Primers
• Anneal to complementary regions of single stranded DNA
• DNA polymerase attaches to the primer and elongates the DNA by adding nucleotides
CTACTTAGTATGAGGCCTATATTTACC TATGA
Primer design overview 1) Locate region of interest in genome browser 2) Paste sequence into Primer3 and set
parameters – Target region (define locations of SNPs) – Product size (400-800 bp) – Annealing Temp or TM (57-62ᵒ)
3) Check specificity by blasting primers against D. melanogaster in NCBI Blast
Locate region of interest in genome browser
1. Go to the UCSC Genome Browser page (https://genome.ucsc.edu/)
2. Click on “Genome Browser” (there are 2 links)
Locate region of interest in genome browser
4. Under “Position/Search Term”, enter your SNP information (e.g., “chr3R:29,462,204-29,462,314”)
SNP Locations
GluClα
chr3R:19,742,169
ChAT chr3R:18,725,183
tenectin
chr3R:24,985,209 chr3R:24,985,256 chr3R:24,985,299
Ptp99A
chr3R:29,462,204 chr3R:29,462,232 chr3R:29,462,270 chr3R:29,462,314
Example: region of interest in serrano, defined by location of SNPs
18,955,920 18,955,959 18,955,986
Set a target range that includes all of the SNPs for the gene
Targets: 500, 100 The program will pick primers that will amplify a PCR product including 100 bp after the first SNP, which is located at 500.
Adjust the product size Min: 600 Opt: 800 Max: 1000
Click Pick Primers
Select Min 600, Opt 800, Max 1000
Output Note the annealing temperatures & product size >>>> forward primer location <<<< reverse primer location **** target region (with SNPs) Additional primers are listed at the bottom
Go to https://blast.ncbi.nlm.nih.gov/Blast.cgi?PAGE_TYPE=BlastSearch
• Make sure the blastn tab is selected. • Enter the primer sequence in the query box. • Click BLAST.
Your BLAST results should only match your gene. Sometimes only location is given, so make sure it’s on the correct chromosome