Prevalence of potato yellow vein virus (PYVV) in Solanumtuberosum Group Phureja Fields in Three States of Colombia

Liliana Franco-Lara & Daniel Rodríguez &

Mónica Guzmán-Barney

Published online: 19 April 2013# Potato Association of America 2013

Abstract Potato yellow vein virus (Crinivirus) causes leafyellowing, is limited to the phloem and is transmitted byTrialeurodes vaporariorum and tubers. PYVV causes up to50 % yield reduction in S. tuberosum. The prevalence ofPYVV was established in Group Phureja in 2008 in theColombian states of Cundinamarca, Antioquia and Nariño.The presence (S) or absence (NS) of symptoms wasestablished in 24,930 plants. Symptom prevalence was asfollows: Cundinamarca 0.74 %±0.03, Antioquia 5.4 %±12and Nariño 6.2 %±0.11. Percentages of S plants were highlyvariable among different states and municipalities. PYVVwas diagnosed by RT-PCR in a subsample of 1,545 plantsfrom Cundinamarca and Nariño. RT-PCR showed that 2.4 %±8.3×10−5 and 41 %±0.0009 % of the symptomlessplants of Cundinamarca and Nariño respectively were pos-itive. This suggests possible late infection of plants by thevector which did not have enough time to express symp-toms, infections with two or more viruses or “virus latency”.PYVV symptomatic prevalence in Group Phureja was lowerthan that reported for Diacol-Capiro (Group Andigena), butincreases if molecular results are taken into account. This isthe first known study aimed at determining PYVV preva-lence using molecular tools and extensively sampling of S.tuberosum Group Phureja plants in grower’s fields in threestates and multiple municipalities of Colombia.

Resumen El virus del amarillamiento de las nervadurasde la hoja de papa (PYVV, Crinivirus) causa amarillamiento

de la hoja, está limitado al floema, se transmitepor Trialeurodes vaporariorum y tubérculos. El PYVVcausa hasta el 50 % de reducción de rendimiento enS. tuberosum. La prevalencia del PYVV se determinó enel Grupo Phureja en 2008 en los Departamentos colombianosde Cundinamarca, Antioquia y Nariño. La presencia (S)o ausencia (NS) de síntomas se determinó en 24,930 plantas.La prevalencia de los síntomas fue de la siguiente manera:Cundinamarca, 0.74 %±0.03, Antioquia 5.4 %±1.2, y Nariño6.2 %±0.11. Los porcentajes de plantas S fueron altamentevariables entre los diferentes Departamentos y Municipios.PYVV se diagnosticó por RT-PCR en una submuestra de1,545 plantas de Cundinamarca y Nariño. La RT-PCRmostró que 2.4 %±8.3×10–5 y 41 %±0.0009 de las plantasasintomáticas de Cundinamarca y Nariño respectivamente,fueron positivas. Esto sugiere una possible infección tardíade las plantas por el vector, que no tuvieron tiempo suficientepara expresar los síntomas, infecciones con dos o más virus,o “latencia viral”. La prevalencia sintomática en el GrupoPhureja fue más baja que la reportada para Diacol-Capiro(Grupo Andígena), pero incrementa si se tienen en cuentalos resultados moleculares. Este es el primer estudio conocidoenfocado a determinar la prevalencia de PYVV usandoherramientas moleculares y Mediante un muestreo extensivode plantas de S. tuberosum Grupo Phureja en Lotes deproductores en tres Departamentos ymúltiplesmunicipalidadesde Colombia.

Keywords PYVD . Egg yolk potato . Vein yellowingsymptoms . RT-PCR . incidence

Introduction

In 2008, the area cultivated with Group Phureja (locallyknown as papa criolla) in Colombia was 7,897 ha,resulting in a production of 61,604 T and 7,62 T/ha

Am. J. Potato Res. (2013) 90:324–330DOI 10.1007/s12230-013-9308-1

L. Franco-Lara :D. RodríguezFacultad de Ciencias, Universidad Militar Nueva Granada,Km 2 vía Cajicá-Zipaquirá, Cajicá, Colombia

