+ All Categories
Home > Documents > Prepared with lots of help from friends... Metsada Pasmanik-Chor, Zohar Yakhini

Prepared with lots of help from friends... Metsada Pasmanik-Chor, Zohar Yakhini

Date post: 09-Jan-2016
Category:
Upload: tamera
View: 17 times
Download: 0 times
Share this document with a friend
Description:
BioInformatics / Computational Biology Introduction & Biological Terms. Prepared with lots of help from friends... Metsada Pasmanik-Chor, Zohar Yakhini and NUMEROUS WEB RESOURCES. Outline. A Few Basic Concepts of Molecular Biology: Genetic material - DNA & RNA. - PowerPoint PPT Presentation
44
Prepared with lots of help from friends... Metsada Pasmanik-Chor, Zohar Yakhini and NUMEROUS WEB RESOURCES. Informatics / Computational Biolog Introduction & Biological Terms.
Transcript
Page 1: Prepared with lots of help from friends... Metsada Pasmanik-Chor, Zohar Yakhini

Prepared with lots of help from friends...Metsada Pasmanik-Chor, Zohar Yakhini and NUMEROUS WEB RESOURCES.

BioInformatics / Computational Biology Introduction & Biological Terms.

Page 2: Prepared with lots of help from friends... Metsada Pasmanik-Chor, Zohar Yakhini

• A Few Basic Concepts of Molecular Biology:• Genetic material - DNA & RNA.

• DNA is a sequence of bases (A,C,T,G).

• Watson-Crick–ery.

• Proteins.

• The central dogma of molecular biology.

• Bio-Informatics Tools Freely available on the web: Highlights.

Outline

Page 3: Prepared with lots of help from friends... Metsada Pasmanik-Chor, Zohar Yakhini

One chromosome, (sometimes circular).

Prokaryotes vs. Eukaryotes

http://departments.oxy.edu/biology/bio130/lectures_2000/11-13-00_lecture.htm

Page 4: Prepared with lots of help from friends... Metsada Pasmanik-Chor, Zohar Yakhini

Cell Size and Shape10-9 m

All organisms are made of cells - basic unit of life (1014 cells in the human body; metabolism, replication).

Cells in all organisms have same type ofgenetic material.

Page 5: Prepared with lots of help from friends... Metsada Pasmanik-Chor, Zohar Yakhini

The Eukaryotic Cellcytoskeleton:

* In plants: chloroplast & cell wall.

http://www.biosci.uga.edu/almanac/bio_103/notes/may_15.html

Page 6: Prepared with lots of help from friends... Metsada Pasmanik-Chor, Zohar Yakhini

http://www.accessexcellence.org/AE/AEPC/NIH/gene03.html

• Each human cell contains 23 pairs of chromosomes.• Chromosomes can be distinguished by size and by unique banding patterns.• This set is from a male, since it contains a Y chromosome. • Females have two X chromosomes.

DNA - the Genetic Material

http://www.dnaftb.org/dnaftb/9/concept/index.html

Page 7: Prepared with lots of help from friends... Metsada Pasmanik-Chor, Zohar Yakhini

Different genes are activated in different cells, creating the specific proteins that give a particular cell type its character.

Different Eukaryotic Cell Types

http://www.accessexcellence.org/AE/AEPC/NIH/gene03.html

Page 8: Prepared with lots of help from friends... Metsada Pasmanik-Chor, Zohar Yakhini

Example: Tissues in Stomach

• Cells originate from one embrio cell and have identical DNA.• Different cell types: Metabolism, regulation, function.

Page 10: Prepared with lots of help from friends... Metsada Pasmanik-Chor, Zohar Yakhini

control region

gene - coding region

• CONTROL REGIONS - Usually are adjacent to genes. Determine when expressed, to what extend. • “JUNK DNA” - Unknown function.

DNA Structure

centromere

telomere

Page 11: Prepared with lots of help from friends... Metsada Pasmanik-Chor, Zohar Yakhini

Source: Alberts et al

DNA is made of 4 subunits (nucleotides).Each nucleotide contains: sugar, phosphate group and a base.

DNA - (deoxyribonucleic acid - THE Double Helix)

Page 12: Prepared with lots of help from friends... Metsada Pasmanik-Chor, Zohar Yakhini

SugarA TC G

deoxyribose

ribose

Nucleotide

4 DNA bases

Purines Pyrimidines

(RNA)

(DNA)

Page 13: Prepared with lots of help from friends... Metsada Pasmanik-Chor, Zohar Yakhini

Conclusion: DNA strands are complementary (1953).

