Dpto. Biología Celular, Genética y Fisiología Facultad de Ciencias
Production of collagen-targeted recombinant human growth factors for regenerative medicine purposes:
BMP-6 and bFGF
Memoria presentada por el Licenciado D. Rick Visser para optar al Grado de Doctor con la mención de Doctorado Europeo por la Universidad de Málaga.
Málaga, a 22 de junio de 2009.
Dr. D. Manuel Cifuentes Rueda, Profesor Titular del Departamento de Biología Celular,
Genética y Fisiología de la Facultad de Ciencias de la Universidad de Málaga, CERTIFICA
Que D. Rick Visser ha realizado bajo mi dirección el trabajo experimental que ha llevado a la redacción de la presente memoria de Tesis Doctoral, titulada “Production of collagen-targeted recombinant human growth factors for regenerative medicine purposes: BMP-6 and bFGF”. Considerando que constituye trabajo de Tesis Doctoral, autorizo su presentación para optar al Grado de Doctor con mención de Doctorado Europeo.
Y para que así conste y surta los efectos oportunos, firmo el presente documento en
Málaga, a 12 de mayo de 2009.
Fdo.: Manuel Cifuentes Rueda
Dr. D. José Becerra Ratia, Catedrático del Departamento de Biología Celular, Genética y
Fisiología de la Facultad de Ciencias de la Universidad de Málaga, CERTIFICA Que D. Rick Visser ha realizado bajo mi dirección el trabajo experimental que ha llevado a
la redacción de la presente memoria de Tesis Doctoral, titulada “Production of collagen-targeted recombinant human growth factors for regenerative medicine purposes: BMP-6 and bFGF”. Considerando que constituye trabajo de Tesis Doctoral, autorizo su presentación para optar al Grado de Doctor con mención de Doctorado Europeo.
Y para que así conste y surta los efectos oportunos, firmo el presente documento en
Málaga, a 12 de mayo de 2009.
Fdo.: José Becerra Ratia
Dr. D. José Becerra Ratia, director del Departamento de Biología Celular, Genética y Fisiología de la Facultad de Ciencias de la Universidad de Málaga,
CERTIFICA Que D. Rick Visser ha realizado el trabajo experimental, que ha llevado a la redacción de la
presente memoria de Tesis Doctoral, en los laboratorios del Área de Biología Celular y del Área de Fisiología, considerando que constituye trabajo de Tesis Doctoral.
Y para que así conste y surta los efectos oportunos, firmo el presente documento en
Málaga, a 12 de mayo de 2009.
Fdo.: José Becerra Ratia
Yo, Rick Visser, declaro que soy autor del presente trabajo de investigación y que lo he realizado en el Departamento de Biología Celular, Genética y Fisiología, bajo la dirección del Dr. Manuel Cifuentes Rueda y del Dr. José Becerra Ratia.
Y para que así conste, firmo el presente documento en Málaga, a 12 de mayo de 2009.
Fdo.: Rick Visser
A las tres grandes mujeres de mi vida: mi abuela, mi madre y mi hermana.
A Miguel.
“I – I hardly know who I am, sir, just at present – at least I know
who I was when I got up this morning, but I think I must have been changed
several times since then”
from Alice in Wonderland Lewis Carroll
Agradecimientos / Acknowledgements.
Éste ha sido un largo viaje, con una meta lejana, muchos caminos sin salida, atajos, penas
y alegrías, fracasos y pequeños éxitos. Como era de esperar en un peregrinaje de este calibre,
se hacen compañeros de viaje. Unos hacen todo el camino contigo, otros acaban eligiendo
caminos distintos y otros aparecen de repente, cuando uno no se lo espera, y se convierten en
compañías irreemplazables. No quiero dejar de agradecer a todas esas personas que, en algún
momento, han decidido calzarse las botas y caminar a mi lado.
A José (Pepe) Becerra por darme ese primer empujón para echar a andar y acogerme en
su grupo, por ser un ejemplo de impertérrita constancia y por mantenerse siempre accesible a
pesar de sus infinitas ocupaciones.
A Manuel (Manolo) Cifuentes, por hacerme descubrir el amor por la ciencia, por ser un
ejemplo de entusiasmo y por guiarme por este mundillo, pero dándome siempre la libertad de
cometer mis propias equivocaciones. A pesar de ser uno de los directores de este trabajo,
siempre ha estado cerca en el laboratorio y dispuesto a remangarse la bata para echar todas
las manos que hicieran falta. Pocos doctorandos tienen la suerte de poder decir que su director
de Tesis es, además, un buen amigo.
A Pilar Arrabal, por haber sido (y seguir siendo) la mejor compañera de viaje que uno
pueda desear. Emprendimos el viaje prácticamente juntos, pero ella siempre ha ido un paso por
delante, machete en mano, para abrir caminos en la maleza donde no los había. Juntos hemos
compartido todos los sinsabores de la ciencia, pero también momentos inolvidables de risas,
confidencias y pequeñas aventuras. Espero que sigas caminando infatigable hacia tus metas,
pero también poder seguir disfrutando de tu compañía y de tus sonrisas en el futuro. Y ahora
que vas a ser mamá, compartir con vosotros la alegría de este gran acontecimiento que tanto
se ha hecho esperar.
A mis amigos de Biología Celular, que han hecho el viaje mucho más agradable de lo que
hubiera podido ser. Eva, Leonor, Ana, Ángel, Mercedes, Iván, Irene, Lola, Juan Félix,
Jesús, Silvia, Pedro… y el resto del área en general.
Eva empezó colándose en Fisio Animal como si nada y acabó convirtiéndose en una amiga
que, con gran sinceridad, ha sabido apoyarme en los momentos malos y, con aún mayor gracia,
ha conseguido arrancarme carcajadas en los momentos buenos. ¡Mucha suerte en todo, rubia!
Leonor fue de las primeras que me dio prácticas en la carrera, allá por 1994 (!) y se ha
convertido en un gran referente para mi, tanto por su calidad humana como científica. Juntos
exploramos la Croacia profunda del “reis an biuti” y espero que aún podamos compartir muchas
más experiencias.
Ana apareció como “otra administrativa más” y acabó cautivándonos a “tous” con su
gracia, su sinceridad y su inocencia mezclada con picardía. No podría imaginarme el
departamento sin ella, ni el día a día sin su amistad.
Ángel, a pesar de quererle parecer serio y cortante a los que no le conocen, es una
fantástica persona a la que estimo mucho por su gran sentido del humor y por estar siempre
dispuesto a echar una mano.
Mercedes es un auténtico encanto y en más de una ocasión me ha prestado el apoyo que
necesitaba en ese momento. Pero mucho más importante es la alegría y el cariño que
transmite. A pesar de lo poco que le escribo, espero que sea consciente de que la echo de
menos y que siempre le desearé todo lo mejor.
Silvia Hernández enamora a cualquiera desde el primer momento. Su sentido del humor
y su enorme humanidad la convierten siempre en una compañía inestimable. Me alegro mucho
de tenerla cerca y espero que sea por mucho tiempo.
Iván es también de esos que se van ganando tu amistad sin darse uno cuenta (aparte de
ser el ganador indiscutible comiendo helados) por su gracia y compañerismo. Le deseo todo lo
mejor en su vida científica y personal.
Irene, Lola, Juan Félix, Jesús Santamaría, Pedro, Dani…, siempre han estado a
mano para hacerle a uno el día más agradable. Irene está en fase de reubicación y espero que
le vaya genial. Lola y Juan Félix son dos personas excepcionales y les deseo toda la felicidad
del mundo. Jesús es también una fantástica persona, siempre dispuesto a ayudar en cualquier
situación. ¡Eres un crack! Pedro y Dani han resultado ser una gran adquisición para el “club
del desayuno” y espero que les vaya todo muy bien.
Muchas gracias también a Inés y a Antonia por echarme una mano con los intrincados
formalismos de la burocracia.
A los demás compañeros de departamento que, en mayor o menor medida, han formado
alguna vez parte de mi viaje: José Manuel, Pepi, Antonio, J. Antonio, Diana, Mónica,
Adri, Lolín, Laura, Silvia, Alicia, Elena, Liz, Wilfredo…
Los integrantes del área de Fisiología Animal (Pedro, Juan, Jesús, Margarita, MariaDo,
Mamme…) han sido como una gran familia para mi, ya que me han acogido y aguantado
desde hace ya un montón de años.
Margarita es también de las primeras que conocí (¡hace ya unos 15 años!) y es una de las
personas que más admiro. No sólo ha sacado tiempo para escucharme siempre que me ha
hecho falta, sino que ha conseguido hacerme revolcarme de risa con su humor y alegría. Ojalá
hubiera más Margaritas en el mundo.
MariaDo también me ha brindado horas de buen humor, risas y afecto. Tu visión crítica del
mundo me cautiva y me ha hecho reflexionar en muchas ocasiones.
Pedro, Juan y Jesús han sido grandes puntos de apoyo, siempre dispuestos a ayudar en
todo. Vuestra compañía ha sido una alegría constante.
Mamme y Rafa, con los que he compartido muy buenos ratos, además de laboratorio y
despacho. Os deseo muchísima felicidad y espero poder ser partícipe de ella.
Carolina, Reme, las distintas Patricias… Gracias por vuestra compañía y los buenos
momentos.
Elena y Pablo llegaron sin previo aviso para traer sangre nueva al laboratorio. Ahora que
se han reubicado, espero que les vaya todo muy bien y poder ser testigo de sus futuras Tesis.
José Esteban siempre ha estado dispuesto a atender a todas las peticiones de ayuda. Le
agradezco mucho su dedicación durante ya muchos años.
For four and a half months, a great family adopted me in Braunschweig. Without knowing
me at all, Ursula (Uschi) Rinas opened me her house and her lab, not expecting anything in
exchange. I not only discovered in her a great researcher, from who I learned a lot, but also a
great woman, with who I hope to stay in contact forever.
I met Felipe in a quite tumultuous time of his life, but still he found some time to help me
with the protein folding. I am very thankful for that and wish him, his wife and their kid(s) all
the best.
With Heike and Xin I had a great feeling. They were always willing to help me with
whatever and I will never forget all the laughter we shared. I wish them all the best in their
personal and scientific life, and hope we will meet again someday (maybe another weekend in
Berlin?).
The beginning with Nadine was a little bit tense, but after just a few weeks I discovered in
her a fantastic person, very down to earth, with who I had some great moments. I wish her
also lots of success.
Ich danke euch allen für Ihre Hilfe und Unterstützung!
Gracias a mis compañeros del área de Genética (Eduardo, Cayo, Araceli, Cristina,
Gabriel, Fidela, Migue, Luis…) que tantas veces me han visto aparecer por ahí para pedirles
ayuda, ya fuera material o intelectual. Vuestra paciencia conmigo ha sido un alivio y vuestros
consejos muy tenidos en cuenta.
Mis vecinos de Fisiología Vegetal (Adolfo, Lourdes, Maca, Gema, Carmen, Elena, Sara,
Nieves, Lara, Sergio, Bea, Juan Antonio…) han sido siempre una compañía agradable y
han alegrado muchos almuerzos y “cigarritos en el porche”. Espero poder seguir disfrutando de
esa compañía mucho tiempo más.
Muchísimas gracias a mis compañeros de Zoología (Ramón Muñoz-Chápuli, José María,
Rita, Juan Antonio, Víctor…) por ofrecerme siempre su ayuda y consejos, y por los buenos
ratos que he pasado charlando con ellos. Es una tremenda alegría tener cerca a un grupo de
gente tan competente y tan dispuesta a echar una mano cuando uno lo pide, e incluso sin que
uno lo pida. Os deseo todo lo mejor.
Gracias también a mi pequeño grupo de acogida de Microbiología (Juanjo, Lola, Esther,
Irene, Benjamín…), que me dieron la oportunidad de vivir un pequeño cambio de aires y con
los que disfruté mucho trabajando.
Many thanks to Dr. A. Hari Reddi for his helpful comments and revision of the manuscript.
Mis amigos fuera de mi “mundo laboral” han sido una de las grandes bases en que me he
podido apoyar. A algunos de ellos les veo poco o casi nada, pero todos se han ganado a pulso
mi respeto y mi cariño, y no quisiera tener que prescindir nunca de ninguno de ellos. Los voy a
repasar por orden alfabético para que nadie se sienta menospreciado/a, aunque todos saben
que tienen su propia parcelita en mi corazón.
Si, en el pasado, alguien me hubiera dicho que alguna vez le iba a coger tanto cariño a
Cristina Draper le hubiera mirado con todo el escepticismo. Aunque poca gente sea capaz de
seguirle el ritmo, la alegría y la energía que transmite animan a cualquiera.
Cristina Muñoz y Rafa me llegaron casi por obligación pero, aún así, no me costó el más
mínimo trabajo empezar a cogerles un cariño que crece día a día. Ya he sido testigo (no literal)
de vuestra boda y de vuestra compra de casa y espero poder compartir muchas más alegrías
con vosotros en el futuro.
Eli ha estado muy presente en mi vida en los últimos años y se ha convertido en una gran
amiga, siempre dispuesta a tender una mano, a preocuparse por mis problemas y a compartir
muchísimas risas, comidas, partidas de cartas, ratos de playa, etc.
Con Esther y Manolo he podido pasar muy buenos momentos de norte a sur del país
(Oviedo, Madrid y Málaga). Ahora que ya parece que se han estabilizado, espero que nos
podamos hacer muchas visitas mutuas.
Isa ha sido una inseparable compañera de carrera y una gran amiga, con la que me he
reído hasta caer al suelo. Aunque ahora casi nunca la vea, espero que sepa el cariño que aún le
guardo y que le vaya todo muy bien.
Manolo se ha ganado el derecho a ser un amigo al que admiro mucho por su espectacular
humor, por su sinceridad y por estar siempre ahí. Espero que seas muy feliz y que coseches
muchos éxitos.
Mª Tere ha sido una especie de hermana durante un largo tiempo, con quien he
compartido muchas experiencias. Aunque nos hemos ido distanciando poco a poco, siempre
tendrá todo mi cariño y mi ayuda cuando la necesite.
En los principios de mi Tesis, Marisella me brindó muchos ratos de risas y conversaciones
surrealistas con su particular forma de ser. Ya hace varios años que perdimos el contacto, pero
espero que alcances todos tus sueños.
Raquel y Domingo son también de esos amigos poco vistos pero muy queridos. Siempre
recordaré los buenos momentos que hemos pasado juntos.
Teresa y Jose han sido de los últimos en aparecer en mi camino, pero rápidamente se han
hecho querer. Poco a poco se van acumulando aventuras vividas juntos a lo largo de toda la
geografía.
Gracias a mi “familia política”, que me ha acogido con tanto cariño y que me permiten
sentirme tan a gusto entre ellos. A Isabel y Antonio, por abrirme las puertas de su casa y
tenerme siempre un hueco reservado en su mesa para compartir esas paellas tan fantásticas. A
mis “cuñados” y “concuñadas”, Toni y Susana, Petri, David y Gladys, y Javi, por hacerme
partícipes de sus vidas y poder compartir unas cuantas risas con ellos.
Dank je wel, Willem, voor altijd klaar te staan om te helpen met wat dan ook. Dank zij jou
had ik zomaar een auto voor de deur en alles wat ik nodig had hoefde ik maar voor te vragen.
Je bent een kei!
Tante Rie, uw gevoel voor humor en doorzettingsvermogen is altijd een positief stimulance
geweest. Dank U wel!
Oma, dank U wel voor alles. U heeft altijd aan mij gedacht, en zelfs al had U niet veel, was
er altijd wat voor mij weggelegd.
Seda, jij bent niet alleen mijn enige zus, maar ook altijd een vriendin geweest. Ookal
hebben we soms ruzie gehad (en dat zal wel zo blijven), weet je dat ik zielsveel van je hou, dat
ik altijd aan je denk en dat ik hoop dat je heel gelukkig wordt.
Mama, wat kan ik zeggen? Je bent altijd, of je het gelooft of niet, mijn grootste steun
geweest. Alles wat ik heb bereikt en wat ik nog bereiken kan is dankzij jouw, jouw werk, jouw
moed en jouw liefde. Ookal hebben we soms onze oneinigheden, mijn liefde en dankbaarheid
voor jouw zit zo bij mij ingegroeid dat dat nooit kan verdwijnen.
Miguel, tú sabes bien lo que supones para mi. No habrá adversidad en el mundo capaz de
mermar lo mucho que te quiero ni la ilusión que tengo por compartirlo todo contigo. Gracias
por estar ahí a mi lado.
Gracias. De verdad. Rick
Durante la realización del presente trabajo de investigación, el doctorando ha disfrutado de una beca de Formación de Personal Docente e Investigador (FPDI) de la Junta de Andalucía, de una beca de Formación de Profesorado Universitario (FPU) del Ministerio de Educación y Ciencia, de un contrato de investigación del Centro de Investigación Biomédica en Red en Bioingeniería, Biomateriales y Nanomedicina (CIBER-BBN) y de un contrato de investigación de la Red de Terapia Celular (Red TerCel) del Instituto de Salud Carlos III.
El presente trabajo de investigación se ha financiado con fondos de los siguientes proyectos
e instituciones: - Ministerio de Educación y Ciencia (BIO2006-03599). - Junta de Andalucía, Consejería de Salud (TCRM 0012/2006). - Junta de Andalucía, Consejería de Innovación, Ciencia y Empresa (P07-CVI-2781). - Red de Terapia Celular. Instituto de Salud Carlos III (RD06/0010/0014).
_________________________________________________________________________Index
Text index.
Abbreviations used in this text ..................................................................................... 1
1. Introduction ............................................................................................................. 7
1.1. Bone and bone regeneration................................................................................. 9
1.1.1. The histology of bone.................................................................................. 9
1.1.2. Bone regeneration ..................................................................................... 10
1.1.3. Molecules involved in bone regeneration ...................................................... 11
1.1.4. Clinical and economic aspects of fracture healing.......................................... 15
1.2. Bone morphogenetic protein-6 ............................................................................. 17
1.2.1. The bone morphogenetic proteins ............................................................... 17
1.2.2. General structure of the BMPs..................................................................... 18
1.2.3. Structure of BMP-6..................................................................................... 20
1.2.4. BMP signalling ........................................................................................... 22
1.2.5. Biological activity of BMPs........................................................................... 25
1.2.6. Biological activity of BMP-6 in osteogenesis .................................................. 27
1.3. Basic fibroblast growth factor............................................................................... 29
1.3.1. The fibroblast growth factors ...................................................................... 29
1.3.2. Structure of bFGF ...................................................................................... 29
1.3.3. bFGF secretion........................................................................................... 30
1.3.4. bFGF receptors and bFGF-binding molecules ................................................ 31
1.3.5. bFGF signalling .......................................................................................... 33
1.3.6. bFGF biological activity ............................................................................... 33
1.4. Therapies for bone defect healing ........................................................................ 37
1.4.1. Growth factors for bone defect healing ........................................................ 37
1.4.2. Safety of the clinical use of growth factors ................................................... 38
1.4.3. Osteoconductive carriers............................................................................. 39
1.4.4. Modified growth factors for regenerative medicine ........................................ 41
1.5. Escherichia coli as an expression system............................................................... 43
1.5.1. Obtaining functional proteins from inclusion bodies....................................... 43
1.5.2. In vitro refolding of proteins ....................................................................... 44
1.6. Baculoviruses as expression systems .................................................................... 47
1.6.1. General information on baculoviruses. The baculovirus life-cycle .................... 47
1.6.2. Baculovirus-based expression systems ......................................................... 49
1.6.3. BacPak6™ and Sapphire™ .......................................................................... 51
i
Index_________________________________________________________________________
2. Hypothesis and objectives ....................................................................................... 53
2.1. Hypothesis.......................................................................................................... 55
2.2. Objectives .......................................................................................................... 57
3. Material and methods .............................................................................................. 59
3.1. Obtaining of the genes encoding h-bFGF and hBMP-6 ............................................ 61
3.1.1. Culture of U-2-OS cells ............................................................................... 61
3.2. Cloning into the pET17b expression vector and the pAcGP67B shuttle vector............ 61
3.2.1. Cloning of the hBMP-6 and the hBMP-6-CBD genes into the pET17b
and the pAcGP67B vectors .......................................................................... 62
3.2.2. Cloning of the h-bFGF and the h-bFGF genes into the pAcGP67B vector .......... 64
3.3. Protein production in Escherichia coli .................................................................... 66
3.3.1. Obtaining of bacterial clones for protein production....................................... 66
3.3.2. Protein expression...................................................................................... 68
3.3.3. Isolation of inclusion bodies ........................................................................ 68
3.3.4. Solubilization of inclusion bodies.................................................................. 69
3.3.5. In vitro refolding ........................................................................................ 69
3.4. Protein production in Sf9 insect cells ..................................................................... 73
3.4.1. Culture of Sf9 cells ..................................................................................... 75
3.4.2. Transfection of Sf9 cells.............................................................................. 75
3.4.3. Isolation of viral clones (plaque assay)......................................................... 76
3.4.4. PCR analysis of the viral clones.................................................................... 78
3.4.5. Expansion of the baculovirus clones............................................................. 78
3.4.6. Titering of viral suspensions ........................................................................ 79
3.4.7. Production assays ...................................................................................... 80
3.4.8. Large-scale protein production .................................................................... 80
3.4.9. Purification of rhBMP-6 produced in Sf9 cells ................................................ 81
3.4.10. Purification of rh-bFGF and rh-bFGF-CBD produced in Sf9 cells..................... 82
3.5. Biochemical analysis of the produced proteins ....................................................... 83
3.5.1. SDS-PAGE ................................................................................................. 83
3.5.2. Western blot.............................................................................................. 83
3.5.3. Dot blot..................................................................................................... 84
3.6. Collagen-binding affinity test ................................................................................ 84
3.7. In vitro biological activity tests ............................................................................. 85
3.7.1. Induction of ALP expression on C2C12 mouse myoblasts ............................... 85
3.7.2. Proliferation assay on MC3T3-E1 mouse preosteoblasts ................................. 86
3.7.3. Inhibition of differentiation assay on MC3T3-E1 mouse preosteoblasts ............ 86
3.8. In vivo heterotopic bone formation assay .............................................................. 87
ii
_________________________________________________________________________Index
3.9. Histological analysis of the implanted ACS............................................................. 88
3.9.1. Histochemical stains ................................................................................... 89
3.9.2. Immunohistochemistry ............................................................................... 89
3.10. Statistical analysis............................................................................................. 89
Appendix I. Protocols and recipes ............................................................................... 91
AI.1. Buffers of general use ....................................................................................... 93
AI.2. Recombinant DNA technology ............................................................................ 93
AI.2.1. Total RNA isolation ................................................................................... 93
AI.2.2. Reverse transcription - polymerase chain reaction....................................... 94
AI.2.3. Polymerase chain reaction......................................................................... 94
AI.2.4. Plasmid purification .................................................................................. 95
AI.2.5. DNA electrophoresis ................................................................................. 95
AI.2.6. RNA electrophoresis ................................................................................. 95
AI.2.7. DNA purification from agarose gels ............................................................ 96
AI.2.8. DNA digestion with endonucleases............................................................. 96
AI.2.9. DNA precipitation ..................................................................................... 97
AI.2.10. DNA ligation .......................................................................................... 97
AI.2.11. DNA sequencing..................................................................................... 98
AI.2.12. Plasmids................................................................................................ 98
AI.2.13. Oligonucleotides....................................................................................100
AI.3. Protein expression in E. coli...............................................................................102
AI.3.1. Bacterial cell culture ................................................................................102
AI.3.2. Bacterial cell culture media.......................................................................102
AI.3.3. Bacterial strains ......................................................................................103
AI.3.4. Storage of bacterial clones .......................................................................103
AI.3.5. Transformation of E. coli strains ...............................................................104
AI.3.5.1. Making of electrocompetents...........................................................104
AI.3.5.2. Electroporation ..............................................................................104
AI.3.6. Colony-PCR.............................................................................................105
AI.4. Eukaryotic cell culture.......................................................................................105
AI.4.1. Cell lines.................................................................................................106
AI.4.2. Cell culture media ...................................................................................106
AI.4.3. Cell counting and determination of cell viability..........................................107
AI.5. Protein analysis................................................................................................108
AI.5.1. Protein precipitation with trichloroacetic acid .............................................108
iii
Index_________________________________________________________________________
AI.5.2. SDS-PAGE.............................................................................................. 108
AI.5.2.1. Buffers and reagents ..................................................................... 108
AI.5.2.2. Gel preparation ............................................................................. 109
AI.5.3. Staining of gels with Coomassie blue........................................................ 110
AI.5.3.1. Buffers and reagents ..................................................................... 110
AI.5.3.2. Staining protocol ........................................................................... 110
AI.5.4. Electrotransference of proteins to PVDF.................................................... 111
AI.5.4.1. Buffers and reagents ..................................................................... 111
AI.5.4.2. Transference protocol .................................................................... 111
AI.5.5. Staining of proteins on PVDF with amido black.......................................... 111
AI.5.5.1. Buffers and reagents ..................................................................... 111
AI.5.5.2. Staining protocol ........................................................................... 112
AI.5.6. Immunostaining of proteins on PVDF ....................................................... 112
AI.5.6.1. Buffers and reagents ..................................................................... 112
AI.5.6.2. Immunostaining protocol................................................................ 112
AI.5.7. Development of immunostained proteins .................................................. 113
AI.6. Histological analyses ........................................................................................ 113
AI.6.1. Fixation, decalcification, dehydration and embedding in paraffin ................. 113
AI.6.2. Hematoxylin-eosin staining...................................................................... 114
AI.6.3. Masson’s trichrome staining..................................................................... 114
AI.6.4. Alcian blue staining................................................................................. 115
AI.6.5. Immunohistochemistry............................................................................ 115
Appendix II. Reagents and equipment...................................................................... 117
AI.1. Fungibles ........................................................................................................ 119
AI.2. Reagents ........................................................................................................ 119
AI.3. Equipment ...................................................................................................... 122
4. Results .................................................................................................................... 125
4.1. Obtaining of the gene encoding hBMP-6.............................................................. 127
4.2. Cloning of the genes into the expression vectors.................................................. 127
4.3. Production of rhBMP-6 in Escherichia coli ............................................................ 128
4.3.1. Obtaining of rhBMP-6-expressing clones of E. coli Rosetta™ (DE3) ............... 128
4.3.2. Expression of rhBMP-6 in Escherichia coli ................................................... 129
4.3.3. Refolding of rhBMP-6 produced in Escherichia coli....................................... 130
4.4. Production of rhBMP-6 and rhBMP-6-CBD in Sf9 cells ........................................... 134
4.4.1. Obtaining of rhBMP-6 and rhBMP-6-CBD expressing clones
of baculoviruses........................................................................................ 134
iv
_________________________________________________________________________Index
4.4.2. Production assays for rhBMP-6 and rhBMP-6-CBD ........................................137
4.4.2.1. Production assay for rhBMP-6 ..........................................................137
4.4.2.2. Production assay for rhBMP-6-CBD ...................................................139
4.4.3. Analysis of the influence of the PDI on rhBMP-6 production in Sf9 cells..........140
4.4.4. Expression and purification of rhBMP-6 and rhBMP-6-CBD ............................141
4.4.4.1. Purification of rhBMP-6 ....................................................................141
4.4.4.2. Purification of rhBMP-6-CBD..............................................................143
4.4.4.3. Obtaining of rhBMP-6 and rhBMP-6-CBD under native conditions..........145
4.4.5. In vitro analysis of the biological activity of rhBMP-6 and rhBMP-6-CBD .........146
4.5. Production of rh-bFGF and rh-bFGF-CBD in Sf9 cells..............................................147
4.5.1. Obtaining of rh-bFGF and rh-bFGF-CBD expressing clones
of baculoviruses ........................................................................................148
4.5.2. Production assays for rh-bFGF and rh-bFGF-CBD .........................................149
4.5.2.1. Production assay for rh-bFGF ............................................................149
4.5.2.2. Production assay for rh-bFGF-CBD.....................................................151
4.5.3. Expression and purification of rh-bFGF and rh-bFGF-CBD .............................151
4.5.3.1. Purification of rh-bFGF......................................................................152
4.5.3.2. Purification of rh-bFGF-CBD ..............................................................153
4.5.3.3. Obtaining of rh-bFGF and rh-bFGF-CBD under native conditions...........155
4.5.4. Collagen-binding affinity tests for rh-bFGF and rh-bFGF-CBD ........................157
4.5.5. In vitro analysis of the biological activity of rh-bFGF and rh-bFGF-CBD...........160
4.5.5.1. Mitogenic activity of rh-bFGF and rh-bFGF-CBD on MC3T3-E1 mouse
Preosteoblasts .................................................................................160
4.5.5.2. Inhibition of differentiation of MC3T3-E1 mouse preosteoblasts
by rh-bFGF and rh-bFGF-CBD ...........................................................163
4.6. In vivo heterotopic bone formation......................................................................164
4.6.1. Analysis of the implants with rhBMP-6 alone................................................169
4.6.2. Analysis of the implants with rhBMP-6 and commercial rh-bFGF ....................170
4.6.3. Analysis of the implants with rhBMP-6 and rh-bFGF produced in Sf9 cells.......171
4.6.4. Analysis of the implants with rhBMP-6 and rh-bFGF-CBD ..............................173
5. Discussion................................................................................................................175
5.1. Engineering of the growth factors........................................................................177
5.1.1. Engineering of the gene encoding the rhBMP-6-CBD ....................................177
5.1.2. Obtaining of the genes encoding the rh-bFGF and the rh-bFGF-CBD..............178
5.2. Production of rhBMP-6 in Escherichia coli .............................................................179
5.3. Production of rhBMP-6 and rhBMP-6-CBD in Sf9 cells ............................................181
5.4. Production of rh-bFGF and rh-bFGF-CBD in Sf9 cells..............................................186
v
Index_________________________________________________________________________
5.5. In vivo osteogenic activity of combinations of BMP-6 and bFGF ............................. 191
5.6. Perspectives for the future ................................................................................. 195
6. Conclusions............................................................................................................. 197
7. Bibliography............................................................................................................ 201
Appendix III. Abstract in Spanish / Resumen en español........................................ 221
Figures and tables index.
Fig. 1. Transversal section through the diaphysis of a long bone.......................................... 10
Table 1. Molecules involved in bone regeneration .............................................................. 14
Table 2. Fracture incidence and costs in the EU ................................................................. 15
Table 3. The BMP family .................................................................................................. 17
Table 4. Identity matrix for the BMP family ....................................................................... 18
Fig. 2. Schematic representation of the BMP-7 monomer .................................................... 19
Fig. 3. Schematic representation of the processing of a BMP pre-pro-protein
to obtain an active dimer....................................................................................... 20
Fig. 4. Three-dimensional representation of the BMP-6 dimer.............................................. 21
Table 5. The BMP receptors ............................................................................................. 22
Fig. 5. Representation of the “canonical” BMP-Smad signalling pathway............................... 23
Fig. 6. Representation of the “noncanonical” BMP-MAPK signalling pathway ......................... 24
Fig. 7. Hierarchic model of BMP-induced osteoblastic differentiation..................................... 26
Fig. 8. Schematic representation of the bFGF mRNA and the isoforms of bFGF
resulting from its alternative translation.................................................................. 30
Fig. 9. Three-dimensional representations of the bFGF molecule, based on
crystallization data at 2.2 Å resolution..................................................................... 31
Fig. 10. Schematic representation of the FGF Receptor....................................................... 32
Fig. 11. Representation of the two major pathways for bFGF signalling:
The MAPK and the PKC pathways ......................................................................... 34
Table 6. Recombinant fusion proteins with additional binding domains to cells
or extracellular matrix proteins ............................................................................ 42
Fig. 12. Schematic representation of the events that can happen during protein
folding............................................................................................................... 44
Fig. 13. Schematic representation of a typical baculovirus infection cycle ............................. 48
vi
_________________________________________________________________________Index
Fig. 14. Schematic representation of the homologous recombination event that
gives rise to an infective, recombinant baculovirus ................................................. 51
Fig. 15. The BacPak6™ viral DNA and the Sapphire™ viral DNA .......................................... 52
Fig. 16. Schematic representation of a recombinant engineered growth factor with a
decapeptidic collagen type I-binding domain fused to the N-terminal part
of the molecule................................................................................................... 56
Fig. 17. Schematic overview of the obtaining of the pET17b:BMP-6 and the
pET17b:BMP-6-CBD constructions ........................................................................ 63
Fig. 18. Schematic overview of the obtaining of the pAcGP67B:BMP-6 and the
pAcGP67B:BMP-6-CBD constructions..................................................................... 64
Fig. 19. Schematic overview of the obtaining of the pAcGP67B:bFGF and the
pAcGP67B:bFGF-CBD constructions ...................................................................... 65
Fig. 20. Schematic overview of the main steps needed for recombinant protein
production in E. coli.............................................................................................. 67
Table 7. Attempts on in vitro refolding of rhBMP6 monomers produced in
Escherichia coli .................................................................................................. 71
Fig. 21. Schematic overview of the steps needed to obtain a recombinant baculovirus .......... 73
Fig. 22. Formation of a lysis plaque .................................................................................. 77
Fig. 23. Real size photograph of the absorbable collagen sponge discs ................................ 85
Table 8. Combinations of growth factors tested by the heterotopic bone
formation assay in rats....................................................................................... 88
Fig. 24. Implantation of ACS loaded with growth factors into the dorsal muscles of rats ........ 88
Fig. 25. The pBlueScript® II SK(+) vector ......................................................................... 99
Fig. 26. The pET17b expression vector ............................................................................. 99
Fig. 27. The pAcGP67B shuttle vector ..............................................................................100
Fig. 28. RT-PCR with P5 vs. P6 on U-2 OS total RNA for the amplification of the sequence
encoding the mature domain of the hBMP-6.........................................................127
Fig. 29. PCR analysis of the obtained expression vectors ...................................................127
Fig. 30. rhBMP-6 production in Escherichia coli .................................................................130
Fig. 31. Effect of GSH:GSSG ratio on in vitro refolding of rhBMP-6 expressed in
Escherichia coli ...................................................................................................131
Fig. 32. Effect of antiaggregants, pH and GSH:GSSG ratio on in vitro refolding
of rhBMP-6 expressed in Escherichia coli ...............................................................132
Fig. 33. Effect of protein concentration and GSH:GSSG ratio on in vitro refolding
of rhBMP-6 expressed in Escherichia coli ...............................................................132
Fig. 34. Effect of redox pair, redox pair concentration and N2 supply on in vitro
refolding of rhBMP-6 expressed in Escherichia coli..................................................133
vii
Index_________________________________________________________________________
Fig. 35. Effect of the temperature on in vitro refolding of rhBMP-6 expressed in
Escherichia coli................................................................................................... 133
Fig. 36. Sf9 cells eight days after co-transfection with pAcGP67B:rhBMP-6 and
Sapphire™ linearized baculoviral DNA.................................................................. 135
Fig. 37. Isolation of baculoviral clones............................................................................. 136
Fig. 38. PCR analysis of the isolated baculoviral clones ..................................................... 136
Fig. 39. Production assay for rhBMP-6, analyzed by Western blot ...................................... 138
Fig. 40. Western blot analysis with reducing agents of the rhBMP-6 produced in Sf9 cells.... 138
Fig. 41. Production assay for rhBMP-6-CBD, analyzed by Western blot ............................... 139
Fig. 42. Production assay for rhBMP-6 expressed by BacPak6™ baculoviruses .................... 140
Fig. 43. Purification by heparin-sepharose chromatography of rhBMP-6 expressed
in Sf9 cells ......................................................................................................... 142
Fig. 44. Western blot analysis of the elution fractions obtained by heparin-sepharose
chromatography of rhBMP-6 expressed in Sf9 cells. ............................................... 142
Fig. 45. Proposed matrix elution model for rhBMP-6 forms expressed in Sf9 cells ................ 143
Fig. 46. Purification by heparin-sepharose chromatography of rhBMP6-CBD expressed
in Sf9 cells ......................................................................................................... 144
Fig. 47. Western blot analysis of the elution fractions obtained by heparin-sepharose
chromatography of rhBMP-6-CBD expressed in Sf9 cells......................................... 144
Fig. 48. Western blot analysis of the rhBMP-6 samples after removing the excess
of urea and NaCl ................................................................................................ 145
Fig. 49. ALP activity induced by rhBMP-6 produced in CHO cells on C2C12
mouse myoblasts................................................................................................ 147
Fig. 50. PCR analysis of the isolated baculoviral clones using primers that hybridize
with the baculoviral DNA flanking the insert .......................................................... 148
Fig. 51. PCR analysis of the isolated baculoviral clones ..................................................... 149
Fig. 52. Production assay for rh-bFGF, analyzed by Western blot....................................... 150
Fig. 53. Production assay for rh-bFGF-CBD, analyzed by Western blot................................ 151
Fig. 54. Purification by heparin-sepharose chromatography of rh-bFGF expressed
in Sf9 cells ......................................................................................................... 152
Fig. 55. Immuno-dot blot analysis of the collection fractions of rh-bFGF produced
in Sf9 cells and purified by heparin-sepharose chromatography .............................. 153
Fig. 56. Purification by heparin-sepharose chromatography of rh-bFGF-CBD expressed
in Sf9 cells ......................................................................................................... 154
Fig. 57. Immuno-dot blot analysis of the collection fractions of rh-bFGF-CBD produced
in Sf9 cells and purified by heparin-sepharose chromatography .............................. 154
Table 9. Samples of bFGF after purification by heparin-sepharose chromatography............. 155
Table 10. Samples of bFGF after buffer exchange and concentration................................. 156
viii
_________________________________________________________________________Index
Fig. 58. Analysis by immuno dot-blot of the rh-bFGF and the rh-bFGF-CBD
produced in Sf9 cells after purification and buffer exchange...................................156
Fig. 59. Collagen-binding test of rh-bFGF and rh-bFGF-CBD produced in Sf9 cells ................158
Fig. 60. Stability of the collagen-binding of rh-bFGF and rh-bFGF-CBD
produced in Sf9 cells ..........................................................................................159
Fig. 61. Phenotypical changes induced by rh-bFGF and rh-bFGF-CBD on MC3T3-E1
mouse preosteoblasts ..........................................................................................161
Fig. 62. Proliferation of MC3T3-E1 mouse preosteoblast induced by bFGF ...........................162
Fig. 63. Mitogenic activity curves of rh-bFGF and rh-bFGF-CBD ..........................................162
Fig. 64. ALP activity in cultures of MC3T3-E1 mouse preosteoblasts in the presence of
ascorbic acid and bFGF ........................................................................................163
Fig. 65. Staining of the implants without BMP-6 with H-E ..................................................165
Fig. 66. Staining of the implants with BMP-6 with H-E and Masson’s trichrome ....................167
Fig. 67. Staining of the implants with alcian blue ..............................................................168
Fig. 68. Immunostaining of the implants with an anti-osteopontin antibody ........................169
Fig. 69. Histological analysis of the implants with rhBMP-6 alone........................................170
Fig. 70. Histological analysis of the implants with rhBMP-6 + commercial rh-bFGF...............171
Fig. 71. Histological analysis of the implants with rhBMP-6 + rh-bFGF produced
in Sf9 cells.........................................................................................................172
Fig. 72. Histological analysis of the implants with rhBMP-6 + rh-bFGF-CBD
produced in Sf9 cells ..........................................................................................173
ix
__________________________________________________________________Abbreviations
Abbreviations used in this text.
A.
ACS: absorbable collagen sponge.
ActR: activin-like receptor.
aFGF (=FGF1): acidic fibroblast growth factor.
ALK: activin receptor-like kinase.
ALP: alkaline phosphatase.
AMSH: associated molecule with the SH3 domain of STAM.
APS: ammonium persulfate.
B.
β-1-LAP: latency-associated peptide of TGF-β.
BAMBI: BMP and activin membrane bound inhibitor.
bFGF (=FGF2): basic fibroblast growth factor.
BMP: bone morphogenetic protein.
BMPR: BMP receptor.
bp: base pair.
BSA: bovine serum albumin.
C.
CBD: collagen-binding domain.
CDMP: cartilage-derived morphogenetic protein.
cDNA: complementary DNA
CHES: 2-(N-Cyclohexylamino) ethanesulfonic acid.
CHO: Chinese hamster ovary.
CIZ: cas-interacting zinc finger protein.
CNS: central nervous system.
Co-Smad: common-partner Smad.
D.
DAB: 3,3’-diaminobenzidine.
DAG: diacyl glycerol.
DAN: differential screening-selected gene aberrative in neuroblastoma.
DBM: demineralized bone matrix.
DEPC: diethyl pyrocarbonate.
DMEM: Dulbecco's modified Eagle medium.
1
Abbreviations__________________________________________________________________
DMSO: dimethyl sulfoxide.
DNA: deoxyribonucleic acid.
dNTP: deoxyribonucleotide triphosphate.
dpp: decapentaplegic.
dsDNA: double stranded DNA.
DTT: dithiothreitol.
E.
ECM: extracellular matrix.
EDTA: ethylenediaminetetraacetic acid.
EGF: epidermal growth factor.
ELISA: enzyme-linked immunosorbent assay.
EMEA: European Medicines Agency.
F.
FBS: foetal bovine serum.
FDA: U.S. Food and Drug Administration.
FGF-BP: FGF-binding protein.
FGFR: FGF receptor.
FRS2: FGF receptor substrate 2.
G.
GDF: growth and differentiation factor.
Gnd-HCl: guanidine hydrochloride.
GOI: gene of interest.
GRB2: growth factor receptor-bound protein 2.
GSH: glutathione (reduced form).
GSSH: glutathione (oxidized form).
GV: granulovirus.
H.
HA: hydroxyapatite.
H-E: hematoxylin-eosin.
HGF: hepatocyte growth factor.
HRP: horseradish peroxidase.
HSPG: heparan sulphate proteglycan.
HVVS: high volume virus stock.
2
__________________________________________________________________Abbreviations
I.
Ibp: inclusion body protein.
IG: immunoglobulin.
IGF: insulin-like growth factor.
IGFBP: insulin-like growth factor binding protein.
IL: interleukin.
IPTG: isopropyl-β-D-thiogalactopyranoside.
IP3: inositol triphosphate.
I-Smad: inhibitory Smad.
K.
Kb: kilobase.
Kbp: kilobase pair.
KDa: kilodalton.
L.
LB: Luria-Bertani culture medium.
Lef-1: lymphoid enhancer-binding factor-1.
M.
MAPK: mitogen-activated protein kinase.
MCS: multiple cloning site.
MEM: minimum essential medium.
MES: 2-(N-morpholino)ethanesulfonic acid.
MNPV: multiple nucleopolyhedrovirus.
mRNA: messenger ribonucleic acid.
MSC: mesenchymal stem cell.
MSV: master stock of virus.
MTT: 3-[4,5-dimethylthiazol-2-yl]-2,5-diphenyltetrazolium bromid.
MW: molecular weight (molecular mass).
N.
NDSB256: non detergent sulfobetaine 256.
Nemo: nuclear factor kappa B essential Modulator.
NLK: Nemo-like kinase.
nls: nuclear localizing sequence.
NPV: nucleopolyhedrovirus.
3
Abbreviations__________________________________________________________________
O.
OC: osteocalcin.
ODx: optical density measured at “x” nm.
OP: osteogenic protein.
ORF: open reading frame.
P.
PBS: phosphate buffered saline.
PBST: phosphate buffered saline – tween20.
PCR: polymerase chain reaction.
PDI: protein disulfide isomerase.
PDGF: platelet-derived growth factor.
pfu: plaque forming units.
pfu polymerase: polymerase from Pyrococcus furiosus.
PG: proteoglycans.
p.i.: post-infection.
pI: isoelectric point.
PIP2: phosphatidyl-inositol-4, 5-bisphosphate.
PLCγ: phospholipase C gamma.
p-NPP: p-nitrophenyl phosphate.
Polh: polyhedrin.
PPolh: polyhedrin promoter.
PSA: ammonium persulphate.
PTHrP: parathyroid hormone-related protein.
PVDF: polyvinylidene fluoride.
R.
RNA: ribonucleic acid.
rpm: revolutions per minute.
R-Smad: receptor-activated Smad.
RT-PCR: reverse transcription – polymerase chain reaction.
S.
SD: standard deviation.
SDS: sodium dodecyl sulfate.