M. Guzmán-Barney (*)Laboratorio de Virus Vegetales, Instituto de Biotecnología,Universidad Nacional de Colombia, Cra 30 Calle 45,Bogotá, Colombiae-mail: mmguzmanb@unal.edu.co

average yield. Group Phureja is one of the two speciesof potato grown in Colombia and represents about 10 %of the total potato production of the country (Bonilla et al.2009). The remaining production corresponds to varieties ofS. tuberosum subsp. Andigena. Colombia is considered acentre of diversity for Group Phureja (Espinal et al. 2005)and new varieties have been recently developed (Rodríguez etal. 2009). Potatoes of Group Phureja are a local delicacy,ingredient of many traditional dishes, a gourmet product anda crop that is increasing in importance for export (Bonilla et al.2009).

Potato yellow vein disease (PYVD) was first reportedin Colombia during the 1950s and is caused by PYVV(Salazar et al. 2000). It is a re-emergent virus inColombia and it has dispersed to Ecuador, Peru andVenezuela (Salazar et al. 2000). The symptoms havebeen described as clearing of secondary and tertiary leafmidribs, followed by vein yellowing with greenintervenial spaces (Salazar, 1997). PYVV has been ten-tatively classified in the genus Crinivirus, family

Closteroviridae (Martelli et al. 2005). It has tripartite,single stranded positive sense RNAs genome with flex-ible filamentous particles, and is limited to the phloemof the infected plants (Salazar et al. 2000; Livieratos etal. 2004). It is transmitted by infected tubers and by thegreenhouse whitefly (Trialeurodes vaporariorum W.) ina semi-persistent manner (Salazar et al. 2000, EPPO1993). Potato plants affected by PYVD have reducedtuber number and size, and losses have been estimatedto be between 28 % and 50 % of the production(Salazar et al. 2000; Guzman-Barney et al., 2012).

With Phureja becoming increasingly important toColombian agriculture and particularly for export, we un-dertook this study to determine PYVV prevalence by sam-pling on large scale in the three major production areas inthe country. The prevalence of S and NS field plants wasdetermined and a subsample of around 10 % was evaluatedby RT-PCR to study the presence of the virus in S and NSplants. Preliminary results of this work have been reported(Franco-Lara et al. 2009).

Table 1 Number of plots and samples evaluated for PYVV symptoms and incidence as determined visually in Cundinamarca, Antioquia andNariño States

State Municipality Numberof plots

Samples evaluatedfor symptomatology

Incidence as determined visually

Number of symptomatic plants/number of total samples

Average percentageof symptomatic plantsper municipality

Cundinamarca Chipaque 4 1,635 40/1635 2.44

El Rosal 2 810 6/810 0.74

Facatativá 4 1,620 0/1620 0.00

Guasca 2 810 2/810 0.25

La Calera 2 810 4/810 0.49

Sibaté 1 400 11/400 2.75

Subachoque 3 1,215 0/1215 0.00

Zipaquirá 3 1,215 0/1215 0.00

Total 8 21 8,515 63/8515 0.74 %±0.03

Antioquia Carmen de Viboral 4 1,710 67/1710 3.92

La Unión 5 2,025 5/2025 0.25

Marinilla 4 1,655 127/1655 7.67

Santuario 2 810 56/810 6.91

Sonsón 3 1,215 44/810 11.69

Total 5 18 7415 385/5760 5.4 %±0.12

Nariño Ipiales 3 1,350 103/1350 7.63

Ospina 3 1,350 62/1350 4.59

Pasto 5 2,250 142/2250 6.31

Puerres 3 1,350 68/1350 5.04

Pupiales 3 1,350 145/1350 10.74

Túquerres 3 1,350 37/1350 2.74

Total 6 20 9,000 557/9000 6.2±0.11

Total in three states 19 59 24,930 1005/24,930 4.031±0.78

Am. J. Potato Res. (2013) 90:324–330 325

Materials and Methods

Field Sampling

To determine the prevalence of PYVV, Group Phureja cropsof three Colombian states were visited in 2008:Cundinamarca, Antioquia and Nariño. According to theNational Potato Crop Census of Cundinamarca (2002) theaverage area of a Group Phureja production unit is 0.70 ha,where approximately 21,000 plants grow. In this study, thesample per plot was determined as 384 plants (95 % confi-dence level, 5 % margin of error) assuming a binomialdistribution (as no prior data were available), with p=0.5and q=0.5 and 95 % confidence level (Zα/2=1.96). Forpractical reasons, in each plot approximately 400 plantswere sampled at random following a W track in 15 rows.