Watson-Crick Complementarity

HumanSheepTurtleSea urchinWheat

E. coli

DNA source% of each base

Purines/Pyrimidines

Base ratios

PurinesPyrimidines

Page 14: Prepared with lots of help from friends... Metsada Pasmanik-Chor, Zohar Yakhini

A binds to TC binds to G

AATGCTTAGTCTTACGAATCAG

Perfect match

AATGCGTAGTCTTACGAATCAG

One base mismatch

Watson-Crick Complementarity

Page 15: Prepared with lots of help from friends... Metsada Pasmanik-Chor, Zohar Yakhini

• Genes carry the instructions for cellular proteins.

• Variations in the code is the source for cellular variations.

• Disease and susceptibility to disease can be caused by changes in the DNA (mutations).

• DNA is identical in all cells of an individual, almost identical among different individuals of same species (99.9%), and very similar in related species (human vs chimpanzee - 98% identity).

• Only 3% of cellular DNA has a known function !

Variability - facts

Humanindividuality

http://www.brc.dcs.gla.ac.uk/~drg/seminars/bioinformatics/sld032.htm

Page 16: Prepared with lots of help from friends... Metsada Pasmanik-Chor, Zohar Yakhini

Hereditary mutations: Carried in the DNA of the reproductive cells.

The mutation will be present in all of the offspring's body cells.

http://www.accessexcellence.org/AE/AEPC/NIH/gene07.html

Acquired mutations:Developed in the DNA during a person's lifetime.

If the mutation arises in a body cell, copies of the mutation will exist only in descendants of that particular cell.

Page 17: Prepared with lots of help from friends... Metsada Pasmanik-Chor, Zohar Yakhini
Page 18: Prepared with lots of help from friends... Metsada Pasmanik-Chor, Zohar Yakhini

RNA is very similar to DNA but has: • Only one strand.• Ribose as a sugar. • Uracil (U) instead of Thymine (T).

RNA - ribonucleic acid Some viruses store genetic information in form of RNA.

In eukaryotes, RNA is formedfrom DNA in a process called

transcription where elimination of introns(splicing) occurs

Page 19: Prepared with lots of help from friends... Metsada Pasmanik-Chor, Zohar Yakhini

splicing

Chromosomal DNA

Splicing - RNA Synthesis and Processing

mRNA

www.albany.edu/~achm110/ mrna.gif

MaturemRNA

Poly A tail

introns

Transcriptionby RNA polymerase

exons

The seven green loops stand for introns

The eight blue bands stand for exons

Promoter/enhancer

exons

Stop signal

Gene

intronssplicing

Page 20: Prepared with lots of help from friends... Metsada Pasmanik-Chor, Zohar Yakhini

http://www1.imim.es/courses/Lisboa01/slide1.5_splicing.html

Splicing - RNA Synthesis and Processing

Page 21: Prepared with lots of help from friends... Metsada Pasmanik-Chor, Zohar Yakhini

http://cbms.st-and.ac.uk/academics/ryan/Teaching/medsci/Medsci4.htm

Example of Alternative Splicing

Page 22: Prepared with lots of help from friends... Metsada Pasmanik-Chor, Zohar Yakhini

Used in translation:tRNA - Small RNA, serves as “adaptor” between mRNA and amino acids.rRNA - One of the structural components of the ribosome (the translation machine from mRNA to proteins).

Types of RNA

http://www.dnaftb.org/dnaftb/24/concept/index.html

http://www.dnaftb.org/dnaftb/21/animation/index.html

mRNA - A copy of a gene (without introns), encoding protein sequence.

See animation at:

Page 23: Prepared with lots of help from friends... Metsada Pasmanik-Chor, Zohar Yakhini

Genes can be turned ON and OFF

http://www.dnaftb.org/dnaftb/33/concept/index.html

Page 24: Prepared with lots of help from friends... Metsada Pasmanik-Chor, Zohar Yakhini

http://cbms.st-and.ac.uk/academics/ryan/Teaching/medsci/Medsci4.htm

Transcription Factors

Page 25: Prepared with lots of help from friends... Metsada Pasmanik-Chor, Zohar Yakhini

nitiationofranscriptionbyolymerase

http://www1.imim.es/courses/Lisboa01/slide1.4_transcription.html

Page 26: Prepared with lots of help from friends... Metsada Pasmanik-Chor, Zohar Yakhini

Regulation of Expression

promoter

Page 27: Prepared with lots of help from friends... Metsada Pasmanik-Chor, Zohar Yakhini

nucleu

s

cyto

plas

m

Page 28: Prepared with lots of help from friends... Metsada Pasmanik-Chor, Zohar Yakhini

The Genetic Code: From 43 = 64 Codons to 20 AA.