SDS-PAGE: sodium dodecyl sulfate polyacrylamide gel electrophoresis.
Sf: Spodoptera frugiperda.
SHC: Scr homologous and collagen protein.
4
__________________________________________________________________Abbreviations
Smad: small mothers against decapentaplegic.
SMURF: smad ubiquitin regulatory factor.
SNPV: single nucleopolyhedrovirus.
SOS: son of sevenless.
STAM: signal-transducing adaptor molecule.
STAT1: signal transduction and activator of transcription 1.
T.
Ta: annealing temperature.
TAB1: TAK1 binding protein.
TAK1: TGF-β activated kinase1.
TB: terrific broth culture medium.
TCA: trichloroacetic acid.
TCF-1: transcription factor-1.
TCID50: tissue culture infectious dose 50.
TEMED: N, N, N', N'-Tetramethyl-1-, 2-diaminomethane.
TGF-β: transforming growth factor-beta.
TK: tyrosine kinase.
TNF-α: tumor necrosis factor-alpha.
TNM-FH: Trichoplusia ni medium – formulation Hink.
Tris: tris (hydroxymethyl) aminomethane.
tRNA: transfer ribonucleic acid.
TS: transfection supernatant.
U.
UV: ultraviolet.
V.
Vgr: vegetal related.
VS: virus stock.
vWF: von Willebrand factor.
X.
XIAP: X-linked inhibitor of apoptosis.
2.
2xYT: 2 x yeast extract-tryptone culture medium.
5
Abbreviations__________________________________________________________________
4.
4-MPAA: 4-Mercaptophenylacetic acid.
6
1. Introduction.
7
8
Introduction
9
1.1. Bone and bone regeneration.
1.1.1. The histology of bone.
Osseous or bone tissue is a specialized type of connective tissue, of which the major
constituent is extracellular matrix. The organic part of this matrix is mainly composed of type I
collagen, though type V and, to a lesser extent, types III, XI and XIII are also found. Just 10%
of the proteins of the bone matrix are non-collagenic, these being proteoglycans, osteonectin,
osteopontin, sialoproteins I and II, osteocalcin (OC) and certain growth factors like insulin-like
growth factor (IGF), tumor necrosis factor-alpha (TNF-α), transforming growth factor-beta
(TGF-β), platelet-derived growth factor (PDGF), bone morphogenetic proteins (BMPs) and
interleukins -1 and -6 (IL-1 and IL-6). The inorganic part of the matrix is formed by calcium
phosphate in the form of hydroxyapatite (HA), which is deposited on the proteinaceous lattice.
In the protective exterior portion of all bones, the matrix is dense (compact bone tissue), while
in the inside it forms a porous network of trabeculae (cancellous or spongy bone tissue) filled
with bone marrow. Covering the outer surface of bones, for except the joints, is a thin layer of
dense, irregular connective tissue named periosteum, which contains fibroblasts and
osteoprogenitor cells. On the other side, lining the surface of the bony tissue that forms the
medullar cavity of long bones is another osteoprogenitor-containing, thin layer of connective
tissue, called endosteum.
Mature bone is mainly formed by cylindrical structural units called osteons or Haversian
systems (Fig. 1). These run parallel to the longitudinal axis of the bone, and possess a central
canal, called Haversian canal, which contains blood vessels and nerves. The Haversian canal is
surrounded by concentric layers of matrix called lamellae. In between the lamellae lay the
mature osseous cells, or osteocytes, which communicate with each other through long
cytoplasmic extensions that occupy tiny canals called canaliculi. The long, longitudinal
Haversian canals are communicated by shorter, perpendicular Volkmann´s canals.
The osteoprogenitor cells are derived from mesenchymal stem cells (MSCs), for which the
bone marrow seems to constitute the main reservoir. These osteoprogenitors can differentiate
into osteoblasts when they are triggered by the proper stimuli. Osteoblasts, which maintain the
capacity to divide their selves, are responsible for secreting the components of the organic part
of the extracellular matrix, also called osteoid. They also secrete matricial vesicles containing
high amounts of alkaline phosphatase (ALP), an enzyme that liberates phosphate groups (PO4-)
from different molecules of the extracellular matrix. These phosphates can react with Ca2+
cations fixed by osteocalcin and other sialoproteins, forming CaPO4 crystals, which trigger
mineralization of the osteoid surrounding the osteoblast by HA [Ca10(PO4)6(OH)2] deposition.
Once the bone matrix that surrounds an osteoblast is completely mineralized, the cell becomes
Introduction _
10
less active and is now called an osteocyte. Osteocytes have just a limited capacity of both
forming and resorbing extracellular matrix, contributing to the homeostasis of calcium levels in
blood. They are also implicated in mechanotransduction, responding to mechanical stimuli
acting on the bone.
Figure 1. Transversal section through the diaphysis of a long bone. Modified from the U.S. National Cancer Institute's Surveillance, Epidemiology and End Results (SEER) Program.
The third type of cells present in bone is the osteoclast, which is formed by differentiation
of a mononuclear haematopoietic progenitor cell of the bone marrow. Osteoclasts are the cells
responsible for bone resorption by pumping protons to the extracellular matrix, causing a local
descent of the pH which leads to partial demineralization. This demineralized matrix is the
substrate for enzymes such as cathepsin K and matrix metalloproteinases, secreted by the
osteoclasts to digest collagen and other proteins of the bone matrix (Ross MH and Pawlina W,
2007).
1.1.2. Bone regeneration.
When a bone becomes broken, neutrophils and macrophages are the first cells to act by
cleaning up the site of fracture, as happens when any other type of tissue is damaged. Then,
new capillary vessels proliferate at the site of the fracture, and fibroblasts invade the damaged
tissue. This leads to the formation of a new loose connective tissue, called granulation tissue,
Osteocyte Osteon of compact bone
Spongy bone
Haversian canals
Volkmann´s canal
Periosteum
Osteon
Canaliculi
Lamellae
Introduction
11
which becomes gradually more compact and, at some places, gives rise to cartilage. The
formed dense connective tissue and cartilage proliferate to cover the bone at the site of the
fracture, forming a callus. During this process, the osteoprogenitor cells of the periosteum
proliferate and differentiate into osteoblasts, which start secreting new osseous tissue at the
external surface of the bone, at a certain distance from the site of fracture. This ossification
progresses towards the fracture until the new-formed bone constitutes a sheath that surrounds
the callus. This osseous sheath sends capillaries and osteoblasts into the callus to form new
bone tissue inside of it, converting it into an osseous callus. At the same time, cells from the
endosteum of the fractured bone also differentiate into osteoblasts, which synthesize new
spongy bone into the medullar cavity. As happens when normal ossification occurs, this spongy
bone will be gradually replaced by compact bone, at the same time the bony callus is being
eliminated by osteoclasts and remodelled to recover the original shape and function of the
bone. During the entire process, the new-forming blood vessels that grow inside the callus act
as a source of new MSCs. In fact, recent publications have given strong evidences of a
perivascular origin for the MSCs (Crisan M et al., 2008; da Silva Meirelles et al., 2008).
Usually, in healthy people, the entire healing process takes between six and twelve weeks,
depending on the seriousness of the fracture and the affected bone (Ross MH and Pawlina W,
2007).
1.1.3. Molecules involved in bone regeneration.
Fracture healing is a complex cascade of biological events that involves mechanical stress
and both intracellular and extracellular molecular signalling for osteoinduction and conduction.
These kind of multistage processes require regulation by many local and systemic regulation
factors, such as growth and differentiation factors, hormones and cytokines (Tsiridis E et al.,
2007).
The molecules that promote osteogenesis during a fracture healing can be divided into
three distinct groups: i) pro-inflammatory cytokines, ii) growth and differentiation factors, and
iii) metalloproteinases and angiogenic factors (Gerstenfeld LC et al., 2003).
I. Pro-inflammatory cytokines: Tumor necrosis factor-alpha (TNF-α) and interleukins-1 and
-6 (IL-1 and IL-6) show peak expression levels within the first 24 hours after fracture, initiating
the cascade of events that leads to healing (Einhorn TA et al., 1995; Gerstenfeld LC et al.,
2003). Secreted by macrophages and cells of mesenchymal origin located in the periosteum,
these cytokines induce downstream responses by exerting chemotaxis on inflammatory and
endogenous fibrogenic cells, enhancing extracellular matrix synthesis and stimulating
angiogenesis (Kon T et al., 2001).
Introduction _
12
II. Growth and differentiation factors: Transforming growth factor-beta (TGF-β) is released
by platelets at the initial inflammatory phase, and might be responsible for initiating callus
formation (Bostrom MP, 1998). This growth factor is also secreted by osteoblasts and
chondrocytes, and stored in the bone matrix, acting as a potent chemotactic stimulator of
MSCs, preosteoblasts, chondrocytes and osteoblasts (Lieberman JR et al., 2002). It also induces
the production of constituents of the extracellular matrix, such as collagen, proteoglycans,
osteopontin, osteonectin and alkaline phosphatase (Sandberg MM et al., 1993), and may initiate
signalling for bone morphogenetic protein synthesis by the osteoprogenitor cells (Lieberman JR
et al., 2002) as well as inhibiting osteoclast activation and promoting osteoclast apoptosis
(Mundy GR, 1996).
Bone morphogenetic proteins (BMPs) are members of the TGF-β superfamily and are
produced by osteoprogenitors, mesenchymal cells, osteoblasts and chondrocytes within the
extracellular matrix. They induce a sequential cascade of events to promote chondro-
osteogenesis, being responsible for chemotaxis, mesenchymal and osteoprogenitor cell
proliferation and differentiation, angiogenesis and controlled production of extracellular matrix
(Prisell PT et al., 1993). BMPs may also stimulate secretion of other bone and angiogenic
growth factors, such as insulin-like growth factor (IGF) and vascular-endothelial growth factor
(VEGF) (Deckers MM et al., 2002). Among the different subgroups into which these growth
factors are divided, each type of BMP has a unique role and distinct temporal expression
patterns during the fracture repair process.
Fibroblast growth factors (FGFs) are synthesized during bone healing by monocytes,
macrophages, mesenchymal cells, osteoblasts and chondrocytes, to promote growth and
differentiation of a variety of cells, such as fibroblasts, myocytes, osteoblasts and chondrocytes.
These factors play a critical role in angiogenesis and mesenchymal cell proliferation during the
early stages of fracture healing. Among the different types of FGFs, acidic fibroblast growth
factor (aFGF) mainly regulates chondrocyte proliferation and maturation, while basic fibroblast
growth factor (bFGF) is expressed by osteoblasts and seems to exert a more potent effect than
aFGF (Lieberman JR et al., 2002).
Platelet-derived growth factor (PDGF) is secreted by platelets at the early stages of fracture
healing, but is also released by monocytes, macrophages, endothelial cells and osteoblasts. It
acts as a potent chemotactic stimulator for inflammatory cells and exerts strong mitogenic
effects on MSCs and osteoblasts (Lieberman JR et al., 2002).
Insulin-like growth factors (IGFs) are found in the bone matrix, released by endothelial
cells, osteoblasts and chondrocytes. IGF-I induces bone matrix formation by fully differentiated
osteoblasts (Canalis E, 1980), while IGF-II seems to act at a later stage of fracture healing by
stimulating type I collagen production, cartilage matrix synthesis and cell proliferation (Prisell
PT et al., 1993).
Introduction
13
III. Metalloproteinases and angiogenic factors: At the final stages of endochondral
ossification, specific matrix metalloproteinases degrade cartilage and bone to allow infiltration of
blood vessels. The regulation of angiogenesis seems to be regulated by two separate pathways:
a VEGF-dependent pathway and an angiopoietin-dependent pathway (Gerstenfeld et al., 2003).
VEGF is a mediator of neoangiogenesis and a mitogen for endothelial cells (Ferrara N and
Davis-Smyth T, 1997), while angiopoietins are regulatory vascular morphogenetic molecules
related to the formation of larger vessels and development of ramifications from existing ones.
Obviously, to achieve restoration of the original shape and function of the damaged bone,
not only osteogenic molecules, but also inhibitory molecules are necessary. These inhibitors can
be divided into two groups: i) BMP inhibitors, and ii) other inhibitory molecules (Tsiridis E et al.,
2007).
I. BMP inhibitors: Many molecules that inhibit BMP signalling at the extracellular level have
been described. Some of these proteins, such as noggin, gremlin and chordin, antagonize BMP
signalling by binding to specific BMPs and blocking their coupling to their receptors (Groppe J et
al., 2002; Piccolo S et al., 1996; Hsu DR et al., 1998). Other antagonists of BMP activity, such
as sclerostin, directly bind to the BMP receptors (Sutherland MK et al., 2004), while follistatin
binds to BMP receptors through BMPs, forming a trimeric complex (Iemura S et al., 1998).
The BMP and activin membrane bound inhibitor (BAMBI) is structurally related to type I
BMP receptors in the extracellular domain, but it lacks the intracellular domain. Therefore, it
inhibits signalling within the cells by preventing the formation of active receptor complexes
(Onichtchouk D et al., 1999).
Since intracellular BMP signalling occurs via a smad (small mothers against
decapentaplegic) signalling cascade, it can also be modulated negatively by inhibitory smads
(Itoh F et al., 2001) or molecules that promote smad degradation, such as the smad ubiquitin
regulatory factor (SMURF)-1 and -2 (Zhu H et al., 1999). Other intracellular proteins that bind
to signalling smads to inhibit the BMP pathway are the oncoprotein ski (Wang W et al., 2000),
the anti-proliferative protein tob (Yoshida Y et al., 2000), smad-8B (Nishita M et al., 1999) and
the cas-interacting zinc finger protein (CIZ) (Shen ZJ et al., 2002).
II. Other inhibitory molecules: Certain cytokines, such as IL-1α, might inhibit osteogenesis
as it has been shown to decrease ALP activity and type I collagen production in osteoblasts in
vitro (Tanabe N et al., 2004). Also IGF-binding proteins (IGFBPs), such as IGFBP-2 and -4,
might inhibit osteogenesis, since it is thought that these molecules diminish the mitogenic
activities of IGF-I and IGF-II in human osteoblast-like cells (Mohan S et al., 1989; McCarthy TL
et al., 1994).
Introduction _
14
Surprisingly, many investigations point to the fact that the potent osteogenic factors TGF-β
and FGFs might also have inhibitory activities. For example, TGF-β was shown to block BMP-2-
mediated stimulation of terminal osteoblast differentiation in vitro (Spinella-Jaegle S et al.,
2001), while it has been suggested that FGF signalling might stimulate early differentiation of
osteogenic precursors, but inhibit late differentiation and mineralization (Fakhry A et al., 2005).
The most important molecules involved in bone regeneration can be found summarized in
Table 1.
OSTEOGENIC INDUCERS Factor Produced by Effects
• TNF-α • IL-1 • IL-6
• Macrophages • Mesenchymal cells
at the periosteum
• Chemotaxis on inflammatory and fibrogenic cells • ↑ extracellular matrix synthesis • ↑ angiogenesis
• TGF-β
• Platelets • Osteoblasts • Chondrocytes
• Initiates callus formation • Chemotaxis on MSCs, preosteoblasts, chondrocytes and osteoblasts • ↑ extracellular matrix synthesis • ↑ BMP synthesis • ↑ osteoclast apoptosis • ↓ osteoclast activation
• BMPs
• Osteoprogenitors • Mesenchymal cells • Osteoblasts • Chondrocytes
• Chemotaxis • Mesenchymal and osteoprogenitor cell proliferation and differentiation • ↑ angiogenesis • ↑ extracellular matrix synthesis • ↑ secretion of IGF and VEGF
• FGFs
• Monocytes • Macrophages • Mesenchymal cells • Osteoblasts • Chondrocytes
• Mesenchymal cell proliferation • Growth and differentiation of fibroblasts, myocytes, osteoblasts and
chondrocytes. • ↑ angiogenesis
• PDGF
• Platelets • Monocytes • Macrophages • Endothelial cells • Osteoblasts
• Chemotaxis on inflammatory cells • Growth of MSCs and osteoblasts
• IGFs
• Endothelial cells • Osteoblasts • Chondrocytes
• ↑ extracellular matrix synthesis • Cell proliferation
OSTEOGENIC INHIBITORS Factor Produced by Effects
• Noggin • Chordin • Gremlin • Follistatin
• Osteoblasts • Osteocytes
• ↓ BMP signalling
• Sclerostin • Osteoclasts • Osteocytes
• ↓ BMP signalling
• IL-1α • Monocytes • Macrophages
• ↓ ALP and type I collagen production by osteoblasts
• IGFBP • Osteoblasts • ↓ IGF activity • TGF-β
• Platelets • Osteoblasts • Chondrocytes
• ↓ BMP signalling
• FGFs
• Monocytes • Macrophages • Mesenchymal cells • Osteoblasts • Chondrocytes
• ↓ late osteoblastic differentiation
Table 1. Molecules involved in bone regeneration.
Introduction
15
1.1.4. Clinical and economic aspects of fracture healing.
Reparation of bone defects and fractures is a major clinical and economic concern. A study
carried out by Polinder, using data from ten European countries revealed that during the year
1999, nearly 2.5 million cases of injury were registered in the hospitals of these countries. From
all these cases, hip fracture was not only the most common, with an incidence of 2.3 per 1,000,
but also the most expensive injury to treat, with an average cost of € 5,530 (Polinder S et al.,
2005). The total cost of hip fractures in the EU was estimated at € 598 million per year (Finnern
HW and Sykes DP, 2003). The average costs of other fractures range from € 1,131 to € 3,504
(Table 2).
INJURY TYPE INCIDENCE RANK INCIDENCE MEAN COSTS (€)
Hip fracture 1 2.3 ‰ 5,530
Knee/lower leg fracture 5 0.9 ‰ 3,504
Wrist fracture 8 0.8 ‰ 1,374
Elbow/forearm fracture 9 0.6 ‰ 1,726
Ankle fracture 10 0.5 ‰ 2,632
Facial fractures 11 0.5 ‰ 1,379
Hand/finger fracture 16 0.4 ‰ 1,131
Upper arm fracture 17 0.3 ‰ 2,818
Rib/sternum fracture 20 0.2 ‰ 2,126
Foot/toe fracture 24 0.2 ‰ 2,514
Clavicle/scapula fracture 26 0.1 ‰ 2,152
Table 2. Fracture incidence and costs in the EU. Modified from Polinder S et al., 2005.
In the United States, over 7.9 million fractures are sustained each year, being trauma the
second most expensive medical problem, with a cost for the US health care system of $ 56,000
million per year. Nearly half of this amount is used for the treatment of broken bones (Bishop
GB and Einhorn TA, 2007).
The expected time for a fracture to heal naturally is between six and twelve weeks, but
there is a high rate of delayed unions, varying from 16-60% for less severe fractures to 43-
100% for more severe cases. A fracture that shows motion at the bony ends and is not
completely healed within 6 months is considered a non-union, which rate has been reported to
range from 4 to 10% (Garrison KR et al., 2007). Non-unions can not only lead to significant
pain, inhibition of function and decreases in personal and professional productivity, but also
enormously raise the economic implications for healthcare providers.
Introduction _
16
The rate of delayed or non-unions is especially high in elderly patients, in which the titer of
MSC within the bone marrow is diminished. While one of every 250,000 bone marrow cells is
estimated to be a MSC at the age of 30, the titer decreases to one of every 2,000,000 cells in
80 years old individuals (Caplan AI, 2007).
External fixation devices may help stabilizing fractures at risk from poor healing, but this
often result in the production of unstable bone with a high probability of refracture (Braddock M
et al., 2001). Extended bone defects following trauma or cancer resection, or non-union
fractures may require more sophisticated treatments than standard conservative or surgical
therapies. In these cases, segmental bone transport, distraction osteogenesis, bone grafting or
biomaterials must be applied for reconstruction (Kneser U et al., 2006).
Bone transport is based on the methods developed by Gavriil Ilizarov. For reparation of
bone defects by these approaches, a length of bone, above or below the defect, is fixed to an
external fixation device and separated from the remaining bone by an osteotomy. This chosen
piece of bone is then slowly (less than 1 mm/day) moved towards the defect, allowing the site
of the osteotomy to be filled with a new-formed callus, which will calcify and form new bone
once the distraction forces are removed (LaBianco et al., 1996). As the treatment with this
technique requires a long period of time, the surgeon may face many problems which may
negatively affect the final outcome (pin tract infection, early or delayed consolidation, axial
deviation, skin inversion, rupture of the bone by the wires, joint contractures, etc.).
Only in the United States, more than 1.5 million bone grafts are performed annually. By
bone grafting, the missing bone is replaced with material from the body of the own patient or
with a natural substitute. When autologous bone is used, it is typically harvested from the iliac
crest of the pelvis. Allografts from cadavers or living donors may also be used, and are usually
sourced from a bone bank. Although bone grafting is generally successful, the limited amount
of available donor tissue and the high associated morbidity, resulting in numbness or tingling at
the donor site, infection, or prolonged pain, make the need for development of alternative
therapies evident (Braddock M et al., 2001).
More recently, the medical field is focused on the use of natural or synthetic biomaterials
(i.e. materials which are compatible with living cells and tissues) for bone repair, being the aim
of these products to mimic the osteoconductive properties of bone grafts. To also confer
osteoinductive capacity to these grafts, their application in combination with osteogenic growth
factors is being widely studied. These alternatives will be further discussed in section 1.4.
Introduction
17
1.2. Bone morphogenetic protein 6.
1.2.1. The bone morphogenetic proteins.
At the end of the 19th century it was already demonstrated that decalcified bovine bone
could be used for the treatment of osteomyelitis (Senn N, 1889). Some decades later, in the
middle of the 20th century, Lacroix postulated that bone might contain an inductive substance,
which he named osteogenin. A few years later, Marshall R. Urist discovered that demineralized
lyophilized bone matrix was able to promote new endochondral bone formation when implanted
subcutaneously or in intramuscular pockets. This discovery led to the isolation of a low-
molecular mass glycoprotein from bone with the capacity of promoting bone formation when
ectopically located (Urist MR, 1965; Urist MR et al., 1976). In the early 1980s, Sampath and
Reddi made the first attempts on purifying the molecules responsible for bone formation
present in the bone matrix. They successfully isolated a pool of soluble proteins with a
molecular mass under 50 KDa which was shown to possess osteoinductive properties (Sampath
TK et al., 1982; Sampath TK and Reddi AH, 1983). But the real identity of the proteins
responsible for bone induction remained unknown until the purification and sequence of bovine
BMP-3 and the cloning of human BMP-2 and -4 in the late 1980s (Wozney JM et al., 1988;
Wang EA et al., 1988; Luyten FP et al., 1989; Celeste AJ et al., 1990; Wozney JM, 1992). To
date, around 20 BMP family members have been identified and characterized (Table 3).
BMP SUBFAMILY BMP OTHER NAMES RESIDUES (PRE-PRO-PROTEIN)
BMP-2 396 BMP-2/4
BMP-4 BMP-2B 408
BMP-3 Osteogenin 472 BMP-3
BMP-3B GDF-10 478
BMP-5 454
BMP-6 Vgr-1 513
BMP-7 OP-1 431
BMP-8A OP-2 402
OP-1/BMP-7
BMP-8B OP-3 402
BMP-12 CDMP-3 / GDF-7 450
BMP-13 CDMP-2 / GDF-6 455 CDMP
BMP-14 CDMP-1 / GDF-5 501
BMP-9 GDF-2 429
BMP-10 424
BMP-11 GDF-11 407
BMP-15 GDF-9B 392
Others
BMP-16 280
Table 3. The BMP family. Modified from Reddi AH, 2001.
Introduction _
18
Analysis of the amino acid sequences of these proteins revealed high identity with TGF-β,
leading to their inclusion as a family into the TGF-β superfamily. The BMP family genes are
highly conserved among evolution, and homologs can be found from Drosophila to Homo
sapiens. Due to their structural homology, these BMPs of distant species have shown to be
functionally interchangeable (Padgett RW et al., 1993; Sampath TK et al., 1993).
Today, BMPs are included in at least 4 subfamilies attending to the sequence homology of
the mature domain of the proteins (Table 4). Besides the BMPs, more than 40 other proteins
belonging to the same family have been identified in different tissues (Reddi AH, 1997).
Although sharing their name and location, BMP-1 is not a member of the TGF-β
superfamily, but a metalloprotease that cleaves the COOH-propeptides of procollagens I, II and
III (Kessler E et al., 1996).
BM
P-7
BM
P-5
BM
P-6
BM
P-8
A
BM
P-8
B
Vgr
-D
UN
IVIN
BM
P-2
BM
P-4
dpp
Vg-
1
BM
P-1
3
BM
P-1
2
BM
P-1
4
BM
P-9
DO
RSA
LIN
BM
P-1
0
BM
P-3
BMP-7 100
BMP-5 88 100
BMP-6 87 91 100
BMP-8A 74 74 75 100
BMP-8B 67 67 68 77 100
Vgr-D 69 74 71 63 55 100
UNIVIN 63 62 63 61 58 54 100
BMP-2 60 61 61 55 57 57 67 100
BMP-4 58 59 60 55 56 54 64 92 100
dpp 58 57 59 53 51 54 56 74 76 100
Vg-1 57 56 58 55 56 51 64 58 56 48 100
BMP-13 53 54 53 52 49 48 60 57 56 53 50 100
BMP-12 53 52 52 53 51 48 60 57 57 53 49 86 100
BMP-14 51 52 51 50 48 48 58 57 57 52 52 86 80 100
BMP-9 51 53 53 48 44 47 50 50 50 51 48 52 50 50 100
DORSALIN 49 51 53 47 44 48 47 53 54 53 46 55 56 53 79 100
BMP-10 47 48 48 46 45 48 49 55 52 49 50 57 55 49 63 66 100
BMP-3 42 43 44 41 41 41 48 48 47 43 49 46 46 47 38 38 39 100
Table 4. Identity matrix for the BMP family, constructed with the members that are more than 42% identical to BMP-7 in their mature domains. Highlighted in gray are groups of sequences having 75% or higher identity, which correspond to the subfamilies. Modified from Griffith DL et al., 1996.
1.2.2. General structure of the BMPs.
The genes encoding the BMP family members are mapped to different chromosomes,
indicating that these proteins have become widely dispersed during evolution (Dickinson ME et
al., 1990). The structure of the BMPs is highly conserved (Fig. 2). They are all produced as
large monomeric pre-pro-proteins formed by a 15-25 residue pre-peptide, a 50-375 residue pro-
domain, and a 110-139 residue mature domain at the C-terminus. The latter contains seven
conserved cystines which determine the formation of the characteristic structural motif of the
Introduction
19
members of the TGF-β superfamily: the cystine knot (McDonald and Hendrickson, 1993). The
cystine knot constitutes the core of the monomer and consists of three intracatenary disulfide
bonds. Two of these bonds form a ring through which the third passes, while the seventh
cystine remains free to form the single intercatenary disulfide bond that allows dimerization of
the molecule. Four strands of antiparallel β-sheets emanate from the knot, forming two finger-
like projections. On the opposite end of the knot, an α-helix lies perpendicular to the axis of the
two fingers, forming the heel of the hand (Griffith DL et al, 1996).
Figure 2. Schematic representation of the BMP-7 monomer, showing the four strands of antiparallel β-sheets forming the two finger-like projections, and the α-helix forming the heel of the hand. The core of the monomer is a cystine knot formed by three disulfide bonds, which are represented as orange lines. The N-linked sugar moiety attached to Asn-80 is represented as a green circle. The N-terminus is unresolved. Modified from Griffith DL et al., 1996.
All BMPs have one or more potential N-glycosylation sites but, in most cases (e.g. BMP-2,
BMP-6, BMP-7), only one of these have an N-linked sugar moiety attached. Glycosylation of the
molecule does not seem to be essential for the biological activity of BMP-2 (Ruppert et al.,
1996; Vallejo et al., 2002; Long et al., 2006), though very recent investigations point to a more
important role for glycosylation in BMP-6 (Saremba S et al., 2008). The pre-peptide is known to mediate translocation of the pre-pro-protein into the lumen of
the endoplasmic reticulum and, thus, secretion. In opposition, the function of the pro-domain is
still unknown. In the case of TGF-β, the pro-domain has been termed latency-associated
peptide (β-1-LAP), since it has been demonstrated to delay the function of the mature growth
factor (Gentry LE and Nash BW, 1990; Böttinger EP et al., 1996). A similar role has been
suggested for the BMP-2 pro-domain, despite its limited sequence homology with β-1-LAP. It
has also been suggested that the pro-domain may mediate oxidative structure formation of
β1 β2
β4 β3
β8 β6
β5 β7
α1
N36
S38
S104
C139
71S
138S
S67
S136
S103
Finger 1 Finger 2
Heel
Asn80
Introduction _
20
BMP-2, though it has been demonstrated that both BMP-2 and pro-BMP2 can be refolded in
vitro with comparable yields from the denatured state (Hillger F et al., 2005).
Dimerization of the molecule occurs after the mature domain of each monomeric precursor
is liberated by the action of a subtilisin-like proprotein convertase (SPC), which cleaves the pro-
domain at a conserved Arg-X-X-Arg maturation site (Akamatsu T et al., 1999; Constam DB and
Robertson EJ, 1999). Once cleaved, the mature domains dimerize and the active dimers are
secreted (Fig. 3) (Kingsley DM, 1994). It has been demonstrated that the dimeric form of the
molecule is the only one with biological activity and capable of triggering the BMP-signalling
pathways (Wang EA et al., 1990).
Figure 3. Schematic representation of the processing of a BMP pre-pro-protein to obtain an active dimer. Proteolytic digestion at the RXXR motif releases the mature domain. Two mature domains refold and dimerize to produce de active form of BMP. The disulfide bonds are drawn as orange lines.
1.2.3. Structure of BMP-6.
BMP-6 was first isolated from a murine embryonic cDNA library and named Vgr-1 due to its
homology with Xenopus Vg-1 (Lyons KM et al., 1989). The human and bovine homologues of
Vgr-1 were subsequently isolated from bone and named BMP-6 (Celeste AJ et al., 1990). The
human bmp-6 gene has been mapped to chromosome 6 (Hahn GV et al., 1992) and its
expression produces a 513-residue pre-pro-protein, formed by a 20-residue pre-peptide, a 354-
residue pro-domain, and a 139-residue mature domain, what makes the BMP-6 the largest
protein of the BMP family. The mature domain of the monomer is liberated after cleavage at an
NH2 RXXR C C C C C C C COOH
Pre-peptide Pro-domain Mature domain (15-25 residues) (50-375 residues) (110-139 residues)
NH2 C C C C C C C COOH
COOH C C C C C C C NH2
Processing, folding and dimerization.
Introduction
21
Arg-Thr-Thr-Arg motif localized in the pro-domain between residues 371 and 374. The seven
cystines implicated in constitution of the cystine knot are localized at sites 38, 67, 71, 103, 104,
136 and 138 of the mature domain. The disulfide bonds Cys67 – Cys136 and Cys71 – Cys138
form the ring structure through which the bond Cys38 – Cys104 passes, while Cys103 forms the
intercatenary bond implicated in dimerization.
BMP-6 is a basic protein, with an isoelectric point (pI) of 8.6 (Celeste AJ et al., 1990). Like
BMP-2 and BMP-7, BMP-6 is considered a strongly hydrophobic molecule, exhibiting large
nonpolar patches among its surface. This results in low solubility and tendency towards
aggregation in aqueous solutions. The N-terminal region of the molecule, preceding the first
cystine, contains 6 arginine residues and possesses a strongly positive net charge. This region,
as is the case for BMP-2 (Koenig BB et al., 1994; Ruppert R et al., 1996), may be responsible
for the affinity to heparin shown by most members of the subfamily.
The crystal structure of BMP-6 has been recently determined to a resolution of 2.1 Å
(Fig. 4) (Saremba S et al., 2008). The results of this study suggest that BMP-6 may adopt two
different conformations and that differences between both conformers are mainly localized in
the prehelix loops, which have been shown to contain the main binding and specificity
determinants for type I receptor recognition in other members of the BMP subfamily (Keller S
et al., 2004; Nickel J et al., 2005).
Each mature monomer of BMP-6 possesses three putative N-glycosylation sequences.
These three sites are also found in the BMP-7 molecule, where the two of them situated at the
N-terminus of the mature domain are not glycosylated (Sampath TK et al., 1992; Jones WK et
al., 1994). In contrast, the third N-glycosylation site, located in the cystine-knot motif, and
which is conserved among the BMP-2/4 and the OP-1/BMP-7 families, does carry carbohydrate
moieties (Groppe J et al., 2002; Greenwald J et al., 2003). Recent studies have revealed that
binding of BMP-6 to type I BMPRs may be strictly dependent on glycosylation at Asn73, since
BMP-6 from CHO cells deglycosylated by N-endoglycosidase F treatment completely lost its
capacity to bind ActR-I (Saremba S et al., 2008).
Figure 4. Three-dimensional representation of the BMP-6 dimer, based on crystallization data at 2.1 Å resolution obtained by Saremba S et al. The two monomers are colored blue and purple, respectively.
Prehelix loop
Prehelix loop
N1
N2
C1 C2
Introduction _
22
1.2.4. BMP signalling.
BMPs, like other members of the TGF-β superfamily, bind to two different types of
serine/threonine kinase receptors, being both type I and type II receptors required for
signalling. These receptors are structurally conserved, comprising an extracellular domain, a
single transmembrane domain, and a large intracellular kinase domain (Kawabata M et al.,
1998). Three type I and three type II receptors have been shown to bind BMPs (Table 5).
TYPE I RECEPTORS TYPE II RECEPTORS
NAME ALTERNATIVE NAME NAME ALTERNATIVE NAME
ActR-I ALK-2 ActR-II none
BMPR-IA ALK-3 ActR-IIB none
BMPR-IB ALK-6 BMPR-II none
Table 5. The BMP receptors (ten Dijke et al., 1994; Koenig et al., 1994; Yamashita H et al., 1996; Macias-Silva et al., 1998).
To initiate the signalling cascade, the ligand first binds two copies of its high-affinity
receptor, after which two copies of the lower-affinity receptor are able to bind, forming a six-
polypeptide chain complex (two monomers of the ligand and two pairs of each receptor type).
In this way, specificity in binding BMPR complex appears to be determined by the type I
receptor, being the type II receptor more important for the activation of signal transducing
mechanisms (Massague J, 1998). To promote osteoblast differentiation, BMP-6 binds ActR-I
with high affinity, using BMPR-II or ActR-II as lower-affinity receptors to form the signalling
complex (Ebisawa T et al., 1999).
Once the signalling complex is formed, the constitutively active type II receptors
phosphorylate a glycine/serine-rich domain of the type I receptors. This can lead to activation
of two different pathways: a “canonical” BMP-Smad pathway or a “non-canonical” BMP-MAPK
pathway (Botchkarev VA, 2003). Which pathway is activated seems to depend on the particular
mechanism of oligomerization of the BMPR complex (Nohe A et al., 2002).
When signal transduction occurs through the BMP-Smad pathway (Fig. 5), the activated
BMPR type I phosphorylates receptor-activated Smad proteins (Smad1, 5 and 8; also named
R-Smads) which can then form heteromeric complexes with a common-partner Smad (Smad4;
also named Co-Smad). This R-Smad/Co-Smad complex subsequently translocates to the
nucleus to regulate transcription of BMP responsive genes. Depending on which coactivator(s)
or corepressor(s) interact with the R-Smad/Co-Smad complex, this regulation will be negative or
positive (ten Dijke et al., 2002). In the particular case of BMP-6, the induction of osteoblastic
Introduction
23
differentiation of human MSCs seems to be mainly mediated by Smad5 and, to a lesser extent,
by Smad1 phosphorylation, with no apparent implication of Smad8 (Ebisawa T et al., 1999).
Inhibitory Smads (Smad6 and 7; also named I-Smads) antagonize the phosphorylation of
R-Smads by BMPR-I kinases (Imamura T et al., 1997). This antagonistic effect of Smad6 may
be blocked by AMSH, which directly binds to this I-Smad to prevent its interaction with the
R-Smads (Itoh F et al., 2001). Other inhibitors of this signalling pathway are Tob, which
interacts specifically with BMP activated Smads (Yoshida Y et al., 2000) and Smurf1, which
mediates the degradation of Smad 1 and 5 (Zhu H et al., 1999). Smurf1 also recognizes the
bone-specific transcription factor Runx2 to mediate its degradation (Zhao M et al., 2003) and
can form a complex with Smad6, which can be exported from the nucleus and targeted to the
type I BMPRs to promote their degradation (Murakami G et al., 2003).
Figure 5. Representation of the “canonical” BMP-Smad signalling pathway. Modified from Botchkarev VA, 2003 and from Chen D, 2004.
P P
PP
BMPR-II BMPR-I
BMP
Soluble antagonists (Noggin, Chordin,
Follistatin, DAN, Gremlin, Cerberus, Caronte).
R-SmadP
R-Smad
Smad6
Smurf1
I-Smad
Smurf1
TobR-Smad
P
R-Smad P
Co-Smad
AMSH
Co-activator / Co-repressor
R-SmadP
Co-Smad
Transcription factor
Smurf1
+/-
Cell membrane
nucleus
Smad6
Smurf1
BAMBI
Introduction _
24
The “non-canonical” BMP-MAPK pathway (Fig. 6) is triggered when the activated BMPR
complex interacts with the apoptosis inhibitor XIAP, which links BMP receptors with TAB1. The
latter, in turn, activates TAK1 (Yamaguchi K et al., 1999), which is a member of the MAPK-
kinase-kinase family. TAK1 subsequently activates NLK, which has been shown to inhibit
phosphorylation of TCF-1/Lef-1 transcription factors and downregulate Wnt/β-catenin-
dependent transcription (Ishitani T et al., 1999). It has also been shown that TAK1 can activate
p38 and JNK pathways, which are both involved in BMP-induced apoptosis (Kimura N et al.,
2000; Zhang D et al., 2000).
This signalling pathway might be linked at different levels with the BMP-Smad pathway,
since it has been shown that the I-Smad Smad6 is able to bind to TAK1 and inhibit its activity
(Kimura N et al., 2000).
Figure 6. Representation of the “noncanonical” BMP-MAPK signalling pathway. Modified from Botchkarev VA, 2003.
Different soluble antagonists, such as noggin, chordin, follistatin, or members of the
DAN/cerberus family, can negatively regulate BMP signalling at the extracellular level. These
P P
P P
BMP
Cell membrane
BMPR-II BMPR-I
nucleus
XIAP
TAB1
TAK1
NLK
β-Catenin
TCF
Smad6
p38 and JNK pathways
APOPTOSIS
Introduction
25
proteins bind to BMPs with different affinities, preventing them from binding to their receptors
(Zimmerman et al., 1996; Piccolo et al., 1996; Patel K, 1998; Massague J and Chen YG, 2000;
Gazzerro E and Canalis E, 2006). The insoluble type I BMPR-like protein BAMBI can also inhibit
BMP signalling by binding ligands without triggering an intracellular signal cascade (Onichtchouk
D et al., 1999).
As happens with other soluble growth factors, structural components of the extracellular
matrix may interact with the BMPs, preventing them from degradation and keeping a solid pool
of morphogens. This would augment the half-life of these molecules and ensure a slow and
controlled liberation of them into the extracellular milieu (Reddi AH, 2000).
1.2.5. Biological activity of BMPs.
BMPs are pleiotropic growth factors, which exert many different functions during both
development (organogenesis) and the adult life (tissue regeneration and renewal and wound
healing).
In development, the BMPs are implicated in the establishment of both the dorsoventral axis
and the left-right asymmetry during the early stages of ontogenesis (Piedra ME and Ros MA,
2002). They also participate in the organization of the embryonic ventral mesoderm and in the
development of almost all the tissues and organs, including the nervous system, heart, lungs,
kidneys, skin and gonads, controlling cell proliferation, differentiation, migration, apoptosis and
cell to cell adhesion (Lyons KM et al., 1991; Dale L et al., 1992; Hogan BL, 1996).
The lack of function of one or more BMPs, their receptors or proteins involved in their signal
transduction can cause premature death of the embryo due to incorrect development of meso-
ecto- and endodermic derivates (Hogan BL, 1996; Whitman M, 1998, Itoh S et al., 2000). All
knock-out mice for every BMP showed a mutant phenotype, indicating that each BMP play a
specific role during development and morphogenesis of one or more tissues, though some
functional redundancy can be observed among some members of the BMP family (Zhao GQ,
2003, Chen D et al., 2004).
The BMP activities during development are regulated by gradients of antagonists in the
extracellular space, although cellular responses to BMPs also depend on other issues, such as
the specific BMPR subtypes, the stage of differentiation of the target cell, other inhibitory or
stimulatory factors, the stage of development of the organism, etc (Yamamoto and
Oelgeschläger, 2004).
In the adult, the BMPs seem to be implicated in the regeneration of many tissues and in
protection and recovering after injuries. In this sense, it has been shown that BMP-7 expression
Introduction _
26
is decreased in various models of renal disease and that administration of BMP-7 can improve
the renal function after experimental kidney injury (Nguyen TQ and Goldschmeding R, 2008). It
is also well-known that BMPs act as neuroprotective agents in the central nervous system. For
example, BMP-6 expression increases in several regions of the central nervous system after a
mild ischemic damage, with this growth factor being apparently released from neurons into the
interstitial space at the cerebral cortex, hippocampus and cerebellum, suggesting a possible
regulation of neuronal resistance to insults (Martinez G et al., 2001). These results were
supported by studies in which BMP-6 attenuated the negative effect of H2O2 on primary cortical
cultures in vitro, and showed neuroprotective effects against ischemic injury in adult rats after
transient right middle cerebral artery ligation. This BMP-6-mediated neuroprotection seemed to
be through inhibition of apoptotic pathways and similar effects have been attributed to BMP-7
(Wang Y et al., 2001; Chang CF et al., 2002; Chou J et al., 2006). Other studies have
demonstrated that BMP-6 and/or BMP-7 act as neurotrophic factors for different cells of the
CNS (Gratacos E et al., 2002; Yabe T et al., 2002).
Nevertheless, the most studied and striking feature of BMPs is their role in the homeostasis
and regeneration of the skeletal system, being some BMPs the only growth factors known to
have the capacity to induce ectopic bone formation in adult vertebrates (Wang EA et al., 1990;
Volek-Smith H and Urist MR, 1996; Nakase T and Yoshikawa H, 2006).
It has been demonstrated that BMP signalling is necessary during all stages of osteoblastic
differentiation, which include proliferation, matrix formation, matrix maturation and
mineralization (Stein GS and Lian JB, 1993; van der Horst G et al., 2002). Furthermore, a study
carried out by Cheng H et al. using fourteen human BMPs showed that different BMPs act at
different stages during osteoblastic differentiation, with BMP-2, -6 and -9 exhibiting the greatest
ability to induce both early and late osteogenic markers, as well as matrix mineralization (Cheng
H et al., 2003). Their results led these authors to propose a model of osteogenic hierarchy of
the BMPs, in which BMP-2, 6 and -9 may be the most potent agents to induce lineage-specific
differentiation of mesenchymal progenitor cells, while most BMPs can promote terminal
differentiation of committed osteoblastic precursors and osteoblasts (Fig. 7).
Figure 7. Hierarchic model of BMP-induced osteoblastic differentiation. Modified from Cheng H et al., 2003.
Multipotential cell Osteoprogenitor Osteoblast Osteocyte
BMP-2, -6, -9 BMP-2, -4, -7, -9Most BMPs
(except BMP-3 and -12)
Introduction
27
1.2.6. Biological activity of BMP-6 in osteogenesis.
The BMP-6 protein is predominantly expressed in hypertrophic chondrocytes during
endochondral ossification (Lyons KM et al., 1989), and is known to stimulate expression of both
chondrogenic and osteogenic phenotypes in vitro (Gitelman SE et al., 1994; Yamaguchi A et al.,
1996) and to induce cartilage and bone formation in vivo (Gitelman SE et al., 1994).