The presence or absence of PYVV symptoms wasrecorded for each plant on fully expanded leaves. Ineach state, from 5 to 8 municipalities plants wereanalysed, for a total of 59 plots with 24,930 plantstested (Table 1). Symptoms were recorded on 6 weekold or older plants. Different symptom intensity inPYYV-infected field plants are shown in Fig 1.

RT-PCR

From the 24,930 plants recorded for symptoms, leafsamples of 1,545 S and NS plants were collected (ap-proximately 36 S and 4 NS per plot) to test for PYVVpresence by RT-PCR. Molecular analysis was performedon samples collected from Cundinamarca and Nariñostates. Plant material was collected and transported at

a b

c d

e f

Fig. 1 Plants or leavesdisplaying PYVV symptomswith different degrees ofintensity. a, b mild;c, d moderate; and e severeand f symptomless

Table 2 Percentage of symp-tomatic plants by state showinglow, moderate and severesymptoms

Low Moderate Severe Total number of plants

Cundinamarca 14 (22 %) 26 (41 %) 23 (37 %) 63

Antioquia 99 (25 %) 167 (42 %) 135 (33 %) 401

Nariño 206 (37 %) 207 (37 %) 144 (26 %) 557

326 Am. J. Potato Res. (2013) 90:324–330

4 °C to the laboratory, where it was stored at −20 °Cuntil processing. dsRNA was extracted grinding theleaves with liquid nitrogen and extracting with 2 %SDS, 0.1 M Tris [pH8], 2 mM EDTA. Extracts weretreated with phenol:chloroform 1:1. The supernatant waspurified through Sephadex columns and after centrifuga-tion the filtrate was collected and stored frozen to beused as template (Guzmán et al. 2006).

The coat protein gene (CP) of PYVV was amplifiedby RT-PCR with specific primers P3 and P4, whichproduce amplicons of 257 bp (López et al. 2006;Guzmán 2008). RT-PCR was performed in two steps.First, reverse transcription was performed with 12U ofMMLV (Epicentre), 1X buffer (Epicentre), 10 μMdNTPs (Bioline), 8U RNAsin (Invitrogen), 0.4 μMprimer P4 (5’ TTGCTGCATTCTTGAACAGGTAA 3’)and 10 mM DTT (Epicentre). Reactions were incubatedat 42 °C for 60 min followed by incubation at 94 °Cfor 5 min. For PCR, 1.5 U Biolase (Bioline), 1X BufferNH4 10X (Bioline), 10 μM dNTPs, 2.5 mM MgCl2, 10μM of primers P3 (5’ GACCGCCGACTTGTTGAATT3’) and P4 and 7 μl of template from the previousreaction were used, in a final volume of 25 μl. Thethermal cycle for PCR was: 94 °C for 3 min, followed by35 cycles at 94 °C 30s, 55 °C for 30s and 72 °C for 60s, andfinal extension at 72 °C for 10 min. The resulting RT-PCRproducts were separated by standard agarose gel electropho-resis and stained with Sybr Safe (Invitrogen). S samples fromNariño and Cundinamarca and NS samples from Nariño wereevaluated individually. NS samples from Cundinamarca were

evaluated individually or in pools of 5 samples (Table 2). AllRT-PCR tests included positive controls (RNA of a PYVVinfected potato plant) and negative controls (virus free invitro potato and CTV Citrus Tristeza Virus infectedplants). CTV was used as a negative control to showthe specificity of the primers, since both viruses belongto the Closteroviridae family.

