter MITE Polymorphism (IMP), interSSR, Inter RGA. Marker types… Amplifies DNA

Marker Attributes

Marker RFLPs RAPDs SSRsAFLPs/ IMPs SFPs SNPs

Development costs high low high low high med-highTechnical complexity high low low med med lowAutomated no no med med semi yesReproducibility high low high med med highCross species yes no yes no yes noSegregation co-dom dom co-dom dom dom co-dom

Information contentgenomic/

gene none genomic nonegenomic/ genes

genomic/ genes

Cost/datapoint high low med low lowFor Breeding no no yes yes no yes

$0.5-1.00 $<0.01-0.20


Recommended