The comparative analysis carried out by Cheng H et al. using adenovirus-mediated gene
transfer of BMPs to mesenchymal progenitor and osteoblastic cells revealed that BMP-6,
together with BMP-2 and -9, had the greatest ability to induce both early and late osteogenic
markers (ALP activity and osteocalcin, respectively), as well as matrix mineralization (Cheng H
et al., 2003). In a similar way, horse bone marrow derived mesenchymal stem cells transduced
with BMP-6-expressing adenoviruses achieved osteogenic differentiation attending to ALP
activity and mineralization levels (Zachos TA et al., 2006). When BMP-6 was administered to
human MSCs, these cells underwent drastic osteogenic differentiation, with bone-associated
gene and protein expression (Osterix, DLX-5, type I collagen and bone sialoprotein II),
extracellular matrix (ECM) mineralization, and hydroxyapatite formation at higher levels than
cells in presence of other BMPs (Friedman MS et al., 2006).
Despite this demonstrated osteogenic potential of BMP-6, surprisingly BMP-6 knock-out
mice are largely unremarkable, with exception of a delayed sternum ossification. Since the
expression of BMP-6 during embryogenesis is closely coupled with that of BMP-2, the lack of
other defects in BMP-6-deficient mice is thought to be due to functional compensation by BMP-2
(Solloway MJ et al., 1998).
It has been shown that addition of sulphated polysaccharides such as native heparan
sulphate and synthetic dextran sulphate to undifferentiated mesenchymal cells in vitro
enhances BMP-2-mediated osteoblastic differentiation. In contrast, the osteogenic activity of
BMP-6 seems to be inhibited by these molecules (Zhao B et al., 2006).
The capacity of this growth factor to promote osteogenesis has also been demonstrated in
vivo. Injection of BMP-6-expressing adenoviral constructions into the calf muscles of athymic
nude rats led to ectopic bone formation by way of mechanisms similar to both endochondral
and intramembranous ossification pathways (Jane JA Jr et al., 2002). The same approach has
been used to accelerate healing of rabbit bilateral ulnar osteotomies (Bertone AL et al., 2004).
In another study, BMP-6 was directly applied to periodontal fenestration defects in rats,
resulting in increased bone and cementum formation compared to control groups (Huang KK et
al., 2005).
Introduction _
28
The effectiveness of bone remodelling depends on a balance of bone formation
(osteoblastogenesis) and bone resorption (osteoclastogenesis). A recent study demonstrated
that BMP-6 has a biphasic effect on primary murine bone marrow cells, stimulating osteoclast
generation at low concentrations (1 ng/mL) and osteoblast generation at higher concentrations
(300 ng/mL) (Wutzl A et al., 2005). All these evidences point to the fact that BMP-6 might be
an important regulator of bone homeostasis.
Introduction
29
1.3. Basic fibroblast growth factor.
1.3.1. The fibroblast growth factors.
The fibroblast growth factors (FGFs) are a family of polypeptide growth factors present in
organisms ranging from nematodes to humans. In vertebrates, this family is composed of 22
members, which are highly conserved in both gene structure and amino-acid sequence among
species. FGFs are key players in the processes of proliferation, differentiation, migration and
survival of many cell types during embryonic development, while acting as homeostatic factors
in tissue repair and response to injury in the adult organism.
Among the FGFs, the most studied members are the two first discovered: acidic fibroblast
growth factor, aFGF or FGF1, and basic fibroblast growth factor, bFGF or FGF2, which have
special relevance on wound healing and blood vessel formation, being both more potent
angiogenic factors than VEGF (Ornitz DM and Itoh N, 2001).
1.3.2. Structure of bFGF.
Fibroblast growth factor 2 or basic fibroblast growth factor (FGF2 or bFGF) is one of the
members of the large family of the FGF family, being this cytokine initially purified from bovine
pituitary gland extracts in 1975 (Gospodarowicz D, 1975).
The human genome has one single copy of the fgf2 gene, localized in chromosome 4, and
extending over more than 36 Kbp. It is composed of three exons separated by two 16 Kbp
introns (Abraham JA et al., 1986). Translation using the conventional AUG codon gives rise to
the first-identified 18 KDa bFGF-isoform, while the existence of upstream in-frame CUG codons
allows alternative translation of higher molecular weight isoforms (Fig. 8). These 22, 22.5, 24
and 34 KDa isoforms possess a nuclear localizing sequence (nls) containing several Gly-Arg
repeats with methylated arginine residues, which directs the growth factor to the cell nucleus,
whereas the 18 KDa isoform is essentially cytosolic. The 34 KDa isoform is induced under cell
stress conditions and is poorly translated (Arnaud E et al., 1999).
Introduction _
30
Figure 8. Schematic representation of the bFGF mRNA and the isoforms of bFGF resulting from its alternative translation. Nuclear localizing sequences (nls) present in the high molecular weight isoforms are represented as orange boxes.
In the present work, we focused on the conventional 18 KDa isoform of bFGF, which is a
monomeric protein containing four cysteine residues with no intramolecular disulfide bonds, a
large number of basic aminoacids, and two sites (Ser64 and Thr112) that can be
phosphorylated by protein kinases A and C, respectively. Due to the predominance of basic
residues, bFGF has a pI of 9.6, being a pH range from 5 to 9 optimal for its stability in aqueous
solutions (Bikfalvi A et al., 1997). Crystallization of bFGF revealed that it consists of twelve anti-
parallel β-sheets organized into a trigonal pyramidal structure (Fig. 9). The region of the
molecule involved in receptor-binding is mainly localized between residues 40 and 100, whereas
the C-terminus is implicated in specific binding to heparan sulphate proteoglycans (HSPGs)
mediated by two lysine-rich surface loops (Asn28, Arg121, Lys126, Gln135, and Lys27, Asn102,
Lys136) (Eriksson AE et al., 1991).
1.3.3. bFGF secretion.
Soluble proteins destined for secretion use to possess N-terminal signal peptides to direct
their translocation into the lumen of the endoplasmic reticulum. From here they can be
packaged into transport vesicles and reach the Golgi apparatus, being finally sent to the cell
surface through vesicular transport. bFGF lacks such a signal peptide and its secretion to the
extracellular space seems to be unconventional, since it does not follow this classic secretory
pathway. It has been suggested that bFGF is released from cells as the result of cell damage,
death and non-lethal membrane disruptions (Conrad HE, 1998). Nevertheless, more recent
studies suggest that bFGF is secreted by direct translocation through the plasma membrane in
CUG 319 CUG 346 CUG 86 CUG 319 AUG 486 Stop 951
5’ 3’ mRNA
Translation
18 KDa
22 KDa
22.5 KDa
24 KDa
34 KDa
Introduction
31
an ATP- and membrane potential-independent manner (Backhaus R et al., 2004; Schäfer T et
al., 2004). It also seems that cell surface HSPGs act as a molecular trap which drives directional
transport of bFGF to the extracellular milieu, since C-terminus truncated bFGF forms are unable
to be secreted and cells lacking functional surface HSPGs do not secrete bFGF (Zehe C et al.,
2006).
1.3.4. bFGF receptors and bFGF-binding molecules.
Extracellular bFGF signals via an autocrine or a paracrine mechanism involving high affinity
transmembrane receptors derived from four separate genes (FGFR1-4). The existence of splice
variants for each receptor type results in differing ligand binding domains, which confer
specificity in signalling in response to the various FGF family members. Although all the
different splice variants of the four FGFRs can be activated by aFGF (acidic fibroblast growth
A B
C D
Figure 9. Three-dimensional representations of the bFGF molecule, based on crystallization data at 2.2 Å resolution obtained by Eriksson EA et al. A) Model of the bFGF molecule showing the twelve β-sheets. B) Wireframe model with the basic residues highlighted in blue and the acidic residues highlighted in red. C) Wireframe model highlighting the residues of the C-terminal surface loops implicated in binding to HSPGs. D) Wireframe model highlighting the central region of the molecule involved in receptor-binding.
Introduction _
32
factor), most of them have narrower specificity for the different FGF ligands (Kan M et al.,
1993). The FGFR2 consists of extracellular immunoglobulin (IG) domains, a transmembrane
domain, and intracellular tyrosine kinase (TK) domains (Fig. 10). The exon encoding the
C-terminus region of the IG loop3 undergoes alternative splicing to generate the IIIb and IIIc
isoforms of FGFR2, being bFGF only capable of binding to FGFR2-IIIc. In particular, bFGF binds
to both the extracellular IG loop2 and the interloop region of IG loop2 (McKeehan WL, 1992).
bFGF has specific affinity to heparin and heparan sulphate, which are linear sulphated
polysaccharides known as glycosaminoglycans. While heparin is only produced by mast cells,
heparan sulphate is present in all mammalian tissues attached to core proteins as heparan
sulphate proteoglycans (HSPGs), which are perlecan, syndecan, betaglycan, CD44 isoforms, and
glycosylphosphatidylinositol-linked forms, such as glypican and cerebroglycan. The binding to
these molecules protects bFGF against heat or acid denaturation, as well as protease cleavage,
maintaining an extracellular pool of active bFGF (Conrad HE, 1998). Binding between bFGF and
HSPGs also increases the binding affinity of bFGF to its receptors, being the basal lamina HSPG
perlican the major activator of bFGF. HSPG density within the extracellular matrix will dictate
bFGF transport and release rates, with cells competing for matrix released bFGF depending on
the density of cell surface binding sites (FGFR and membrane-associated HSPGs). The
magnitude and type of cellular response might depend on the ability to form ternary complexes
of bFGF, HSPGs and FGFR. These high-affinity complexes will have slower dissociation rates and
will thus show increased persistence on the cell surface and within the intracellular
compartments (Folkman J et al., 1988; Dowd CJ et al., 1999).
Figure 10. Schematic representation of the FGF Receptor.
bFGF
Signal peptide
IG Domain I loop 1 Acid box IG Domain II loop 2
IG Domain III loop 3
Transmembrane domain cell membrane
Tyrosine kinase domain I Tyrisone kinase domain II C-tail
Heparin-binding domain
Introduction
33
1.3.5. bFGF signalling.
bFGF signals through two major transduction pathways: the mitogen-activated protein
kinase (MAPK) pathway, and the protein kinase C (PKC) pathway (Fig. 11). Binding of bFGF to
its receptor leads to autophosphorylation of five tyrosine residues (Tyr586, Tyr656, Tyr657,
Tyr733 and Tyr769) of the TK domains, following dimerization of two FGFRs. Some of the
phosphotyrosines are binding sites for proteins containing phosphotyrosine-binding domains,
such as FGF receptor substrate 2 (FRS2) and Scr homologous and collagen protein (SHC).
These two proteins act as docking molecules that recruit a complex formed by growth factor
receptor-bound protein 2 (GRB2) and son of sevenless (SOS). The GRB2-SOS complex activates
the small G-protein RAS, which recruits and activates RAF, a serine/threonine kinase that
phosphorylates MEK. Activated MEK phosphorylates MAPK, which can translocate to the nucleus
to directly activate transcription factors by phosphorylation. On the other side, some
phosphotyrosines of the TK domain of FGFR can bind to the SH2 domain of phospholipase C
gamma (PLCγ) which, when activated, will cleave phosphatidyl-inositol-4, 5-bisphosphate (PIP2)
to diacylglycerol (DAG) and inositol triphosphate (IP3). The latter induces calcium liberation
from the endoplasmic reticulum, while DAG activates PKC in the presence of calcium.
The specific transduction pathways and molecules involved in bFGF signalling can depend
on the particular FGFR type activated, as well as on the type of cell surface HSPGs implicated in
receptor activation and direct activity of intracellular and intranuclear bFGF. Due to this
complexity, activation of various cell types by bFGF can lead to a variety of cellular responses,
such as proliferation, migration and/or stimulation/inhibition of the expression of a certain
phenotype (Nugent MA and Iozzo RV, 2000).
1.3.6. bFGF biological activity.
Though bFGF was first described as a mitogen for fibroblasts, it plays a key role in
development, remodelling and regeneration of almost every organ (Bikfalvi A et al., 1997). Most
of the reported activities are for the 18 KDa isoform, which is widely distributed in many
tissues. Anyway, as evidenced by knock-out experiments, no vital function is absolutely
dependent on bFGF, probably due to redundant functions of several FGFs triggering the same
FGFR variants. bFGF(-/-) mice lacking all the growth factor isoforms are viable, fertile and
phenotypically almost identical to wild-type mice, for except of some neuronal defects in the
cortex and reduced blood pressure due to an impaired neural reflex control of the vascular tone
(Dono R et al., 1998).
Introduction _
34
Nevertheless, bFGF is known to play important roles during the embryonic development of
vertebrates. For example, it has been demonstrated that bFGF acts synergically with BMPs to
induce controlled cell death during avian limb development (Montero JA et al., 2001)
Figure 11. Representation of the two major pathways for bFGF signalling: The MAPK and the PKC pathways.
One of the best characterized activities of this growth factor is the regulation of growth and
function of vascular cells, such as endothelial and smooth muscle cells. bFGF has been
implicated in angiogenesis and in the pathogenesis of vascular diseases, such as
atherosclerosis. Due to this feature, bFGF has been related with tumour progression and
metastasis (Basilico C and Moscatelli D, 1992), and a secreted FGF-binding protein (FGF-BP)
that mobilizes and activates locally stored FGF has been reported to act as an angiogenic switch
in human cancer (Czubayko F et al., 1997).
bFGF
PP
P
P
P
P
FRS2
GRB-2 SHC PLCγ
SOS
RAS GTP
RAF GDP+Pi
MEK
MAPK
MAPK
PIP2
IP3 + DAG
Ca2+
release
PKC
bFGF
bFGFFGFR
HSPG
Cell membrane
nucleus
Jun, Fos
Introduction
35
In bone regeneration, bFGF might play a double role. Its well known angiogenic activity can
stimulate neovascularization of the new formed bone (Lind M, 1998), while it might also be
important to induce proliferation and/or differentiation of mesenchymal osteoprogenitor cells.
The invasion of new blood vessels into the newly forming bone or bone grafts is considered
a source of potential osteoprogenitor cells. These blood vessels, growing between the neo-
formed woven-bone trabeculae, not only provide the nutrients for the new bone, but also form
the haematopoietic bone marrow, which is the origin of the osteoclasts responsible for bone
resorption (van de Wijngaert FP et al., 1987). In a later stage, this woven bone is remodelled
and replaced by mature lamellar bone. Stimulation of capillary invasion will lead to more bone
formation at the site of the defect.
On the other hand, there is a great controversy around the effect of bFGF on the
osteogenic cells themselves. Several in vitro studies revealed inhibition of cartilage and bone
differentiation by bFGF. In cultured chondrocytes, terminal differentiation was inhibited by
bFGF, since alkaline phosphatase activity, calcium deposition (Kato Y and Iwamoto M, 1990;
Iwamoto M et al., 1995) and proteoglycan synthesis (Demarquay D et al., 1990) was
diminished. This effect seems to be due to induction of parathyroid hormone-related protein
(PTHrP) expression (Terkeltaub RA et al., 1998). Similar inhibitory effects have been observed
in cultured osteoblastic cells, in which bFGF decreased the steady-state mRNA levels for
osteocalcin, type I collagen and alkaline phosphatase (Rodan SB et al., 1989; Hurley MM et al.,
1993; Delany AM and Canalis E, 1998). Also several in vivo studies revealed inhibitory effects of
bFGF on bone formation. It has been shown that exogenous bFGF did not accelerate fracture
healing in rabbits (Bland YS et al., 1995), while administration of this growth factor diminished
mechanical strength during repair of tibial segmental defects in rats (Andreshak JL et al., 1997).
Administration of bFGF mixed with bone matrix powder in hamstring muscles of mice showed a
dose-dependent inhibition of heterotopic endochondral bone formation (Sakano S et al., 2002).
In opposition to these evidences, many other studies have revealed important stimulatory
effects of bFGF on bone formation. In vitro, bFGF was shown to activate the transcription of the
human osteocalcin gene in ROS 17/2.8-transfected cells (Schedlich LJ et al., 1994), as well as it
enhanced the growth, expression of osteogenic markers (alkaline phosphatase and osteocalcin)
and formation of mineralized bone-like tissue in rat and human stromal bone marrow cells in
the presence of dexamethasone (Pitaru S et al., 1993; Pri-Chen S et al., 1998). In vivo, the
administration of low doses of this growth factor to growing rats stimulated endosteal and
endochondral bone formation, preceded by an initial increase in preosteoblastic cells from which
osteoblast were recruited (Nagai H et al., 1995). When administered together with
demineralized bone matrix powder, bFGF greatly enhanced reparation of mandibular critical-size
defects in rabbits (Lu M and Rabie AB, 2002). Direct infusion of 100 ng/day of bFGF into rat
femora after bone marrow ablation caused an increase in mRNA levels of osteopontin, but
Introduction _
36
decreased the expression of type I collagen, while higher doses inhibited gene expression of
osteogenic markers (Tanaka H et al., 2003). It has also been shown that intravenous
administration of bFGF to ovariectomized rats results in a significant increase in bone formation
and upregulation of transforming growth factor beta (TGF-β) and insulin-like growth factor-I
(IGF-I) expression (Power RA et al., 2004).
Probably, these contradictory observations just reflect the complexity of signalling by bFGF.
The effect of this growth factor is highly unpredictable depending on the concentration of
effective molecules, the stage of differentiation of the target cells and the presence of other
growth factors. Biphasic dose-dependent responses are common in growth factor biology, and
have already been reported for bFGF, as it enhanced bone formation in bone grafts (Wang JS
and Aspenberg P, 1996) and in a mandibular defect model (Zellin G and Linde A, 2000) at low
doses, while inducing fibrous tissue formation at higher doses. This kind of effect might be
explained by downregulation of FGF receptors in response to an excess of ligands (Moscatelli D,
1994), resulting in reduced bFGF action. It also seems that the bFGF effects are differentiation
stage-specific, as it stimulated cell growth and reduced the expression of osteoblast markers in
less mature human calvaria cells, whereas it induced OC production and matrix mineralization in
more mature osteoblasts (Debiais F et al., 1998). Other authors report that bFGF stimulates
proliferation of immature osteoblasts, but induces apoptosis in differentiating cells (Mansukhani
A et al., 2000). At last, bFGF activity in vivo may be modulated by a variety of other growth
factors with opposite activities or partially overlapping signalling pathways. Simultaneous
presence of bFGF and strong osteogenic molecules such as BMPs or IGF-I might cause a
conflict leading to inhibition of osteoblastic differentiation or even cell death, rather than
inducing osteogenesis. It has been reported that FGFs inhibit BMP receptor 1b (Merino R et al.,
1998) and FGFR3 seems to be a negative regulator of bone growth, since up-regulation of its
signalling represses hedgehog signalling and BMP-4 expression, leading to inhibition of
endochondral bone growth (Deng C et al., 1996; Naski MC et al., 1998). All these evidences
point to the fact that osteoblast responses are regulated by relative strengths of opposing
signalling pathways.
Introduction
37
1.4. Therapies for bone defect healing.
For the treatment of non-union fractures, autologous bone grafts are still considered the
gold standard nowadays, since they possess both important osteoconductive and osteoinductive
properties. The term osteoconduction refers to the process that supports the ingrowth of
capillaries, perivascular tissue and osteoprogenitors into the three-dimensional structure of the
graft, while osteoinduction is the process that supports the proliferation of undifferentiated
mesenchymal cells and the formation of osteoprogenitors with the capacity to form bone
(Bishop GB and Einhorn TA, 2007). Nevertheless, due to the limitations of autografts,
commented in section 1.1.4, the search for alternatives to autologous bone grafts has become
a need.
Human demineralized bone matrix (DBM) is commercially available but, when used alone,
has failed to demonstrate equivalent efficacy to autologous bone (Finkemeier CG, 2002).
Furthermore, the use of DBM mixed with CaSO4 in treatment of non-union fractures showed
high rates of wound drainage, infection and treatment failure (Ziran BH et al., 2007). On the
other hand, synthetic grafts, such as calcium phosphate, calcium sulphate, calcium
hydroxyapatite and collagen-calcium phosphate composites, can mimic the osteoconductive
properties of bone grafts, but fail in their osteoinductive properties.
Thanks to the recombinant DNA technology, many growth factors involved in osteogenesis,
angiogenesis and wound healing have become commercially available, and their potential use in
clinical bone repair is widely being studied. Combinations of an osteoconductive biomaterial and
osteoinductive growth factors have arisen as very promising alternatives to autografts.
1.4.1. Growth factors for bone defect healing.
Among the wide variety of growth factors involved in bone homeostasis, the BMPs have
especially focused the attention of the researches, because of their strong osteogenic properties
and of being the only cytokines known to induce ectopic bone formation.
The use of recombinant human BMP-2 for the treatment of open tibial fractures was
investigated by the BESTT trial (the BMP-2 Evaluation in Surgery for Tibial Trauma) (Govender
S et al., 2002) and by a subgroup analysis (Swiontkowski MF et al., 2006). These studies
concluded that patients treated with 1.50 mg/Kg rhBMP-2 showed fewer hardware failures,
fewer infections and faster wound healing than patients in the control groups. These studies
finally led, in July 2002, to approval of the use of rhBMP-2 (InductOs®) by the European
Medicines Agency (EMEA) for treatment of severe tibial fractures in adults. A few months later,
in November 2002, the American Food and Drug Administration (FDA) approved the use of
Introduction _
38
rhBMP-2 in combination with absorbable bovine type I collagen sponges (INFUSE® Bone Graft
Device) for treatment of open fractures in long bones. rhBMP-2 has also been approved by the
FDA for use in spinal fusions, in the form of a cylindrical titanium fusion cage filled with
rhBMP-2/collagen sponge (InFuse® Bone Graft/LT-CAGE® Lumbar Tapered Fusion Device). This
approach has been proven to be effective to achieve anterior inter-body fusion in patients with
degenerative lumbar disc disease (Boden SD et al., 2000; Burkus JK et al., 2002, 2003, 2004).
Also rhBMP-7 for the treatment of tibial non-unions was investigated by a prospective,
randomised clinical trial, concluding that rhBMP-7 implanted with a type I collagen carrier is a
safe and effective alternative to autologous bone grafting for treatment of tibial non-unions
(Friedlaender GE et al., 2001). On this basis, the FDA issued a Humanitarian Device Exemption
for the application of BMP-7 implants (OP-1® Implant) in recalcitrant long bone non-unions
where autografts are unfeasible and alternative treatments had failed. Similarly, the EMEA
approved the use of Osigraft® for the same purposes. Since then, different clinical studies of
resistant tibial non-unions treated with rhBMP-7 have been published (Pecina M et al., 2001,
2003). In April 2004, the FDA also approved the use of a combination of rhBMP-7, bovine type I
collagen and carboxymethylcellulose (OP-1® Putty) for posterolateral spinal fusion after failure
of alternative treatments. This decision was made based on data obtained from previous
preclinical studies in dogs and clinical pilot studies (Cook SD, 1995; Vaccaro AR et al., 2002,
2004, 2005).
On the other hand, angiogenesis is known to play a critical role in both the systematic
growth and repair of bone, and the combination of angiogenic and osteogenic factors is thought
to enhance bone healing and regeneration (Kanczler JM and Oreffo RO, 2008). In this sense,
many in vivo studies have revealed that bone defects co-treated with bFGF and BMP-2 showed
improved healing when low concentrations of bFGF were used (Fujimura K et al., 2002;
Nakamura Y et al., 2005; Tanaka E et al., 2006; Kakudo N et al., 2006). In these studies, the
positive effect of bFGF might not only be due to enhancement of angiogenesis, but also to
stimulation of proliferation and/or differentiation of mesenchymal osteoprogenitors at the
implant site.
1.4.2. Safety of the clinical use of growth factors.
The clinical studies carried out with rhBMP-2 concluded that the effective osteoinductive
dose of this growth factor is 1.5 mg BMP-2 / mL ACS (Valentin-Opran A et al., 2002; Govender
S et al., 2002). Nevertheless, concentrations in the order of just hundreds of nanograms per
millilitre are sufficient to induce osteoblastic differentiation of mesenchymal cells in vitro while,
in the human body, normal concentrations of BMPs are estimated at 2 ng/g of bone
Introduction
39
(Rengachary SS, 2002). Thus, clinical application of BMPs implies raising their local
concentration more than 106-fold over the physiological levels.
It has been shown that, after administration of rhBMP-2, the amount of growth factor that
can be found in the systemic blood stream is about 0.1% of the used dose, and that these
molecules have a half-life of just a few minutes. Furthermore, neither ectopic ossification nor
calcification of soft tissues has been reported after clinical application of BMPs (Valentin-Opran
A et al., 2002). Although the use of BMP-2 and -7 is considered save, the long-term effects of
the application of such amounts of these potent, highly pleiotropic growth factors are not well
known. On the other hand, the immune mechanisms triggered upon BMP implantation are not
well defined due to controversy in the literature. It seems that single applications of allogenic
BMPs can promote recruitment of macrophages, lymphocytes and plasma cells, as well as
activate a moderate production of anti-BMP antibodies (Granjeiro JM et al., 2005). It has been
suggested that, because of these antibody responses, BMPs should not be used in pregnant
women and the repeated use of BMPs should be avoided (Carlisle E and Fischgrund JS, 2005).
Another disadvantage of the use of high doses of growth factors is the enormous economic
cost of the treatments. In the UK, it is estimated that the use of InductOs® for the treatment of
tibial fractures would cost £ 1,790 per fracture additional to the standard treatment and the
total incremental cost of adopting the use of BMPs in the treatment of open tibial fractures is
estimated to be approximately £ 3.5 million per year (Garrison KR et al., 2007).
1.4.3. Osteoconductive carriers.
It has been demonstrated that new bone formation can be achieved by direct application of
BMPs alone (Wozney JM et al., 1990; Einhorn TA et al., 2003). Nevertheless, these approaches
require the use of very high doses of growth factors, since they use to have a short half-life in
vivo and suffer a quick systemic dispersion after their injection. Application of the growth
factors in combination with specific carriers improves their osteogenic abilities (Peel SA et al.,
2003). The aim of the carrier is to retain the growth factors at the wound site, maintaining their
local concentrations, since it has been demonstrated that the bone healing efficiency is
correlated with the prolonged presence of BMPs at the wound site (Woo BH et al., 2001).
Furthermore, the carrier can act as an osteoconductive milieu, permitting its infiltration by
mesenchymal cells and the ingrowth of blood vessels (Peel SA et al., 2003).
It can be concluded that an ideal carrier for bone regeneration purposes should possess the
following qualities (Geiger M et al., 2003): i) biocompatibility, low immunogenicity and
antigenicity; ii) biodegradability with biocompatible components, in predictable manner in
concert with bone growth; iii) adequate porosity for cellular invasion and vascularization;
iv) adequate compressive and tensile strength; v) enhancement of cellular attachment, without
Introduction _
40
inducing soft tissue growth at the bone/implant interface; vi) amenability to sterilization without
loss of properties; vii) affinity to growth factors and host bone; viii) enhancement of osteogenic
activity of the growth factors with a restrictive release of them at an effective dose during a
period coincident with the accumulation of target cells; ix) adaptability to irregular wound site,
malleability; x) availability to surgeon on short notice.
Unfortunately, none of the currently available materials can be considered an ideal carrier.
Many investigations have been performed to test carriers based on inorganic materials
(tricalcium phosphate, HA, titanium, etc.), polymeric materials (polylactic acid, poly-lactic-co-
glycolic acid, poly-lactic acid/polyethylene glycol, etc.), and organic materials (collagen,
demineralized bone matrix, etc.) (Babensee JE et al., 2000; Kirker-Head CA, 2000; Li RH and
Wozney JM, 2001, Williams DF, 2008).
Among the organic carriers, DBM has shown many advantages and excellent BMP-
retention/liberation properties (Peel SA et al., 2003), but fails as a suitable carrier since it is
known to maintain endogenous growth factors, which are not eliminated during the
demineralization process (Blum B et al., 2004). In fact, DBM alone has some capacity of
inducing bone formation (Kale AA and Di Cesare PE, 1995; Hartman EH et al., 2004). Due to
the great amount and variety of growth factors that remains in DBM after demineralization, the
local effects of DBM implants are unpredictable, having the graft possibilities of being rejected
in long term, as frequently happens with allografts when used in bone surgery (Ziran BH et al.,
2007). Furthermore, other studies suggest that DBM contains proteins that can partially block
BMP activity (Behnam K et al., 2006). In contrast, despite its poor biomechanical properties,
collagen is the only carrier approved for clinical application of BMPs due to its high
biocompatibility and biodegradability and low immunogenicity (Hubbell JA, 1995; Friess W,
1998).
Collagen is the main protein of connective tissue in animals, and is considered the most
abundant protein in mammals. Among the 28 different types of collagen, type I is the most
represented in the human body and is found mainly in tendons, endomysium, fibrocartilage,
bone and in scar tissue. Clinical administration of BMPs for bone regeneration is done in
combination with bovine type I absorbable collagen sponges (ACS), which are soaked with the
growth factor before implantation (Valentin-Opran A et al., 2002). It has been shown that this
form of collagen allows proper cell infiltration during new bone formation (Friess W, 1998).
Unfortunately, most growth factors have little natural affinity to collagen. Pharmacokinetic
studies of rhBMP-2 retention/liberation from collagen sponges in vivo showed a rapid initial loss
followed by an exponential liberation of the growth factor (Hollinger JO et al., 1998).
Electrostatic attraction forces, due to the different pI of collagen and BMPs, are believed to be a
major factor controlling the protein-matrix interactions (Geiger M et al., 2003). When testing a
modified rhBMP-2, treated with plasmin to remove positive charges from the molecule, it was
demonstrated that its affinity to collagen diminished, showing a much faster liberation rate from
collagen sponges and, thus, a shorter local persistence. Although this modified growth factor
Introduction
41
exhibited an increased biological activity tested in vitro on cell cultures (Hollinger JO et al.,
1998), it osteogenic activity in vivo was partially lost in comparison to native rhBMP-2 (Israel DI
et al., 1992). According to these facts, it seems that a sustained liberation of BMPs in vivo may
be a critical pharmacokinetic parameter for osteoinduction, with the amount of new produced
bone increasing with the local concentration of the osteoinductive growth factor (Uludag H et
al., 2000, 2001).
1.4.4. Modified growth factors for regenerative medicine.
Most of the problems associated with clinical application of growth factors could be palliated
if these could be specifically retained at the wound site, with a slow and sustained liberation
from their carrier.
Several proteins have natural domains to confer them specific affinity to collagen. For
example, many pathogenic bacteria express virulence factors with collagen-binding properties,
which facilitate adhesion to the extracellular matrix of the host tissues (e.g. the Yersinia
enterolitica adhesin YadA) or its degradation (e.g. Clostridium histolyticum class I collagenase).
In higher organisms, most of the collagen-binding proteins are related with blood coagulation
and wound healing, such as fibronectin, thrombospondin and the von Willebrand Factor (vWF),
all of which are present in blood plasma (Takagi J et al., 1992).
Many different cytokines have already been produced as fusion proteins with some of these
additional domains to confer them specific affinity to cells or components of the ECM, without
loss of their natural biological activity (Table 6).
The collagen-binding domain (CBD) of the bovine vWF has been identified as a decapeptide
with the sequence Trp-Arg-Glu-Pro-Ser-Phe-Cys-Ala-Leu-Ser (Takagi J et al., 1992). This CBD
has already been used to successfully produce a fusion protein with bFGF in E. coli, and fusion
proteins with several members of the TGF-β superfamily, including BMPs (Table 6). All these
proteins showed increased collagen-binding properties without loss of their natural biological
activity. In both the cases of bFGF and BMP-2, the CBD was fused to the N-terminal part of the
growth factor, and the Cys-7 of the CBD was replaced by a methionine to avoid incorrect
disulphide bond formation during their production or posterior manipulation. In the case of
bFGF, the protein was also produced with a 6xHis purification tag and a thrombin cut site to
eliminate this tag after purification (Andrades JA et al., 2001), while this was already avoided
for the production of the collagen-targeted rhBMP-2, which was purified by its natural affinity to
heparin (Visser R et al., 2009).
Introduction _
42
PROTEIN MODIFICATION REFERENCE
HGF Collagen-binding domain of fibronectin Kitajima T et al., 2007
Cell-binding domain of fibronectin Kawase Y et al., 1992
Collagen-binding domain of C. hystolyticum collagenase Nishi N et al., 1998
EGF
Collagen-binding domain of fibronectin Ishikawa T et al., 2001
Collagen-binding domain of C. hystolyticum collagenase Nishi N et al., 1998
Collagen-binding domain of the vWF Andrades JA et al., 2001
bFGF
Fibrin-binding domain Zhao W et al., 2008
TGF-β1 Collagen-binding domain of the vWF Tuan TL et al., 1996
TGF-β2 Collagen-binding domain of the vWF Han B et al., 1997
BMP-3 Collagen-binding domain of the vWF Han B et al., 2002
Fibrin-binding domain Schmoekel HG et al., 2005
Collagen-binding domain of the vWF Chen B et al., 2007a
Collagen-binding domain of C. hystolyticum collagenase Chen B et al., 2007b
BMP-2
Collagen-binding domain of the vWF Visser R et al., 2009
Table 6. Recombinant fusion proteins with additional binding domains to cells or extracellular matrix proteins.
Since collagen is not just the only carrier approved by the EMEA and the FDA for bone
healing applications, but also a main natural constituent of bone, collagen-targeted growth
factors are of special clinical interest. After direct administration in soluble form, these
molecules could be used to augment their local concentrations by direct binding to collagen
fibres at the site of injection. On the other hand, when administered in combination with a
collagenic carrier, the latter would partially retain the growth factors, limiting their actions to
the wound site. These approaches could reduce the concentration of growth factors needed to
achieve tissue regeneration when compared to the use of native molecules, improving the
safety of the treatments and reducing their costs.
Besides their potential use by direct administration, collagen-targeted growth factors might
also be useful for the in vitro selection and amplification of osteogenic populations of bone
marrow derived cells cultured in collagen gels (Andrades JA et al., 1999; Becerra J et al., 2006).
These strategies may help solve the decrease in the osteogenetic capacity of the bone marrow
of aged patients.
Introduction
43
1.5. Escherichia coli as an expression system.
The enterobacterium Escherichia coli has been used for recombinant DNA technologies
since 1973, when Stanley N. Cohen constructed the first recombinant plasmid for heterologous
DNA transcription in this microorganism (Cohen SN et al., 1973). Since then, E. coli has become
probably the most studied prokaryote. The vast knowledge of its structure and metabolism has
led to the development of many different strains, a great diversity of cloning and gene
expression systems, and to optimisation of media and culture conditions.
The main advantages of the use of E. coli as expression system are:
- The costs of expression are much lower than those of other systems.
- Bacteria are easy to manipulate and to maintain in culture.
- Most of the E. coli strains are harmless and require no specific equipment for
manipulation.
- Many different cloning and expression systems are available. For most of them, all
cloning steps can be performed in vitro.
- Very strong expression of heterologous genes (up to 100 mg/L) can be achieved in
E. coli.
On the other hand, the main disadvantages of the use of bacteria are:
- E. coli is unable to carry out most of the posttranslational modifications that are often
required for eukaryotic protein production.
- Production attempts often result in insoluble, unfunctional proteins aggregated as
inclusion bodies.
- The simple, plasmid-based systems, only allow cloning of a limited amount of
heterologous DNA.
1.5.1. Obtaining functional proteins from inclusion bodies.
Inclusion bodies are insoluble protein aggregates formed by deposition of misfolded or
partially folded polypeptides, due to intermolecular interactions between their exposed
hydrophobic patches (Fig. 12). These structures are generated by the failure of chaperones and
proteases to either fold of degrade un- or misfolded polypeptides synthesized at high rates
(Villaverde A and Carrió MM, 2003).
Introduction _
44
Figure 12. Schematic representation of the events that can happen during protein folding. Correct folding is a multi-step pathway (1). Misfolding (2) can lead to protein aggregation (3). Aggregation can also affect correct folding intermediates with exposed hydrophobic patches. The green lines represent the hydrophilic parts of the protein, while the red lines are the hydrophobic patches. Modified from Vallejo LF and Rinas U, 2004.
During heterologous protein expression, the amount of recombinant protein represents
between 50 and 95% of the inclusion bodies, while the remaining percentage is formed by heat
shock proteins (inclusion body proteins A and B; IbpA and IpbB) (Allen SP et al., 1992),
chaperones like DnaK and GroEL (Carrió MM and Villaverde A, 2002), and some other
contaminants, all of which may be passively trapped in the inclusion bodies through their
natural interactions with the polypeptides during their formation (Hart RA et al., 1990; Rinas U
and Bailey JE, 1992).
The formation of inclusion bodies during recombinant protein expression can be seen as an
advantage when considering the high degree of purity of the target protein in the aggregate
fraction and the higher protection against proteolysis compared to the soluble counterpart.
Although inclusion bodies are easy to isolate (directly yielding a protein fraction highly
enriched in the goal protein), many further in vitro manipulation of the recombinant proteins is
needed to obtain them with their biological activity. In general, the strategy for protein recovery
includes four consecutive steps: i) isolation of the inclusion bodies; ii) solubilization of the
aggregated proteins; iii) in vitro refolding of the solubilized protein; iv) purification of the
refolded fraction (Villaverde A and Carrió MM, 2003).
1.5.2. In vitro refolding of proteins.
Inclusion bodies usually consist of inactive proteins, and a more or less complex refolding
process has to be carried out after solubilization to obtain active proteins in their native
conformation. Many different refolding techniques have been developed for successfully
refolding of proteins, with every one of these having specific requirements. The most commonly
applied techniques are (Vallejo LF and Rinas U, 2004):
1a 1b
3
2 3
Introduction
45
I. Direct dilution: This is the simplest refolding procedure, consisting in direct dilution of the
solubilized proteins into a proper refolding buffer. A method to improve the refolding yield of
this technique is the continuous or pulse addition of the denatured proteins.
II. Membrane controlled denaturant removal: These methods consist in the use of dialysis
and diafiltration systems to gradually change from denaturing to native buffer conditions. These
methods use to cause more aggregation during refolding compared to direct dilution, and
refolding yields may be reduced due to non-specific adsorption of the proteins to the
membrane.
III. Chromatographic methods: These techniques are based on denaturing buffer
substitution by refolding buffer inside a size exclusion or hydrophobic interaction
chromatography column.
IV. Matrix-assisted refolding: consisting in attaching the solubilized proteins to a solid
support prior to changing from denaturing to native buffer conditions by one of the above-
mentioned techniques. This method may avoid the intermolecular interactions between the
folding intermediates with tendency to aggregation.
Regardless of the chosen refolding technique, many physical and chemical variables have to
be taken into account to achieve successful refolding of proteins produced as inclusion bodies.
Among these, critical variables are:
I. Temperature: Each protein is thermodynamically stable in a limited temperature range.
Low temperatures can suppress hydrophobic aggregation during refolding, but also slow down
the refolding rate.
II. Pressure: High pressure can dissolve protein aggregates and inclusion bodies and
gradual depressurization may allow proteins to reach their native state.
III. Chemical additives: Several substances, such as L-arginine, 2-(N-Cyclohexylamino)
ethanesulfonic acid (CHES), sulfobetaines, etc., have shown to suppress aggregation and to
increase refolding yields. Although the way these agents interact with the folding intermediates
remains unclear, they are presumed to diminish aggregation by shielding hydrophobic regions
of the partially folded chains.
IV. Micelles and liposomes: Detergents and phospholipids have shown potential to aid
protein refolding since they can form micelles and liposomes, respectively, with which the
Introduction _
46
folding intermediates can establish transient non-polar interactions to avoid protein
aggregation.
V. Chaperones: Natural chaperones have been used for successful refolding of several
proteins in vitro. The main disadvantages of their application are their high cost and the need
for their removal once the refolding procedure has finished.
Besides the above mentioned general requirements, proteins containing disulfide bonds
have additional special requirements to achieve their native conformation. After their
solubilization in the presence of reducing agents, they have to be refolded under conditions that
allow the formation of their native disulfide bonds, having in mind that these proteins are often
very unstable and show a high tendency towards aggregation in their reduced states. Since air
oxidation of the free cysteine residues is slow and often yields mismatched disulfides, a mixture
of low molecular weight thiols in their reduced and oxidized state is usually added to a slightly
alkaline refolding buffer to permit rapid disulfide exchange reactions until the protein reaches
the thermodynamically most stable conformation.
The use of protein disulfide isomerase (PDI) in combination with a redox system has also
been shown to increase the refolding yields and/or rates of several disulfide-bonded proteins.
This protein is a folding catalyst known to participate in disulfide bond formation in vivo.
In any case, the best refolding conditions for each particular protein have to be empirically
determined, what is usually not a simple task.
Introduction
47
1.6. Baculoviruses as expression systems.
1.6.1. General information on baculoviruses. The baculovirus life-
cycle.
The baculoviruses are a family (Baculoviridae) of rod-shaped viruses that is divided into two
genera:
- The Granuloviruses (GVs) have only one nucleocapsid per envelope. They produce
granulin occlusion bodies, containing one single virion.
- The Nucleopolyhedroviruses (NPVs) contain one (SNPVs) or multiple (MNPVs)
nucleocapsids per envelope. They produce polyhedrin occlusion bodies (also called
polyhedra), which contain multiple embedded virions.
Baculoviruses infect many different invertebrates, being over 600 host species identified,
mainly larval stadiums of moth species. They are not known to replicate in vertebrate cells.
Nucleopolyhedrovirus infection is composed of two infection cycles (Fig. 13): The infection
begins when a healthy host-larva ingests the polyhedra released from an earlier host. These
polyhedra reach the alkaline environment of the midgut, where they are dissolved. The released
viruses will then fuse with the columnar epithelial cell membranes of the host intestine to
trigger primary infection. Viral transcription and replication occur in the cell nucleus, being two
types of progeny produced: a budded virus form and an occluded virus form.
The budded viruses collect cell membrane material as well as binding proteins when
budding through the basolateral cell membrane, being responsible for secondary infection
through an endocytosic process, spreading infection from the midgut cells to the rest of the
larva.
The occluded viruses accumulate as polyhedra in the animal during infection. Cell lysis and,
ultimately, disintegration of the larva will release the polyhedra to the environment to start a
new infection cycle. In their occluded form, baculoviruses are very resilient to environmental
factors and can survive for extended periods of time.
Introduction _
48
Figure 13. Schematic representation of a typical baculovirus infection cycle.
Attending to protein expression, a typical baculovirus infection can be divided to three
distinct phases, though some genes can be expressed in more than one phase of the replication
cycle. Genes which promoter elements have strong similarity to insect promoters tend to be
expressed early in the cycle, whereas genes with specific viral promoter sequences tend to be
expressed during later phases. These phases are:
- Early phase (0-6 hours post-infection). During this phase, genes involved in the
regulation of the replication cascade and in preventing host responses are expressed,
as well as genes required for DNA synthesis, factors involved in late gene expression,
and a number of genes which modify aspects of the intra- and extracellular
environment.
Polyhedra are disolved in the midgut, liberating occlusion-derived viruses.
Virus fuses with midgut cell (primary infection)
Uncoating
Virogenic stroma Cell nucleus
Budding
Budded virus
Secondary infection
Envelopment and occlusion
Cell lysis and polihedra liberation
Polyhedra are ingested by host
Introduction
49
- Late phase (6-24 hours p.i.). The proteins expressed during this phase are involved in
the shutdown of host cell transcription and translation, in viral DNA packaging, as well
as GP64 (an envelope protein found on the surface of the budded viruses). In the late
phase, the viral DNA is replicated and the nucleocapsids are formed. These
nucleocapsids can either bud out through the cellular membrane and disseminate the
infection within the larva by infecting other cells by GP64-mediated envelope fusion and
endocytosis, or be occluded for horizontal transmission.
- Very late phase (24-72 hours p.i.). In this phase (also called occlusion phase), high
amounts of polyhedrin are produced to occlude the viruses in polyhedra. During the
final stage of this phase, the infected cells are lysed, resulting in death and liquefaction
of the host. P10, a 10 KDa microtubule-associated protein which seems to play a role in
host cell process formation during the infection, is also highly expressed in the very late
phase.
1.6.2. Baculovirus-based expression systems.
Since 1990, baculoviruses are used for expression of recombinant proteins. This is possible
thanks to the existence of high expression promoters in the viral genome, which are non-
essential for virus propagation in vitro. The main advantages of the use of baculoviruses as
expression system are:
- The costs of expression are lower than those when mammalian cells are used.
- Insect cells are easy to manipulate and to maintain in culture.
- Baculoviruses are harmless for vertebrates.
- Baculoviruses have the potential for very strong expression of heterologous genes.