Statistical Analysis

The prevalence of S plants per municipality and state wasestimated from percentage of S plants. These values weretransformed using the formula y ¼ arcsen

ffiffiffi

pp

. The resultingdata were analysed by ANOVA and Tukey multiple comparisontest (p=0.05) “R-project” (version 1.9.1 free access at www.r-project.org). Additionally, S plants were classified according to ascale of severity (symptom intensity level) arbitrarilyestablished: S = severe; M = moderate; L = mild (Fig. 1).

Results

To estimate the prevalence of PYVV-associated yellowingsymptoms, a random sample of 24,930 plants fromCundinamarca, Antioquia and Nariño was visually inspected.Different levels of PYVD symptom intensity observed in thefield are shown in Fig. 1.

The percentage of S plants varied between states. InNariño 6.2 %±0.11, (557 of 9,000 plants), in Antioquia5.4 %±0.12 (397 of 7,415 plants) and in Cundinamarca0.74 %±0.03 (63 of 8,515 plants) were S (Fig. 2, Table 1).Plants from Cundinamarca showed the lowest prevalence ofPYVD (<1 %) and was highly significantly different toAntioquia (p=0.0028) and Nariño (p=0.00027) whichshowed prevalence of 5 % and 6 % respectively.

In Cundinamarca, the highest PYVD prevalence wasfound in municipality of Sibaté (2.8 %) and Chipaque(2.41 %) at the east of the state. El Rosal, which isconsidered as the municipality with the largest GroupPhureja yield in Colombia, followed with (0.74 %). Themost affected municipalities in Antioquia were Santuario(13.83 %), Sonsón (11.69 %) and Marinilla (7.71 %) and inNariño were Pupiales (10.74 %), Ipiales (7.63 %) and Pasto(6.31 %) (Table 1). Large variation in the number of positivesamples in plots of the same municipality was observed.

Table 3 Number of plants sam-pled for dsRNA extraction andRT-PCR analysis from statesCundinamarca and Nariño

apools contained composite of 5tissue samples

State No. plants individuallyanalysed

No. plants evaluatedin “pools”a

Total No. plants evaluatedby RT-PCR

Cundinamarca 180 644 824

Nariño 721 0 721

Total 901 644 1,545

Fig. 2 Average percentage of symptomatic prevalence in the threestates studied. Bars indicate standard error

Am. J. Potato Res. (2013) 90:324–330 327

Plants had different levels of symptom intensities. Theplants were classified into three categories according to thedegree of symptom expression (Fig. 1). In the three states,similar percentages of plants showing mild symptoms wereobserved (range from 22 to 37 %), as well as moderate (37to 42 %) and severe (26 to 37 %) (Table 3) and no signif-icant differences were observed among them.

Molecular Analysis

From the group of 1,545 samples from Cundinamarca andNariño that were tested by RT-PCR, 183 displayedyellowing symptoms. In Cundinamarca 75 %±0.009 (36of 48 samples) and in Nariño 94 %±0.0016 (135 of 143

samples) of the S plants were positive by RT-PCR (Fig. 3a).In each state 8 plants that expressed yellowing symptomswere negative by RT-PCR.

RT-PCR was performed on 1,362 NS samples. In bothstates positive samples were found among those plants(Fig 4). In Cundinamarca 2.4 %±8.3×10−5 (22 of 920)and in Nariño 41 %±0.0009 (235 of 578) NS samples wereinfected with PYVV although the plants had the appearanceof non-infected healthy plants (Fig. 3b). The remainder ofthe symptomless plants 97.6 %± 8.32 ×−10 −5 inCundinamarca and 59 %±0,0009 in Nariño were negativeby RT-PCR.

Discussion

This work studied the prevalence of PYVV in Phurejaduring 2008, in the most important Colombian states forGroup Phureja production: Cundinamarca, Antioquia andNariño. To our knowledge, this is the first study carriedout at this scale, based on the observation of 24,930 samplesfrom 19 municipalities, using two approaches symptomobservation and RT-PCR detection of the virus.