5’ 3’

4 nucleotide types

20 amino acids

3 letter code 64 Codons

Page 29: Prepared with lots of help from friends... Metsada Pasmanik-Chor, Zohar Yakhini

http://cbms.st-and.ac.uk/academics/ryan/Teaching/medsci/Medsci5.htm

The Genetic Code: From 43 = 64 Codons to 20 AA.

Page 30: Prepared with lots of help from friends... Metsada Pasmanik-Chor, Zohar Yakhini

The Genetic Code

The only start amino acid is Methionine, which has a single codon.

Page 31: Prepared with lots of help from friends... Metsada Pasmanik-Chor, Zohar Yakhini

http://cbms.st-and.ac.uk/academics/ryan/Teaching/medsci/Medsci4.htm

Page 32: Prepared with lots of help from friends... Metsada Pasmanik-Chor, Zohar Yakhini

Amino Acid Relative Frequencies-Mammals

http://cbms.st-and.ac.uk/academics/ryan/Teaching/molbiol/Bioinf_files/v3_document.htm

Page 33: Prepared with lots of help from friends... Metsada Pasmanik-Chor, Zohar Yakhini

5’ ACGTGTAGTTGCCGTGACG 3’3’ TGCACATCAACGGCACTGC 5’

A DNA sequence with direction shown

NN PKRGACMLTNQFKRKSACQ C C

A protein sequence with ends indicated

Nucleotides vs Amino Acids Code

Page 34: Prepared with lots of help from friends... Metsada Pasmanik-Chor, Zohar Yakhini

Proteins

Page 35: Prepared with lots of help from friends... Metsada Pasmanik-Chor, Zohar Yakhini

Translation -Mediated by the ribosome, an organ which is made from rRNA and proteins.

Page 36: Prepared with lots of help from friends... Metsada Pasmanik-Chor, Zohar Yakhini

Proteins are Made of Amino Acids

http://www.iacr.bbsrc.ac.uk/notebook/courses/guide/aa.htm

Page 37: Prepared with lots of help from friends... Metsada Pasmanik-Chor, Zohar Yakhini

Translation in Eukaryotes

http://www1.imim.es/courses/Lisboa01/slide1.6_translation.html Animation: http://cbms.st-and.ac.uk/academics/ryan/Teaching/medsci/Medsci6.htm

Page 38: Prepared with lots of help from friends... Metsada Pasmanik-Chor, Zohar Yakhini

http://www.yangene.com/content22_10.htm

Protein Structure

Page 39: Prepared with lots of help from friends... Metsada Pasmanik-Chor, Zohar Yakhini

What Determines Cell Structure and Function ?

• Unique protein expression by each cell type.

• Proteins are ~60% of dry mass of living cell.

• Proteins determine function.

How is this controlled ?

Page 40: Prepared with lots of help from friends... Metsada Pasmanik-Chor, Zohar Yakhini

Levels of Eukaryotic Gene Regulation

http://www.library.csi.cuny.edu/~davis/Bioinfo_326/lectures/centralDogmaProteins/centralDogma.html

Page 41: Prepared with lots of help from friends... Metsada Pasmanik-Chor, Zohar Yakhini

Central Dogma

Transcription

mRNA

Cells express different subset of the genes in different tissues and under different conditions.

Gene (DNA)

Translation

Protein

DNA RNA Protein

Symptomes (Phenotype)

Page 42: Prepared with lots of help from friends... Metsada Pasmanik-Chor, Zohar Yakhini

The Central Dogma of Molecular Biology

Replication-DNA duplication

Transcription-RNA synthesisNucleus

Cytoplasm

Translation-Protein synthesis

http://www.accessexcellence.com/AB/GG/central.html

Page 43: Prepared with lots of help from friends... Metsada Pasmanik-Chor, Zohar Yakhini

New Central Dogma…1 gene

Many protein types

Many mRNA Transcriptsdue to alternative splicing

Page 44: Prepared with lots of help from friends... Metsada Pasmanik-Chor, Zohar Yakhini

http://www.nature.com/nrg/journal/v3/n1/slideshow/nrg703_bx1.html

1 gene

Many mRNA transcripts

Many protein types

Central Dogma in the 21st

Century.


Recommended