Usual expression levels are in the range of 1-3 mg/L for intracellular proteins, and 3-15
mg/L for secreted proteins.
- Being a eukaryotic system, the baculovirus expression system is capable of proper
protein folding and performing posttranslational modifications, such as signal peptide
cleavage, phosphorylation, N- and O- glycosylation, disulfide bond formation, and
substitution of unusual analogs into proteins (e.g. selenomethionine, heme analogs,
etc.) (Luckow VA, 1991).
- Since the expression is performed at 27 ºC, this system is suitable for expression of
some temperature-sensitive proteins.
- The size of the baculovirus genome (ranging from 80 to 180 Kbp) permits cloning of
several heterologous genes for co-expression.
Introduction _
50
On the other hand, the disadvantages of the use of baculoviruses are:
- The costs of expression are higher than those for expression in prokaryotic systems.
- Expression levels are lower than those achieved with prokaryotic systems.
- The N-glycosylation pathway of baculovirus-infected cells differs from the pathway
found in higher eukaryotes. Glycoproteins produced in the baculovirus system typically
lack complex biantennary N-linked oligosaccharide side chains containing penultimate
galactose and terminal sialic acid residues. This could affect the biological properties of
the produced proteins.
- Extremely high level expression of proteins might overwhelm the ability of the cell to
modify the protein product, being secretion, phosphorylation and glycosylation affected
in particular.
Most of the today available baculovirus expression systems are based on substitution of a
viral non-essential gene by the heterologous gene of interest, maintaining the viral promoter to
control expression. The most commonly substituted genes are those encoding the very-late
expressed proteins P10 and Polh (polyhedrin). When cloned under the polh promoter, the
expression of a heterologous gene achieves maximum levels at 48-72 hours p.i., without
compromising the spreading of the infection among the cultured cells by viral budding.
The main strategy for obtaining a baculovirus expression system consists in cloning the
gene of interest into a shuttle vector, which possesses essential virus sequences flanking each
side of the MCS. On the other hand, the baculovirus DNA is digested with the restriction
enzyme Bsu36I, removing a fragment of an essential gene (ORF1629) for viral replication
(Possee RD et al., 1991) and producing a linear virus DNA that is unable to replicate within
insect cells. Co-transfection of insect cells with the linearized viral DNA and the shuttle vector
containing the gene of interest under the control of the polyhedrin promoter (or other
baculovirus or non-baculovirus promoters) flanked by baculovirus sequences homologous to
those removed by Bsu36I digestion, restores ORF1629 and re-circularises the virus by allelic
replacement (Fig. 14). The recombinant baculovirus DNA is then able to replicate in insect cells
and, in the late phase of infection, virions are assembled and recombinant baculoviruses are
produced. This mechanism ensures that all of the infective viruses are recombinant and that no
wild-type viruses will be produced.
Introduction
51
Figure 14. Schematic representation of the homologous recombination event that gives rise to an infective, recombinant baculovirus.
1.6.3. BacPak6™ and Sapphire™.
The two baculovirus-based expression systems used in the present work were BacPAK6™
(Clontech) and Sapphire™ (Orbigen). Both are designed for expression of recombinant proteins
under control of the polh promoter.
The BacPAK6™ system is a basic baculovirus expression system as explained in section
1.6.2. Recombinant baculoviruses are produced by homologous recombination after co-
transfection of the host cells with a shuttle vector in which the GOI is cloned, and the linearized
(Bsu36I digested) viral DNA, which is 137 Kbp in size (Fig. 15).
The Sapphire™ system is also a basic expression system, though it is improved for the
production of disulfide bond-containing proteins. Besides expression of the cloned GOI,
Sapphire™ baculoviruses co-express the protein disulfide isomerase (PDI) under control of the
p10 promoter (Fig. 15). This protein catalyzes oxidative protein folding in vivo by oxidizing pairs
of cysteines to form disulfide bonds, but can also shuffle incorrect disulfides into their correct
pairings (Gruber CW et al., 2006).
ORF603 ORF1629
GOI
Polh promoter MCS MCS
Shuttle vector with gene of interest (GOI)
Linearized (Bsu36I digested) baculovirus DNA
Infective, recombinant baculovirus DNA
Recombination
Introduction _
52
Figure 15. The BacPak6™ viral DNA and the Sapphire™ viral DNA.
Bsu36IBsu36I
Bsu36I
Bsu36IBsu36I
Bsu36I
PDI
2. Hypothesis and objectives.
53
54
________________________________________________________Hypothesis and Objectives
2.1. Hypothesis.
It has been demonstrated that collagen is a suitable osteoconductive carrier to be used in
combination with rhBMPs, leading to its approval for these purposes in clinical repair of osseous
defects. Nevertheless, the low natural affinity of BMPs to collagen implies that these approaches
require the use of very high concentrations of these growth factors to achieve the desired levels
of osteogenesis at the wound site, augmenting the risks of immune reactions and/or possible
undesired side effects due to diffusion of the molecules to the surrounding tissues or organs, or
into the blood stream. On the other side, bFGF is a potent mitogenic and angiogenic factor and
has been demonstrated to enhance osteogenesis. Nevertheless, the administration of bFGF for
bone repair purposes could also lead to side effects. Furthermore, growth factors are expensive,
and their clinical use significantly increases the costs of the treatments when compared to
standard intervention methods.
Previous studies have shown that the use of a recombinant collagen-targeted hBMP2 fusion
protein in combination with ACS increased osteogenesis at the site of implantation. This so-
called rhBMP2-CBD showed a higher affinity to ACS when compared to native rhBMP-2 and was
able to induce osteogenesis when used at lower concentrations than the threshold established
by other authors for rhBMP-2. This leads to the conclusion that the use of engineered collagen-
targeted growth factors in combination with collagenic carriers may be a better and safer
alternative for clinical repair of osseous defects than the at present available methods.
Among the BMP family members, BMP-6 has been demonstrated to be one of the most
potent inducers of both early and late osteogenic markers. In fact, BMP-6 can induce
osteogenesis at lower concentrations than BMP-2. On the other hand, bFGF is both an
important mitogenic factor for many different cell types, and a potent inducer of angiogenesis.
Several studies have shown that low concentrations of bFGF can enhance BMP-2 mediated
osteogenesis in vivo, but the osteogenic potential of combinations of BMP-6 and bFGF has not
been tested. The aim of the present work is to study this topic. Therefore, the goal is to
produce and purify both rhBMP-6 and rh-bFGF with and without an additional decapeptidic
collagen type I-binding domain derived from the vWF and to test the abilities of these growth
factors to induce osteogenesis in vivo. To avoid major changes to the molecules, the fusion
proteins will be produced without purification tags or any other additional domains. Although
the collagen-binding decapeptide (CBD) present in the vWF contains one cysteine residue, in
the fusion protein this residue will be replaced by a methionine to avoid disulfide scrambling or
unspecific disulfide bond formation during protein production (Fig. 16).
55
Hypothesis and Objectives________________________________________________________
NH2 CBD GROWTH FACTOR COOH
Trp-Arg-Glu-Pro-Ser-Phe-Met-Ala-Leu-Ser
Gly-Ala-Ser
Figure 16. Schematic representation of a recombinant engineered growth factor with a decapeptidic collagen type I-binding domain fused to the N-terminal part of the molecule. The original Cys-7 of the decapeptide has been replaced by a Met. An additional Gly-Ala-Ser tripeptide acts as a link.
We hypothesize that these collagen-targeted growth factors will be retained more efficiently
at the wound site when implanted together with absorbable collagen sponges, due to specific
binding to the carrier. This would allow the use of lower concentrations of these growth factors
to achieve significant levels of osteogenesis. In this sense, the combination of ACS with
collagen-targeted recombinant human bFGF and BMP-6 would show a greater osteogenic
activity than ACS combined with native rh-bFGF and BMP-6. Furthermore, we hypothesize that
the combination of rh-bFGF with rhBMP-6 will enhance osteogenesis when compared to
rhBMP-6 alone.
In conclusion, our hypothesis is that the use of ACS with collagen-targeted recombinant
human bFGF and BMP-6 could be a more effective and safer system for clinical repair of
osseous defects.
56
________________________________________________________Hypothesis and Objectives
2.2. Objectives.
The objectives established for the present work were:
1. To obtain the genes encoding the human bFGF and the human BMP-6, to add the
sequence encoding the collagen binding domain derived from the vWF to these genes
and to clone them into expression vectors.
2. To perform heterologous expression and to purify the native and collagen-targeted
rh-bFGF and rhBMP-6.
3. To determine the affinity to collagen type I of the collagen-targeted growth factors.
4. To characterize the osteogenic activity of the collagen-targeted growth factors in vitro
and in vivo and to compare it with the osteogenic activity of the native molecules.
5. To compare the osteogenic activity in vivo of combinations of bFGF and BMP-6 with
BMP-6 alone.
57
58
3. Material and methods.
59
60
____________________________________________________________Material and methods
61
3.1. Obtaining of the genes encoding h-bFGF and hBMP-6.
The sequence encoding the mature domain of the human bmp-6 gene was obtained by
RT-PCR on total RNA samples isolated from U-2 OS human osteosarcoma cells cultured in vitro.
The isolated RNA sample was previously analyzed by RNA electrophoresis (see Appendix I,
section AI.2.6) to check its quality. The RNA concentration in the sample was calculated from
the OD260 value, and the purity was determined by its OD260/OD280 ratio. Afterwards, the sample
was diluted to 1 µg/mL in highly pure, sterile, RNAse-free water. RNA isolation was performed
as described in Appendix I, section AI.2.1, while RT-PCR was performed with the specific
primers P5 vs. P6 (see Appendix I, section AI.2.13) as described in Appendix I, section AI.2.2.
The sequence encoding the human bfgf gene was obtained directly from the
pET28b:hbFGF-F1 and pET28b:hbFGF-F2 constructs described in Andrades JA et al., 2001.
3.1.1. Culture of U-2 OS cells.
U-2 OS human osteosarcoma cells are known to express rhBMP-6 and other members of
the BMP family. These cells were cultured as monolayers in 75 cm2 culture flasks with McCoy’s
5A medium supplemented with 10% foetal bovine serum (FBS) and 2 mM L-glutamine, at 37 ºC
in a humidified atmosphere with 5% CO2 (standard conditions). Cells were subcultured when
65-75% confluence was reached, by detaching them with 5 mL of a 0.25% tripsin, 0.03% EDTA
solution and diluting the cells 1:6 in fresh medium.
3.2. Cloning into the pET17b expression vector and the
pAcGP67B shuttle vector.
The gene encoding the hBMP-6 protein and the construction encoding the hBMP-6-CBD
were cloned into both the pET17b expression vector (for protein production in E. coli) and the
pAcGP67B shuttle vector (for protein expression in Sf9 cells). In contrast, the h-bFGF gene and
the construction encoding the h-bFGF-CBD were only cloned into the pAcGP67B shuttle vector.
For details on PCR, plasmid purification, DNA electrophoresis, DNA purification from agarose
gels, DNA digestion with endonucleases, DNA precipitation, DNA ligation, DNA sequencing,
transformation of bacteria or colony-PCR, see Appendix I, sections AI.2.3, AI.2.4, AI.2.5, AI.2.7,
AI.2.8, AI.2.9, AI.2.10, AI.2.11, AI.3.6 and AI.3.7, respectively.
Material and methods____________________________________________________________
62
3.2.1. Cloning of the hBMP-6 and the hBMP-6-CBD genes into the
pET17b and the pAcGP67B vectors.
The sequence encoding the mature domain of the hBMP-6, obtained by RT-PCR was ligated
into the pBIISK plasmid, previously digested with the EcoRV endonuclease, and the ligation
mixture was used to transform E. coli DH5α cells. In order to select a clone containing the
plasmid with the GOI correctly inserted, ten colonies were chosen and analyzed by colony-PCR
with the oligonucleotides P5 vs. P4.
The pBIISK:BMP-6 plasmid was isolated from the selected clone and used as template for
PCR reactions with a pfu polymerase and the oligonucleotides P10 vs. P11 (which yields the
mature bmp-6 sequence with an EcoRI restriction site upstream and a BamHI site downstream)
or P12 vs. P11 (which yields the mature bmp-6 sequence with an EcoRI restriction site and the
sequence for the CBD upstream and an BamHI site downstream). Both fragments were double-
digested with EcoRI and BamHI and ligated into the the pET17b vector previously digested with
the same combination of endonucleases. The ligation mixtures were used to transform E. coli
DH5α cells and the obtained clones were analyzed by colony-PCR using the oligonucleotide pair
P1 vs. P2. The selected, positive clones, were used for isolation of the pET17b:BMP-6 and
pET17b:BMP-6-CBD constructions (Fig. 17).
For cloning of the genes into the pAcGP67B shuttle vector, the obtained, isolated
pBSIIK:BMP-6 plasmid was used as a template for PCR reactions with a Pfu polymerase and the
oligonucleotides P7 vs. P8 (yielding the mature bmp-6 sequence with a BamHI restriction site
upstream and an EcoRI site downstream) or P9 vs. P8 (which yields the mature bmp-6
sequence with a BamHI restriction site and the sequence for the CBD upstream and an EcoRI
site downstream). Both fragments were double-digested with BamHI and EcoRI and ligated into
the pAcGP67B vector, previously digested with the same endonucleases. E. coli DH5α cells were
transformed with the ligation mixtures and the obtained clones were analyzed by colony-PCR
using the oligonucleotide pair P42 vs. P43. The selected, positive clones were used for isolation
of the pAcGP67B:BMP-6 and pAcGP67B:BMP-6-CBD constructions (Fig. 18)
____________________________________________________________Material and methods
63
Figure 17. Schematic overview of the obtaining of the pET17b:BMP-6 and the pET17b:BMP-6-CBD constructions.
P5 P6 vsRT-PCR
mature bmp-6 sequence
bmp-6 mRNA
Total RNA isolation
U-2 OS cells
mature bmp-6 sequence
Cloning
pBIISK (+)
EcoRV
pBIISK:BMP-6
Transformation of E. coli DH5α P5 P4vs
Plasmid isolation
PCR PCRP10 P11vs P12 P11 vs
mature bmp-6 sequence mature bmp-6 sequenceCBD
EcoRI/BamHI
EcoRI/BamHI
mature bmp-6 sequence mature bmp-6 sequenceCBD
pET17b
mature bmp-6 sequence
pET17b:BMP-6
mature bmp-6 sequence CBD
pET17b:BMP-6-CBD
EcoRI/BamHI
Cloning Cloning
Colony screening by PCR
Material and methods____________________________________________________________
64
Figure 18. Schematic overview of the obtaining of the pAcGP67B:BMP-6 and the pAcGP67B:BMP-6-CBD constructions.
3.2.2. Cloning of the h-bFGF and the h-bFGF genes into the
pAcGP67B vector.
For the obtaining of the pAcGP67B:bFGF and pAcGP67B:bFGF-CBD constructions, the
pET28b:hbFGF-F1 and pET28b:hbFGF-F2 constructs described in Andrades JA et al. (2001)
were used as templates for PCRs with a Pfu polymerase and the oligonucleotides P13 vs. P14
(yielding the bfgf sequence with a BglII restriction site upstream and an EcoRI site
downstream) or P15 vs. P14 (which yields the bfgf sequence with a BglII restriction site and the
sequence for the CBD upstream and an EcoRI site downstream). A BglII restriction site was
chosen instead of a BamHI restriction site since the sequence encoding the h-bFGF naturally
contains one BamHI site. Nevertheless, the digestion with BglII and BamHI generate
mature bmp-6 sequence
pBIISK:BMP-6
PCR PCRP7 P8 vs P9 P8vs
mature bmp-6 sequence mature bmp-6 sequence CBD
BamHI/EcoRI
BamHI/EcoRI
mature bmp-6 sequence mature bmp-6 sequence CBD
pAcGP67B
mature bmp-6 sequence
pAcGP67B:BMP-6
mature bmp-6 sequence CBD
pAcGP67B:BMP-6-CBD
BamHI/EcoRI
Cloning Cloning
____________________________________________________________Material and methods
65
compatible cohesive ends which allow the ligation of a BglII-digested fragment into a BamHI-
digested vector.
Both fragments were double-digested with BglII and EcoRI and ligated into the pAcGP67B
vector, previously digested with BamHI and EcoRI. E. coli DH5α cells were transformed with the
ligation mixtures and the obtained clones were analyzed by colony-PCR using the
oligonucleotide pair P42 vs. P43. The selected, positive clones were used for isolation of the
pAcGP67B:bFGF and pAcGP67B:bFGF-CBD constructions (Fig. 19)
Figure 19. Schematic overview of the obtaining of the pAcGP67B:bFGF and the pAcGP67B:bFGF-CBD constructions.
bfgf
pET28b:hbFGF-F1
PCR PCR P13 P14vs P15 P14 vs
bfgf bfgf CBD
BglII/EcoRI
BglII/EcoRI
bfgf bfgf CBD
pAcGP67B
bfgf
pAcGP67B:bFGF
bfgf CBD
pAcGP67B:bFGF-CBD
BamHI/EcoRI
Cloning Cloning
bfgf
pET28b:hbFGF-F2
CBD
Material and methods____________________________________________________________
66
3.3. Protein production in Escherichia coli.
To obtain purified recombinant proteins expressed in E. coli, the following steps must be
performed (Fig. 20):
- Transformation of E. coli with the expression vector (containing the gene of interest).
- Isolation of bacterial clones selected for antibiotic resistance.
- PCR analysis and/or sequencing of the selected clones to ensure that they contain the
expression vector and that it has suffered no mutations.
- Culture of the cells and protein expression.
- Cell disruption and isolation of inclusion bodies.
- Solubilization of the inclusion bodies.
- In vitro folding of the solubilized proteins, yielding a mixture of folded, misfolded and
unfolded proteins.
- Purification of the fraction containing the correctly folded proteins.
3.3.1. Obtaining of bacterial clones for protein production.
For information about culture media, culture conditions or bacterial strains, see Appendix I,
sections AI.3.1, AI.3.2 and AI.3.3, respectively.
E. coli Rosetta™ (DE3) cells were made competent and transformed by electroporation (see
Appendix I, section AI.3.5) with the pET17b:BMP-6 and the pET17b:BMP6-CBD constructions.
50 and 200 µL of each transformed aliquot were plated on LB agar dishes supplemented with
ampicillin and chloramphenicol, and incubated overnight to allow the bacteria that had
incorporated the expression vector to grow and form colonies. The next day, 10 isolated
colonies for each expression vector were selected and analyzed by colony-PCR (see Appendix I,
section AI.3.6) using specific primer pairs to detect the BMP-6 or the BMP6-CBD inserts. The
obtained PCR products were ran on an agarose gel (see Appendix I, section AI.2.5) to identify
which colonies were carrying the expression vector.
5 positive colonies for each expression vector were used to inoculate 5 mL 2xYT cultures,
which were incubated overnight. 1 mL of each culture was used to prepare a glycerol stock (see
Appendix I, section AI.3.4), while the other 4 mL were used for plasmid isolation (see Appendix
I, section AI.2.4). 2 plasmid samples for each expression vector were sequenced using specific
primers against the regions of the plasmidic DNA flanking the insert (T7 Promoter and
Terminator Primers, see Appendix I, section AI.2.13).
____________________________________________________________Material and methods
67
Figure 20. Schematic overview of the main steps needed for recombinant protein production in E. coli.
Expression vector Escherichia coli Transformation
Cell culture & protein expression
Inclusion body isolation
Inclusion body solubilization
In vitro refolding
Purification
Purified rhBMP-6 dimers
rhBMP-6 monomers
Inclusion bodies
Soluble rhBMP-6 monomers
Material and methods____________________________________________________________
68
3.3.2. Protein expression.
Isolated colonies from the clones containing the recombinant expression vectors, selected
by DNA sequencing, were obtained by resuspending a small amount of glycerol stock in 100 µL
of LB broth and seeding this suspension on an LB agar plate supplemented with ampicillin and
chloramphenicol. After incubating the plate for 24 hours at 37 ºC, one single, isolated colony
was picked and used to inoculate a 10 mL TB culture, which was grown overnight at 37 ºC with
200 rpm shaking. The following day, the OD600 of this inoculum was measured and a proper
volume of it was used to inoculate a new 100 mL TB culture to a starting OD600 value of 0.1.
This culture was grown at 37 ºC with shaking and its OD600 measured hourly. When the OD600
of the culture reached 0.8, IPTG was added to a final concentration of 1mM to induce
heterologous protein expression. The culture was incubated for an additional 4 hours, taking a
1 mL sample hourly for protein expression analysis. From each of these samples, cells were
harvested by centrifugation at 5,800 xg for 30 min at room temperature, resuspended in 50 mM
PB, pH 7.0 to a final OD600 value of 5.0, sonicated at 50 W for 2 minutes on ice and stored at
4 ºC until analysis by SDS-PAGE (see section 3.5.1). After 4 hours of induction, all the cells of
the culture were harvested by centrifugation and the pellet was stored at -80 ºC until inclusion
body isolation (see section 3.3.3).
3.3.3. Isolation of inclusion bodies.
The frozen cell pellet was resuspended in 50 mM PB to a final OD600 value of 5.0, pH 7.0
(one volume) and sonicated at 50 W for 2 minutes on ice. A small aliquot of this total protein
cell-content sample was taken for SDS-PAGE analysis, and the remaining sample was
centrifuged for 40 min at 38,000 xg, 4 ºC. The supernatant was removed and the insoluble
proteins contained in the pellet were resuspended with the same volume of 50 mM PB, pH 7.0.
A small aliquot of this insoluble protein sample was taken apart for SDS-PAGE analysis (see
section 3.5.1), and the remaining sample was used for isolation of inclusion bodies. For this
purpose, the sample was centrifuged for 40 min at 38,000 xg, 4 ºC, resuspended in ¼ the
volume of 50 mM PB, pH 7.0, centrifuged again and finally resuspended in twice the volume of
MR buffer (20 mM Tris-HCl, pH 8.5, 0.5 mM EDTA, 2% Tx-100), which removes the membrane-
associated and other lipophilic proteins. The proteins were centrifuged twice more at the same
conditions and resuspended in one volume and ½ the volume of MR buffer, respectively. A
small aliquot of the final suspension, containing the washed inclusion bodies, was taken apart
for SDS-PAGE analysis, and the remaining sample was used for inclusion body solubilization
(see section 3.3.4).
____________________________________________________________Material and methods
69
3.3.4. Solubilization of inclusion bodies.
In order to solubilize the recombinant proteins prior to in vitro refolding, the sample was
centrifuged for 40 min at 38,000 xg, 4 ºC, and the pellet was resuspended in 3 mL of
solubilization buffer (0.1 M Tris, pH 8.5, 6 M Gnd-HCl, 0.1 M DTT, 1 mM EDTA). Solubilization
was performed overnight, at room temperature, with constant stirring. The next day, the
sample was centrifuged for 45 min at 26,000 xg, 4 ºC to remove the remaining insoluble
particles, and the supernatant (containing the solubilized proteins) was transferred to another
tube. The pH of the sample was lowered below 6.0 by 16% HCl addition and the sample was
then dialyzed against MES-Gnd buffer (50 mM MES, pH 5.0, 6 M Gnd-HCl, 1 mM EDTA) for at
least 4 hours at 4 ºC in order to lower the DTT concentration below 1-2 mM, since the presence
of DTT would interfere with the protein refolding by reducing the cysteine residues involved in
disulfide bond formation.
After the dialysis, the final protein concentration of the sample was estimated by SDS-PAGE
analysis, since the concentration of the target protein during refolding is a critical parameter.
For this purpose, a small aliquot of the sample was diluted 1 :1,000 in 2x SDS-PAGE loading
buffer with DTT and heated at 95 ºC for 5 minutes. 1 :2, 1 :4, 1 :6, 1 :8 and 1 :10 dilutions in
2x SDS-PAGE loading buffer with DTT were made from the previous stock dilution and loaded
on a polyacrylamide gel for SDS-PAGE and Coomassie blue staining (see section 3.5.1 and
Appendix I, section AI.5.3, respectively). A sample of BMP-2 monomers of known concentration
was used as a standard for estimation of the rhBMP-6 concentration by digital image analysis
(Quantiscan v3.0, Biosoft®, Cambridge, UK).
3.3.5. In vitro refolding.
The attempts on refolding of rhBMP-6 produced in E. coli were based on the conditions
established for efficient rhBMP-2 refolding by Vallejo LF et al., 2002. These authors achieved
high refolding yields of this member of the BMP family by performing the renaturation for 72
hours at 10 ºC in a degassed refolding buffer containing 57.5 mM Tris, pH 8.5, 0.55 mM EDTA,
0.9 M NaCl, 0.75 M CHES, 0.5 M Gnd-HCl, 2 mM GSH and 1 mM GSSG. These were the starting
conditions used for rhBMP-6 refolding. The different variations on these conditions tested can
be found summarized in Table 7.
In general, 50 mL of redox base buffer A (55 mM Tris, pH 7.5 or pH 8.5 or pH 9.5, 1 M
NaCl, 0.5 mM EDTA, 0.82 M CHES or 0.55 M NDSB256 or 1.09 M NDSB256 or 0.55 mM
L-arginine or 1.64 M L-arginine) were mixed with 4.2 mL of redox base buffer B (100 mM Tris,
pH 7.5 or pH 8.5 or pH 9.5, 6 M Gnd-HCl, 1 mM EDTA). In some cases this mixture was
degassed for 20 minutes by N2 infusion while in others it was not. 0.55 mL of a 100x redox pair
Material and methods____________________________________________________________
70
stock solution (GSH :GSSG or 4-MPAA :GSSG) were added to the mixture and, afterwards,
0.39 mL of the rhBMP-6 solution, previously diluted with MES-Gnd buffer to obtain a 140-fold
concentration of the desired final concentration in the refolding mixture, were added. This
refolding mixture was placed in a cooling bath at 10 or 20 ºC and left for 72 hours. In some
cases, N2 was continuously supplied to the mixture during the entire refolding process to avoid
air-oxidation of the cysteine residues.
After 72 hours of incubation, the refolding yield for each condition tested was analyzed. For
this purpose, a 100 µL sample of the refolding mixture was taken apart and 11 µL of 1 M
iodoacetate was added to stop the refolding process by alkylation of the sulfhydryl groups. After
20 minutes of incubation at room temperature, the proteins in this aliquot were precipitated
with trichloroacetic acid (see Appendix I, section AI.5.1) and used for SDS-PAGE analysis (see
section 3.5.1).
____________________________________________________________Material and methods
71
Pro
tein
con
cen
trat
ion
Tem
p.
pH
Add
itiv
es
Red
ox p
air
Deg
assi
ng
CH
ES
ND
SB2
56
Arg
inin
e
GSH
:GSS
G
4-M
PA
A :
GS
SG
Yes
1 m
M
3 m
M
3 m
M Att
emp
t n
º
10
.7 µ
g/m
L
20
.0 µ
g/m
L
50
.0 µ
g/m
L
53
.4 µ
g/m
L
10
ºC
20
ºC
7.5
8.5
9.5
0.7
5 M
0.5
M
1.0
M
0.5
M
1.5
M
2 :
1
10
:1
2 :
1
10
:1
40
:1
2 :
1
10
:1
No
No
con
tin
uou
s N
2 s
upp
ly
Con
tin
uou
s N
2 s
upp
ly
1 ● ● ● ● ● ●
2 ● ● ● ● ● ●
3 ● ● ● ● ● ●
4 ● ● ● ● ● ●
5 ● ● ● ● ● ●
6 ● ● ● ● ● ●
7 ● ● ● ● ● ●
8 ● ● ● ● ● ●
9 ● ● ● ● ● ●
10 ● ● ● ● ● ●
11 ● ● ● ● ● ●
12 ● ● ● ● ● ●
13 ● ● ● ● ● ●
14 ● ● ● ● ● ●
15 ● ● ● ● ● ●
16 ● ● ● ● ● ●
17 ● ● ● ● ● ●
18 ● ● ● ● ● ●
19 ● ● ● ● ● ●
20 ● ● ● ● ● ●
21 ● ● ● ● ● ●
22 ● ● ● ● ● ●
23 ● ● ● ● ● ●
24 ● ● ● ● ● ●
25 ● ● ● ● ● ●
Material and methods____________________________________________________________
72
Pro
tein
con
cen
trat
ion
Tem
p.
pH
Add
itiv
es
Red
ox p
air
Deg
assi
ng
CH
ES
ND
SB2
56
Arg
inin
e
GSH
:GSS
G
4-M
PA
A :
GS
SG
Yes
1 m
M
3 m
M
3 m
M Att
emp
t n
º
10
.7 µ
g/m
L
20
.0 µ
g/m
L
50
.0 µ
g/m
L
53
.4 µ
g/m
L
10
ºC
20
ºC
7.5
8.5
9.5
0.7
5 M
0.5
M
1.0
M
0.5
M
1.5
M
2 :
1
10
:1
2 :
1
10
:1
40
:1
2 :
1
10
:1
No
No
con
tin
uou
s N
2 s
upp
ly
Con
tin
uou
s N
2 s
upp
ly
26 ● ● ● ● ● ●
27 ● ● ● ● ● ●
28 ● ● ● ● ● ●
29 ● ● ● ● ● ●
30 ● ● ● ● ● ●
31 ● ● ● ● ● ●
32 ● ● ● ● ● ●
33 ● ● ● ● ● ●
34 ● ● ● ● ● ●
35 ● ● ● ● ● ●
36 ● ● ● ● ● ●
37 ● ● ● ● ● ●
38 ● ● ● ● ● ●
39 ● ● ● ● ● ●
40 ● ● ● ● ● ●
41 ● ● ● ● ● ●
Table 7. Attempts on in vitro refolding of rhBMP6 monomers produced in Escherichia coli. Each row corresponds to one tested combination of parameters, which are highlighted at the upper part of the table.
____________________________________________________________Material and methods
73
3.4. Protein production in Sf9 insect cells.
To obtain a recombinant, infective baculovirus clone to be used for the production of
recombinant proteins in Sf9 cells, the following steps must be performed (Fig. 21):
- Co-transfection of Sf9 cells with the shuttle vector (containing the gene of interest) and
linearized baculovirus DNA. Homologous recombination events inside the cells will give
rise to complete viral DNA molecules.
- Separation of single viral clones by plaque assays.
- PCR analysis and/or sequencing of the selected clones to ensure that the gene of
interest is correctly inserted into de viral DNA and has suffered no mutations.
- Expansion of the selected clones and titering of the obtained viral suspensions.
- Production assays, to determine the optimal conditions of MOI and days post-infection
to obtain the highest yield of correctly expressed proteins.
Co-transfection into Sf9 cells
Shuttle vector Linearized baculovirus DNA
Transfection supernatant
Plaque assay
Single plaque picking Recombinant virus clone (Virus stock)
Material and methods____________________________________________________________
74
Figure 21. Schematic overview of the steps needed to obtain a recombinant baculovirus.
Master stock of virus (MSV)Titering
Clone expansion
Titering High volume virus stock (HVVS)
Production assay
Western blot analysis
PCR analysis and/or sequenciation
Clone expansion
____________________________________________________________Material and methods
75
3.4.1. Culture of Sf9 cells.
The Sf9 cell line was obtained from pupal ovarian tissue of the fall armyworm Spodoptera
frugiperda, by isolation of a clone of the parental IPLB-SF21-AE cell line (Vaughn JL et al.,
1977) by G. Smith and C. Cherry in 1983 (O’Reilly DR et al., 1994). This cell line is highly
susceptible to infection with Autographa californica nuclear polyhedrosis virus, and is widely
used for the production of recombinant proteins. Sf9 cells are spherical, and can be grown both
as an adherent monolayer in culture flasks or dishes, or as a suspension culture in spinner
vessels.
Culture of Sf9 cells was always performed at 28 ºC in an incubator without CO2 supply, in
TNM-FH Medium (Trichoplusia ni Medium – Formulation Hink), composed of Grace Medium for
insect cells (Grace TD, 1962) supplemented with trace metals, lactalbumin hydrolysate,
yeastolate and 10% (v/v) heat inactivated foetal bovine serum (FBS). To ensure sterility of the
cultures, amphotericin B (2.5 mg/L, final concentration) and a penicillin/streptomycin solution
(105 U/L and 100 mg/L, final concentrations, respectively) were also added to the medium. Only
during the production of the recombinant proteins, the cells were maintained in TNM-FH
Medium without FBS, but supplemented with 2 mM L-glutamine, since some authors have
published that high levels of L-glutamine can enhance recombinant protein production in these
cells (Sanders MM and Kon C, 1992; Nguyen B et al., 1993; Benslimane C et al., 2005).
Monolayer cultures were performed in Petri dishes (90 or 150 mm diameter) or in culture
flasks (T-75 cm2 or T-175 cm2) at a starting density of 3x105 cells/mL. When the monolayer
became confluent, cells were harvested by gently scraping with a sterile Digralsky spreader
covered by teflon® and subcultured at a 1:5 dilution.
Suspention cultures were started seeding cells harvested from adherent cultures at 5x105
cells/mL in a spinner vessel. Cells were grown with gentle agitation (50-100 rpm) until a density
of 2 – 3x106 cells/mL was reached before subculturing.
To determine the cell density of any suspension, cells were diluted in a trypan blue solution
and counted using a Neubauer haemocytometer (see Appendix I, section AI.4.3). All
experiments were performed seeding cells with a viability of 95% or higher.
3.4.2. Transfection of Sf9 cells.
Once the GOI was correctly cloned into the pAcGP67B shuttle vector, Sf9 cells had to be co-
transfected with this construction and linear baculovirus DNA molecules (BacPak6™ or
Sapphire™) in order to generate complete, infective baculoviruses by homologous
recombination within the cells.
Material and methods____________________________________________________________
76
For this purpose, cells from a suspension culture growing in log phase were seeded in 6-
well culture plates at a density of 1.5x106 cells/well and incubated for 1 h at 28 ºC to allow cells
to adhere to the bottom of the wells. Afterwards, the medium was removed from the wells,
cells were washed twice with serum-free TNM-FH and incubated another 30 minutes at 28 ºC
with 1.5 mL of serum-free TNM-FH/well. Meanwhile, the transfection mixtures were prepared in
sterile polyestirene tubes, gently mixed and left for 15 minutes at room temperature to allow
formation of complexes between the DNA molecules and the liposomes provided by the
transfection reagent. A control transfection mixture (reagent C-) was also prepared, lacking the
baculoviral DNA. A second control (cell C-) consisted of just 100 µL sterile water.
Transfection Reagent C- Cell C-
Sterile water 86 µL 91 µL 100 µL
pAcGP67B:GOI (100 ng/µL) 5 µL 5 µL -
Baculovirus DNA (20 ng/µL) 5 µL - -
Transfection reagent 4 µL 4 µL -
Each transfection mixture was added, drop by drop, to a different well of the culture plate,
and the plate was left for 4 h at room temperature with gentle shaking. Afterwards, 1.5 mL of
TNM-FH + 10% FBS was added to each well and the plate was left in a 28 ºC incubator for 6-9
days.
Finally, once the transfected cultures started showing signs of infection (increased cell
diameter, granular appearance of the cytoplasm and decreased growth rate), the medium
containing the recombinant baculoviruses was harvested, centrifuged at 1,000 xg for 5 minutes
to eliminate cells and cell debris, and the supernatant stored at 4 ºC. This supernatant was
denominated transfection supernatant (TS).
3.4.3. Isolation of viral clones (plaque assay).
The transfection supernatant obtained in the previous step is a heterogeneous mixture of
recombinant baculoviruses. To ensure the production of a homogeneous pool of recombinant
proteins, the cells have to be infected with one single viral clone.
The method used for isolation of clones from the TS was the plaque assay, by which cell
monolayers were infected with serial dilutions of the TS and covered with agarose to limit the
mobility of the viruses. When a cell is infected by one virus, the budded viruses liberated at the
end of the infection cycle are prevented by the agarose from freely disseminating through the
____________________________________________________________Material and methods
77
culture and will, thus, infect only the neighbour cells. This leads to the formation of lysis
plaques, which can be visualized by staining the living cells surrounding them (Fig. 22).
Figure 22. Formation of a lysis plaque. 1. One single virus infects a cell. 2. First infected cell lyses and newly formed viruses infect the surrounding cells. 3. Staining of the living cells with a vital stain reveals the lysis plaque.
To perform a plaque assay, cells from a suspension culture growing in log phase were
seeded in 6-well culture plates at a density of 1.2x106 cells/well and incubated for 1 h at 28 ºC
to allow cells to adhere to the bottom of the wells. Afterwards, the medium was retired from
the wells, cells were washed twice with serum-free TNM-FH and incubated another 30 minutes
at 28 ºC with 1.5 mL of serum-free TNM-FH/well. In the meantime, serial dilutions of the TS
were prepared in serum-free TNM-FH, from 10-3 to 10-8. Afterwards, the medium was removed
from the wells and 300 µL of each TS dilution were added, drop by drop, on top of the cell
monolayers of the different wells. Viruses were allowed to infect the cells during 2 h at room
temperature, gently inclining the plate every 5-10 minutes to avoid drying of the cells.
Meanwhile, a 3% low melting agarose solution was mixed 1:1 with TNM-FH + 10% FBS,
and kept in a heating bath at 37 ºC. The virus solutions were retired from the wells and 2 mL
agarose solution were carefully added to each well, covering the cell monolayers. Agarose was
allowed to solidify at room temperature for 30 minutes before adding 1 mL of TNM-FH + 10%
FBS to each well. The plate was then incubated for 5 days at 28 ºC.
Once the incubation time was finished, the medium was carefully removed from the wells
and 1 mL of a 0.33% neutral red solution diluted 1/16 in sterile PBS was added to each well.
After 2 h of incubation at room temperature, the staining solution was retired and the plate was
left upside down overnight to drain the remaining liquid.
The following day, the lysis plaques were observed through an inverted microscope and the
agarose covering each plaque was picked out using a sterile Pasteur pipette. Each piece of
agarose, containing a single viral clone, was placed in a microcentrifuge tube with 500 µL of
TNM-FH + 10% FBS and stored at 4 ºC. These samples were denominated virus stocks (VS)
1 2 3
Material and methods____________________________________________________________
78
3.4.4. PCR analysis of the viral clones.
Although the use of linearized (Bsu36I digested) viral DNA guarantees that no wild-type,
infective baculoviruses can rise in the TS, the clones selected by plaque assay were submitted
to PCR analysis to verify correct cloning of the GOI into the viral DNA (Malitschek B and Schartl
M, 1991; Webb AC et al., 1991). The list of oligonucleotides used for this purpose can be found
in Appendix I, section AI.2.13.
To obtain the viral DNA suitable for PCR analysis, 10 µL of each VS were mixed with 89 µL
of virus lysis buffer (10 mM Tris-HCl, pH 8.3, 100 µg/mL gelatine, 0.45% (v/v) Triton X-100,
0.45% (v/v) Tween-20, 50 mM KCl) and 1 µL of proteinase K solution (6 mg/mL). These
mixtures were first incubated for 1 h at 60 ºC in a dry block heated thermostat and, afterwards,
for 10 minutes at 90 ºC. This procedure destroys the viral coating and liberates the DNA
molecules.
PCR reactions were prepared using the 5Prime® MasterMix system. For each reaction
(25 µL total volume), 11.5 µL sterile water, 10 µL 5Prime® MasterMix, 2.5 µL virus sample and
0.5 µL of each 25 pM oligonucleotide solution were mixed in a 0.2 mL PCR tube. PCR was
performed using the Ta specified for each oligonucleotide pair.
Finally, the obtained PCR products were analyzed by DNA electrophoresis in agarose gels
(see Appendix I, section AI.2.5).
3.4.5. Expansion of the baculovirus clones.
For the production of the recombinant proteins, a large, homogeneous and titered batch of
baculoviruses is fundamental. This ensures that every production can be performed under the
same conditions and with the same MOI (multiplicity of infection; i.e. the number of pfu per cell
used to infect a culture).
94 ºC 94 ºC 1 min
72 ºC 72 ºC
x35 cycles
1 min 6 min 2 min 1 min Ta
____________________________________________________________Material and methods
79
The first amplification of the VS gives rise to a master stock of virus (MSV), which is titered
by a serial dilution assay (see section 3.4.6). Once the titer of the MSV is known, a second
amplification is performed to obtain a high volume virus stock (HVVS). This HVVS is produced
infecting a culture with a low MOI (0.1), so that the viral population can grow exponentially
before the majority of the cells die, yielding a high-titer suspension of virus. Once the HVVS is
harvested, it also has to be titered, so that every future protein production can be performed
using the same MOI.
Every MSV was obtained by seeding 5x106 cells on a 90 mm culture dish with, 10 mL of
TNM-FH + 10% FBS. Once the cells were attached to the bottom of the dish, the medium was
removed before adding 100 µL of the VS, drop by drop, on top of the monolayer of cells.
Afterwards, 10 mL of fresh TNM-FH + 10% FBS were added and the culture was incubated at
28 ºC for 7 days. The viral suspension was harvested, centrifuged for 5 minutes at 1,000 xg in
a swing bucket centrifuge to remove cell debris, and the supernatant stored at 4 ºC before
titering (Jarvis DL and Garcia A Jr, 1994).
The HVVS were produced by seeding 3x107 cells on a 160 mm culture dish, with 30 mL of
TNM-FH + 10% FBS. The cells were allowed to adhere to the bottom of the dish for 1 hour
before removing the medium and infecting the culture with the appropriate volume of MSV,
corresponding to a MOI of 0.1. Afterwards, 30 mL of fresh TNM-FH + 10% FBS were added to
the dish, and the culture was left in a 28 ºC incubator for 7 days. Finally, the viral suspension
was harvested, centrifuged for 5 minutes at 1,000 xg in a swing bucket centrifuge, and the
supernatant stored at 4 ºC before titering.
3.4.6. Titering of viral suspensions.
The concentration of infective viruses in a suspension can be determined using a variant of
the limit dilution method described by Reed and Muench (1938). This method yields a value for
the 50% tissue-culture infectious dose (TCID50), which is the dilution at which 50% of the
inoculated cultures become infected. The TCID50 of a viral suspension can be converted into a
titer expressed as pfu/mL applying a Poisson distribution.
Titering was performed seeding cells from a suspension culture growing in log phase in 96-
well culture plates at a density of 8x103 cells/well and incubating the plates for 1 h at 28 ºC to
allow cells to adhere to the bottom of the wells. Meanwhile, serial ten-fold dilutions of the viral
suspension were prepared, from 10-5 until 10-16. Afterwards, 10 µL of each dilution were added
to 12 wells and the plate was left for 6 days at 28 ºC.
At the end of the process, each well was observed through an inverted microscope and the
number of infected wells for each dilution was determined. With these numbers, the TCID50
value and the titer in pfu/mL was calculated.
Material and methods____________________________________________________________
80
3.4.7. Production assays.
Before starting large-scale protein productions, the best conditions of MOI and production
time had to be determined for each recombinant protein. Usually, protein productions are
initiated infecting a culture with a high MOI (1-10) to ensure a high protein synthesis rate and a
rapid increase of the recombinant protein levels in the culture medium. The main disadvantage
of this strategy is the also high rate of cell lysis of the culture, which implies a significant
release of contaminants and proteases.
Combinations of MOI values of 2.5 and 10, and production times of 72, 96 and 120 hours
were tested for each protein to produce. Note that the production time was started counting
once the culture medium was changed by serum-free TNM-FH, what was done 24 hours p.i.
To perform a production assay, cells from a suspension culture growing in log phase were
seeded on 24-well culture plates at a density of 5x105 cells/well. Plates were then left for 1 hour
at 28 ºC to allow the cells to adhere to the bottom of the wells. The medium was removed and
the proper volume of HVVS was added to 16 of the wells before adding 500 µL of fresh TNM-FH
+ 10% FBS. Eight wells were infected with a MOI of 2.5, and the other eight wells with a MOI
of 10. The remaining wells were left uninfected to serve as a negative control. After 24 hours of
incubation at 28 ºC, the cells were washed twice with serum-free TNM-FH which was finally
replaced by 500 µL of serum-free TNM + 10% FBS + 2 mM L-glutamine. At this point the
production time started counting.