The prevalence of PYVD yellowing symptoms at the timeof the study in Group Phureja crops was 0.74 %±0.03, 5.4 %±12 and 6.2 %±0.11 in Cundinamarca, Antioquia and Nariñorespectively (Table 1). These prevalences were relatively lowwhen compared to regional results reported by other authorsfor varieties of the Andigena group, such asDiacol-Capiro. Forexample, Salazar et al. (2000), in observations made between1995 and 1997 reported 55 % to 80% prevalence in Antioquia(in 20 plots) and in Cundinamarca 10% to 60% prevalence (in15 plots). On the other hand, Saldarriaga et al. (1988) reportedlow PYVD prevalences (0.01 to 0.04 %) in crops of Diacol-Capiro during the 1980s.

The prevalence among municipalities of the each statewas variable. In Antioquia Santuario and La Unión showedprevalences of 13.83 and 0.25 % respectively, with a stateaverage of 5.36 %±0.12. In Nariño, Pupiales had a preva-lence of 11 % and Túquerres of 2.74 % (state average of 6.19 %±0.11 %). In Cundinamarca, the state average was 0.74 %±0.03, where Sibaté presented the highest prevalence

Symptomatic Asymptomatic ControlFig. 4 RT-PCR of samples fromPuerres (Nariño) includingsymptomatic and symptomlessplants. Lane 1 Molecular weightmarker GeneRuler 100 bp (100–3,000 bp Fermentas); Lanes 2 to11 NS samples; Lanes 12 to 19Ssamples; Lane 20 positive potatocontrol; Lane 21 negative potatocontrol; Lane 22 negative controlinfected with CTV

0

10

20

30

40

50

60

70

80

90

100

Cundinamarca Nariño

NS PLANTS RT-PCR +

NS PLANTS RT-PCR -

0

10

20

30

40

50

60

70

80

90

100

Cundinamarca Nariño

NS PLANTS RT-PCR +

NS PLANTS RT-PCR -

a

b

Fig. 3 Percentage of PYVV RT-PCR positive and negative samplesamong S (a) and NS (b) plants in Cundinamarca and Nariño. Barsindicate standard error

328 Am. J. Potato Res. (2013) 90:324–330

2.80 % while in Zipaquirá, Subachoque and Facatativá nocases of PYVD were observed.

There is no obvious explanation for the prevalence varia-tion in PYVV prevalence, although it may reflect the differentorigin of seed-tubers, crop management and the variation ofthe populations of T. vaporariorum. Our field observationssuggest that the populations of T. vaporariorumwere larger inAntioquia and Nariño, than in Cundinamarca, althoughwe didnot collect data. Unfortunately certified seed-tuber is rarelyused and there is little control of movement of germplasmbetween municipalities and states with known presence ofPYVD which could be one of the main reasons for diseasenow being present in areas that previously had low incidence.Another issue is the increase in the occurrence of white fly inColombian potato fields. Historically, they have not been anissue for potato producers and hence there are no labeledinsecticides for potato management. T. vaporariorum havebeen a problem in other crops and hence there are insecticideslabeled, and in fact their frequent use has resulted in resistantpopulations of white flies (Rodríguez et al. 2003).

A percentage of the symptomatic plants fromCundinamarcaandNariño tested negative by RT-PCR, in Cundinamarca 25%and 6 % of Nariño (Fig. 3a). There are several explanations forthese results. First, misidentification of yellowing symptoms inthe field. Second, the RT-PCR technique has lower limit de-tection when compared with molecular techniques such asqPCR, which is about 100 fold more sensitive (López et al.,2006). Another possibility is that infected tissue displayingvery severe yellowing symptoms may be less efficient forPYVV replication so it may accumulate lower virus titres. Aneven more important observation is that in both states, RT-PCRpositive samples were found among symptomless plants,2.4 %±8.3×10-5 in Cundinamarca and 41 %±0.0009 inNariño. Similar observations have been reported before(Salazar et al. 2000; Guzmán and Rodríguez 2010; Guzman-Barney et al. 2012). The possibility of “viral latency” ininfected plants that do not develop symptoms has beensuggested (Salazar et al. 2000) but the mechanism underlyingthis phenomenon is unknown. Other possibilities include thelate transmission of the virus by the vector to plants, meaningthat symptoms have not yet developed or alternatively the co-infection with other viruses that could suppress (Poolpol andInouye 1986) or enhance PYVV expression (Karyeija et al.2000; Mukasa et al. 2006). The role of the infected symptom-less plants in the epidemiology of the disease is unknown butclearly important in diagnostics.

Similar percentages of plants having mild, moderate andsevere symptoms were found in all three states (Table 2),suggesting that there was no differential effect due to cli-mate, latitude, altitude or other environmental factors insymptom expression. The need to increase the tuber-seedquality in all states must be emphasised to reduce PYVVspead through infected tubers.

Yield reduction in potato crops due to PYVD has beenreported to be around 50 % in varieties of Group Andígena(Díaz 1966; Saldarrriaga et al. 1988; Ortega and Rodríguez2005; Salazar et al. 2000). Guzmán-Barney et al. (2012) founda linear relationship between the number of S plants and yieldlosses in Group Phureja crops and showed that the productionwill be reduced by ~130 g/plant when 10 % of the plants in aplot show PYVD symptoms. The losses caused by PYVVandits high prevalence in Colombia make this a virus an importantthreat to the production of potato in Colombia.

From this study performed in 2008 PYVVwas found in allthree states of Colombia in which Phureja is commerciallyproduced. Prevalence of the virus is likely to increase unlessgrowers of both Andigena and Phureja use integrated pestmanagement approaches which includes using certified seed,and becoming diligent in controlling weeds that act as PYVVhosts as it is unlikely that the white fly populations will beeliminated without the aid of chemicals. These findingsshould be of value to seed certification programs, breedersand potato in Colombia, and other Andean countries.

Acknowledgments We would like to thank the Instituto deBiotecnología - Universidad Nacional de Colombia and the UniversidadMilitar Nueva Granada. We acknowledge the funding provided by theMinistry of Agriculture and Rural Development and ASOHOFRUCOL(project 2007S4654-69). We would also like to thank Karen Cubillos,Anngie Hernández, Angela Villamil for their technical collaboration andtechnicians at Fedepapa.

References

Bonilla, M. H., F. Cardozo, y A. Morales. 2009. Agenda prospectiva deinvestigación y desarrollo tecnológico para la cadena productiva dela papa en Colombia con énfasis en papa criolla. Ministerio deAgricultura y Desarrollo Rural, http://www.minagricultura.gov.co/archivos/agenda_papa_criolla.pdf. Accessed 13 August 2010.

Censo Nacional del Cultivo de Papa. 2002. Ministerio de Agricultura yDesarrollo Rural DANE. http://www.dane.gov.co/files/investigaciones/agropecuario/ena/papa_censo_cundinamarca.pdf .Accessed 27 July 2011.

Díaz, J. 1966. Incidencia del Virus del amarillamiento de las venas dela papa en el Ecuador y su trasmisión a través de los tubérculos.Revista Turrialba 16: 15–24.

EPPO. 1993. Potato yellow vein disease data sheet on quarantine pests.http://www.eppo.org/QUARANTINE/virus/Potato_yellow_vein_virus/PYVV00_ds.pdf, Accessed 27 July 2011.

Espinal, C., H. Martínez, N. Pinzón, and C. Barrios. 2005. La cadena dela papa en Colombia. Una mirada global de su estructura y dinámica1991‐2005. Documento de trabajo No. 54.Ministerio deAgriculturay Desarrollo Rural. Observatorio Agrocadenas Colombia. http://www.agronet.gov.co/www/docs_agronet/2005112163731_caracterizacion_papa.pdf, Accessed 30 Feb 2009

Franco-Lara, L., P. Rodríguez, and M. Guzmán. 2009. Determinationof prevalence of potato yellow vein virus (PYVV) in crops ofSolanum phureja in three states of Colombia by symptom detec-tion and RT-PCR. Phytopathology 99(6): S36.

Guzmán, M. 2008.Manual de protocolos para la detección de algunosvirus que infectan la papa. Cevipapa -Ministerio de Agricultura yDesarrollo Social. Bogota: Unibiblos.

Am. J. Potato Res. (2013) 90:324–330 329

Guzmán, M., and P. Rodríguez. 2010. Susceptibility of Solanumphureja (Juz et Buk) to potato yellow vein virus. AgronomíaColombiana 28: 219–224.