72 hours later, the medium of two wells infected with MOI 2.5 and two wells infected with
MOI 10 was harvested, centrifuged for 5 minutes at 1,000 xg, and the supernatants were
stored at -20 ºC for its further analysis. Every next 24 hours, the medium of two wells for each
MOI was harvested in the same way. The negative controls were harvested together with the
samples corresponding to a 120 hour production time.
400 µL of each sample were precipitated with trichloroacetic acid (see Appendix I, section
AI.5.1) and analyzed by SDS-PAGE and Western blot (see sections 3.5.1 and 3.5.2).
3.4.8. Large-scale protein production.
Once the optimal conditions of MOI and production time have been established, the goal
proteins can be produced at large scale. For this purpose, cells from a suspension culture
growing in log phase were seeded in T-175 cm2 culture flasks at a density of 4 x 107 cells/flask.
Once the cells had adhered to the bottom of the flasks, the medium was removed and the cells
were infected with the proper volume of HVVS to achieve the MOI selected by the previous
production assay. 40 mL of fresh TNM-FH + 10% FBS were added to each flask.
____________________________________________________________Material and methods
81
After 24 hours of incubation at 28 ºC, the cells were washed twice with serum-free TNM-FH
and, at the end, 40 mL of serum-free TNM-FH + 2 mM L-glutamine were added to each flask.
The cultures were then left in a 28 ºC incubator until the optimal production time was reached.
At this moment, the medium was harvested and centrifuged for 10 min at 1,000 xg in a swing
bucket centrifuge. In case the supernatant was not directly used for protein purification, it was
stored at -80 ºC.
3.4.9. Purification of rhBMP-6 produced in Sf9 cells.
The rhBMP-6 produced in Sf9 cells was purified by its natural affinity to heparin, using 1 mL
HiTrap™ Heparin HP columns (Amersham Biosciences / GE Healthcare). Because of the strong
tendency towards aggregation of this protein, the entire process was carried out in presence of
6 M urea to prevent it from precipitating inside the column or in the elution fractions. Therefore,
urea was dissolved directly into the conditioned medium to reach a 6 M concentration. Before
passing this sample through the column, it was filtered through a 2 mL Sephadex® G25 column
to eliminate any possible precipitates and/or particles.
The entire purification was performed using a BioLogic Duo Flow chromatographer (Biorad),
at room temperature, and at a flow rate of 1 mL/min. First, the column was equilibrated with 5-
10 mL of serum-free TNM-FH + 6 M urea before loading the sample (100-500 mL). Once the
sample had entirely passed through the column, the latter was washed with 10 mL BMP-
washing buffer (50 mM MES, pH 5.5, 6 M urea, 0.15 M NaCl) prior to eluting the proteins.
Elution of the retained proteins was induced by increasing the conductivity in the column.
In some cases, this was done using a linear gradient from BMP-washing buffer + 0.15 M NaCl
to 1 M NaCl, and in other cases a two-step elution was performed (a first step elution with BMP-
washing buffer + 0.43 M NaCl and a second step elution with BMP-washing buffer + 1 M NaCl).
The elution fractions were analyzed by Western dot-blot (see section 3.5.3) to identify those
containing the protein of interest.
To obtain the proteins in their native, active forms, the urea and the excess of NaCl had to
be removed from the samples. To achieve this, different strategies were tried:
1. Samples were directly dialyzed for at least 4 hours against DMEM, pH 7.0.
2. Samples were directly dialyzed for at least 4 hours against DMEM, pH 4.9.
3. Samples were directly dialyzed for at least 4 hours against 4 mM HCl.
4. Samples were dialyzed for at least 4 hours against 10 mM ammonium acetate, pH 4.0,
subsequently lyophilized and resuspended in sterile, highly pure water.
Material and methods____________________________________________________________
82
5. Samples were dialyzed for at least 4 hours against 10 mM ammonium acetate, pH 4.0,
subsequently lyophilized and resuspended in sterile, highly pure water with 0.1% BSA.
6. Samples were dialyzed for at least 4 hours against 10 mM ammonium acetate, pH 4.0,
subsequently lyophilized and resuspended in 4 mM HCl.
7. Samples were dialyzed for at least 4 hours against 10 mM ammonium acetate, pH 4.0,
subsequently lyophilized and resuspended in 4 mM HCl, 0.1% BSA.
8. Samples (2 mL) were loaded on Vivaspin 2 columns (GE Healthcare) and centrifuged at
10,000 xg at room temperature to reduce their volume. Then, 4 mM HCl was added to
the column to dilute the urea and the NaCl of the sample. These steps were repeated
until the urea and NaCl concentration was below 5 mM and the volume of the sample
was reduced to, approximately, 0.5 mL.
The biological activity of all the samples was tested in vitro on C2C12 mouse myoblasts
(section 3.7.1), using serial dilutions of the samples from 1/2 to 1/1024 in DMEM + 2% FBS.
3.4.10. Purification of rh-bFGF and rh-bFGF-CBD produced in Sf9 cells.
The rh-bFGF and rh-bFGF-CBD produced in Sf9 cells were purified by its natural affinity to
heparin, using 1 mL HiTrap™ Heparin HP columns (Amersham Biosciences / GE Healthcare).
Before passing the samples through the column, they were pre-filtered through a 2 mL
Sephadex® G25 column to eliminate any possible precipitates and/or particles.
The entire purification was performed using a BioLogic Duo Flow chromatographer (Biorad),
at room temperature, and at a flow rate of 1 mL/min. The column was first equilibrated with 5-
10 mL of serum-free TNM-FH before loading the sample (250 mL). Once the sample had
entirely passed through the column, the latter was washed with 10 mL FGF-washing buffer
(20 mM Tris, pH 7.1, 1 mM EDTA, 1 mM DTT, 0.15 M NaCl) prior to eluting the proteins.
Elution of the retained proteins was induced by increasing the conductivity in the column
using a 60 mL linear gradient from FGF-washing buffer + 0.15 M NaCl to 2 M NaCl, harvesting
1 mL elution fractions.
The elution fractions were analyzed by Western dot-blot (see section 3.5.3) to identify
those containing the protein of interest. Similar elution fractions were then reunited and treated
for removal of excess of NaCl. For this purpose, the samples were loaded on Vivaspin 2 columns
(GE Healthcare) and centrifuged at 10,000 xg, 20 ºC until the volume was reduced to
approximately 0.3 mL. Sterile PBS, pH 7.3, 1 mM EDTA, 1 mM DTT was added to the column to
dilute the salt concentration in the sample, being these steps repeated until the NaCl
concentration in the samples was below 20 mM and the total volume was reduced to
approximately 0.3 mL.
____________________________________________________________Material and methods
83
3.5. Biochemical analysis of the produced proteins.
3.5.1. SDS-PAGE.
Analysis of the production, refolding and/or renaturation of the proteins was performed by
sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS-PAGE), following the method
described by Laemmli (1970).
Samples were diluted 1:1 in 2x SDS-PAGE Sample Buffer and heated at 95 ºC for 5 minutes
in a dry block heating thermostat prior to loading them into a 90x60x0.75 or 90x60x1.50
(mm WxHxT) gel. Polyacrylamide concentration of the gels was usually 12.5% for BMP-6
analysis, and 15.0% for bFGF analysis. In case the presence of disulfide bonds in the proteins
needed to be determined, DTT was added to the Sample Buffer to a final concentration of
135 mM. Besides the samples, one well of each gel was used for loading 10 µg of a commercial
mixture of molecular mass standard proteins: myosin (200.00 KDa), β-galactosidase
(116.25 KDa), phosphorylase b (97.40 KDa), BSA (66.20 KDa), ovoalbumin (45.00 KDa),
carbonic anhydrase (31.00 KDa), soybean trypsin inhibitor (21.50 KDa), lysozyme (14.40 KDa)
and aprotinin (6.50 KDa) (BioRad).
Electrophoresis was performed at 200 Volt, at room temperature, for approximately 1 hour,
in Laemmli Running Buffer. Once the electrophoretic separation of the samples was finished,
proteins in the gel were stained with Coomassie Blue (see Appendix I, section AI.5.3) or
transferred to a PVDF membrane for Western Blot analysis (see section 3.5.2).
3.5.2. Western blot.
After their electrophoretic separation, proteins in the gel were transferred to a PVDF
membrane following the method described by Towbin H et al. (1979). For the detailed protocol
see Appendix I, section AI.5.4.
Transference was performed at 100 mA, at room temperature, for approximately 3 hours,
in transference buffer. Once the transference was completed, the lane corresponding to the
molecular mass standard proteins was stained with amido black (see Appendix I, section
AI.5.5), while the membrane with the transferred samples was immunostained (see Appendix I,
section AI.5.6).
Material and methods____________________________________________________________
84
3.5.3. Dot blot.
In some cases, protein samples were not separated electrophoretically before
immunostaining, but loaded directly onto a PVDF membrane. This permits identification of the
goal protein within a sample, without determining its molecular mass.
For dot blotting, 10 µL of each sample was directly pipetted as a spot onto a PVDF sheet,
previously activated with methanol and washed with PBST. Once the drop of sample was
absorbed by the membrane, the samples were treated for immunostaining as described in
Appendix I, section AI.5.6.
3.6. Collagen-binding affinity test.
In order to test the affinity of the growth factors to collagen in the form of absorbable
collagen sponges (ACS), a method described by T. Kitajima was used (Kitajima T et al., 2007).
An ACS sheet (obtained from highly pure, bovine skin-derived, native collagen; kindly provided
by Dr. M. E. Nimni; US patent 5374539) was cut into discs (5 mm diameter, 1 mm thickness;
Fig. 23) and washed with PBST (PBS + 0.1% Tween-20). Each disc was impregnated with
10 µL of a solution containing 1.25 pmol of each growth factor, and incubated for 2 hours at
37 ºC. Afterwards, the ACS discs were washed with PBST for 1 hour to remove the unbound
molecules and immunostained with an anti-bFGF antibody as described for immunostaining of
proteins on PVDF in Appendix I, section AI.5.6.
To test the stability of the binding to collagen, the same protocol was used, but the
washing step after binding of the proteins to the ACS was prolonged for 6 days before
immunostaining, with the PBST being renewed twice every day. This washing was performed at
4 ºC to minimize protein loss by degradation.
Quantification of the amount of proteins bound to the collagen sponges was done using
digital image analysis with the free software program ImageJ (Rasband, WS., ImageJ, U.S.
National Institute of Health, Bethesda, Maryland, USA; http://rsb.info.nih.gov.ij), version 1.38x.
A circular area of approximately 5 mm diameter was placed on the centre of each spot and the
pixel density within that area was measured and used for comparison between the different
sponges. The background of the image, corresponding to the measurement of pixel density on
the negative control sponge, was subtracted from all the other obtained values for graphic
representation of the data.
____________________________________________________________Material and methods
85
Figure 23. Real size photograph of the absorbable collagen sponge discs used for the collagen-binding affinity tests and for the in vivo heterotopic bone formation assay.
3.7. In vitro biological activity tests.
3.7.1. Induction of ALP expression on C2C12 mouse myoblasts.
C2C12 mouse myoblasts were cultured as monolayers in 175 cm2 culture flasks with
Dulbecco's Modified Eagle's Medium (DMEM) supplemented with 10% foetal bovine serum
(FBS) and 2 mM L-glutamine, at 37 ºC in a humidified atmosphere with 5% CO2 (standard
conditions). Cells were subcultured when 65-75% confluence was reached, by detaching them
with 5 mL of a 0.25% trispin, 0.03% EDTA solution and diluting the cells 1:6 in fresh medium.
C2C12 cells are known to transdifferentiate from the myoblastic to the osteoblastic lineage
in presence of BMPs, which induce the expression of osteogenic markers, such as alkaline
phosphatase, in these cells. A method described by Katagiri T et al. (1994) was used to test the
biological activity of rhBMP-6. For this purpose, 30,000 cells/well were seeded on 96-well
culture plates with DMEM + 10% FBS, and incubated for 3 hours under standard conditions.
Afterwards, the medium was removed from the wells, replaced by DMEM + 2% FBS and the
cells incubated with this medium for another hour. The medium was again removed, replaced
by 100 µL of DMEM + 2% FBS containing the rhBMP-6 to test, and the cells were incubated for
72 hours under standard conditions.
After this time, the cells were washed with PBS and 100 µL of p-nitrophenyl phosphate
(p-NPP, Sigma Fast™) was added to each well. After 5-15 minutes of incubation under standard
conditions, the reaction was stopped by addition of 100 µL 0.1 M NaOH and the OD405 in each
well was measured using an ELISA plate reader. Finally, the OD405 values obtained were
transformed into U/L.
As a positive control, commercial rhBMP-6 produced in CHO cells (R&D Systems) was used.
Material and methods____________________________________________________________
86
3.7.2. Proliferation assay on MC3T3-E1 mouse preosteoblasts.
MC3T3-E1 mouse preosteoblasts were cultured as monolayers in 175 cm2 culture flasks
with alpha-Minimum Essential Medium (alpha-MEM) supplemented with 10% fetal bovine serum
(FBS) and 2 mM L-glutamine, at 37 ºC in a humidified atmosphere with 5% CO2 (standard
conditions). Cells were subcultured when 65-75% confluence was reached, by detaching them
with 5 mL of a 0.25% trispin, 0.03% EDTA solution and diluting the cells 1:4 in fresh medium.
To test the ability of rh-bFGF and rh-bFGF-CBD to induce proliferation of these cells, a
method based on the cleavage of the tetrazolium salt MTT to formazan crystals by metabolic
active cells was used (Vistica DT et al., 1991). When cells are incubated with the yellow MTT
solution, this tetrazolium salt is cleaved inside the mitochondria, yielding purple, insoluble
formazan salt crystals. These crystals can be solubilized and spectrophotometrically quantified
using an ELISA reader. An increase in number of living cells results in an increase of the total
metabolic activity in the sample, and this increase directly correlates to the amount of purple
formazan crystals formed.
For this purpose, 10,000 cells/well were seeded on 96-well culture plates with alpha-MEM +
2 mM L-glutamine + 10% FBS, and incubated for 3 hours under standard conditions.
Afterwards, the medium was removed from the wells, replaced by alpha-MEM +
2mM L-glutamine + 2% FBS and the cells incubated with this medium for another hour. The
medium was again removed, replaced by 100 µL of alpha-MEM + 2 mM L-glutamine + 2% FBS
containing the rh-bFGF or the rh-bFGF-CBD to test, and the cells were incubated for 72 hours
under standard conditions.
After this time, 10 µL of MTT labelling reagent (final concentration of 0.5 mg/mL) was
added to each well and the cells were incubated for 4 hours under standard conditions to allow
them to form the formazan crystals. Finally, 100 µL of solubilization solution was added to each
well and the plates were left overnight at 37 ºC to ensure complete lysis of the cells and
solubilization of the formazan crystals. The OD570 of the wells was measured using an ELISA
plate reader and the values transformed into number of cells by interpolation into a standard
curve. Commercially available rh-bFGF (R&D Systems) was used as a positive control.
3.7.3. Inhibition of differentiation assay on MC3T3-E1 mouse
preosteoblasts.
This assay was performed to test the ability of rh-bFGF and rh-bFGF-CBD to inhibit the
differentiation of MC3T3-E1 cells into the osteogenic lineage induced by ascorbic acid. Under
limitant serum conditions and in the presence of ascorbic acid, these cells are known to stop
____________________________________________________________Material and methods
87
proliferating and initiate their osteogenic differentiation, while the presence of bFGF should
partially block this differentiation.
For this purpose, 10,000 cells/well were seeded on two 96-well culture plates with alpha-
MEM + 2 mM L-glutamine + 10% FBS + 0.2 mM L-ascorbic acid, and incubated for 3 hours
under standard conditions. Afterwards, the medium was removed from the wells, replaced by
alpha-MEM + 2 mM L-glutamine + 2% FBS + 0.2 mM L-ascorbic acid and the cells were
incubated with this medium for another hour. The medium was again removed, replaced by
100 µL of alpha-MEM + 2 mM L-glutamine + 2% FBS + 0.2 mM L-ascorbic acid containing the
rh-bFGF or the rh-bFGF-CBD to test, and the cells were incubated for 120 hours under standard
conditions. One of the plates was used for determination of the number of cells per well by MTT
labelling, as described in section 3.7.2, while the other plate was used for measurement of ALP
activity, as described in section 3.7.1. Finally, the ALP activity per cell was calculated.
3.8. In vivo heterotopic bone formation assay.
To evaluate the biological activity of the rh-bFGF and rh-bFGF-CBD produced in Sf9 insect
cells and their capacity to enhance bone formation in combination with BMP-6, a heterotopic
bone formation assay in rats was used.
For this purpose, an ACS sheet (obtained from highly pure, bovine skin-derived, native
collagen; kindly provided by Dr. M. E. Nimni; US patent 5374539) was cut into discs (5 mm
diameter, 1 mm thickness). Under sterile conditions, 10 µL of growth factor solution, containing
13.89 pmol (0.5 µg) dimeric rh-BMP-6, 1.25 pmol rh-bFGF or rh-bFGF-CBD, or a combination of
both growth factors were loaded on each disc. A set of discs loaded with 10 µL of sterile PBS
was used as a negative control (n=4, for each assayed condition). The assayed conditions are
summarized in Table 8.
Six, four months old, male Wistar rats with a weight of 250-280 g were used for this study.
Animals were anesthetized by an intraperitoneal injection of 2,2,2-tribromo-ethanol (1% in
0.9% NaCl), using 1 mL of anaesthetic solution per 100 g animal weight. Once anesthetized,
the dorsal skin of the animals was disinfected with 70% ethanol and shaved. An incision was
made along the dorsal midline of the skin to expose the underlying dorsal muscles and small
cuts were made in the epimysium and the dorsal muscles to form a small muscular pocket. The
collagen sponges were randomly introduced in these pockets (Fig. 24), the epimysium was
sutured, the skin closed with surgical clamps and the wound disinfected once more with iodine.
Animals were housed in individual cages, with full access to standard food and water, a
controlled temperature of 20±2 ºC and a 12 hour-photoperiod. 21 days later, the animals were
sacrificed by CO2 inhalation and the implants dissected for histological analysis.
Material and methods____________________________________________________________
88
Condition rhBMP-6 rh-bFGF
(R&D Systems) rh-bFGF rh-bFGF-CBD
1 ●
2 ●
3 ●
4 ●
5 ● ●
6 ● ●
7 ● ●
8 (C-)
Table 8. Combinations of growth factors tested by the heterotopic bone formation assay in rats.
Animal housing and experimentation were carried out according to international
(86/609/EU, 2003/65/CE, 2007/526/CE) and national (RD 1201/2005, LEY 32/2007) laws
concerning animal welfare and scientific experimentation, and were approved by the Committee
for Ethics in Investigation of the University of Málaga.
Figure 24. Implantation of ACS loaded with growth factors into the dorsal muscles of rats for the heterotopic bone formation assay. Asterisk: ACS implanted into a muscular pocket.
3.9. Histological analysis of the implanted ACS.
The dissected implants were fixed with 3.7-4% buffered formaldehyde for 24 hours. After
fixation, the implants that contained rhBMP-6 were decalcified for 4 hours prior to dehydration,
while the rest of the implants were directly dehydrated and embedded in paraffin (see
Appendix I, section AI.6.1).
The samples were transversally cut into 10 µm-thick sections with help of a microtome and
these were placed on poly-L-lysine coated glass slides and incubated at 37 ºC for drying.
*
____________________________________________________________Material and methods
89
3.9.1. Histochemical stains.
The following histochemical stains were used for analysis of the samples:
Hematoxylin-Eosin. For simple observation of the tissue samples, these were stained
with hematoxylin and eosin (H-E), as detailed in Appendix I, section AI.6.2. By this staining
method, the osteoid appears light pink, while mineralized bone gains a dark pink colour.
Masson’s trichrome. The Masson’s trichrome staining uses three stains to differentiate
muscle, collagen fibers, reticulin and erythrocytes. By use of this technique, the nuclei appear
black, the cytoplasm, muscle and erythrocytes appear red and the collagen and reticulin fibers
appear green. The staining protocol is detailed in Appendix I, section AI.6.3.
Alcian blue. This stain binds to acid and sulphated residues of the glycosaminoglycans
present in the cartilaginous matrix, giving cartilage a bluish colour, while the rest of the tissues
remain unstained. See Appendix I, section 6.4.
3.9.2. Immunohistochemistry.
For determination of the expression of the osteogenic marker osteopontin in the tissue
samples, immunohistochemistry with a specific anti-osteopontin antibody was performed. The
detailed protocol for tissue immunostaining can be found in Appendix I, section AI.6.5.
3.10. Statistical analysis.
All statistic analyses were performed using SigmaStat version 3.1 (Systat Software Inc., San
Jose, CA, USA). Student’s t-test was applied for paired samples comparisons. For multiple
comparison tests, a one-way ANOVA (Holm-Sidak test) was performed.
90
Appendix I. Protocols and recipes.
91
92
__________________________________________________Appendix I. Protocols and recipes
93
AI.1. Buffers of general use.
PBS, 0.1 M:
Na2HPO4 • 2H2O 1.9 g/L
KH2PO4 0.43 g/L
NaCl 7.2 g/L
pH 7.3.
Tris-PBS, 0.1 M:
Na2HPO4 • 2H2O 1.48 g/L
KH2PO4 0.48 g/L
NaCl 7.0 g/L
Tris 5.0 g/L
NaN3 0.2 g/L
pH 7.8.
AI.2. Recombinant DNA technology.
AI.2.1. Total RNA isolation.
Isolation of total RNA content from eukaryotic cells was performed using a commercial kit
(Nucleospin® RNA II, Clontech), following the manufacturers instructions.
The ARN yield of each purification was measured according to the OD260 of the sample,
applying the formula:
[ARN](µg/mL) = OD260 x 40 x dilution factor
The purity and quality of the sample was estimated both by spectrophotometry and RNA
electrophoresis (see Appendix I, section AI.2.6). For spectrophotometric analysis, the
OD260/OD280 relation was calculated. A sample was considered free of contaminant proteins
when this coefficient was higher than 1.8.
Appendix I. Protocols and recipes__________________________________________________
94
AI.2.2. Reverse transcription – polymerase chain reaction.
RT-PCR on the isolated total RNA samples was performed using a commercial kit (Titan™
One Tube RT-PCR System, Roche), which allows sequential retrotranscription and PCR in the
same reaction tube. The list of oligonucleotides used can be found in section AI.2.13.
A first 30 minutes step at 55 ºC allowed synthesis of the cDNA (RT), while a second, 35-
cycle, step is used for amplification of dsDNA (PCR). In the last 25 cycles, the elongation time
had a 5 second/cycle increase.
1) X sec = 60 seconds + ∆ 5 sec/cycle
AI.2.3. Polymerase chain reaction.
PCR reactions were prepared using the 5Prime MasterMix system. For each reaction (25 µL
total volume), 11.5 µL sterile water, 10 µL 5Prime MasterMix, 2.5 µL DNA sample and 0.5 µL of
each 25 pM oligonucleotide solution were mixed in a 0.2 mL PCR tube. PCR was performed
using the Ta specified for each oligonucleotide pair. The oligonucleotides used are listed in
section AI.2.13.
94 ºC 94 ºC 94 ºC 30 sec 30 sec
68 ºC 68 ºC 68 ºC
x10 cycles x25 cycles
1 min 2 min 30 sec Ta 30 sec Ta
55 ºC
30 min
X sec1 7 min
94 ºC 94 ºC 1 min
72 ºC 72 ºC
x30 cycles
1 min 7 min 2 min 1 min Ta
__________________________________________________Appendix I. Protocols and recipes
95
AI.2.4. Plasmid purification.
For isolation of plasmidic DNA from bacterial cultures a commercial kit (GFX™ Micro Plasmid
Prep Kit, Amersham Biosciences) was used, following the manufacturers instructions. The DNA
yield of each purification was roughly measured by semi-quantitative DNA electrophoresis (see
Appendix I, section A.2.5), comparing the intensity of the plasmid bands with the bands of the
molecular mass standard, each of which contains a known amount of DNA.
AI.2.5. DNA electrophoresis.
DNA electrophoresis was used to visualize any DNA sample (estimation of plasmid yield
after plasmid isolation, evaluation of restriction analyses, analysis of PCR products, etc.).
Gels were prepared by dissolving agarose (1.5% for plasmid visualization or 0.8% for PCR
products visualization) in TAE buffer (40 mM Tris, 20 mM sodium acetate, 1 mM EDTA) with
help of a microwave oven. Ethidium bromide was added to a final concentration of 0.5 µg/mL
and the solution was poured into a gel caster. Once the gel had solidified, it was transferred to
a horizontal electrophoresis chamber filled with TAE buffer.
The samples were prepared by addition of a proper volume of 6x DNA loading buffer
(0.25% (w/v) bromophenol blue, 0.25% (w/v) xylene cyanole, 30% (v/v) glycerol) and loaded
into the wells of the agarose gel. Lambda phage DNA cut with HindIII endonuclease (Sigma-
Aldrich) was used as molecular mass standard for plasmid visualization, while a mixture of low
molecular mass DNA fragments (precision molecular mass standard, BioRad) was used when
running PCR products.
Electrophoretical separation of the samples was performed at 70-100 Volt during 30-90
minutes, and bands were observed by placing the gel on an ultraviolet-light transilluminator.
For detailed analysis, the gel was photographed with help of a gel documentation system
(UVItec).
AI.2.6. RNA electrophoresis.
For RNA visualization, the samples were ran on a denaturing agarose gel. The presence of
formaldehyde and formamide in the gel denatures the secondary structures that most RNA form
via intramolecular base pairing, allowing RNA molecules to migrate strictly according to their
size.
Appendix I. Protocols and recipes__________________________________________________
96
Gels were prepared by dissolving 0.3 g agarose in a mixture of 25 mL DEPC-treated, sterile
water, 2 mL 37% formaldehyde and 3 mL sterile 10x MESA buffer (200 mM MOPS, 10 mM
EDTA, 50 mM sodium acetate, pH 7.0), by heating in a microwave oven. Ethidium bromide was
added to a final concentration of 0.5 µg/mL and the solution was poured into a gel caster. Once
the gel had solidified, it was transferred to a horizontal electrophoresis chamber filled with 1x
MESA buffer (20 mM MOPS, 1 mM EDTA, 5 mM sodium acetate, pH 7.0).
The samples were prepared by addition of 3.45 volumes of RNA loading buffer (0.25%
(w/v) bromophenol blue, 50% (v/v) formamide, 6.5% (v/v) formaldehyde, 6% (v/v) glycerol,
10% 10x MESA buffer), denatured for 5 minutes at 70 ºC in a dry block heating thermostat and
loaded into the wells of the agarose gel.
Electrophoretical separation was performed at 70 Volt during 45 minutes, and bands were
observed by placing the gel on an UV light transilluminator. For detailed analysis, the gel was
photographed with help of a gel documentation system (UVItec).
AI.2.7. DNA purification from agarose gels.
For purification of a DNA sample previously separated electrophoretically, the agarose gel
was placed on a 312 nm UV transilluminator to allow visualization of the bands. The band of
interest was cut out with help of a surgical blade and the obtained piece of agarose was
weighed. To remove agarose and ethidium bromide from the sample, a commercial purification
kit (GFX™ PCR DNA and Gel Band Purification Kit, Amersham Biosciences) was used, following
the manufacturers instructions.
AI.2.8. DNA digestion with endonucleases.
Endonuclease enzymes for digestion of DNA molecules were from Amersham Biosciences.
1/10 of the final reaction volume (generally 50 µL) of the proper 10x restriction buffer was
added to the DNA solution. In case the enzyme needed the presence of 0.01% BSA and/or
0.01% Triton X-100, these supplements were also added to the reaction. The volume of the
reaction was adjusted with sterile MilliQ water. A suitable amount of enzyme (10-15 U/µg DNA)
was added, never exceeding the volume of enzyme stock used 1/20 of the reaction volume.
The tubes containing the endonuclease reaction were incubated for at least 2 hours in a 37 ºC
(30 ºC for BamHI restriction) water bath.
Simultaneous digestions with two different endonucleases were only performed when both
enzymes required the same restriction buffer. Else, the DNA was first cut with one enzyme,
__________________________________________________Appendix I. Protocols and recipes
97
purified using a commercial kit (GFX™ PCR DNA and Gel Band Purification Kit, Amersham
Biosciences) or precipitated, and finally cut with the second enzyme.
The composition of the different 10x restriction buffers can be found below.
10x L restriction buffer: 100 mM Tris-HCl, pH 7.5, 100 mM MgCl, 10 mM Dithiothreitol.
10x M restriction buffer: 100 mM Tris-HCl, pH 7.5, 100 mM MgCl, 10 mM Dithiothreitol,
500 mM NaCl.
10x H restriction buffer: 500 mM Tris-HCl, pH 7.5, 100 mM MgCl, 10 mM Dithiothreitol,
1 M NaCl.
10x K restriction buffer: 200 mM Tris-HCl, pH 8.5, 100 mM MgCl, 10 mM Dithiothreitol,
500 mM NaCl.
10x T restriction buffer: 330 mM Tris-acetate, pH 7.9, 100 mM Mg-acetate, 5 mM
Dithiothreitol, 660 mM K-acetate.
AI.2.9. DNA precipitation.
For precipitation of DNA in an aqueous solution, 1/10 volume of 3 M sodium acetate, pH 5.2
and 2.5 volumes of pre-chilled absolute ethanol were added to the sample. The sample was
then incubated at -80 ºC for at least 30 minutes before centrifuging at 15,000 xg for 15
minutes at 4 ºC to precipitate de nucleic acids. The supernatant was removed and the DNA
pellet was washed with 500 µL of cold 70% ethanol. The sample was again centrifuged under
the same conditions, ethanol was removed and the pellet was left air-drying before
resuspending it in a suitable volume of MilliQ water.
AI.2.10. DNA ligation.
Ligation of cohesive-ended fragments of DNA into digested plasmids was performed using
the T4 DNA ligase (Usb Corporation). The ligation reactions were prepared by mixing 50 ng of
plasmid with a proper volume of the fragment solution to reach a 1:3 or 1:6 molar proportion.
1 µL (1 U) of T4 DNA ligase and sterile MilliQ water were added to the mixture to complete
10 µL of reaction volume. Different negative controls were prepared for testing both the
plasmid digestion-efficiency and the DNA ligase activity. One control lacked the fragment
(C- VL) and another control lacked both the enzyme and the fragment (C- V).
All reactions were placed in a 16 ºC water bath for 16 hours. After this time, 1 µL of each
sample and each control was used for transformation of E. coli DH5α (see Appendix I, section
AI.3.4). Another aliquot was transformed with 5 ng of non-digested plasmid (C- P). 200 µL of
Appendix I. Protocols and recipes__________________________________________________
98
each transformed bacterial aliquot were plated on a LB agar dish and incubated overnight at
37 ºC. The next day, the number of colonies grown on each dish was counted.
The colonies grown on the dish corresponding to the C- V are due to plasmid copies that
had remained circular (i.e. that have not been cut with any endonuclease). Comparing this
number with the number of colonies grown on the C- P dish, a percentage of non-digestion can
be calculated:
% Non-digestion = (C- V) x 100 / (C- P)
On the other hand, the number of colonies grown on the C- VL dish can be used to
calculate the percentage of plasmid copies that had been double-digested:
% Double digestion = 100 – [ (C- VL) x 100 / (C- P) ]
AI.2.11. DNA sequencing.
Sequencing of DNA fragments was performed by the Nucleic Acid Sequencing Service at the
University of Málaga.
AI.2.12. Plasmids.
The plasmids used in this work were:
pBlueScript® II SK(+): Fig. 25. Abbreviated pBIISK, this phagemid is a vector used for
routine cloning and sequencing procedures. The MCS is located inside a lacZ gene fragment,
allowing blue-white screening for plasmids with an insert when using strains containing
lacZ∆M15 on an F’ episome. Bacteria containing wild-type pBSIIK copies will produce blue
colonies when grown in presence of IPTG and X-gal, while bacteria containing the plasmid with
a cloned insert will produce white colonies under the same conditions, due to disruption of the
lacZ gene by the insert.
__________________________________________________Appendix I. Protocols and recipes
99
Figure 25. The pBlueScript® II SK(+) vector.
pET17b: Fig. 26. This plasmid is specifically designed for protein expression in E. coli. The
target gene is cloned under control of bacteriophage T7 transcription and translation signals.
When an expression host, carrying a chromosomal copy of the T7 RNA polymerase gene under
lacUV5 control, is transformed with this plasmid, target protein expression can be induced by
IPTG addition.
Figure 26. The pET17b expression vector.
pBIISK (+)
3.0 Kbp
ampR
(1976-2833)
pUC ori (1158-1825)
Plac
Kpn I (653) Xho I (668) Sal I (674) Hind III (689) EcoR V (695) EcoR I (701) Pst I (707) Sma I (713) BamH I (719) Spe I (725) Xba I (731) Not I (737) Eag I (738) BstX I (744) Sac II (747) Sac I (755)
MCS
f1 ori (135-441)
lacZ’
PT7
Xho I (141) Not I (147) BstX I (160) EcoR V (166) EcoR I (174) BstX I (186) Spe I (199) BamH I (205) Ban II (215) Sac I (215) Kpn I (221) Hind III (223) Nhe I (261) Nde I (268) Xba I (306)
MCS
pET17b
3.3 Kbp
ampR
(2241-3098)
ori (1480)
Appendix I. Protocols and recipes__________________________________________________
100
pACGP67B: Fig. 27. This plasmid is a shuttle vector for transferring heterologous genes
into baculoviral DNA. It contains the gp67 signal sequence in front of the MCS, and the target
protein will be expressed as a gp67 signal peptide fusion protein under the control of the
baculovirus polyhedrin promoter. Baculovirus DNA flanking the MCS allow homologous
recombination with the baculovirus genome when co-transfected into insect cells.
Figure 27. The pAcGP67B shuttle vector.
AI.2.13. Oligonucleotides.
The oligonucleotides used in this work were:
NUMBER FULL NAME SEQUENCE DESCRIPTION
P1 T7 Promoter Primer 5'-TAATACGACTCACTATAGGG-3' Hybridizes with the pET17b plasmid, upstream of the MCS.
P2 T7 Terminator Primer 5'-GCTAGTTATTGCTCAGCGG-3' Hybridizes with the pET17b plasmid, downstream of the MCS.
P42 Bac1 5’-ACCATCTCGCAAATAAATAAG-3’ Hybridizes with the pAcGP67B plasmid, upstream of the MCS.
P43 Bac3 5’-TCCCAGGAAAGGATCAG-3’ Hybridizes with the pAcGP67B plasmid, downstream of the MCS.
P3 M13 Forward Primer 5’-TGTAAAACGACGGCCAGT-3’ Hybridizes with the pBIISK plasmid, upstream of the MCS.
P4 M13 Reverse Primer 5’-CAGGAAACAGCTATGACC-3’ Hybridizes with the pBIISK plasmid, downstream of the MCS.
P5 RT-BMP6-UP 5’-CCTGGTGGGCAGAGACG-3’ Antisense primer for amplification of the bmp-6 mRNA.
P6 RT-BMP6-DOWN 5’-GAACCAGCTGATCCTTTAGCC-3’ Sense primer for amplification of the bmp-6 mRNA.
P7 BamHI-BMP6-UP 5’-AAGGATCCAGGTCAGCCTCCAG-3’ Antisense primer for amplification of the
bmp-6 gene, introducing the BamHI restriction site.
pAcGP67B
9.7 Kbp
ampR
Ppolyhedrin
Col E ori
BamH I (4258) Xma I (4262) Sma I (4262) Nco I (4268) EcoR I (4274) Not I (4274) Eag I (4285) Pst I (4291) Bgl II (4295)
MCS
gp67 secretion signal
__________________________________________________Appendix I. Protocols and recipes
101
NUMBER FULL NAME SEQUENCE DESCRIPTION
P8 EcoRI-BMP6-DOWN 5’-AAGAATTCAGTTAGTGGCATCCAC AAGCTC-3’
Sense primer for amplification of the bmp-6 gene, introducing the EcoRI
restriction site.
P9 BamHI-CBDBMP6-UP
5’-AAGGATCCTGGCGCGAACCGAGCT TCATGGCTCTGAGCGGTGCTAGCAGG
TCAGC-3’
Antisense primer for amplification of the bmp-6 gene, introducing the BamHI
restriction site and the CBD sequence.
P10 EcoRI-BMP6-UP 5’-AAGAATTCAGGTCAGCCTCCAG-3’ Antisense primer for amplification of the
bmp-6 gene, introducing the EcoRI restriction site.
P11 BamHI-BMP6-DOWN
5’-AAGGATCCAGTTAGTGGCATCCAC AAGCTC-3’
Sense primer for amplification of the bmp-6 gene, introducing the BamHI
restriction site.
P12 EcoRI-CBDBMP6-UP 5’-AAGAATTCTGGCGCGAACCGAGCT TCATGGCTCTGAGCGGTGCTAGCAGG
TCAGC-3’
Antisense primer for amplification of the bmp-6 gene, introducing the EcoRI
restriction site and the CBD sequence.
P13 BglII-FGF-UP 5’- TTAGATCTGCAGCCGGGAGCATCACC-3’ Antisense primer for amplification of the
bfgf gene, introducing the BglII restriction site.
P14 EcoRI-FGF-DOWN 5’- AAGAATTCTCAGCTCTTAG CAGACATTGG -3’
Sense primer for amplification of the bfgf gene, introducing the EcoRI
restriction site.
P15 BglII-CBDFGF-UP 5’-TTAGATCTTGGCGCGAACCGAGC
TTCATGGCTCTGAGC-3’
Antisense primer for amplification of the bfgf-CBD gene, introducing the BglII
restriction site.
The restriction sites are highlighted in colours: blue = BamHI; orange = EcoRI;
green = BglII. The sequence of the CBD is highlighted in red.
The Ta used for each specific oligonucleotide pair was:
OLIGONUCLEOTIDE PAIR Ta (ºC)
P1 vs. P2 52.6
P5 vs. P6 56.0
P5 vs. P4 56.2
P10 vs. P11 58.2
P12 vs. P11 59.1
P7 vs. P8 58.2
P9 vs. P8 59.1
P42 vs. P43 54.2
P13 vs. P14 53.5
P15 vs. P14 57.2
Appendix I. Protocols and recipes__________________________________________________
102
AI.3. Protein expression in E. coli.
AI.3.1. Bacterial cell culture.
All bacterial cultures were incubated at 37 ºC. Liquid cultures were performed in shake
flasks with vigorous shaking (200-300 rpm). The volume of the culture did never exceeded 1/5
of the capacity of the flask to ensure proper oxygenation of the medium. Preparation and
manipulation of the cultures was always performed under semi-sterile conditions, using
sterilized equipment and material and working nearby a Bunsen burner.
AI.3.2. Bacterial cell culture media.
Culture medium for standard liquid culture of E. coli strains (I). Luria-Bertani (LB)
broth, composed of 5 g/L NaCl, 5 g/L yeast extract and 10 g/L tryptone, pH 7.0. This medium
was autoclaved for sterilisation. If necessary, antibiotics and/or supplements were added before
use.
Culture medium for standard liquid culture of E. coli strains (II). 2xYT broth was
used when a higher cell density or faster growth of the cultures was needed. This medium is
composed of 5 g/L NaCl, 10 g/L yeast extract and 20 g/L tryptone, pH 7.0, and was autoclaved
for sterilisation. If necessary, antibiotics and/or supplements were added before use.
Culture medium for protein production in E. coli. Terrific broth (TB), which was
prepared by mixing in a 9:1 proportion the following solutions, previously autoclaved
separately:
YTG Base:
Yeast extract 26.67 g/L
Tryptone 13.33 g/L
Glycerol 8 mL/L
B solution:
KH2PO4 23.1 g/L
K2HPO4 125.4 g/L
Medium was supplemented with antibiotics before use.
__________________________________________________Appendix I. Protocols and recipes
103
Culture medium for standard solid-phase culture of E. coli strains. Luria-Bertani
(LB) agar, composed of LB broth and 20 g/L of bacteriological European type agar. After
autoclaving, medium was cooled to a temperature below 60 ºC before adding the proper
antiobiotics and/or supplements and finally poured into sterile, 90 mm diameter, Petri dishes
(approximately 20 mL/dish). Once the medium had solidified, the dishes were stored at 4 ºC
before use.
Ampicillin was prepared as a 25 mg/mL filtered, aqueous stock solution and added to the
media to a 100 µg/mL final concentration. Chloramphenicol was prepared as a 34 mg/mL
filtered stock solution in absolute ethanol and added to the media to a 25 µg/mL final
concentration. IPTG was prepared as a 100 mg/mL filtered, aqueous stock solution and added
to the media to a 240 µg/mL (1 mM) final concentration.
AI.3.3. Bacterial strains.
All the cloning procedures and protein production were performed in Escherichia coli. The
specific strains used in this work were:
DH5α. This strain is a non-expression host, used for general purpose cloning and plasmid
propagation. It has no inherent resistance to any antibiotics.
Rosetta™ (DE3). This strain is a lactose permease (lacY) mutant, deficient in lon and
ompT proteases. It contains a plasmid encoding argU, argW, glyT, ileX, leuW, metT, proL, thrT,
thrU, and tyrU, allowing expression of genes encoding the tRNAs for rare argenine codons AGA,
AGG, and CGA, glycine codon GGA, isoleucine codon AUA, leucine codon CUA, and proline
codon CCC. This accessory plasmid also includes the chloramphenicol resistance gene. These
features make this strain suitable for heterologous protein expression.
AI.3.4. Storage of bacterial clones.
For long-term storage of a bacterial clone, a fresh-grown colony was picked from an LB
agar dish and used to inoculate a 5 mL 2xYT culture, which was incubated overnight at 37 ºC
with vigorous shaking. The next day, 1 mL of the culture was transferred to a microcentrifuge
tube and the cells were pelleted at 10,000 xg for 2 minutes. The supernatant was removed and
the cells were resuspended in 500 µl sterile filtered 50% glycerol and stored at -80 ºC.
Appendix I. Protocols and recipes__________________________________________________
104
AI.3.5. Transformation of E. coli strains.
The bacterial strains were transformed with the plasmid of interest by electroporation, by
which internalization of the plasmids by the cells, previously made competent, is triggered by
an electric impulse.
AI.3.5.1. Making of electrocompetents.
To obtain electrocompetent cells, bacteria from a glycerol stock were spread on a Petri dish
with LB agar and incubated overnight at 37 ºC to obtain single colonies. One of these colonies
was picked and used to inoculate a 10 mL LB broth culture, which was also incubated overnight
at 37 ºC. The following day, a proper volume of this culture was used to inoculate 200 mL of
fresh LB broth to obtain an initial OD600 of 0.1. This new culture was incubated at 37 ºC and its
OD600 was measured hourly until a value of 0.5 was reached. At this point, cells were harvested
by centrifugation at 15,000 xg, 15 min, 4 ºC and the pellet was resuspended in 200 mL sterile,
ice-cold milliQ water. Centrifugation was repeated three more times under the same conditions,
resuspending the cells in 100, 20 and 2 mL sterile, ice-cold milliQ water, respectively. Finally,
cells were centrifuged one more time and resuspended in 600 µL pre-chilled, sterile 10%
glycerol. This suspension was aliquoted in 40 µL fractions in microcentrifuge tubes, frozen
immediately in liquid N2 and stored at -80 ºC.
AI.3.5.2. Electroporation.
In general, 100 ng of purified plasmid was used for each electroporation. The aliquots of
competent cells were slowly thawed on ice before adding 1 µL of the 0.1 mg/mL plasmid
solution and mixing by gently pippeting. As a negative control, one aliquot of cells with 1 µL of
sterile milliQ water was used. Cells were left on ice for 1 minute before transferring to an
electroporation cuvette. Electroporation was performed at 2.5 Volt, 200 Ohm of resistance and
25 µF of capacitance. The length of the electric impuls was between 4.5 and 4.8 milliseconds.
After electroporation, each aliquot of cells was resuspended with 960 µL 2xYT (without any
antibiotics or supplemented with 25 µg/mL chloramphenicol when transforming the Rosetta™
(DE3) strain) and transferred to a sterile microcentrifuge tube. Cells were incubated for 45
minutes at 37 ºC with stirring to allow them to start synthesizing the β-lactamase enzyme,
which confers resistance to ampicillin. Finally, 50 and 200 µL of each sample were seeded on an
LB agar dish. The C- cells were pelleted for 3 minutes at 10,000 xg in a microcentrifuge,
__________________________________________________Appendix I. Protocols and recipes
105
resuspended with 100 µL 2xYT and seeded on another LB agar dish. Dishes were placed upside
down in a 37 ºC incubator and colonies were allowed to grow for at least 12 hours.