Guzmán, M., E. Ruiz, N. Arciniegas, and R.H.A. Coutts. 2006.Occurrence and variability of potato yellow vein virus in threestates of Colombia. Journal of Phytopathology 154: 748–750.

Guzman-Barney, M., L. Franco-Lara, D. Rodriguez, L. Vargas, andJ.E. Fierro. 2012. Yield losses in solanum tuberosum groupphureja cultivar criolla colombia in plants with symptoms ofPYVV in field trials. American Journal of Potato Research 89:438–447.

Karyeija, R.F., J.F. Kreuze, R.W. Gibson, and J.P.T. Valkonen. 2000.Synergistic interactions of a potyvirus and a phloem limitedcrinivirus in sweetpotato plants. Virology 269: 26–36.

Livieratos, I.C., E. Eliasco, G. Müller, R.C.L. Olsthoorn, L.F. Salazar,C.W.A. Pleij, and R.H.A. Coutts. 2004. Analysis of potato yellowvein virus RNA: evidence for a tripartite genome and conserved3’-terminal structures among members of the genus Crinivirus.The Journal of General Virology 85: 2065–2075.

López, R., C. Asensio, M. Guzman-Barney, and N. Boonham. 2006.Development of real-time and conventional RT-PCR assays forthe detection of potato yellow vein virus (PYVV). Journal ofVirological Methods 136: 24–29.

Martelli, G.P., A.A. Agranovsky, M. Bar-Joseph, D. Boscia, T.Candresse, R.H.A. Coutts, V.V. Dolja, B.W. Falk, D. Gonsalves,J.S. Hu, W. Jelkmann, A.V. Karasev, A. Minafra, S. Namba, H.J.Vetten, C.G. Wisler, and N. Yoshikawa. 2005. FamilyClosteroviridae. In Virus taxonomy. 8th. Report of the ICTV, ed.C.M. Fauquet, M.A. Mayo, J. Mani Maniloff, U. Desselberger,and L.A. Ball, 1077–1087. San Diego: Elsevier Academic Press.

Mukasa, S.B., P.R. Rubaihayo, and J.P.T. Valkonen. 2006. Interactionsbetween a crinivirus, an ipomovirus and a potyvirus in coinfectedsweetpotato plants. Plant Pathology 55: 458–467.

Ortega, E., and Y. Rodríguez. 2005. El virus del amarilleo de las venasde papa (PYVV). INIA Divulga 4: 33–36.

Poolpol, P., and T. Inouye. 1986. Enhancement of cucumber mosaicvirus multiplication by zucchini yellow mosaic virus in doublyinfected cucumber plants. Annals of the PhytopathologicalSociety of Japan 52: 22–30.

Rodríguez, I., H. Morales, and C.M. Cardona. 2003. Líneas base, dosisdiagnóstico y medición periódica de resistencia a insecticidas enpoblaciones de adultos e inmaduros de Trialeurodesvaporariorum (Homoptera:Aleyrodidae) en el Valle del Cauca,Colombia. Revista Colombiana de Entomología 29: 21–27.

Rodríguez, L.E., C.E. Ñustez, and N. Estrada. 2009. Criolla Latina,Criolla Paisa y Criolla Colombia, nuevos cultivares de papa criollapara el departamento de Antioquia (Colombia). AgronomíaColombiana 27: 289–303.

Salazar, L.F. 1997. La enfermedad del amarillamiento de las venas de lapapa: evidencia de la presencia de un virus inusual. Agroenfoque 12:24–26.

Salazar, L.F., G. Müller, M. Querci, J.L. Zapata, and R.A. Owens.2000. Potato yellow vein virus: its host range, distribution inSouth America and identification as a crinivirus transmitted byTrialeurodes vaporariorum. The Annals of Applied Biology 137:7–19.

Saldarrriaga, A., M. Alvarez, and J. Jaramillo. 1988. Efecto delamarilleo de venas transmitido por Trialeurodes vaporariorum(Westwood) en papa. Revista Colombiana de Entomología 14:3–8.

330 Am. J. Potato Res. (2013) 90:324–330