AI.3.6. Colony-PCR.
For rapid selection of colonies of transformed cells, PCR was performed directly on bacteria,
without previous plasmid isolation. PCR reactions were prepared using the 5Prime® MasterMix
system. For each reaction (50 µL total volume), a small portion of a colony was picked using
the tip of a micropipette and resuspended in 29 µL sterile water in a 0.2 mL PCR tube. 20 µL
5Prime® MasterMix and 0.5 µL of each 25 pM oligonucleotide solution were added to each tube
and gently mixed. PCR was performed using the Ta specified for each oligonucleotide pair. The
list of oligonucleotides used can be found in section AI.2.13.
The obtained PCR products were analysed by DNA electrophoresis in agarose gels (see
Appendix I, section AI.2.5).
AI.4. Eukaryotic cell culture.
Manipulation of eukaryotic cells was always done under sterile conditions, working with
sterilized material, equipment and reagents. All cultures and assays involving eukaryotic cells
were performed on a clean bench (Telstar AH100).
94 ºC 94 ºC 1 min
72 ºC 72 ºC
x25 cycles
1 min 7 min 5 min 1 min Ta
Appendix I. Protocols and recipes__________________________________________________
106
AI.4.1. Cell lines.
U-2 OS cells. ECACC, catalogue number 92022711. This human osteosarcoma cell line was
derived from a moderately differentiated sarcoma of the tibia of a 15 year old girl. U-2 OS cells
are epithelial-like and grow as an adherent monolayer in culture flasks or dishes. They are
known to express high levels of BMP-2, -4, -5, -6 and -7 (Raval P et al., 1996).
Sf9 cells. ECACC, catalogue number 89070101. This cell line was obtained from pupal
ovarian tissue of the fall armyworm Spodoptera frugiperda, by isolation of a clone of the
parental IPLB-SF21-AE cell line (Vaughn JL et al., 1977) by G. Smith and C. Cherry in 1983
(O’Reilly DR et al., 1994). Sf9 cells are highly susceptible to infection with Autographa
californica nuclear polyhedrosis virus (AcNPV), and they are widely used for the production of
recombinant proteins. Sf9 cells are spherical, and can be grown both as an adherent monolayer
in culture flasks or dishes, or as a suspension culture in spinner vessels.
C2C12 cells. ECACC, catalogue number 91031101. This mouse myoblastic cell line was
established by Yaffe D and Saxel O in 1977. C2C12 cells are fibroblast-shaped and grow as an
adherent monolayer in culture flasks or dishes. They differentiate rapidly, forming contractile
myotubes and producing characteristic muscle proteins. Treatment with BMP-2 is known to
cause a shift in their differentiation pathway from myoblastic to osteoblastic (Katagiri T et al.,
1994).
MC3T3-E1 cells. ECACC, catalogue number 99072810. This mouse preosteoblastic cell line
was established from a C57BL/6 mouse calvaria and selected on the basis of high alkaline
phosphatase activity in the resting state. MC3T3-E1 cells are fibroblast-shaped and grow as
adherent monolayers in culture flasks or dishes. They have the capacity to differentiate into
osteoblasts and osteocytes and can form calcified bone tissue in vitro.
AI.4.2. Cell culture media.
Culture medium for U-2 OS osteosarcoma cells. MacCoy’s 5A, which is the medium of
election for most osteosarcoma cell lines. This medium is bought liquid, sterile and with a pH of
6.9. Before use, 1.25 mg/L amphotericin B, 105 U/L penicillin and 100 mg/L streptomycin were
added, and the medium was supplemented with 10% (v/v) heat inactivated FBS and 2 mM
L-glutamine.
__________________________________________________Appendix I. Protocols and recipes
107
Culture medium for Sf9 insect cells. Trichoplusia ni Medium – Formulation Hink (TNM-
FH), composed of Grace Medium for insect cells supplemented with trace metals, 3.3 g/L
lactalbumin hydrolysate and 3.3 g/L yeastolate, pH 6.0. This medium is bought in powder form
and reconstituted following the manufacturers indications. Once the medium is sterilized by
filtering through a 0.22 µm filter, 2.5 mg/L amphotericin B, 105 U/L penicillin and 100 mg/L
streptomycin were added. When necessary, the medium was also supplemented with 10% (v/v)
heat inactivated FBS and/or 2 mM L-glutamine.
Culture medium for C2C12 mouse myoblasts. Dulbecco's Modified Eagle's Medium
(DMEM), which is a modification of Basal Medium Eagle (BME), containing four-fold
concentrations of the amino acids and vitamins to improve growth of primary cultures of mouse
and chicken cells. It also contains 4.5 g/L glucose and 110 mg/L sodium pyruvate. This medium
is bought liquid, sterile and with a pH value of 6.9. Before use, 1.25 mg/L amphotericin B,
105 U/L penicillin, 100 mg/L streptomycin and 2 mM L-glutamine were added. When necessary,
the medium was also supplemented with 2 or 10% (v/v) heat inactivated FBS.
Culture medium for MC3T3-E1 mouse preosteoblasts. Alpha-Minimum Essential
Medium (alpha-MEM), which is a modification of standard MEM, supplemented with vitamin B12,
non-essential amino acids, sodium pyruvate, lipoic acid and D-biotin. This medium is bought
liquid, sterile and with a pH of 6.9. Before use, 1.25 mg/L amphotericin B, 105 U/L penicillin,
100 mg/L streptomycin and 2 mM L-glutamine were added. When necessary, the medium was
also supplemented with 2 or 10% (v/v) heat inactivated FBS. For the inhibition of differentiation
assay, the medium was supplemented with 0.2 mM L-ascorbic acid.
AI.4.3. Cell counting and determination of cell viability.
In order to seed the amount of cells required for each experiment, the cell density and the
percentage of living cells in the starting suspension had to be determined. For this purpose, a
5-fold dilution of the suspension in trypan blue was prepared and used to fill both chambers of
a Neubauer haemocytometer. With help of a microscope, the cells on the four corner squares
were counted and the final number was divided by four to obtain the mean number of cells per
square. Since the volume of the column of liquid on top of one square is 1x1x0.1 = 0.1 mm3 =
10-4 mL and the cell suspension was 5-fold diluted, the cell density of the starting suspension
was calculated by multiplying the mean of cells/square by 5 and by 104.
Cells/mL = (total cells / 4) x 5 x 104
Appendix I. Protocols and recipes__________________________________________________
108
To estimate the viability of the cells, the living cells (not stained with trypan blue) and the
dead cells (stained blue) were counted separately. The percentage of viability was calculated
applying the formula:
% Viability = (living cells / total cells) x 100
AI.5. Protein analysis.
AI.5.1. Protein precipitation with trichloroacetic acid.
Precipitation of proteins in aqueous solutions with trichloroacetic acid (TCA) can be used for
analysis of low concentration protein samples by SDS-PAGE or immunoblotting (Hames BD and
Rickwood D, 1981). Previous addition of deoxycholate improves the concentration for samples
with protein contents below 1 µg/mL (Peterson GL, 1983).
For every 100 µL of sample, 1 µL of a 20 mg/mL deoxycholate solution was added and the
sample was left on ice for 10 minutes. Afterwards, 43 µL of a pre-chilled 20% TCA solution was
added and the sample was left on ice for another 30 minutes. Proteins were then pelleted at
38,000 xg for 10 minutes at 4 ºC and the pellet was washed with 200 µL cold acetone. The
sample was again centrifuged as before and the acetone was carefully removed. Tubes were
left open at room temperature to eliminate remaining traces of acetone by evaporation. Finally,
the proteinaceous pellet was resuspended in 2x SDS-PAGE Sample Buffer.
AI.5.2. SDS-PAGE.
AI.5.2.1. Buffers and reagents.
4x Laemmli running buffer:
2 M Tris-HCl 50 mL/L
Glycine 58 g/L
10% SDS 40 mL/L
__________________________________________________Appendix I. Protocols and recipes
109
2x SDS-PAGE loading buffer:
2 M Tris-HCl, pH 6.8 60 µL/mL
10% SDS 0.4 mL/mL
Glycerol 0.2 mL/mL
Bromophenol blue 1 mg/mL
Stacking gel buffer:
Tris 181.5 g/L
pH 8.8
Resolving gel buffer:
Tris 60 g/L
pH 6.8
AI.5.2.2. Gel preparation.
SDS-PAGE was performed using 12.5 and 15% polyacrylamide gels, with 90 x 60 mm
(WxH) dimensions and 0.75 or 1.5 mm thickness. The equipment used was from BioRad (Mini-
Protean III).
An outer glass and a short plate were assembled and placed in a gel caster. The liquid
resolving gel mixture was prepared on ice to avoid premature polymerization, poured between
the two plates and covered with 50% isopropanol until complete polymerization (approx.
1 hour). Afterwards, isopropanol was removed and the liquid stacking gel mixture was poured
on top of the resolving gel. Immediately after, a 10-well comb was introduced into the stacking
gel and the latter was left at room temperature for polymerization for at least 45 minutes.
Resolving gel 12.5% 15%
30% acrylamide:bis-acrylamide (37.5:1) 4125 µL 4950 µL
MilliQ water 3220 µL 2395 µL
Resolving gel buffer 2500 µL 2500 µL
10% SDS 100 µL 100 µL
10% PSA 50 µL 50 µL
TEMED 5 µL 5 µL
Appendix I. Protocols and recipes__________________________________________________
110
Stacking gel 5%
30% acrylamide:bis-acrylamide (37.5:1) 1020 µL
MilliQ water 3420 µL
Stacking gel buffer 1500 µL
10% SDS 60 µL
10% PSA 30 µL
TEMED 6 µL
AI.5.3 Staining of gels with Coomassie blue.
AI.5.3.1. Buffers and reagents.
Fixing solution:
Isopropanol 250 mL/L
Acetic acid 100 mL/L
Coomassie blue staining solution:
Coomassie blue G-250 1 g/L
Methanol 500 mL/L
Acetic acid 100 mL/L
Coomassie blue destaining solution:
Methanol 100 mL/L
Acetic acid 100 mL/L
AI.5.3.2. Staining protocol.
After electrophoretic separation of the proteins, the gel was incubated for 30 minutes in
fixing solution to avoid protein diffusion through the gel. Afterwards, the proteins were stained
with Coomassie blue staining solution for 45 minutes and the gel was destained overnight in
destaining solution. All incubations were done with gentle agitation on a horizontal shaker.
__________________________________________________Appendix I. Protocols and recipes
111
AI.5.4. Electrotransference of proteins to PVDF.
AI.5.4.1. Buffers and reagents.
5x Transference buffer:
2 M Tris-HCl 62.5 mL/L
Glycine 72 g/L
1x Transference buffer:
5x Transference buffer 200 mL/L
Methanol 200 mL/L
10% SDS 10 mL/L
AI.5.4.2. Transference protocol.
PVDF sheets were cut into the same dimensions as the polyacrylamide gels, activated by
immersion in methanol for 10 seconds, and washed with transference buffer.
The gel was also equilibrated in transference buffer for 10 minutes, after which the PVDF
membrane was placed on the gel in a transference cassette. Transference was performed at
100 mA, at room temperature, for approximately 3 hours, in transference buffer.
AI.5.5. Staining of proteins on PVDF with amido black.
AI.5.5.1. Buffers and reagents.
Amido black staining solution:
Amido black 10B 1 g/L
Methanol 450 mL/L
Acetic acid 100 mL/L
Amido black destaining solution:
Methanol 500 mL/L
Acetic acid 100 mL/L
Appendix I. Protocols and recipes__________________________________________________
112
AI.5.5.2. Staining protocol.
The sheet of PVDF containing the molecular mass standard proteins was directly incubated
for 5-10 minutes in amido black staining solution after transference from the SDS-PAGE gel.
Afterwards, the sheet was placed in amido black destaining solution for 20-30 minutes with
several renewals of the solution until the excess of stain was removed. The PVDF sheet was
then rinsed with distilled water and placed between sheets of laboratory paper for drying.
AI.5.6. Immunostaining of proteins on PVDF.
AI.5.6.1. Buffers and reagents.
PBST:
PBS (see Appendix I, section AI.1) with 0.1% Tween-20.
Blocking solution:
PBST with 2% BSA and 5% non-fat dehydrated milk.
AI.5.6.2. Immunostaining protocol.
Proteins transferred or loaded on PVDF sheets were immunostained using specific
antibodies. All washing and incubating steps were performed at room temperature with gentle
agitation.
The PVDF sheet was washed with PBST (2 x 5 min, 2 x 10 min, 2 x 5 min) before blocking
the sheet with blocking solution (2 x 30 min) to avoid non-specific antibody binding. The sheet
was then washed again with PBST (2 x 5 min) to remove the excess of blocking solution. The
specific primary antibody was diluted at the proper concentration (1:2,500 for anti-BMP-6 and
1:1,000 for anti-bFGF) in PBS + 2% BSA + 0.02% NaN3 and the sheet was incubated overnight
in this solution. The next day, the sample was again washed with PBST (2 x 5 min, 2 x 10 min,
2 x 5 min) and incubated for 1 hour in darkness in the secondary antibody solution (anti-mouse
or anti-rabbit IgG conjugated with HRP, diluted 1:5,000 in blocking solution). From this step on,
the sample was preserved from light to avoid photoinactivation of the peroxidase. The sheet
was washed once more with PBST (2 x 5 min, 2 x 10 min, 2 x 5 min) to remove traces of
unbound secondary antibody, and finally washed with PBS (2 x 5 min).
__________________________________________________Appendix I. Protocols and recipes
113
AI.5.7. Development of immunostained proteins.
Detection of the immunostained proteins was performed in a dark room. The PVDF sheet
was placed in a plastic envelope and covered with ECL™ detection reagent (Amersham) for 2-3
minutes. The detection reagent was removed and a Kodak Biomax® chemiluminescence film
was placed on top of the envelope. The exposure time depended on the sample type and
concentration.
After exposure, the film was developed for 5 minutes by submersion in Kodak GBX
developer, washed for 1 minute with water and, fixed for 10 minutes in Kodak GBX fixer.
Finally, the film was extensively washed with water and left drying.
AI.6. Histological analyses.
AI.6.1. Fixation, decalcification, dehydration and embedding in
paraffin.
The fixation of tissue samples to maintain their histological integrity was done by
submersion in buffered 3.7-4.0% formaldehyde for 24 hours, followed by washing with distilled
water for 30 minutes. The samples that were presumed to contain calcified tissue were
decalcified for 4 hours in Decalcifier II®, which is a commercial hydrochloric acid – EDTA
solution, and extensively washed with distilled water for 1 hour, prior to dehydration. The rest
of the samples were directly dehydrated and embedded in paraffin as described below:
- 80º ethanol 30 min at room temperature.
- 96º ethanol 40 min at room temperature.
- 96º ethanol 50 min at room temperature.
- 100º ethanol 60 min at room temperature.
- 100º ethanol 75 min at room temperature.
- 1:1 100º ethanol:butanol 60 min at room temperature.
- Butanol 2 x 15 min at room temperature.
- 1:1 butanol:paraffin 120 min at 60 ºC.
- paraffin overnight at 60 ºC.
- paraffin 2 x 120 min at 60 ºC.
Afterwards, the samples were placed into paraffin casts filled with liquid paraffin and left at
room temperature until its complete solidification. Finally, the samples were transversally cut
Appendix I. Protocols and recipes__________________________________________________
114
into 10 µm-thick slices whit help of a microtome and these were placed on poly-L-lysine coated
glass slides and incubated at 37 ºC for drying.
AI.6.2. Hematoxylin-eosin staining.
Before staining, the samples were deparaffined with xylene and hydrated. Afterwards,
staining was performed by the following steps:
- Harris hematoxylin 40 sec.
- Ethanol 96º + 8 drops of acetic acid 5 min.
- Running water 5 min.
- Eosin yellowish, hydroalcoholic solution 8 sec.
- Distilled water 1 min.
Afterwards, the samples were dehydrated and mounted with Eukitt.
AI.6.3. Masson’s trichrome staining.
Before staining, the samples were deparaffined with xylene and hydrated. Afterwards,
staining was performed by the following steps:
- Bouin liquor 60 min.
- Extensive washing with distilled water
- Ferric hematoxylin 10 min.
- Running water 10 min.
- Distilled water 5 min.
- Scarlet - acid fuchsin 3 min.
- Distilled water 5 min.
- Phosphotungstic acid 5% 15 min.
- Light green 2% 8 min.
- Distilled water 5 min.
- Acetic acid 1% 4 min.
Afterwards, the samples were dehydrated and mounted with Eukitt.
__________________________________________________Appendix I. Protocols and recipes
115
Preparation of the different staining solutions was done as detailed below:
Ferric hematoxylin. Solutions A and B were mixed well before use according to the
manufacturer instructions.
Light green.
Light green 2 g
Acetic acid glacial 1 mL
Distilled water 99 mL
AI.6.4. Alcian blue staining.
Before staining, the samples were deparaffined with xylene and hydrated. Afterwards,
staining was performed by the following steps:
- Acetic acid 3% 3 min.
- Alcian blue 1 hour
- Running water
Afterwards, the samples were dehydrated and mounted with Eukitt.
Alcian blue.
Alcian blue 1 g
3% acetic acid 100 mL
pH 2.5
AI.6.5. Immunohistochemistry.
Before staining, the samples were deparaffined with xylene and hydrated, and the
endogenous peroxidase activity was inactivated by incubating the samples for 1 hour in
10% H2O2 + 10% methanol in PBS, pH 7.3. The samples were then washed for 3 x 10 minutes
with PBS and saturated with 10% normal sheep serum in PBS for 1 hour.
Appendix I. Protocols and recipes__________________________________________________
116
Afterwards, immunostaining of the samples was performed by the following steps:
- PBS 3 x 5 min.
- Primary antibody 18 hours.
- PBS 3 x 5 min.
- Biotinylated secondary antibody 1 hour.
- PBS 3 x 5 min.
- ABC reagent (avidin-biotin complex) 30 min.
The peroxidase activity was developed for 10 minutes with a solution containing 0.2% 3,3’-
diaminobenzidine (DAB) and 0.03% H2O2 in PBS. Then, the nuclei were counterstained with
Harris Hematoxylin for 15 seconds followed by a 7 minutes incubation in ethanol 96º + 8 drops
of acetic acid. Finally, the sections were dehydrated and mounted with Eukitt.
The primary antibodiy used was:
- Anti-osteopontin mouse monoclonal antibody 1:500 in 0.1 M PB + 0.3% triton x-100 +
0.3% BSA
The secondary antibody used was:
- Biotinylated anti-mouse IgG rabbit antibody 1:1,000 in 0.1 M PB + 0.3% triton x-100 +
0.3% BSA
As a negative control, a set of samples was incubated for 18 hours in 0.1 M PB + 0.3%
triton x-100 + 0.3% BSA without primary antibody.
Appendix II. Reagents and equipment.
117
118
_______________________________________________Appendix II. Reagents and equipment
AII.1. Fungibles.
Conical bottom tubes 15 mL and 50 mL (Sterilim) Cryogenic vials 1 mL (377224, Nunc) Culture flask T-75 cm (Nunc) 2
Culture flask T-175 cm (Nunc) 2
Culture plates 6, 12, 24, 48 and 96 wells (Nunc)Dyalisis membranes (D-9652, Sigma) Electroporation cuvettes, Gene Pulser (165-2086, BioRad)®
Filters 0.22 µm, Millex-GP50 (SLGPB5010, Millipore) Haemocytometer (717815, Brand)HiTrap™ Heparin HP columns, 1 mL (17-0406, GE Healthcare) Microcentrifuge tubes 1.5 mL Micropipette filter tips 0.5-10 µL, 5-30 µL, 5-200 µL and 100-1000 µL (Bioscience, Inc) Microscope coverslips (Menzel-Gläser) Microscope glass slides (Thermo Scientific)Pasteur pipettes (Normax) PCR tubes, 0.2 mL (PCR-02D-C, Axygen)Petri dishes for bacterial culture 90 mm (Soria Gelab, S.A.) Petri dishes for cell culture 60, 90 and 150 mm (Nunc)Serological pipettes 2, 5, 10 and 25 mLSuspension culture vessels 1 L (2605-0001, Nalgene) Suspension culture vessels 250 mL (129500, Pobel) Suspension culture vessels 500 mL (129510, Pobel) Syringe filters 0.2 µm (190-2520, Nalgene)Vivaspin 2, 5 kDa MWCO (28-9322-45, GE Healthcare) Ultraviolet spectrophotometry cuvettes (7591 50, Brand)
AII.2. Reagents.
ABC peroxidase staining kit (32020, Pierce) Acetic acid glacial (CH3COOH) (141008, Panreac) Acetone (CH3COCH3) (141007, Panreac) Acrilamide-bisacrilamide solution 30% 37.5:1 (161-0158, BioRad) Agarose (11404, Serva) Agarose, low melting point (A-4018) Alcian blue (A3157, Sigma) Amido black 10B (252036, Panreac) Ammonium acetate (CH3COONH4) (131114, Panreac) Ammonium persulphate (PSA) (161-0700, BioRad) Amphotericin B (A-2942, Sigma) Ampicillin, sodium salt (A-9518, Sigma) Anti-BMP-6 mouse monoclonal antibody (MAB507, R&D Systems) Anti-bFGF rabbit polyclonal antibody (858-450-5558, Calbiochem) Anti-mouse IgG, biotinylated, developed in goat (Ab7067, Abcam) Anti-mouse IgG, HRP-conjugated, developed in rabbit (A-5906, Sigma) Anti-osteopontin mouse monoclonal antibody (MPIIIB10(1), Hybridoma bank) Anti-rabbit IgG, HRP-conjugated, developed in goat (A-6145, Sigma) BacPAK6™ DNA (631401, Clontech)Bacteriological agar (402302, Cultimed)
119
Appendix II. Reagents and equipment_______________________________________________
BamHI endonuclease (E1010V, Amersham) BglII endonuclease (E1021Y, Amersham) Biebrich scarlet-acid fuchsin solution (HT151, Sigma) Bouin liquor (254102, Panreac) Bovine serum albumin (BSA) (12018, Merck) Bromophenol blue (B-8502, Sigma) Butanol (141082, Panreac) Chloramphenicol (C-0378, Sigma) Coomassie brilliant blue G-250 (B-1131, Sigma) Decalcifier II® (00460, Surgipath) Diethyl pyrocarbonate (DEPC) (D-5758, Sigma) Dimethyl sulfoxide (DMSO) (C2H6OS) (D-8779, Sigma) di-Potassium hydrogen phosphate anhydrous (K2HPO4) (121512, Panreac) di-Sodium hydrogen phosphate 2-hydrate (Na2HPO4•2H2O) (122507, Panreac) Dithiothreitol (DTT) (C4H10O2S2) (D-9779, Sigma) DMEM (D-6546, Sigma) Dodecyl sodium sulphate (SDS) (C12H25O4SNa) (142363, Panreac) ECL chemiluminiscence detection reagents (RPN2209, Amersham) EcoRI endonuclease (E1040Y, Amersham) EcoRV endonuclease (10667145001, Roche) Eosin yellowish hydroalcoholic solution 1% (251301, Panreac) Escort transfection reagent (E-9770, Sigma) Ethanol absolute (C2H5OH) (212801, Panreac) Ethanol 96º (212800, Panreac) Ethidium bromide (E-1510, Sigma) Ethylenediaminetetraacetic acid (EDTA) (C10H16N2O8) (131669, Panreac) Ethylenediaminetetraacetic acid (EDTA) (disodium salt) 0.5 M (E-7889, Sigma) Eukitt (O. Kindler GmbH) EZMix™ Terrific broth (T-9179, Sigma) Foetal bovine serum gold (FBS) (A15-649, PAA Laboratories) Formaldehyde 3.7-4.0 % (252931, Panreac) Formaldehyde 36.5-38% (F-8775, Sigma) Formamide (F-7508, Sigma) Gelatin (G-9391, Sigma) GFX™ Micro Plasmid Prep Kit (27-9601-01, Amersham) GFX™ PCR DNA and Gel Band Purification Kit (27-9602-01, Amersham) Glutathione, oxidized form (GSSG) (G-6654, Sigma) Glutathione, reduced form (GSH) (G-4251, Sigma) Glycerol (G-5516, Sigma) Glycine (C2H5NO2) (131340, Panreac) Guanidine hydrochloride (G-3272, Sigma) Harris hematoxylin (253949, Panreac) Hydrochloric acid 37% (HCl) (131019, Panreac) Isopropyl alcohol (C3H8O) (I-0398, Sigma) Isopropyl-β-D-thiogalactopyranoside (IPTG) (I-5502, Sigma) Kodak BioMAx films (Z370398, Sigma) Kodak GBF developing solution (P-7042, Sigma) Kodak GBF fixing solution (P-7167, Sigma) Lambda DNA HindIII digest (D-9780, Sigma) L-arginine (H2NC(=NH)NH(CH2)3CH(NH2)CO2H) (A-5006, Sigma) LB broth (L-3022, Sigma) L-glutamine (G-7513, Sigma) Light green SF yellowish (62110, Sigma) Low fat dehydrated milk (Central Lechera Asturiana) McCoy’s 5A medium (M-8403, Sigma) MEM-alpha (M-8042, Sigma)
120
_______________________________________________Appendix II. Reagents and equipment
MEM-alpha (A1049001, Gibco) Methanol (CH3OH) (141091, Panreac) MOPS (M-1254, Sigma) NDSB256 (480010, Calbiochem) Neutral red (N-2889, Sigma) N, N, N', N'-Tetramethyl-1-, 2-diaminomethane (TEMED) (161-0800, BioRad) Normal sheep serum (S-2263, Sigma) Nucleospin® RNA II (635990, Clontech) pAcGP67B shuttle vector (554757, Pharmingen) Paraffin pellets, Histosec® (11609, Merck) pBIISK(+) cloning vector (212205, Stratagene) PCR Mastermix (2200100, 5Prime) Penicilin-streptomicin solution (P-0781, Sigma) pET17b expression vector (69663, Stratagene) PfuTurbo® DNA polymerase (600250, Stratagene) Phosphotungstic acid (121033, Panreac) Poly-L-lysine solution (P-8920, Sigma) Potassium chloride (KCl) (131494, Panreac) Potassium di-hydrogen phosphate (KH2PO4) (131509, Panreac) Precision molecular mass standard (170-8207, BioRad) Proteinase K (E76230Y, Amersham) PVDF sheets, Immobilon-P (IPVH-20200, Millipore) rh-bFGF (233-FB, R&D Systems) rhBMP-6 (507-BP, R&D Systems) Sapphire™ linearized baculovirus DNA (BVD-10001, Orbigen) SDS-PAGE Broad Range molecular weight markers (161-0317, BioRad) Sephadex® G-25, fine (G-2580, Sigma) Sf9 insect cells (71104-3, Novagen) Sigma Fast™ p-nitrophenyl phosphate tablets (N-2770, Sigma) Sodium acetate (C2H3O2Na) (S-2889, Sigma) Sodium azide (NaN3) (122712, Panreac) Sodium bicarbonate (NaHCO3) (S-5761, Sigma) Sodium carbonate (Na2CO3) (6392, Merck) Sodium chloride (NaCl) (141659, Panreac) Sodium deoxycholate (D-6750, Sigma) Sodium di-hydrogen phosphate monohydrate (NaH2PO4•H2O) (6346, Merck) Sodium hydroxide (NaOH) (141687, Panreac) Sodium iodoacetate (I-9148, Sigma) Titan™ One Tube RT-PCR System (11888382001, Roche) TNM-FH (T-1032, Sigma) Tribromoethanol (90710, Fluka) Trichloroacetic acid (TCA) (T-9159, Sigma) Tris (hydroxymethyl)-aminomethane (TRIS) (C4H11NO3) (TR0424, Scharlau) Triton X-100 (t-octylphenoxypoly-ethoxyethanol) (T-8787, Sigma) Trypan blue (T-8154, Sigma) Trypsin-EDTA (T-3924, Sigma) Tryptone (T-9410, Sigma) Tween®20 (Polyoxyethylene sorbitan monolaurate) (P-1379, Sigma) T4 DNA ligase (7005Y, Usb) Urea (131754, Panreac) Weigert’s iron hematoxylin solution (HT1079, Sigma) Xylene (141769, Panreac) Xylene cyanol (X-4126, Sigma) Yeast extract (Y-1625, Sigma) 2-mercaptoethanol (C2H6OS) (M-3148, Sigma) 2-(N-Cyclohexylamino) ethanesulfonic acid (CHES) (C-2885, Sigma) 2-(N-morpholino)ethanesulfonic acid (MES) (M-3671, Sigma)
121
Appendix II. Reagents and equipment_______________________________________________
2-propanol ((CH3)2 CHOH) (141090, Panreac) 2X YT microbial medium (Y-2377, Sigma) 3,3’-diaminobenzidine (DAB) (D-5637, Sigma)
AII.3. Equipment.
Autoclave, Presoclave 75, Selecta. Balance, EB 300, Salter. Chromatographer, Biologic Duo Flow, BioRad. Cell freezing container, Cryo 1ºC, 5100-0001, Nalgene. Centrifuge, MC-15, Cobos. Centrifuge, 320 R, Hettich. Conductimeter, 524, Crison. Container for cell cryopreservation in liquid N2, XC47/11-6, MVE. Electronic propipette, Accu-jet, Brand. Electronic propipette, Pipetboy acu, Integra Biosciences. Electroporator, GenePulser™, BioRad. ELISA plate reader, ELx800, Bio-Tek Instruments. Fixed rotor centrifuge, 3K30, Sigma. Gel documentation system, Uvidoc GAS9000, UVItec. Heating plate, Plan-Tronic, Selecta. Horizontal shaker, OVAN. Horizontal shaker, ProMax 1020, Heidolph. Incubator, Digitronic, Selecta. Incubator (28 ºC, for insect-cell culture), HotCold-S, Selecta. Incubator (37 ºC, for bacterial cultures), 205, Selecta. Incubator/Shaker (37 ºC for bacterial cultures), G25, New Brunswick Scientific. Incubator with CO2 supply (37 ºC, for mammalian cells and tissues), HeraCell, Heraus. Inverted optic microscope, Nikon. Laminar flow cabinet, AV-30/70, Telstar. Lyophilizer, Cryodos-45, Telstar Magnetic shaker, Asincro, Selecta. Magnetic shaker, IKA. Microcentrifuge, 110, Sigma. Micropipettes Eppendorf, Biohit Proline and Boeco. Microtome, HM 340, Microm Heidelberg. Microwave oven, LG. Multiple magnetic shaker, A-04, SBS. Multiple magnetic shaker, A-013, SBS. Multiple micropipette, Biohit Proline. Nucleic acid electrophoresis chamber, Mini-Sub® Cell DT, BioRad. Nucleic acid electrophoresis power supply, EPS300, Pharmacia. Optic microscope, Labophot2, Nikon. Orbital shaker, Heidolph. Pasteur sterilization oven, Conterm 2000 210, Selecta. pHmeter, micropH 2000, Crison. pHmeter, pH211 Microprocessor pH Meter, Hanna Instruments. Precision balance, ER120A, AND. Precision balance, Mettler AM100, German Weber. Protein electrophoresis and electrotransference power supply, PowerPac 300, BioRad. Protein electrophoresis and electrotransference system, MiniProtean III, BioRad. Quantiscan, Biosoft, Ferguson. Spectrophotometer, UV-1603, Shimadzu.
122
_______________________________________________Appendix II. Reagents and equipment
Swinging bucket centrifuge, Centronic, Selecta. Swinging bucket centrifuge, Rotofix 32, Hettich. Thermocycler, GeneAmp PCR system 2400, Perkin Elmer. Thermostatic block, BioTDB-100, Boeco. Thermostatic water bath, Digiterm 100, Selecta. Thermostatic water bath, Memmert. Thermostatic water bath, Precisterm, Selecta. Tube shaker, Movil-Rod, Selecta. Ultraviolet light lamp, 312 nm, UVIlite, LF 206 LM, UVItec. Water deionizer, ATAPA 25, ATAPA.
123
124
4. Results.
125
126
________________________________________________________________________Results
127
4.1. Obtaining of the gene encoding hBMP-6.
Total RNA was isolated from cultured U-2 OS human osteosarcoma cells and used as a
template for the amplification of the sequence encoding the mature domain of the hBMP-6 by
RT-PCR. As expected, the RT-PCR yielded a 460 bp band (Fig. 28), which was purified from the
agarose gel and cloned into the pBIISK maintenance vector.
Figure 28. RT-PCR with P5 vs. P6 on U-2 OS total RNA for the amplification of the sequence encoding the mature domain of the hBMP-6.
4.2. Cloning of the genes into the expression vectors.
By PCR, using specific oligonucleotides and the pBIISK:BMP-6 construction as template,
both the sequences of the BMP-6 and the BMP-6-CBD were obtained with an EcoRI restriction
site upstream and a BamHI restriction site downstream (for cloning into the pET17b expression
vector) or with a BamHI restriction site upstream and an EcoRI restriction site downstream (for
cloning into the pAcGP67B shuttle vector). After digestion of these fragments with the proper
endonucleases, they were ligated into the two above mentioned plasmids. Cloning of the
fragments was confirmed by PCR analysis using oligonucleotides against the sequences flanking
the MCSs of the plasmids (Fig. 29 A and B).
Figure 29. PCR analysis of the obtained expression vectors. A) PCR with P1 vs. P2 on the pET17b:BMP-6 (lane 1) and pET17b:BMP-6-CBD (lane 2) constructions. B) PCR with P42 vs. P43 on the pAcGP67B:BMP-6 (lane 1) and pAcGP67B:BMP-6-CBD (lane 2) constructions. C) PCR with P42 vs. P43 on the pAcGP67B:bFGF (lane 1) and pAcGP67B:bFGF-CBD (lane 2) constructions.
500 bp
1 Kbp
700 bp
1 Kbp
500 bp
700 bp
700 bp
1 Kbp
A B C 1 2 1 2 1 2
Results________________________________________________________________________
128
For the cloning of the sequences encoding the rh-bFGF and the rh-bFGF-CBD into the
pAcGP67B shuttle vector, a PCR with specific oligonucleotides was performed on the
pET28b:hbFGF-F1 and pET28b:hbFGF-F2 constructs to obtain the fragments with a BglII
restriction site upstream and an EcoRI restriction site downstream. After digestion of the
fragments with the proper endonucleases, they were ligated into the pAcGP67B shuttle vector
and the cloning was confirmed by PCR analysis using oligonucleotides against the sequences
flanking the MCS of the plasmid (Fig. 29 C).
4.3. Production of rhBMP-6 in Escherichia coli.
Since Escherichia coli is known to be a potent system for the production of heterologous
proteins, and other members of the BMP family have been successfully produced using this tool
(Vallejo LF et al., 2002), even with an additional collagen binding domain (Chen B et al., 2007a;
Chen B et al., 2007b; Visser R et al., 2009), the first attempts on rhBMP-6 and rhBMP-6-CBD
production were made using this system.
4.3.1. Obtaining of rhBMP-6-expressing clones of E. coli
Rosetta™ (DE3).
E. coli Rosetta™ (DE3) cells were made competent and transformed with the pET17b:
BMP-6 and the pET17b:BMP6-CBD constructions. The transformed cells were plated on LB agar
dishes supplemented with antibiotics and ten of the obtained colonies for each expression
vector were analyzed by colony-PCR using specific primers against the rhBMP-6 or rhBMP-6-
CBD inserts. All of the analyzed colonies resulted to be positive for their respective
constructions.
Five positive colonies for each expression vector were grown in liquid cultures and their
plasmids were isolated. Two plasmid samples for each expression vector were sequenced using
specific primers against the regions of the plasmidic DNA flanking the insert. Since the
sequence of both genes was correct, with no mutations being found, and they were all cloned
in frame, one clone for each expression vector was selected for protein expression.
________________________________________________________________________Results
129
4.3.2. Expression of rhBMP-6 in Escherichia coli.
For rhBMP-6 production, the selected E. coli Rosetta™ (DE3) clone, containing the
recombinant pET17b expression vector, was grown in TB with a starting OD600 of 0.1, until an
OD600 of 0.8 was reached. At this point, IPTG was added to the culture to induce the expression
of the heterologous proteins, and the production was continued for four hours, taking samples
and measuring the OD600 of the culture hourly. During this period, a clear variation of the
growth rate could be observed after addition of IPTG when compared to a control culture of
non-transformed bacteria (Fig. 30 A). While the control culture continued its exponential growth
during the entire analyzed period, the rhBMP-6-expressing culture slowed its growth after the
addition of IPTG, as showed by the lowering of the slope of the growth curve. This was
presumed to be a direct consequence of a high rate of heterologous protein expression, which
should interfere with the normal physiological behaviour of the bacteria in a highly rich culture
medium such as TB.
Four hours after the induction of heterologous protein expression, the cells of the culture
were harvested, obtaining approximately 612 mg (wet weight) of bacterial biomass. A 1 mL
aliquot of the culture was used for SDS-PAGE analysis of the protein production procedure. For
this purpose, the cells were lysed by sonication, the soluble protein fraction was separated from
the insoluble protein fraction, and the produced inclusion bodies were subsequently isolated
from the latter by washing in presence of triton x-100. As shown in figure 30 B, before the
addition of IPTG to the culture, the total protein content of the bacteria included one most
represented protein that migrated as a ±16.5 KDa band in the polyacrylamide gel. The facts
that this band did not appear when analyzing the total protein content of non-transformed
control cultures, and that its molecular mass corresponded to that of non-glycosilated rhBMP-6
monomers, made us assume that this was our goal protein. The presence of rhBMP-6 in the
bacteria before the induction of heterologous protein expression showed that the chosen
expression system has a low stringency, and that the T7 RNA polymerase responsible for
heterologous protein expression is present in the host cells at basal levels in the absence of
lactose or its analogue IPTG.
After IPTG addition to the cultures, a significant increase of the band corresponding to the
rhBMP-6 and of the rhBMP-6/total protein ratio could be observed. This increase was especially
reached during the first hour after induction, being the protein expression rate lower during the
following three hours. Four hours after IPTG addition, the rhBMP-6 monomers were estimated
to represent 40-50% of the total protein content of the bacteria.
The high amounts of rhBMP-6 monomers produced and the fact that they could be
recovered in the insoluble protein fraction made us assume that they were accumulated in the
form of inclusion bodies. Washing of these inclusion bodies in the presence of triton x-100 to
Results________________________________________________________________________
130
remove contaminant, insoluble, membrane-associated proteins yielded a highly pure sample of
inclusion bodies containing the rhBMP-6 monomers.
Figure 30. rhBMP-6 production in Escherichia coli. A) Growth of a not transformed control culture (blue line) versus a culture expressing rhBMP-6 (red line). The arrow indicates addition of IPTG to the culture to induce recombinant protein expression. B) Cell protein content analyzed by SDS-PAGE and Coomassie blue staining. Lane 1, total protein content before induction of expression. Lane 2, total protein content 1 hour after induction of expression. Lane 3, total protein content 2 hours after induction of expression. Lane 4, total protein content 3 hours after induction of expression. Lane 5, total protein content 4 hours after induction of expression. Lane 6, insoluble protein content 4 hours after induction of expression. Lane 7, washed inclusion bodies.
The obtained inclusion bodies were solubilized with 6 M Gnd-HCl and finally dialyzed against
MES-Gnd buffer, yielding a 4 mL solution. Quantification of the rhBMP-6 in this sample by SDS-
PAGE and digital image analysis revealed that the concentration of rhBMP-6 was approximately
2.7 mg/mL and that the yield of monomeric rhBMP-6 production with the used expression
system and host cell strain was, thus, approximately 108 mg/L.
4.3.3. Refolding of rhBMP-6 produced in Escherichia coli.
Since the active form of rhBMP-6 is a homodimer with one intercatenary disulfide bond and
three intracatenary disulfide bonds per monomer, in vitro refolding of the produced monomers
became a need. BMPs do not spontaneously acquire their native conformation when the
chaotropic agent is removed from the solubilization buffer, so a complex refolding procedure
has to be performed, in which many different variables have to be taken into account (i.e.
protein concentration, refolding time, temperature, pH, redox pairs, antiaggregants, chaotropic
0
2
4
6
8
10
12
14
16
0 2 4 6 8 10 12
OD600
Time (hours)
1 2 3 4 5 6 7
14 KDa
21 KDa
31 KDa
45 KDa
66 KDa
rhBMP-6
A B
________________________________________________________________________Results
131
agent concentration, presence of molecular oxygen in the refolding mixture, etc). The starting
conditions assayed for rhBMP-6 refolding were based on those described for the successful
refolding of rhBMP-2 by Vallejo LF et al., 2002, which also resulted useful for refolding of a
collagen-targeted rhBMP-2 (Visser R et al., 2009). These conditions were refolding for 72 hours
at 10 ºC and a protein concentration of 20 µg/mL in a refolding buffer containing 57.5 mM Tris,
pH 8.5, 0.55 mM EDTA, 0.9 M NaCl, 0.75 M CHES, 0.5 M Gnd-HCl, 2 mM GSH and 1 mM GSSG.
The first attempt on rhBMP-6 refolding was done using these conditions and testing the
possible effect of three different GSH :GSSG ratios.
SDS-PAGE analysis of the refolding procedure showed that, in the three cases, most of the
rhBMP-6 remained in the monomeric form (Fig. 31). Besides the ±16.5 KDa band, a
characteristic ladder appeared, formed of a ±32 KDa, a ±47 KDa, a ±63 KDa and higher bands.
Since the molecular mass of these bands could correspond to dimeric, trimeric, tetrameric and
polymeric forms of rhBMP-6, respectively, they were assumed to be due to unspecific
intermolecular disulfide bond formation. This was confirmed by analyzing these samples by
SDS-PAGE in the presence of DTT, in which the higher bands disappeared and only the
16.5 KDa band could be seen.
Figure 31. Effect of GSH:GSSG ratio on in vitro refolding of rhBMP-6 expressed in Escherichia coli. Monomers (x1) give rise to dimers (x2), trimers (x3), tetramers (x4) and higher polymers. Lane 1, GSH:GSSG ratio 2:1. Lane 2, GSH:GSSG ratio 10:1. Lane 3, GSH:GSSG ratio 40:1.
Since our aim was to obtain a better refolding yield and a more specific disulfide bond
establishment, different variations on the previous standard conditions were assayed. In total,
41 combinations of parameters were tested and analyzed by SDS-PAGE (Figs. 32, 33, 34, 35).
1 2 3
14 KDa
21 KDa
31 KDa
45 KDa
66 KDa
x1
x2
x3
x4
Results________________________________________________________________________
132
Figure 32. Effect of antiaggregants, pH and GSH:GSSG ratio on in vitro refolding of rhBMP-6 expressed in Escherichia coli. A) Refolding in presence of NDSB256. Lane 1, 0.5 M NDSB256, pH 7.5, GSH:GSSG ratio 2:1. Lane 2, 0.5 M NDSB256, pH 7.5, GSH:GSSG ratio 40:1. Lane 3, 0.5 M NDSB256, pH 8.5, GSH:GSSG ratio 2:1. Lane 4, 0.5 M NDSB256, pH 8.5, GSH:GSSG ratio 10:1. Lane 5, 0.5 M NDSB256, pH 8.5, GSH:GSSG ratio 40:1. Lane 6, 0.5 M NDSB256, pH 9.5, GSH:GSSG ratio 2:1. Lane 7, 0.5 M NDSB256, pH 9.5, GSH:GSSG ratio 40:1. Lane 8, 1 M NDSB256, pH 7.5, GSH:GSSG ratio 2:1. Lane 9, 1 M NDSB256, pH 7.5, GSH:GSSG ratio 40:1. Lane 10, 1 M NDSB256, pH 8.5, GSH:GSSG ratio 2:1. Lane 11, 1 M NDSB256, pH 8.5, GSH:GSSG ratio 10:1. Lane 12, 1 M NDSB256, pH 8.5, GSH:GSSG ratio 40:1. Lane 13, 1 M NDSB256, pH 9.5, GSH:GSSG ratio 2:1. Lane 14, 1 M NDSB256, pH 9.5, GSH:GSSG ratio 40:1. B) Refolding in presence of arginine. Lane 1, 0.5 M arginine, pH 7.5, GSH:GSSG ratio 40:1. Lane 2, 0.5 M arginine, pH 8.5, GSH:GSSG ratio 2:1. Lane 3, 0.5 M arginine, pH 8.5, GSH:GSSG ratio 10:1. Lane 4, 0.5 M arginine, pH 8.5, GSH:GSSG ratio 40:1. Lane 5, 0.5 M arginine, pH 9.5, GSH:GSSG ratio 40:1. Lane 6, 1.5 M arginine, pH 7.5, GSH:GSSG ratio 2:1. Lane 7, 1.5 M arginine, pH 7.5, GSH:GSSG ratio 40:1. Lane 8, 1.5 M arginine, pH 8.5, GSH:GSSG ratio 2:1. Lane 9, 1.5 M arginine, pH 8.5, GSH:GSSG ratio 10:1. Lane 10, 1.5 M arginine, pH 8.5, GSH:GSSG ratio 40:1. Lane 11, 1.5 M arginine, pH 9.5, GSH:GSSG ratio 40:1.
Figure 33. Effect of protein concentration and GSH:GSSG ratio on in vitro refolding of rhBMP-6 expressed in Escherichia coli. A) Refolding of rhBMP-6 at low concentration (10.7 µm/mL). Lane 1, GSH:GSSG ratio 40:1. Lane 2, GSH:GSSG ratio 10:1. Lane 3, GSH:GSSG ratio 2:1. B) Refolding of rhBMP-6 at high concentration (53.4 µm/mL). Lane 1, GSH:GSSG ratio 40:1. Lane 2, GSH:GSSG ratio 10:1. Lane 3, GSH:GSSG ratio 2:1.
1 2 3 4 5 6 7 8 9 10 11 12 13 14 1 2 3 4 5 6 7 8 9 10 11
A B
14 KDa
21 KDa
31 KDa
45 KDa
66 KDa
97 KDa
1 2 3 1 2 3
A B
14 KDa
21 KDa
31 KDa
45 KDa
66 KDa
97 KDa
x1
x2
x3
x4
________________________________________________________________________Results
133
Figure 34. Effect of redox pair, redox pair concentration and N2 supply on in vitro refolding of rhBMP-6 expressed in Escherichia coli. A) Refolding of rhBMP-6 with 1 mM of GSH:GSSG, without N2 supply. Lane 1, GSH:GSSG ratio 2:1. Lane 2, GSH:GSSG ratio 10:1. B) Refolding of rhBMP-6 with 3 mM of GSH:GSSG, with continuous N2 supply. Lane 1, GSH:GSSG ratio 2:1. Lane 2, GSH:GSSG ratio 10:1. C) Refolding of rhBMP-6 with 3 mM of 4-MPAA:GSSG with continuous N2 supply. Lane 1, 4-MPAA:GSSG ratio 2:1. Lane 2, 4-MPAA:GSSG ratio 10:1.
Figure 35. Effect of the temperature on in vitro refolding of rhBMP-6 expressed in Escherichia coli. Lane 1, refolding performed at 10 ºC. Lane 2, refolding performed at 20 ºC.
None of the assayed combinations was able to produce a satisfactory yield of rhBMP-6
dimers. In all cases, the previously described ladder of bands appeared, though the degree of
polymerization versus dimerization varied among the different conditions used. For example,
the highest levels of polymerization (unspecific disufide bond formation) were obtained when
1 2 1 2 1 2
A B C
14 KDa
21 KDa
31 KDa
45 KDa
66 KDa
97 KDa
x1
x2
x4
x3
1 2
x1
x2
X3
14 KDa
21 KDa
31 KDa
45 KDa
66 KDa
Results________________________________________________________________________
134
using 1 M NDSB 256 or 0.5 M L-arginine as antiaggregants (Fig. 32) or when the protein
concentration was increased (Fig. 33 B).
4.4. Production of rhBMP-6 and rhBMP-6-CBD in Sf9 cells.
Since the refolding of the rhBMP-6 produced in Escherichia coli was unsuccessful, we
decided to try the production of these proteins in a eukaryotic expression system, in which the
folding of the monomers to obtain the native quaternary structure of the protein occurs within
the cell. The observation that rhBMP-6 monomers seem to be highly susceptible to form
polymers through unspecific disulfide bonds led us to use a baculoviral expression system in
which our goal proteins were co-expressed with the PDI. We hypothesized that this enzyme
could be helpful to shuffle incorrect disulfides into their correct pairings, what would improve
the yield of correctly folded dimers. Furthermore, in order to facilitate the recovery and
posterior purification of the produced proteins, we used a system by which the goal proteins are
produced with a fused signal peptide which directs them through the endoplasmic reticulum
and the Golgi apparatus for secretion into the culture medium. This signal peptide is excised
from the molecule by specific endopeptidases of the host cell before secretion.
4.4.1. Obtaining of rhBMP-6 and rhBMP-6-CBD expressing clones of
baculoviruses.
Once the genes encoding the rhBMP-6 and rhBMP-6-CBD were correctly cloned into the
pAcGP67B plasmid, Sf9 cells were co-transfected with the recombinant donor plasmid and
linearized Sapphire™ baculoviral DNA in order to obtain infective, heterologous protein-
expressing baculoviruses by homologous recombination. Eight days after transfection, the
cultures showed clear signs of infection (i.e., presence of both enlarged and lysed cells)
(Fig. 36), and the transfection supernatants (TS) were harvested. These TS are heterogeneous
mixtures of recombinant baculoviruses, cell debris and DNA molecules derived from the
degradation of donor plasmid and baculoviral DNA molecules.
________________________________________________________________________Results
135
Figure 36. Sf9 cells eight days after co-transfection with pAcGP67B:rhBMP-6 and Sapphire™ linearized baculoviral DNA. A) Control culture transfected only with the donor plasmid. B) Culture co-transfected with the donor plasmid and the baculoviral DNA. Small arrows point to lysed cells. Arrowheads point to cells with increased diameter, which are in the late phase of the infection cycle.
To ensure the reproducible production of the proteins, these must be expressed by a single
baculoviral clone. In order to obtain pure clones of the recombinant baculoviruses, the TS were
used to perform a plaque assay, infecting cultures with 10-3 to 10-8 dilutions and covering the
cells with agarose. Five days p.i., the cultures were stained with neutral red to identify the lysis
plaques (Fig. 37 A), which were found in the cultures infected with 10-3 to 10-6 dilutions of the
TS. Ten well-isolated lysis plaques were picked and the viruses they contained were analyzed
by PCR using specific primers against the viral DNA flanking the inserts (Fig. 37 B). Since the
lysis plaques were picked from cultures infected with high dilutions of the TS and the selected
plaques were small, round-shaped and well isolated from others, it was assumed that each of
them corresponded to one single viral clone.
One clone for each protein was selected and used for amplification to obtain a master stock
(MSV), which was then titered by a limit dilution assay. The calculated titer of the MSV of
rhBMP-6 was 4.35 x 109 pfu/mL, while the titer of the MSV of rhBMP-6-CBD was 1.16 x 1010
pfu/mL. Although the viruses isolated by the plaque assay were roughly analyzed by PCR to
confirm that they had the heterologous genes inserted into the viral DNA, a second PCR
analysis was performed on the master stocks. In this case, PCR reactions on both clones were
performed using a specific primer against the 3’-end of the bmp6 gene and a primer against the
5’-end of the gene or against the sequence of the CBD (Fig. 38). Furthermore, both clones were
sequenced with the primers against the viral DNA flanking the inserts to ensure that no
mutations or frame-shifting had occurred during the generation of the recombinant
baculoviruses.
A B
Results________________________________________________________________________
136
Figure 37. Isolation of baculoviral clones. A) Plaque assay for isolation of clones expressing rhBMP-6-CBD. The arrows point to the lysis plaques. B) PCR analysis of the selected clones using primers that hybridize with the baculoviral DNA flanking the insert. Lane 1, analysis of a clone expressing rhBMP-6. Lane 2, analysis of a clone expressing rhBMP-6-CBD.
Figure 38. PCR analysis of the isolated baculoviral clones. Lanes 1 and 2, Analysis of the rh-BMP6-CBD expressing clone with specific primers against the CBD and the BMP-6 sequence (P9 vs. P8, and P7 vs. P8), respectively. Lanes 3 and 4, Analysis of the rh-BMP6 expressing clone with specific primers against the CBD and the BMP-6 sequence (P9 vs. P8, and P7 vs. P8), respectively.
To obtain a high volume virus stock (HVVS) with which all the future protein productions
can be made, the MS were amplified by infecting cultures with a MOI of 0.1. This low MOI
allows the viral population to grow exponentially before the majority of the cells die, yielding a
high-titer suspension of virus. Finally, the obtained HVVS were titered to allow us to perform
the protein productions with a known and previously established MOI. The calculated titer of
the HVVS of rhBMP-6 was 3.48 x 108 pfu/mL, while the titer of the HVVS of rhBMP-6-CBD was
estimated to be 4.92 x 1014 pfu/mL.
1 Kbp
700 pb
1 2 A B
500 bp
200 bp
1 2 3 4
________________________________________________________________________Results
137
4.4.2. Production assays for rhBMP-6 and rhBMP-6-CBD.
To determine the best conditions for large scale protein production, a production assay was
performed with the two HVVS obtained. This was done infecting Sf9 cultures with a MOI of 2.5
or 10, and harvesting the medium of the cultures 72, 96, 120 and 144 hours p.i. (i.e.,
production times of 48, 72, 96 and 120 hours). Since previous works carried out by our group
on the production of other BMPs in Sf9 cells already demonstrated that the yield of this
expression system is not high enough to detect the heterologous proteins secreted into the
culture medium by SDS-PAGE and Coomassie blue staining, 400 µL of the harvested
conditioned media were precipitated with TCA and the samples analyzed by SDS-PAGE and
Western blot.
4.4.2.1. Production assay for rhBMP-6.
In the case of rhBMP-6, immunostaining of the proteins with a specific anti-BMP-6 antibody
revealed the presence of at least three proteins in the culture media which were recognized by
the antibody (Fig. 39). The rhBMP-6 produced in CHO cells, used as a C+, appeared as a triplet
of bands, with the central band having a MW of ±37 KDa. In the analyzed samples, the lowest
of the bands also had an estimated MW of ±37 KDa and could correspond to the dimeric,
glycosilated form of rhBMP-6. The intensity of this band increased from 48 to 72 hours and
decreased afterwards as the production time progressed. A second band, with an estimated
MW of ±56 KDa, was also found in all of the analyzed samples. This band, which intensity
slightly increased from 48 to 72 hours and then remained stable, could correspond to rhBMP-6
trimers. A third band, with an estimated MW of ±73 KDa, appeared slightly in the samples
corresponding to cells infected with a MOI of 2.5 but was more intense in the samples of cells
infected with a MOI of 10. This band could correspond to a tetrameric organization of rhBMP-6
molecules.
To determine whether the proteins observed in the Western blot analysis of the production
assay were disulfide bonded di-, tri-, tetra-, or polymers, or other non BMP-related proteins, the
samples of the cultures infected with a MOI of 10 were analyzed by western blot under
reducing conditions (Fig. 40). In this analysis it became clear that the three previously
described bands are more or less unique with 48 and 72 hours of production time, but that they
are not with longer production times. With 120 hours of production time, instead of a single
±37 KDa band, a triplet of bands (±34, ±37 and ±40 KDa) appeared.
Results________________________________________________________________________
138
Figure 39. Production assay for rhBMP-6, analyzed by Western blot. Lane 1, rhBMP-6 produced in CHO cells (R&D Systems). Lanes 2-5, rhBMP-6 produced with a MOI of 2.5 and 48, 72, 96 and 120 hours production time, respectively. Lanes 6-9, rhBMP-6 produced with a MOI of 10 and 48, 72, 96 and 120 hours production time, respectively.
In the presence of DTT, the three unique bands previously described for the 48 and 72
hours production time conditions disappeared, and were substituted by a doublet of bands (±18
and ±23 KDa), which molecular mass could correspond to that of the rhBMP-6 monomer. This
fact demonstrated that the higher molecular mass proteins observed under non-reducing
conditions are disulfide bonded proteins. This doublet also appeared after 96 and 120 hours,
although a great variety of higher molecular mass bands could also be observed in these
samples.
Figure 40. Western blot analysis with reducing agents of the rhBMP-6 produced in Sf9 cells. Lane 1, rhBMP-6 produced in CHO cells (R&D Systems). Lanes 2-5, rhBMP-6 produced with a MOI of 10 and 48, 72, 96 and 120 hours production time, respectively. Lanes 6-9, rhBMP-6 produced with a MOI of 10 and 48, 72, 96 and 120 hours production time, respectively, in the presence of DTT.
1 2 3 4 5 6 7 8 9
31 KDa
45 KDa
66 KDa
97 KDa
21 KDa
1 2 3 4 5 6 7 8 9
31 KDa
45 KDa
66 KDa
97 KDa
________________________________________________________________________Results
139
According to these results, the best conditions for rhBMP-6 production were determined to
be infecting with a MOI of 10 and harvesting the conditioned medium after 48-72 hours of
production time since, under these conditions, the highest yields of the ±37 KDa protein
(rhBMP-6 dimers) were found, with less contamination of tri-, tetra-, or polymers, or other non
BMP-related proteins.
4.4.2.2. Production assay for rhBMP-6-CBD.
In the case of rhBMP-6-CBD, immunostaining with the anti-BMP-6 antibody also revealed
three bands (Fig. 41). The lowest of these had an estimated MW of ±39 KDa and could
correspond to the dimeric, glycosilated form of rhBMP-6-CBD, which predicted MW is 38.56
KDa. The intensity of this band increased from 48 to 72 hours and decreased afterwards as the
production time progressed, has happened with the production assay analysis for rhBMP-6. The
second band had an estimated MW of ±58 KDa and the third band had an estimated MW of
±77 KDa. These bands could correspond to a trimeric and tetrameric organization of rhBMP-6-
CBD, respectively, and the evolution of their intensity with production time mimicked that of the
±39 KDa band. Under all circumstances, the intensity of the ±58 KDa band was higher than
that of the lower, ±39 KDa band
Figure 41. Production assay for rhBMP-6-CBD, analyzed by Western blot. Lane 1, rhBMP-6 produced in CHO cells (R&D Systems). Lanes 2-5, rhBMP-6-CBD produced with a MOI of 2.5 and 48, 72, 96 and 120 hours production time, respectively. Lanes 6-9, rhBMP-6-CBD produced with a MOI of 10 and 48, 72, 96 and 120 hours production time, respectively.
According to these results, the best conditions for rhBMP-6-CBD production were
determined to be infecting with a MOI of 10 and harvesting the conditioned medium after 72
hours of production time since, under these conditions, the highest yields of the ±39 KDa
1 2 3 4 5 6 7 8 9
31 KDa
45 KDa
66 KDa
97 KDa
Results________________________________________________________________________
140
protein (rhBMP-6-CBD dimers) were found, although the amounts of the other detected
proteins was also very high.
4.4.3. Analysis of the influence of the PDI on rhBMP-6 production in
Sf9 cells.
To determine if the excessive production of disulfide bonded polymers of rhBMP-6 was due
to the co-expression of the PDI by the Sapphire™ baculovirus, Sf9 cells were co-transfected
with the pAcGP67B:BMP-6 donor plasmid and BacPak6™ linearized baculoviral DNA in order to
obtain recombinant baculoviruses to express rhBMP-6 without co-expression of the PDI
chaperone. Eight days after co-transfection, the cells showed signs of infection, so the culture
medium was harvested and 1 mL was used to infect 6 x 106 Sf9 cells seeded on a 90 mm Petri
dish with the aim of amplifying the generated recombinant baculoviruses. Four days p.i., the
culture medium was harvested and used for a production assay for rhBMP-6. For this purpose,
Sf9 cells were seeded on a 24 well culture dish at a density of 5 x 105 cells/well and infected
with 25 µL of serial dilutions of the obtained baculovirus suspension, from 0 to 10-6. 96 hours
p.i. (72 hours production time), the conditioned media were harvested and analyzed by
Western blot (Fig. 42).
Figure 42. Production assay for rhBMP-6 expressed by BacPak6™ baculoviruses. Lane 1, uninfected control. Lane 2, rhBMP-6 produced in CHO cells (R&D Systems). Lanes 3-9, cultures infected with 0 to 10-6 dilutions of the viral suspension, respectively.
1 2 3 4 5 6 7 8 9
31 KDa
45 KDa
66 KDa
97 KDa
________________________________________________________________________Results
141
The cultures infected with the non-diluted viral suspension or with 10-1 or 10-2 dilutions
yielded the same dimer:polymer ratio as the rhBMP-6-expressing Sapphire™ baculoviruses, with
a great proportion of trimers. In contrast, no bands were recognized by the anti-BMP-6
antibody in the uninfected cultures.
These results indicate that the PDI is not responsible for polymer formation during rhBMP-6
expression in Sf9 cells. Nevertheless, since the PDI might be helpful for disulfide scrambling
among the dimeric rhBMP-6 fraction, what would increase the number of correctly folded
molecules in this population, the rest of the experiments were done using the rhBMP-6 and
rhBMP-6-CBD expressing Sapphire™ baculoviruses.
4.4.4. Expression and purification of rhBMP-6 and rhBMP-6-CBD.
Once the best conditions for rhBMP-6 and rhBMP-6-CBD had been established, larger scale
productions of both proteins were performed, culturing the cells at a density of 4 x 107
cells/flask in T-175 cm2 flasks and infecting them with a MOI of 10. 96 hours p.i. (72 hours
production time), the conditioned media were harvested and 6 M urea was added to prevent
protein precipitation within the purification column.
Purification of the protein was done by heparin-affinity chromatography, since the BMPs are
known to possess an amino-terminal heparin-binding site (Ruppert R et al., 1996). After
washing of the column and loading of the sample, a two-step elution of the proteins was
performed, using elution buffers with conductivity values of 31 mS/cm (0.43 M NaCl) and
63 mS/cm (1 M NaCl).
4.4.4.1. Purification of rhBMP-6.
The purification profile for rhBMP-6 showed one clear peak of the OD280 for each
conductivity value, indicating that at least two protein populations with different affinities to
heparin were separated (Fig. 43).
Results________________________________________________________________________
142
Figure 43. Purification by heparin-sepharose chromatography of rhBMP-6 expressed in Sf9 cells. The analyzed collection fractions are highlighted in a grey box.
The elution fractions corresponding to both OD280 peaks were analyzed by Western blot, as
well as the non-purified conditioned medium supernatant and the flow-through fraction
(Fig 44). Immunostaining with a specific anti-BMP-6 antibody showed the presence of the three
previously described bands in the conditioned medium supernatant, which are assumed to
correspond to rhBMP-6 dimers, trimers and tetramers, respectively. As happened in the
production assays, trimers were the most represented form of rhBMP-6 in this sample. No
proteins were recognized by the anti-BMP-6 antibody in the flow-through fraction.
Figure 44. Western blot analysis of the elution fractions obtained by heparin-sepharose chromatography of rhBMP-6 expressed in Sf9 cells. Lane 1, 20 ng of rhBMP-6 produced in CHO cells (R&D Systems). Lane 2, 25 µL of conditioned culture medium supernatant. Lane 3, 25 µL of the flow-through fraction. Lanes 4-18, 5 µL of the elution fractions e12-e26, respectively.
-0.06
-0.04
-0.02
0
0.02
0.04
0.06
0.08
0
10
20
30
40
50
60
70
OD280 Conductivity
e12-e26
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18
31 KDa
45 KDa
66 KDa
97 KDa
________________________________________________________________________Results
143
The ±39 KDa protein (rhBMP-6 dimer) appeared in fractions e12-e16, with a maximum of
intensity in fractions e13 and e14 (conductivity: 27.6-30.4 mS/cm). The ±56 KDa protein
(rhBMP-6 trimer) appeared in fractions e13-e26, with a maximum of intensity in fractions e14
and e15. The ±73 KDa protein (rhBMP-6 tetramer) appeared in fractions e14-e26, with a
maximum of intensity in fractions e21 and e22. Thus, the elution profiles of the different forms
of rhBMP-6 partially overlapped as proposed by the model shown in figure 45, what implies that
it is impossible to completely purify one of the forms using a standard FPLC system.
Figure 45. Proposed matrix elution model for rhBMP-6 forms expressed in Sf9 cells.
This behaviour could be considered a logic consequence of the fact that rhBMP-6 dimers
only possess two heparin-binding domains, while the trimeric and tetrameric forms possess
three and four of them, respectively. This also supports the idea that the heparin-binding
properties of BMP-6 are not due to structural aspects of the heparin-binding site, but only
depends on the net charge of the amino acid sequence that forms this domain.
The elution fractions e13, e14 and e15 were selected for further analysis, since they
contained the highest amounts of dimeric rhBMP-6. These fractions were reunited in one single
sample (rhBMP6 e13-e15).
4.4.4.2. Purification of rhBMP-6-CBD.
The purification profile for rhBMP-6-CBD could be considered identical to that of rhBMP-6,
showing one clear peak of the OD280 for each conductivity value, being the peaks comparable in
height and width to those of the rhBMP-6 purification profile (Fig. 46).
The elution fractions corresponding to both OD280 peaks were analyzed by Western blot, as
well as the non-purified conditioned medium supernatant and the flow-through fraction
n n+1 n+2 n+3 n+4 n+5 n+6
Elution fraction
rhBMP-6 tetramers
rhBMP-6 trimers
rhBMP-6 dimers
Results________________________________________________________________________
144
(Fig 47). Immunostaining with the specific anti-BMP-6 antibody showed the presence of the
three previously described bands in the conditioned medium supernatant, which are assumed to
correspond to rhBMP-6-CBD dimers, trimers and tetramers, respectively. In this case, rhBMP-6-
CBD dimers were found in more elution fractions (e12-e19), with a maximum of intensity in
fractions e13 to e18 (conductivity: 27.4-30.9 mS/cm). The ±58 KDa protein (rhBMP-6-CBD
trimer) appeared in fractions e13-e37, with a maximum of intensity in fractions e16 to e18. The
±77 KDa protein (rhBMP-6-CBD tetramer) appeared in fractions e35-e37, with a maximum of
intensity in fractions e35 and e36.
Figure 46. Purification by heparin-sepharose chromatography of rhBMP6-CBD expressed in Sf9 cells. The analyzed collection fractions are highlighted in grey boxes.
Figure 47. Western blot analysis of the elution fractions obtained by heparin-sepharose chromatography of rhBMP-6-CBD expressed in Sf9 cells. Lane 1, 20 ng of rhBMP-6 produced in CHO cells (R&D Systems). Lane 2, 25 µL of conditioned culture medium supernatant. Lane 3, 25 µL of the flow-through fraction. Lanes 4-14, 5 µL of the elution fractions e9-e19, respectively. Lanes 15-18, 5 µL of the elution fractions e35-e38, respectively.
-0.08
-0.06
-0.04
-0.02
0
0.02
0.04
0.06
0.08
10
20
30
40
50
60
70
530 535 540 545 550 555 560 565
Vol (mL)
0.08 70 0.06 0.04
0.02 0 -0.02
-0-04 -0.06 -0.08
60
50
40
30
20
10 OD280 Conductivity
e35-e38 e9-e19
31 KDa
45 KDa
66 KDa
97 KDa
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18
________________________________________________________________________Results
145
1 2 3 4 5 6
31 KDa
45 KDa
66 KDa 97 KDa
The elution fractions e12, e13 and e14 were selected for further analysis, since they
contained the highest amounts of dimeric rhBMP-6 with less contamination of trimers. These
fractions were reunited in one single sample (rhBMP6-CBD e12-e14).
4.4.4.3. Obtaining of rhBMP-6 and rhBMP-6-CBD under native conditions.
Since the purification of rhBMP-6 and rhBMP-6-CBD was performed in presence of 6 M urea,
and the elution of the proteins was induced by increased NaCl concentrations, the excess of
urea and NaCl had to be removed from the selected samples to obtain samples suitable for in
vitro testing of their biological activity. For this purpose, different strategies were tried:
- Dialysis of the samples against 4 mM HCl, against DMEM, pH 7.0, or against DMEM,
pH 4.9. This resulted in a slight increase of volume of the samples.
- Dialysis of the samples against 10 mM ammonium acetate, pH 4.0, lyophilization and
resuspension with water alone, water with 0.1% BSA, 4 mM HCl alone or 4 mM HCl
with 0.1 % BSA.
- Buffer exchange to 4 mM HCl in Vivaspin 2 columns (GE Healthcare).
After removing of the urea and the NaCl, the obtained samples were analyzed by Western
blot (Fig. 48).
Figure 48. Western blot analysis of the rhBMP-6 samples after removing the excess of urea and NaCl. Lane 1, 20 ng of rhBMP-6 produced in CHO cells (R&D Systems). Lane 2, rhBMP-6 e13-e15 before removing the excess of urea and NaCl. Lanes 3 and 4, rhBMP-6 e13-e15 dialyzed against DMEM, pH 7.0 or against DMEM, pH 4.9, respectively. Lane 5, rhBMP-6 e13-e15 dialyzed against 10 mM ammonium acetate, pH 4.0, lyophilized and resuspended with 4 mM HCl + 0.1% BSA. Lane 6, rhBMP-6 e13-e15 recovered from a Vivaspin 2 column after buffer exchange to 4 mM HCl.
Immunostaining of the samples with a specific anti-BMP-6 antibody showed that little
protein was lost in the samples that were dialyzed against DMEM or 4 mM HCl, since the loss of
Results________________________________________________________________________
146
intensity corresponded with the increase of the sample volumes. In the case of the lyophilized
samples, the proteins became more concentrated without detecting signs of protein loss due to
precipitation. In the case of the samples loaded on a Vivaspin column, most of the protein was
lost during the process. This could be attributed to protein precipitation within the column, or to
the proteins becoming trapped by the filter membrane.
4.4.5. In vitro analysis of the biological activity of rhBMP-6 and
rhBMP-6-CBD.
The biological activity of the obtained samples was assayed by testing their ability to induce
ALP expression on C2C12 mouse myoblasts cultured in vitro, since BMPs are known to have the
capacity to transdifferentiate these cells into the osteoblastic lineage.
For this purpose, C2C12 cells were seeded on 96-well culture plates with DMEM +
10% FBS. Once attached to the bottom of the plate, the cells were washed with DMEM +
2% FBS and finally incubated with DMEM + 2% FBS containing the different samples of
rhBMP-6 or rhBMP-6-CBD for 72 hours before measuring the ALP activity in the cultures.
The following samples were used for this assay:
- Serial 1/2 dilutions of the rhBMP-6 and rhBMP-6-CBD samples dialyzed against DMEM,
pH 4.9 or 7.0, in DMEM + 2% FBS, from 1/2 to 1/1,024.
- Serial 1/2 dilutions of the rhBMP-6 and rhBMP-6-CBD samples dialyzed against 10 mM
ammonium acetate and lyophilized, in DMEM + 2% FBS, from 1/10 to 1/5,120.
- Serial 1/2 dilutions of the rhBMP-6 and rhBMP-6-CBD samples recovered from the
Vivaspin 2 columns, in DMEM + 2% FBS, from 1/2 to 1/1,024.
- Serial 1/2 dilutions of the rhBMP-6 and rhBMP-6-CBD conditioned medium
supernatants dialyzed against DMEM, in DMEM + 2% FBS, from 1/2 to 1/1,024.
- Serial 1/2 dilutions of the rhBMP-6 and rhBMP-6-CBD conditioned medium
supernatants, in DMEM + 2% FBS, from 1/1 to 1/512.
- Serial 1/2 dilutions of rhBMP-6 produced in CHO cells (R&D Systems), in DMEM + 2%
FBS, from 1 µg/mL to 15.625 ng/mL.
After 72 hours of incubation, ALP activity was only detected in the C+ cultures incubated
with rhBMP-6 produced in CHO cells (Fig. 49). None of the samples containing rhBMP-6 or
rhBMP-6-CBD produced in Sf9 cells was able to induce ALP expression at any tested dilution.
________________________________________________________________________Results
147
Figure 49. ALP activity induced by rhBMP-6 produced in CHO cells on C2C12 mouse myoblasts. Data are represented as the mean ± SD. n=3.
4.5. Production of rh-bFGF and rh-bFGF-CBD in Sf9 cells.
Since an rh-bFGF-CBD has already been produced in Escherichia coli and both its biological
activity and collagen-binding ability tested (Andrades JA et al., 2001), we wanted to produce
rh-bFGF and rh-bFGF-CBD in a eukaryotic expression system, which resembles more to human
bFGF-expressing cells than E. coli.
The native bFGF is a monomeric protein with no intracatenary disulfide bonds, though
several cysteine residues, susceptible of forming unspecific disulfide bonds under permissive
conditions, are present in its primary structure. This fact led us to use a baculovirus system that
does not co-express the PDI, since the presence of this chaperone could lead to incorrect
folding of the recombinant proteins by establishing unspecific disulfide bonds.
Although natural bFGF seems to be secreted by an unconventional secretion pathway, by
which the protein is directly translocated through the plasma membrane without entering the
endoplasmic reticulum or the Golgi apparatus, we decided to produce the recombinant bFGF
proteins with a fused signal peptide to direct them through the conventional secretion pathway.
Since Sf9 cells are not natural producers of bFGF, these cells may not possess the elements
involved in the bFGF secretion mechanism, so production of bFGF without a signal peptide in
these cells could lead to accumulation of the recombinant proteins in the form of inclusion
bodies within them.
05
101520
2530354045
0 200 400 600 800 1000 1200
rhBMP-6 (ng/mL)
rhBMP-6 (R&D Systems)
Results________________________________________________________________________
148
4.5.1. Obtaining of rh-bFGF and rh-bFGF-CBD expressing clones of
baculoviruses.
Once the genes encoding the rh-bFGF and rh-bFGF-CBD were correctly cloned into the
pAcGP67B plasmid, Sf9 cells were co-transfected with the recombinant donor plasmid and
linearized BacPak6™ baculoviral DNA in order to obtain infective, heterologous protein-
expressing baculoviruses by homologous recombination. Six or nine days after transfection (for
rh-bFGF and rh-bFGF-CBD, respectively), the cultures showed signs of infection, so the
transfection supernatants (TS) were harvested.
The obtained TS were used to perform a plaque assay, infecting Sf9 cultures with 10-3 to
10-8 dilutions and covering the cells with agarose. Five days p.i., the cultures were stained with
neutral red to identify the lysis plaques, which were found in the cultures infected with 10-5 to
10-7 dilutions of the TS. Four well-isolated lysis plaques for rh-bFGF and six well-isolated lysis
plaques for rh-bFGF-CBD were picked and the viruses they contained were analyzed by PCR
using specific primers against the viral DNA flanking the inserts (Fig. 50).
Figure 50. PCR analysis of the isolated baculoviral clones using primers that hybridize with the baculoviral DNA flanking the insert (P42 vs. P43). A) Analysis of the rh-bFGF-CBD-expressing clones. Lane 1, negative control reaction on the pAcGP67B plasmid. Lanes 2-7, analysis of clones 1-6, respectively. B) Analysis of the rh-bFGF-expressing clones. Lane 1, negative control reaction on the pAcGP67B plasmid. Lanes 2-5, analysis of clones 1-4, respectively.
One clone for each protein was selected and used for amplification to obtain a master stock
(MSV), which was titered by a limit dilution assay. The estimated titer of the MSV of rh-bFGF
was 7.31 x 108 pfu/mL, while the titer of the MSV of rh-bFGF-CBD was 1.62 x 1011 pfu/mL.
Although the viruses isolated by the plaque assay were roughly analyzed by PCR to confirm that
they had the heterologous genes inserted into the viral DNA, a second PCR analysis was
performed on the master stocks. In this case, PCR reactions on both clones were performed
using a specific primer against the 3’-end of the bfgf gene and a primer against the 5’-end of
1 Kbp
700 bp 500 bp
200 bp
1 2 3 4 5 6 7 1 2 3 4 5 A B
1 Kbp
700 bp 500 bp
200 bp
________________________________________________________________________Results
149
the gene or against the sequence of the CBD (Fig. 51). Furthermore, both clones were
sequenced with the primers against the viral DNA flanking the inserts to ensure that no
mutations or frame-shifting had occurred during the generation of the recombinant
baculoviruses.
Figure 51. PCR analysis of the isolated baculoviral clones. Lanes 1 and 2, Analysis of the rh-bFGF expressing clone with specific primers against the bFGF and the CBD sequence (P13 vs P14, and P15 vs P14), respectively. Lanes 3 and 4, Analysis of the rh-bFGF-CBD expressing clone with specific primers against the CBD and the bFGF sequence (P15 vs P14, and P13 vs P14), respectively.
To obtain a high volume virus stock (HVVS) with which all the future protein productions
can be made, the MS were amplified by infecting cells cultured on 160 mm Petri dishes with a
MOI of 0.1. The obtained HVVS were titered to allow us to perform the protein productions with
a known and previously established MOI. The estimated titer of the HVVS of rh-bFGF was 2.76
x 1010 pfu/mL, while the estimated titer of the HVVS of rh-bFGF-CBD was 9.59 x 109 pfu/mL.
4.5.2. Production assays for rh-bFGF and rh-bFGF-CBD.
To determine the best conditions for large scale protein production, a production assay was
performed with the two HVVS obtained. For this purpose, Sf9 cultures were infected with a MOI
of 2.5 or 10, and the medium of the cultures was harvested 96, 120 and 144 hours p.i. (i.e.,
production times of 72, 96 and 120 hours). 400 µL of the harvested conditioned media were
precipitated with TCA and the samples analyzed by SDS-PAGE and Western blot.
4.5.2.1. Production assay for rh-bFGF.
Immunostaining of the proteins with a specific anti-bFGF antibody revealed one single band
in all the lanes corresponding to the conditioned culture media (Fig. 52). This band had an
1 2 3 4
500 pb
700 pb
200 pb
Results________________________________________________________________________
150
estimated molecular mass of ±16 KDa, which is the value described for the commercial bFGF
produced in Escherichia coli.
The highest intensity and integrity of this band was found in the medium of cultures
infected with a MOI of 10 and after a production time of 72 hours. With longer production
times, the intensity of the band diminished and a lower MW smear (possibly due to protein
degradation or incorrectly produced, truncated bFGF accumulation) became more patent.
Infection of the cultures with a MOI of 2.5 yielded less of this ±16 KDa protein and a similar
smear was found under the band with progression of the production time.
In the lane loaded with the commercial rh-bFGF (R&D Systems), the antibody recognized at
least three bands, with an estimated MW of ±16 KDa, ±33 KDa and ±50 KDa. According to
their molecular masses, the two highest bands could correspond to aggregated bFGF molecules
in the form of dimers and trimers, though these aggregations could not be due to unspecific
disulfide bonds since the buffer in which this commercial protein is diluted contains DTT to
avoid cysteine oxidation.
Figure 52. Production assay for rh-bFGF, analyzed by Western blot. Lane 1, 25 ng of commercial rh-bFGF (R&D Systems). Lanes 2-4, rh-bFGF produced with a MOI of 10 after 72, 96 and 120 hours of production time, respectively. Lanes 5-7, rh-bFGF produced with a MOI of 2.5 after 72, 96 and 120 hours of production time, respectively.
According to these results, the best conditions for rh-bFGF production were found to be
infecting with a MOI of 10 and harvesting the conditioned medium after 72 hours of production
time since, under these conditions, the highest yields of the ±16 KDa protein (rh-bFGF) were
found, with apparently less protein degradation.
1 2 3 4 5 6 7
14 KDa
21 KDa
31 KDa
45 KDa
66 KDa
________________________________________________________________________Results
151
4.5.2.2. Production assay for rh-bFGF-CBD.
In this case, immunostaining of the proteins with a specific anti-bFGF antibody also
revealed the presence of one single band in the conditioned culture media, with their behaviour
strongly resembling that of the bands found in the production assay for rh-bFGF (Fig. 53).
The estimated MW of this band was ±18 KDa, which could correspond to the predicted
value for rh-bFGF-CBD (± 17.28 KDa). Little differences were found between the cultures
infected with a MOI of 10 or 2.5. In both cases, the intensity and integrity of the band was
higher with shorter production times (72 hours), and diminished with longer production times.
After 120 hours of production time, a lower MW smear appeared under the ±18 KDa band.
Figure 53. Production assay for rh-bFGF-CBD, analyzed by Western blot. Lanes 1-3, rh-bFGF-CBD produced with a MOI of 10 after 72, 96 and 120 hours of production time, respectively. Lanes 4-6, rh-bFGF-CBD produced with a MOI of 2.5 after 72, 96 and 120 hours of production time, respectively. Lane 7, 50 ng of commercial rh-bFGF (R&D Systems).
According to these results, we decided that the best conditions for rh-bFGF production were
infecting indistinctly with a MOI of 10 or 2.5 and harvesting the conditioned medium after 72
hours of production time since, under these conditions, the highest yields of the ±18 KDa
protein (rh-bFGF-CBD) were detected, with apparently less protein degradation.
4.5.3. Expression and purification of rh-bFGF and rh-bFGF-CBD.
Once the best conditions for rh-bFGF and rh-bFGF-CBD had been established, larger scale
productions of both proteins were performed, culturing Sf9 cells at a density of 4 x 107
1 2 3 4 5 6 7
14 KDa
21 KDa
31 KDa
45 KDa
66 KDa
Results________________________________________________________________________
152
cells/flask in T-175 cm2 flasks and infecting them with a MOI of 10. 96 hours p.i. (72 hours of
production time), the conditioned media were harvested and directly loaded on heparin-
sepharose chromatography columns for purification. Elution of the proteins was performed
using a linear gradient from 0.15 M to 2 M NaCl (18.9 to 153.0 mS/cm).
4.5.3.1. Purification of rh-bFGF.
280 mL of conditioned medium were used for purification of rh-bFGF. The purification
profile for rh-bFGF showed two overlapping peaks of the OD280 between 22 and 80 mS/cm,
corresponding to at least two different protein populations with different, but relatively low,
affinities to heparin. Two smaller peaks were detected at the end of the profile, which
correspond to proteins that elute between 112 and 150 mS/cm (Fig. 54).
Figure 54. Purification by heparin-sepharose chromatography of rh-bFGF expressed in Sf9 cells. The analyzed collection fractions are highlighted in grey boxes.
Since the analysis of the production assays demonstrated that the rh-bFGF appears as a
single band, 10 µL of the elution fractions corresponding to the four OD280 peaks, the non-
purified conditioned medium supernatant and the flow-through fraction were analyzed by dot
blot instead of by Western blot, because this technique allows a faster analysis of more samples
at once (Fig. 55).
-0.06
-0.05 -0.04
-0.03
-0.02 -0.01
0
0.01 0.02
0.03
0
20
40
60
80
100
120
140 160
180
OD280 Conductivity
e7-e26 e42-e60
________________________________________________________________________Results
153
A
B
C
D
E
F
G
1 2 3 4 5 6 7
Figure 55. Immuno-dot blot analysis of the collection fractions of rh-bFGF produced in Sf9 cells and purified by heparin-sepharose chromatography. Spot 1A, 10 ng of commercial rh-bFGF. Spot 2A, culture medium supernatant. Spot 3A, flow-through fraction. Spot 4A, column washing with 20 mM Tris, pH 7.1, 1 mM EDTA, 1 mM DTT, 150 mM NaCl. Spots 5A-3D, collection fractions e7-e26. Spots 1E-5G, collection fractions e42-e60.
Immunostaining of the proteins with a specific anti-bFGF antibody showed the presence of
the rh-bFGF in the conditioned culture medium, while no rh-bFGF was detected in the flow-
through fraction, indicating that all of the recombinant protein was retained within the column
after loading of the sample. The rh-bFGF was also found in all of the analyzed elution fractions,
although a drastic decrease of intensity was detected after fraction e50 (138 mS/cm).
Since the elution fractions between e27 and e41 were not analyzed, it was not possible to
determine if the elution of rh-bFGF was continuous along the entire NaCl gradient, or if the
decrease of the OD280 between these fractions correlated with a decrease of concentration of
recombinant proteins within these fractions. Nevertheless, the strong negative slope of the
purification curve in this area made us assume that the rh-bFGF found between e7 and e26
(23-77 mS/cm), and the one found between e42 and e50 (112-129 mS/cm) correspond to at
least two different bFGF populations with different affinities to heparin. According to this, both
groups of fractions were reunited and further analyzed separately (rh-bFGF e7-e26 and rh-bFGF
e42-e50; or rh-bFGF “low heparin-affinity” and “high heparin-affinity” samples, respectively).
4.5.3.2. Purification of rh-bFGF-CBD.
210 mL of conditioned medium were used for purification of rh-bFGF-CBD. The purification
profile for rh-bFGF-CBD strongly resembled the one observed for rh-bFGF. Again, two
overlapping peaks of the OD280 were found when eluting with relatively low conductivity values
(26-79 mS/cm) and a group of small overlapping peaks were detected at the end of the
gradient, between 116 and 150 mS/cm. In this case, another relevant peak of the OD280 was
found between 90 and 101 mS/cm (Fig. 56).
Results________________________________________________________________________
154
-0.06
-0.05
-0.04
-0.03
-0.02
-0.01
0
0
20
40
60
80
100
120
140
160
180
OD280 Conductivity
e7-e15 e16-e31 e32-e39 e45-e71e40-e44
Figure 56. Purification by heparin-sepharose chromatography of rh-bFGF-CBD expressed in Sf9 cells. The analyzed collection fractions are highlighted in grey boxes.
10 µL of all of the elution fractions between e7 and e71 (26-150 mS/cm) were analyzed by
dot blot to determine which of the observed peaks of the OD280 correspond to rh-bFGF-CBD
elution. The non-purified conditioned culture medium supernatant and the flow-through fraction
were also analyzed (Fig. 57).
Figure 57. Immuno-dot blot analysis of the collection fractions of rh-bFGF-CBD produced in Sf9 cells and purified by heparin-sepharose chromatography. Spot 1A, culture medium supernatant. Spot 2A, flow-through fraction. Spots 3A-3I, collection fractions e7-e71. Spots 4I and 5I, 10 ng of commercial rh-bFGF.
1 2 3 4 5 6 7 8
A B C D E F G
I
H
________________________________________________________________________Results
155
Immunostaining of the proteins with the specific anti-bFGF antibody showed the presence
of the rh-bFGF-CBD in the conditioned culture medium, while no rh-bFGF was detected in the
flow-through fraction, indicating that all of the recombinant protein was retained within the
column. The rh-bFGF-CBD was found in all of the analyzed elution fractions, until e46 (121
mS/cm), although the intensity of the spots showed clear variations along the elution gradient.
Most of the rh-bFGF-CBD was found between e16 and e31 (49-87 mS/cm), corresponding with
the highest observed peak of the OD280. Nevertheless, a second, unexpected, intensity peak
was found between e41 and e 43 (106-113 mS/cm), not corresponding to any clear peak of the
OD280.
Since the elution gradient was linear, it could be concluded that both intensity peaks
correspond to different rh-bFGF-CBD populations with distinct affinities to heparin. According to
this, both groups of fractions were reunited and further analyzed separately (rh-bFGF-CBD
e16-e31 and rh-bFGF-CBD e40-e44; or rh-bFGF-CBD “low heparin-affinity” and “high heparin-
affinity” samples, respectively).
4.5.3.3. Obtaining of rh-bFGF and rh-bFGF-CBD under native conditions.
In summary, the samples obtained after purification of the recombinant proteins were:
Sample Volume (mL) Conductivity range (mS/cm) Average NaCl concentration (M)
rh-bFGF e7-e26 20 23-77 0.594
rh-bFGF e42-e50 9 112-129 1.530
rh-bFGF-CBD e16-e31 16 49-87 0.800
rh-bFGF-CBD e40-e44 5 104-116 1.395
Table 9. Samples of bFGF after purification by heparin-sepharose chromatography.
Although the purification of rh-bFGF and rh-bFGF-CBD was preformed in the absence of
urea or other denaturing or chaotropic agents, the high NaCl molarity of the samples did not
allow their use on cells or living tissues. To remove the excess of salt, 4 mL of each sample
were loaded on a Vivaspin 2 column with a 5 KDa MW cut-off and the elution buffer was
exchanged to PBS, pH 7.3, 1 mM DTT, 1 mM EDTA by repeated centrifugation and dilution
steps. At the end of the process, the NaCl concentration in the samples was reduced to values
below 20 mM and the final volumes of the samples were approximately 250 µL (Table 10).
Results________________________________________________________________________
156
Sample Volume (µL) Estimated NaCl concentration (mM)
rh-bFGF e7-e26 ±220 ±11
rh-bFGF e42-e50 ±250 ±18
rh-bFGF-CBD e16-e31 ±240 ±14
rh-bFGF-CBD e40-e44 ±250 ±15
Table 10. Samples of bFGF after buffer exchange and concentration.
To determine if the recombinant proteins were lost or could be recovered after the buffer
exchange, the obtained samples before and after the buffer exchange procedure were analyzed
by dot blot for comparison (Fig. 58).
Figure 58. Analysis by immuno dot-blot of the rh-bFGF and the rh-bFGF-CBD produced in Sf9 cells after purification and buffer exchange. Row 1, 1 µL of rh-bFGF e7-e26, rh-bFGF e42-e50, rh-bFGF-CBD e16-e31 and rh-bFGF-CBD e40-e44, respectively, before buffer exchange and concentration. Row 2, 1 µL of rh-bFGF e7-e26, rh-bFGF e42-e50, rh-bFGF-CBD e16-e31 and rh-bFGF-CBD e40-e44, respectively, after buffer exchange and concentration.
Immunostaining of the proteins with the specific anti-bFGF antibody revealed that both the
rh-bFGF e7-e26 and the rh-bFGF-CBD e16-e31 samples had suffered a significant loss of
proteins during buffer exchange and/or concentration. Although the spots corresponding to
these samples increased their intensity after this procedure, this increase was not high enough
to correlate with the 16-fold decrease of the sample volume achieved. In contrast, the proteins
with high affinity to heparin (rh-bFGF e42-e50 and rh-bFGF-CBD e40-e44) greatly increased
their concentration after the buffer exchange procedure, so it was assumed that no significant
protein loss had occurred in these samples.
An active bFGF molecule has to possess a high affinity to heparin, since binding of bFGF to
glycosaminoglycans is necessary for the formation of the bFGF-FGFR complex. The facts that
the samples rh-bFGF e7-e26 and rh-bFGF-CBD e16-e31 seemed to contain mostly bFGF forms
with a diminished affinity to heparin, and that most of the proteins of these samples were lost
by precipitation or by becoming trapped in the column membrane during buffer exchange,
made us decide to reject them. From now on, we will refer to the samples rh-bFGF e42-e50 and
rh-bFGF-CBD e40-e44 as rh-bFGF and rh-bFGF-CBD, respectively.
1 2
________________________________________________________________________Results
157
To determine the collagen-binding affinity and the biological activity of the proteins in the
samples, the concentration of the recombinant growth factors had to be estimated. For this
purpose, serial dilutions of both samples and of a commercial standard rh-bFGF solution of
known concentration were analyzed by Western blot. Densitometric analysis of the bands were
performed using the program ImageJ (Rasband, WS., ImageJ, U.S. National Institute of Health,
Bethesda, Maryland, USA). The estimated recombinant protein concentrations in the samples
were:
rh-bFGF: 16.67 µg/mL, i.e., 926.11 nM
rh-bFGF-CBD: 9.27 µg/mL, i.e., 481.81 nM
According to these values, the final yield of the production of these proteins in Sf9 cells
with the used expression system could be calculated:
rh-bFGF: ±33.50 µg/L, i.e., 1.86 nmol/L
rh-bFGF-CBD: ±13.80 µg/L, i.e., 0.72 nmol/L
4.5.4. Collagen-binding affinity tests for rh-bFGF and rh-bFGF-CBD.
To determine if the addition of the CBD in the engineered rh-bFGF-CBD conferred an
increased affinity to collagen to the molecule, a collagen-binding affinity test was performed
following a method described by T. Kitajima (Kitajima T et al., 2007). Absorbable collagen
type I sponge discs (1 mm thick, 5 mm diameter) were incubated with 10 µL of a solution
containing 1.25 pmol of either commercial rh-bFGF (R&D Systems), rh-bFGF or rh-bFGF-CBD for
2 hours at 37 ºC. Afterwards, the collagen sponges were washed for 1 hour with PBST and
immunostained with a specific anti-bFGF antibody. Finally, the amount of proteins bound to the
collagen sponges was quantified by digital image analysis using the program ImageJ (Rasband,
WS., ImageJ, U.S. National Institute of Health, Bethesda, Maryland, USA).
Immunostaining of the sponges revealed that almost all of the commercial rh-bFGF,
produced in Escherichia coli, was washed from the ACS (Fig. 59). Surprisingly, a slight staining
of the ACS incubated with rh-bFGF was observed, indicating that the rh-bFGF produced in Sf9
cells with the used expression system had an increased affinity to collagen when compared to
the growth factor produced in E. coli. These differences were found to be statistically significant
(p<0.05).
As hypothesized, the sponges incubated with rh-bFGF-CBD showed an increased staining
when compared to both the commercial rh-bFGF and the rh-bFGF produced in Sf9 cells, what
Results________________________________________________________________________
158
indicated that the addition of the CBD conferred a specific affinity to collagen type I to the
molecule. This increase of the collagen-binding properties of rh-bFGF-CBD was statistically
significant when compared to those of rh-bFGF, reaching a value close to 50%.
Figure 59. Collagen-binding test of rh-bFGF and rh-bFGF-CBD produced in Sf9 cells. A) Immunostaining with an anti-bFGF antibody of absorbable collagen sponges incubated with 1.25 pmol of rh-bFGF or rh-bFGF-CBD and washed for 1 hour with PBST. Black circles indicate the location of the sponges incubated with commercial rh-bFGF; the red circle indicates the location of the negative control sponge. B) Graphic showing the densitometric analysis of the spots. Data are represented as the blanked means ± SD, using a relative scale (0-255). n = 5; *p < 0.05.
Since the aim of the production of rh-bFGF-CBD was to obtain an active form of bFGF with
the ability of being retained for a longer period of time at the wound site when implanted in
vivo for bone repair purposes, with a consequent enhanced effect on tissue healing and safety
of the clinical approach, we wanted to determine if the binding of rh-bFGF-CBD to the
absorbable collagen sponges was stable in time. For this purpose, a new set of ACS discs were
incubated with 1.25 pM of either rh-bFGF or rh-bFGF-CBD for 2 hours at 37 ºC. Afterwards, the
sponges were washed for 6 days with PBST at 4 ºC before immunostaining of the proteins.
The immunostaining of the collagen sponges revealed that both the rh-bFGF and the
rh-bFGF-CBD remained bound after 6 days of extensive washing (Fig. 60). As observed when
the sponges were washed during only one hour, the collagen-targeted rh-bFGF-CBD showed an
increased affinity to collagen when compared to native rh-bFGF, being the difference
statistically significant (p<0.05).
0
5
10
15
20
25
30
35
rh-bFGF (R&D Systems)
rh-bFGF
rh-bFGF-CBD
rh-bFGF-CBD
rh-bFGF
rh-bFGF (R&D Systems)
C-
A B *
*rh-bFGF (R&D Systems)
rh-bFGF
rh-bFGF-CBD
________________________________________________________________________Results
159
Figure 60. Stability of the collagen-binding of rh-bFGF and rh-bFGF-CBD produced in Sf9 cells. A) Immunostaining with an anti-bFGF antibody of absorbable collagen sponges incubated with 1.25 pmol of rh-bFGF or rh-bFGF-CBD and washed for 6 days with PBST. The red circle indicates the location of the negative control sponge. B) Graphic showing the densitometric analysis of the spots. Data are represented as the blanked means ± SD, using a relative scale (0-255). n = 5; *p < 0.05.
According to these results, it could be concluded that the rh-bFGF and rh-bFGF-CBD
produced in Sf9 cells showed an enhanced affinity to collagen when compared to commercial
rh-bFGF produced in E. coli, and that binding of the growth factors to collagen type I sponges
was stable during long periods of time. Furthermore, the CBD of the rh-bFGF-CBD conferred to
the molecule an additional affinity to collagen type I.
0
10
20
30
40
50
rh-bFGF
rh-bFGF-CBD
*
rh-bFGF-CBD rh-bFGF
C- A B
*
Results________________________________________________________________________
160
4.5.5. In vitro analysis of the biological activity of rh-bFGF and
rh-bFGF-CBD.
4.5.5.1. Mitogenic activity of rh-bFGF and rh-bFGF-CBD on MC3T3-E1 mouse
preosteoblasts.
Since bFGF is especially known for being a potent mitogen for cells of mesodermic and
neuroectodermic origins, the biological activity of the produced recombinant growth factors was
tested in vitro by a proliferation assay on mouse preosteoblastic cells.
MC3T3-E1 mouse preosteoblast were seeded on 96-well culture plates at a density of
10,000 cells/well and incubated with 1.25 nM, 625, 312.50 or 156.25 pM of either rh-bFGF
produced in E. coli (R&D Systems), rh-bFGF or rh-bFGF-CBD. 72 hours later, the number of
cells/well was measured using an MTT-based colorimetric method.
After 72 hours of incubation with the highest concentration of any of the recombinant
growth factors, the cells showed evident morphological changes when compared to the control
cultures without bFGF (Fig. 61). The first had experienced a remarkable decrease of size,
showing a small, slightly fibroblastic or round-shaped cell body and long, thin cytoplasmic
prolongations which connected them with their neighbour cells or to the plate. These cells also
had a small, condensed nucleus and a well-defined cell border. In contrast, the cells of the
control cultures were much bigger and had a polygonal shape, with smaller cytoplasmic
prolongations if any. They showed a big nucleus and the borders of the cells were difficult to
identify.
These morphological changes were found to be dose-dependent, since the cells incubated
with the lowest concentrations of the recombinant growth factors showed an intermediate
phenotype between that of the cells incubated with 1.25 mM of bFGF and that of the cells in
the control cultures.
________________________________________________________________________Results
161
Figure 61. Phenotypical changes induced by rh-bFGF and rh-bFGF-CBD on MC3T3-E1 mouse preosteoblasts. Photomicrographs were taken after 72 hours of incubation with the growth factors and 2 hours of incubation with MTT labelling reagent. A, B and C) Cells incubated with 1.25 nM rh-bFGF (R&D Systems), rh-bFGF and rh-bFGF-CBD, respectively. D, E and F) Cells incubated with 156.25 pM of rh-bFGF (R&D Systems), rh-bFGF and rh-bFGF-CBD, respectively. G) Negative control culture of cells incubated without bFGF. Scale bars = 100 µm.
The conversion of the obtained OD570 values into number of cells per well showed that,
after 72 hours of incubation, the cells in the C- cultures had grown to a density of 30,121 ±
3,573 cells/well (Fig. 62). After the same period of incubation with any form of bFGF, the
cultures all reached higher densities (ranging from 39,790 ± 2390 to 54,960 ± 7861 cells/well),
being these differences statistically significant (p<0.05). Furthermore, no significant differences
were found between the cell proliferation achieved by the commercial rh-bFGF or by the
rh-bFGF or rh-bFGF-CBD produced in Sf9 cells when used at low concentrations (156.25 or
312.50 pM). Only in the cultures incubated with higher concentrations of growth factors
(625.00 pM or 1.25 nM), the commercial rh-bFGF was able to induce a significant higher level of
proliferation when compared to the growth factors produced in Sf9 cells (p<0.05).
A B C
D E F
G
Results________________________________________________________________________
162
Figure 62. Proliferation of MC3T3-E1 mouse preosteoblast induced by bFGF. At any concentration tested, the proliferation achieved in the cultures treated with any bFGF was significantly higher than the one observed in the control cultures. Only at the highest concentrations (1.25 nM and 625.00 pM), the commercial rh-bFGF was significantly more active than the rh-bFGFs produced in Sf9 cells. Data are represented as the means ± SD. n = 7; *p < 0.05.
Graphic representation of the data as activity curves showed more clearly how the initial
slopes of the curves of the three growth factors were identical (Fig. 63). Furthermore, no
differences between the curves corresponding to both growth factors produced in Sf9 cells
could be observed at any of the tested concentrations. Only at the highest concentrations
assayed, the commercial rh-bFGF showed slightly significant more mitogenic activity than the
recombinant growth factors produced with the baculoviral expression system.
Figure 63. Mitogenic activity curves of rh-bFGF and rh-bFGF-CBD. Data are represented as the means ± SD. n = 7; *p < 0.05.
25000
30000
35000
40000
45000
50000
55000
60000
65000
bFGF concentration
Num
ber
of c
e
rh-bFGF (R&D Systems)
rh-bFGF
rh-bFGF-CBD
0 156.25 625.00 1250 pM 312.50
*
*
rh-bFGF (R&D Systems)
rh-bFGF
rh-bFGF-CBD
C-
1.25 nM 625.00 pM 312.50 pM 156.25 pM bFGF concentration
0
10000
20000
30000
40000
50000
60000
70000Nu
mbe
r of c
ells
* *
* *
*
*
________________________________________________________________________Results
163
4.5.5.2. Inhibition of differentiation of MC3T3-E1 mouse preosteoblasts by rh-bFGF
and rh-bFGF-CBD.
To determine if the produced recombinant growth factors had the ability to inhibit the
osteoblasic differentiation of MC3T3-E1 preostoblastic cells induced by ascorbic acid, cells were
seeded on 96-well culture plates at a density of 10,000 cells/well in medium containing 0.2 mM
L-ascorbic acid and incubated with 1.25 nM, 625, 312.50 or 156.25 pM of either rh-bFGF
produced in E. coli (R&D Systems), rh-bFGF or rh-bFGF-CBD. Negative control cultures were
incubated under the same conditions without bFGF. 120 hours later, the number of cells/well
and the ALP activity in the cultures were measured using an MTT-based and a p-NPP-based
colorimetric method, respectively.
After 120 hours of incubation, no ALP activity could be detected in any of the cultures
treated with bFGF. Only in the negative control cultures, very low levels (0.338 ± 0.109 U/L) of
ALP activity were found. Nevertheless, when calculating the ALP activity per cell, these
differences were found to be statistically significant (Fig. 64).
Fig. 64. ALP activity in cultures of MC3T3-E1 mouse preosteoblasts in the presence of ascorbic acid and bFGF. Data are represented as the means ± SD. n = 7; **p < 0.01.
According to these results, it could be concluded that the recombinant growth factors
produced in Sf9 cells were able to inhibit the osteoblastic differentiation of preostoblasts in the
presence of ascorbic acid.
1.25 nM 625.00 pM 312.50 pM 156.25 pM -5E-10
0
5E-10
0.000000001
1.5E-09
0.000000002
2.5E-09
0.000000003
bFGF concentration
ALP
act
ivit
y (U
/cel
l)
rh-bFGF (R&D Systems)rh-bFGFrh-bFGF-CBDC-
** ** ** **3 x 10-9
2.5 x 10-9
2 x 10-9
1.5 x 10-9
1 x 10-9
5 x 10-10
-5 x 10-10
0
Results________________________________________________________________________
164
4.6. In vivo heterotopic bone formation.
To evaluate the biological activity of the rh-bFGF and rh-bFGF-CBD produced in Sf9 insect
cells and their capacity to enhance bone formation in combination with BMP-6, ACS discs
carrying 13.89 pmol rhBMP-6 alone, 1.25 pmol of rh-bFGF or rh-bFGF-CBD alone, or
combinations of these factors, were implanted into the dorsal muscles of rats. Commercial
rh-bFGF produced in E. coli was used as a positive control, while ACS discs loaded with vehicle
only served as a negative control.
21 days after surgery, all of the implants loaded with growth factors could be recovered
and no macroscopic signs of immune rejection or fibrotic encapsulation were observed. In
contrast, none of the negative control ACS, loaded with vehicle only, could be recovered due to
reabsorption.
All the implants that were loaded with rhBMP-6 (alone or in combination with bFGF) showed
a well-defined border and hard consistency, though varied in size. In opposition, most of the
implants that were loaded with commercial rh-bFGF, rh-bFGF produced in Sf9 cells or
rh-bFGF-CBD alone, were difficult to localize in the muscle and mainly appeared as more loose,
sometimes disperse, particles.
The histological analysis of the implants loaded with commercial rh-bFGF, rh-bFGF
produced in Sf9 cells or rh-bFGF-CBD alone showed that these all had given raise to a more or
less dense, fibrotic tissue in which no signs of ossification and almost no signs of angiogenesis
could be detected (Fig. 65). Spread throughout the implants, dense accumulations of an
apparently disorganized, unidentified extracellular matrix were observed (asterisks in Fig. 65),
being these accumulations especially frequent and compact in the implants loaded with rh-bFGF
and rh-bFGF-CBD produced in insect cells. Staining of these implants with Masson’s trichrome
revealed the presence of collagen molecules within the extracellular matrix accumulations,
especially in those found in the implants loaded with commercial rh-bFGF.
________________________________________________________________________Results
165
Figure 65. Staining of the implants without BMP-6 with H-E (A, B and C) and Masson’s trichrome (D, E and F). A, D) Implant with commercial rh-bFGF. B, E) Implant with rh-bFGF produced in Sf9 cells. C, F) Implant with rh-bFGF-CBD. asterisks: extracellular matrix accumulations; m: muscle. Scale bars = 100 µm.
A
B
D
E
C Fm
m
m
m
*
* *
*
*
*
*
*
* *
*
Results________________________________________________________________________
166
All the implants loaded with rhBMP-6 (alone or in combination with bFGF) showed clear
signs of osteogenesis, leading to the formation of a bony tissue with a trabecular appearance
(Fig. 66). Staining of the implants with hematoxylin-eosin revealed the existence of trabeculae,
especially at the periphery and, to a greater or lesser extent, also at the inner part of the
samples, with numerous osteocytes embedded inside of them. By staining of the samples with
Masson’s trichrome these trabeculae appeared green, indicating that they were mainly
composed of collagen.
The external surface of the implants was, in most cases, covered by a dense, fibrous cluster
of mesenchymal cells, organized as more or less concentric layers around the external
trabeculae. In contrast, the inner part of the implants was mainly filled with a bone marrow-like
tissue, constituted of large quantities of undifferentiated mesenchymal cells. In between these
cells it was possible to observe blood lacunae, which had an irregular shape and poorly defined
borders, corresponding to blood vessels in a very immature state. Other implants showed more
mature blood vessels with clearly differentiated endothelial cells and, in some cases, cells
forming a partial second layer around the endothelium, resembling perivascular cells. These
blood vessels varied in diameter but exceeded 200 µm in some implants. Adipocytes were
found spread throughout the inner part of the implants, more or less isolated or forming small
groups.
In some implants, it was possible to find zones of hypertrophic cartilage, indicating that
bone formation occurred, at least at some areas, by the endochondral ossification mechanism.
Staining of the implants with alcian blue, which binds to the acid and sulphated residues of the
glycosaminoglycans present in the cartilaginous matrix, revealed the presence of more
immature patches within the bony trabeculae, corresponding to areas where the cartilaginous
matrix was not yet completely substituted by osteoid and mineralized (Fig. 67). As expected,
alcian blue staining was especially intense in the areas where the hypertrophic chondrocytes
were localized.
________________________________________________________________________Results
167
Figure 66. Staining of the implants with BMP-6 with H-E (A, B, C and D) and Masson’s trichrome (E, F, G and H). A, E) Implant with rhBMP-6 alone. B, F) Implant with rhBMP-6 + commercial rh-bFGF. C, G) Implant with rhBMP-6 + rh-bFGF produced in Sf9 cells. D, H) Implant with rhBMP-6 + rh-bFGF-CBD. bl: blood lacunae. bm: bone marrow-like tissue; f: fibrous layers. m: muscle; t: trabeculae; v: blood vessels. Scale bars = 100 µm.
A E
B F
C G
m m
m m
mm
m
t
t
t
t
t
t
t
t
t
t
t
t
t t
f
f
f
f f
f
f
f
bl
bm
bm
bmv
v v
v v
v bm
bl bl
bl
bl bl
bl
bm bm
D H
m
bm
t t
t
t m
bm
Results________________________________________________________________________
168
Figure 67. Staining of the implants with alcian blue. A) Implant with rhBMP-6 alone. B) Implant with rhBMP-6 + commercial rh-bFGF. C) Implant with rhBMP-6 + rh-bFGF produced in Sf9 cells. D) Implant with rhBMP-6 + rh-bFGF-CBD. bl: blood lacunae. bm: bone marrow-like tissue; m: muscle; t: trabeculae; v: blood vessels. Scale bars = 100 µm.
Immunolocalization of osteopontin with a specific anti-osteopontin antibody revealed the
expression of this early osteogenic marker in all the implants loaded with BMP-6, alone or in
combination with bFGF (Fig. 68). Osteopontin was found in the bone trabeculae, where it was
heterogeneously localized but mainly concentrated at their external surfaces, defining the areas
of active synthesis of new osteoid. Some of the osteocytes embedded in the trabecular osteoid
also showed certain immunoreactivity with the antibody used for staining.
Among the bone marrow, osteopontin could be found as more or less small accumulations
in the extracellular matrix. It was also possible to observe numerous osteoblasts expressing this
protein between the undifferentiated mesenchymal cells.
A
m t
bm
B
vv
v
t
t bm
D
m
t
v
m
t
m
bm
C
v
v
v v
t
t
t
bm
________________________________________________________________________Results
169
Figure 68. Immunostaining of the implants with an anti-osteopontin antibody. A) Implant with rhBMP-6 alone. B) Implant with rhBMP-6 + commercial rh-bFGF. C) Implant with rhBMP-6 + rh-bFGF produced in Sf9 cells. D) Implant with rhBMP-6 + rh-bFGF-CBD. bm: bone marrow-like tissue; m: muscle; t: trabeculae; v: blood vessels; arrowheads: osteopontin accumulations; Scale bars = 100 µm.
4.6.1. Analysis of the implants with rhBMP-6 alone.
The implants that were loaded with rhBMP-6 alone were, in general, smaller in size than the
rest of the rhBMP-6-containing implants (Fig. 69). They showed bone trabeculae containing
osteocytes mainly at the outer surface but almost not at the inner part of the implant. These
trabeculae showed little staining with alcian blue, indicating that almost no cartilaginous matrix
was left within them. The inner part of the implants was constituted of a very dense
accumulation of undifferentiated mesenchymal cells in between which only few, disperse
adipocytes could be observed. Immunostaining with a specific anti-osteopontin anitbody
revealed that this protein was accumulated mainly within the osteoid of the trabeculae and that
only small groups of osteoblast were expressing this osteogenic marker in the rest of the
implant, indicating that there was little osteogenic activity in the sample. Only some immature
blood lacunae and small blood vessels could be observed throughout these implants.
A m
t
bm
C
v
v v
t
bm
B
v
v
bm t
D
m
t
bm
Results________________________________________________________________________
170
Figure 69. Histological analysis of the implants with rhBMP-6 alone. A) H-E staining. B, C and D) Immunolocalization of osteopontin. D shows a magnification of the area marked in C. bm: bone marrow-like tissue; f: fibrous layers; t: trabeculae; arrowheads: osteoblasts expressing osteopontin. Scale bars = 100 µm in A, B and C; 20 µm in D.
4.6.2. Analysis of the implants with rhBMP-6 and commercial rh-bFGF.
The implants that were loaded with rhBMP-6 and commercial, E. coli-derived rh-bFGF
showed a clear border formed by bone trabeculae containing numerous osteocytes, as observed
in the implants that were loaded with rhBMP-6 alone (Fig. 70). Nevertheless, the inner part of
the implants was also occupied by a broad network of trabeculae. In between the trabeculae, a
bone marrow-like tissue was observed, containing undifferentiated mesenchymal cells but also
many adipocytes. Osteopontin was localized not only in the osteoid of the trabeculae, but some
of the implants also showed areas of osteopontin-containing material with a fibrous,
disorganized appearance (arrowheads in Fig. 70 B). Many blood lacunae and some relatively big
blood vessels could be found along the implant, with some of these blood vessels showing a
well-defined endothelium. In some cases, additional layers of cells could be observed associated
with the endothelium, resembling perivascular organizations (asterisk in Fig. 70 E) and
indicating a greater maturity of these vessels.
BA
C
t
bm
t
bm
t
bm
D
f
f
________________________________________________________________________Results
171
Figure 70. Histological analysis of the implants with rhBMP-6 + commercial rh-bFGF. A, E and F) H-E staining. B, C and D) Immunolocalization of osteopontin. F shows a magnification of the area marked in E. a: adipocytes; bl: blood lacunae; bm: bone marrow-like tissue; t: trabeculae; v: blood vessels; arrowheads: osteopontin accumulations; arrows: osteocytes; double arrows: endothelial cells; asterisks: perivascular organizations. Scale bars = 100 µm in A, B, C and D; 50 µm in E; 20 µm in F.
4.6.3. Analysis of the implants with rhBMP-6 and rh-bFGF produced in Sf9 cells.
The implants that were loaded with rhBMP-6 and rh-bFGF produced in insect cells were
very similar to the ones that were loaded with rhBMP-6 and commercial rh-bFGF, showing bone
trabeculae with numerous osteocytes at the surface and at the inner part, and a bone marrow-
like tissue with areas of adipose tissue and disperse adipocytes in between the undifferentiated
mesenchymal cells (Fig. 71). Nevertheless, these implants contained small osteopontin
A B
C
a
v v
v
t
t
bm
v
a
a
D
bl
t
t
E
bm
t
v
*
F
*
t v
Results________________________________________________________________________
172
accumulations within the bone marrow, but no disorganized, fibrous, osteopontin-containing
material could be observed. Furthermore, all of the implants contained numerous blood lacunae
and very big blood vessels. The latter reached 200 µm of diameter in some cases and showed a
well defined endothelial border. As happened in the implants loaded with rhBMP-6 and
commercial rh-bFGF, groups of perivascular cells could be found associated to some of the
blood vessels (asterisk in Fig. 71 E). These implants showed the most mature appearance of all
the analyzed samples.
Figure 71. Histological analysis of the implants with rhBMP-6 + rh-bFGF produced in Sf9 cells. A and F) H-E staining. B, C, D and E) Immunolocalization of osteopontin. a: adipocytes; bm: bone marrow-like tissue; t: trabeculae; v: blood vessels; arrowheads: osteopontin accumulations; arrows: osteocytes; double arrows: endothelial cells; asterisks: perivascular organizations. Scale bars = 100 µm in A, B and C; 50 µm in D and F; 20 µm in E.
A B
C D
v v
a
bmt
a
v
v
tbm
t
bm
bm
F
bm
t
v
*
E
t
________________________________________________________________________Results
173
4.6.4. Analysis of the implants with rhBMP-6 and rh-bFGF-CBD.
The implants that were loaded with rhBMP-6 and rh-bFGF-CBD were comparable in size to
those loaded with rhBMP-6 and commercial or Sf9-derived rh-bFGF. Nevertheless, the general
aspect of these implants was clearly different than the latter, having the appearance of bony
tissue in an earlier stage of maturation (Fig. 72). Bone trabeculae containing osteocytes were
heterogeneously distributed along the implants, defining areas of more mature and areas of
less mature bone. In these less mature areas it was possible to observe many hypertrophic
chondrocytes embedded in a strong alcian blue-positive matrix (Figs. 67 D and 72 C and D).
Although some hypertrophic chondrocytes could be found in the other implants, these were
especially abundant in the ones loaded with rhBMP-6 and rh-bFGF-CBD. In between these
patches of hypertrophic cartilage, abundant fibrous-like accumulations of osteopontin-
containing material could be observed (arrowheads in Fig. 72 C), similar to those found in some
of the implants loaded with rhBMP-6 and commercial rh-bFGF.
The bone marrow-like tissue of these implants contained only few adipocytes and almost no
signs of angiogenesis.
Figure 72. Histological analysis of the implants with rhBMP-6 + rh-bFGF-CBD produced in Sf9 cells. A) H-E staining. B and C) Immunolocalization of osteopontin. D) Alcian blue staining. a: adipocytes; bm: bone marrow-like tissue; hc: hypertrophic chondrocytes; m: muscle; t: trabeculae; v: blood vessels; arrowheads: osteopontin accumulations; arrows: osteocytes. Scale bars = 100 µm.
C
A
D
B
hc
hc
hc
hc
m
t
bm
v
t
t
174
5. Discussion.
175
176
Discussion
5.1. Engineering of the growth factors.
5.1.1. Engineering of the gene encoding the rhBMP-6-CBD.
Since U-2 OS osteosarcoma cells are known to express high levels of BMP-6, they were
used as the primary source of the bmp-6 mRNA. By RT-PCR, the sequence that encodes the
mature domain of the hBMP-6 was retro-transcribed to cDNA, amplified and cloned into the
routine maintenance vector pBIISK. We decided to use only the sequence of the mature
domain, removing the sequences for the preceding pre-peptide and pro-domain, to simplify the
expression in the host cells and to allow us to add the sequence of the CBD derived from the
vWF to the N-terminus of the protein. The pre-peptide and pro-domain are excised from the
BMP during its processing inside the cell and are not known to be necessary for the protein to
acquire its native, folded and active structure (Hillger F et al., 2005). Furthermore, the pre-
peptide seems to mediate translocation of the pre-pro-protein into the lumen of the
endoplasmic reticulum, what becomes unnecessary when the heterologous proteins are
expressed in a prokaryotic system. In the case of the eukaryotic expression systems used, the
shuttle vector in which the gene is cloned provides the GP64 signal peptide sequence to direct
the produced heterologous proteins to the lumen of the endoplasmic reticulum. This signal
peptide, located at the N-terminus of the protein, is eliminated by the endopeptidases of the
host cell before secretion of the protein to the culture medium.
On the other hand, the function of the pro-domain is still unclear, although it has been
suggested that it could delay the maturation of the growth factor until its excision, controlling
the BMP activity in vivo (as happens with the latency-associated peptide of TGF-β) or mediate
oxidative structure formation of the BMPs.
These facts, together with the demonstration that both BMP-2 and pro-BMP2 can be
refolded in vitro from the denatured state (Hillger F et al., 2005) made us decide to use only
the sequence of the mature domain.
For the production of the rhBMP-6-CBD, the sequence encoding the decapeptidic collagen
binding domain derived from the von Willebrand factor was added to the bmp-6 sequence to
obtain this CBD fused to the N-terminus of the molecule. This location was chosen since the
cysteine-rich region involved in the constitution of the cysteine knot and the regions involved in
binding to the BMP receptors are mainly located at the C-terminus (McDonald and Hendrickson,
1993). Thus, addition of the CBD to the C-terminus might cause incorrect folding of these
structures or, if not, partially hide the correctly folded BMPR-recognition sites.
In opposition, the N-terminus of the BMPs contains 6 arginine residues and possesses a
strongly positive net charge. This region seems to be responsible for the affinity to heparin
177
Discussion_____________________________________________________________________
shown by the BMPs, which may help to modulate their biological effects in vivo, but is not
directly involved in signal transduction (Ruppert R et al., 1996).
The original sequence of the CBD contains one cysteine residue (Takagi J et al., 1992),
which could react with any of the other 7 cysteines present in the mature domain to form an
unspecific disulfide bond, hindering the correct establishment of the cysteine knot and, thus,
giving rise to an inactive, aberrant BMP. In our construction, the cysteine of the CBD was
replaced by a methionine (Tuan TL et al., 1996) in order to limit the probability of the CBD to
interfere with the correct folding of the protein.
Other recombinant growth factors produced with this same CBD by other groups also
contained a hexa-histidine purification tag and a thrombin recognition site to excise this tag
after recovery and purification of the protein (Tuan TL et al., 1996; Han B et al, 1997; Andrades
JA et al, 2001). Since the presence of six histidine residues (which have a positive net charge)
could interfere with the folding of the protein, and our aim was to obtain the growth factors
with the fewer modifications and to perform as little in vitro manipulations as possible, we only
added the decapeptidic CBD and a tripeptidic (Gly-Ala-Ser) linker sequence to the molecule. The
presence of the glycine in the linker sequence should allow free rotation of the CBD and
minimize possible conformational impediments between the CBD and the N-terminal domain of
the growth factor.
5.1.2. Obtaining of the genes encoding the rh-bFGF and the
rh-bFGF-CBD.
The genes encoding the rh-bFGF and rh-bFGF-CBD were directly obtained from the two
constructions (pET28b:hbFGF-F1 and pET28b:hbFGF-F2) that were used for their expression in
Escherichia coli as described in Andrades JA et al., 2001. Although these constructions
contained the above mentioned sequences for a His6 purification tag and a thrombin recognition
site, these elements were not amplified together with the growth factors during the PCRs
performed to transfer them to the pAcGP67B shuttle vector since we wanted to avoid the extra
manipulation steps necessary to remove them after the purification of the molecules.
178
Discussion
5.2. Production of rhBMP-6 in Escherichia coli.
The first attempt on rhBMP-6 production was performed in E. coli, since this expression
system was demonstrated to be suitable for the production of active rhBMP-2 and rhBMP-2-CBD
with acceptable yields (Visser R et al., 2009). As in this case, the Rosetta™ (DE3) strain was
used for expression of the growth factor, since this strain possesses the tRNA molecules for
codons that are rare in prokaryotic organisms. The sequence encoding the mature domain of
the hBMP-6 includes 12 of these codons (1 AGA, 1 CGA, 1 ATA, 3 AGG, 3 GGA and 3 CCC),
which could cause frame-shifting during the translation of the sequence (with the consequent
formation of truncated proteins) if the used strain does not express sufficient of these rare
tRNAs (Kane JF, 1995).
The addition of IPTG to the culture of bacteria transformed with the pET17b:rhBMP-6
expression vector resulted in a clear reduction of the growth rate, what could be due to high-
level expression of heterologous proteins. Indeed, SDS-PAGE analysis of the total protein
content of the bacteria revealed the presence of one highly-represented, ±16.5 KDa protein
which was assumed to correspond to the rhBMP-6 molecule. Although this protein constituted
more than 40% of the total protein content and most of it could be isolated in the insoluble
protein fraction of the cells, it is well known that the following in vitro manipulations needed to
obtain a purified sample of correctly refolded and biologically active growth factors imply a
great loss of proteins. This is especially important in the case of BMPs, which need a complex
refolding procedure to obtain correctly folded dimers and have a great tendency towards
aggregation and precipitation in their unfolded states.
Most of the methods used to obtain active BMPs expressed in Escherichia coli consist in
complex purification steps to separate the monomers from the rest of the protein content of the
cells, followed by dialysis, in vitro refolding and one or two more purification steps to isolate the
obtained dimers from the remaining monomers (Ruppert R et al., 1996; Long S et al., 2006). All
this makes the obtaining of active BMPs a long and complex process with many in vitro
manipulations and important losses of recombinant proteins during the entire procedure. To
partially avoid these problems we followed the method described by Vallejo LF et al., 2002 for
the renaturation and purification of BMP-2, which also resulted useful for the successful
refolding and purification of an rhBMP-2-CBD (Visser R et al., 2009). This method simplifies the
needed procedure as it consists in isolation of the produced inclusion bodies by simple washing
steps, followed by solubilization, direct refolding of the non-purified monomers, and one single
purification step to separate the dimeric molecules from the remaining monomers.
One of the main issues during the in vitro refolding of BMPs is the loss of proteins due to
aggregation of the folding intermediates by their exposed hydrophobic patches and consequent
179
Discussion_____________________________________________________________________
precipitation. Different strategies can be used to minimize this aggregation, such as performing
the renaturation at very low protein concentrations, at low temperature and/or including
antiaggregants into the refolding mixture. The method described by Vallejo LF et al. assessed
renaturation of rhBMP-2 and rhBMP-2-CBD at high concentrations (up to 50 µg/mL) by the
addition of the antiaggregant CHES, which seems to stabilize the folding intermediates,
preventing them from establishing hydrophobic interactions with other molecules.
Unfortunately, the refolding conditions established by these authors resulted not to be suitable
for the in vitro refolding of rhBMP-6 and, in consequence, forty other conditions were designed
and assayed.
All the 41 combinations of parameters tested for the refolding of the rhBMP-6 monomers
gave rise to a mixture of monomeric, dimeric, trimeric, tetrameric and polymeric associations,
although the ratio of dimeric BMP-6 versus other forms was always low. The fact that this effect
could be reverted in the presence of a reducing agent such as DTT demonstrated that these
associations of monomers were due to the establishment of disulfide bonds between them and
not to hydrophobic or other interactions. In most of the cases in which CHES was used as
antiaggregant, the degree of association was relatively low, and most of the rhBMP-6 remained
monomeric. In contrast, when the antiaggregant was changed to a non-detergent sulfobetaine
or to L-arginine, the majority of the peptides formed high molecular mass polymers. This effect
was only mimicked by a CHES-containing refolding mixture when the protein concentration was
raised to 53.4 µm/mL. Thus, it could be thought that NDSB265 and L-arginine are less suitable
antiaggregants than CHES for BMP-6 refolding, since these molecules are supposed to interact
with the peptides, hiding their hydrophobic patches and exposing their reactive cysteines to
allow the establishment of disulfide bonds. NDSB265 and L-arginine seem to interact less with
the BMP-6 molecules, allowing the formation of many unspecific disulfides in a similar way as
when the protein concentration is increased and the probability of encounter between two
peptides is raised. In contrast, the interaction between CHES and the BMP-6 peptides seems to
result in less exposure of the cysteines and, thus, fewer disulfide bond establishments.
When the same conditions are used for the refolding of rhBMP-2, only monomeric and
dimeric molecules can be observed after 72 hours (Vallejo LF et al., 2002; Chen B et al.,
2007a ; Visser R et al., 2009) . This indicates that, in contrast to BMP-2, BMP-6 has multiple
thermodynamically stable conformations, although only one of these is supposed to correspond
to the biologically active molecule.
In any case, since the rate of unspecific disulfide bond formation was very high during the
refolding process, it might be assumed that even among the dimeric fraction observed under
some conditions, only a small percentage (if any) would correspond to correctly folded BMP-6.
According to this, attempts on purifying these putative active dimers were considered unviable
and it was concluded that in vitro refolding of rhBMP-6 expressed in Escherichia coli is not
180
Discussion
suitable. This conclusion was later supported by other groups, which also made unsuccessful
approaches to E. coli-derived BMP-6 refolding in vitro (Saremba S et al., 2008; personal
communications).
5.3. Production of rhBMP-6 and rhBMP-6-CBD in Sf9 cells.
Since we were unsuccessful in obtaining biologically active rhBMP-6 by the Escherichia coli
expression system, we decided to make a second attempt using a eukaryotic expression
system. We chose a baculovirus-Sf9 system, since these cells provide a suitable cellular milieu
for the production of heterologous proteins and can carry out the main posttranslational
modifications, such as signal peptide cleavage, phosphorylation, N- and O- glycosylation,
disulfide bond formation, and substitution of unusual analogs into proteins, in a similar way as
mammalian cells (Luckow VA, 1991). These expression systems are also known to be cheaper
and to produce higher yields than typical mammalian cell expression systems. Furthermore,
besides many structurally simpler proteins, some proteins containing a cysteine knot have been
produced with success using these kinds of expression systems, including murine and Xenopus
PDGF (Wang C et al., 1992), a human BMP-2 (Maruoka Y et al., 1995) and several Xenopus
BMPs (Hazama M et al., 1995; Aono A et al., 1995).
The high degree of unspecific disulfide bond formation observed after the attempts on in
vitro refolding of rhBMP-6 produced in E. coli made us decide to use a baculoviral system that
co-expresses the protein disulfide isomerase (PDI), since this foldase is known to facilitate both
disulfide bond formation and isomerization (Gruber CW et al., 2006) and it has been shown that
its co-expression can enhance the secretion of heterologous proteins expressed in insect cells
(Hsu TA et al., 1996).
We also decided to use an expression system in which recombinant protein expression is
under control of the polyhedrin promoter (PPolh), which is strongly activated during the late
stages of the infection cycle. This promoter is the most used for heterologous protein
expression by baculoviral systems, since it ensures the highest yields of recombinant proteins.
The analysis of the production assays performed for rhBMP-6 and rhBMP-6-CBD showed
that both proteins were mainly found in the culture media in the form of trimers, although a
significant percentage of dimers and small amounts of tetramers and higher polymers were also
observed, somewhat resembling the results obtained for the in vitro refolding of the rhBMP-6
produced in E. coli. Nevertheless, no signs of unfolded monomers were found.
The concentration of the recombinant proteins in soluble form was usually highest when
production times of 72 hours were used, diminishing when the infection was continued for
longer periods. This effect could be due to protein aggregation followed by precipitation when
181
Discussion_____________________________________________________________________
the concentration in the culture medium reaches a certain threshold. Nevertheless, since the
protein concentration is far below the detection limit for Coomassie staining and the intensity of
the bands is even lower than the one corresponding to the commercial rhBMP-6 used as a
positive control, protein loss due to precipitation seems improbable. More likely, the loss of
proteins could be due to proteolytic degradation by proteases secreted by the Sf9 cells or
liberated to the medium by them after cell lysis.
In order to determine if the BMP-6 dimers and trimers were disulfide linked, the samples
were analyzed by Western blot under reducing conditions. In presence of DTT, which reduces
the cysteine residues of the peptides, the bands corresponding to the dimeric, trimeric and
tetrameric forms disappeared and were substituted by a doublet of low molecular mass bands,
what indicates that the oligomers were stabilized by disulfide bonds. Although the predicted
molecular masses of the rhBMP-6 and rhBMP-6-CBD monomers are ±18 KDa and ±19.3 KDa,
respectively (attending to their amino acid sequences), the appearance of a slightly higher
molecular mass band was not surprising, since the commercial rhBMP-6 is described to run as a
triplet of bands. These additional bands could be due to non-homogeneous glycosylation of the
BMP-6 population or to the production of truncated or elongated peptides by frame shifting
during translation.
Since the only biologically active form of the BMPs is a dimer, we wanted to determine if
the excessive establishment of intercatenary disulfides, which give rise to the trimeric and
tetrameric BMP-6, was due to the co-expression of the PDI and if the yield of BMP-6 dimers
could be improved by expressing the proteins in the absence of heterologous PDI. The analysis
of the rhBMP-6 production assay without PDI co-expression showed that the formation of these
higher oligomers was PDI-independent, since the pattern of bands that could be observed was
identical to the one obtained when using the Sapphire™ expression system. According to this, it
could be assumed that the presence of this foldase does not negatively affect the BMP-6
production, since it did not increase the formation of intercatenary disulfides. Nevertheless, the
PDI could still be beneficial for the formation of correctly folded BMP-6 dimers among this
fraction, since this chaperone not only promotes the formation of disulfides, but also catalyzes
their isomerization. Thus, if the correctly folded structure of the BMP-6 dimer is
thermodynamically more stable than the other possible conformations, the presence of the PDI
might help to increase the rate of correctly versus incorrectly folded dimers.
Another possible explanation for the high yield of incorrectly folded BMP-6 molecules
obtained is the election of the polyhedrin promoter to drive the heterologous protein
expression. This promoter is strongly activated during the very late phase of the viral infection
cycle, a stage at which the cellular protein-production machinery, re-programmed by the viral
DNA, is fully committed to the production of large quantities of new virions. In this
182
Discussion
compromised stage, the activation of the PPolh forces the synthesis of huge amounts of
rhBMP-6(-CBD) monomers, which are translocated into the endoplasmic reticulum by the GP67
signal peptide. It does not seem improbable that the accumulation of heterologous BMP-6
inside the endoplasmic reticulum of a cell in an altered state due to infection by a lytic virus
could lead to an alteration of the endoplasmic luminal microenvironment. This, together with
the high concentration of BMP-6 monomers inside the endoplasmic reticulum, could cause
protein aggregation and/or establishment of unspecific disulfides. Furthermore, possibly many
of these incorrectly folded proteins do not even reach the Golgi apparatus for their vesicular
secretion, but are directly liberated to the culture medium when the host cell becomes lysed. If
this were the case, these problems might have been overcome by the election of an earlier
promoter to drive the heterologous protein expression. If we would have used a milder
promoter we probably would have obtained lower yields of total rhBMP-6(-CBD), but possibly
the ratio of correctly versus incorrectly folded proteins would have been higher.
The purification of both the rhBMP-6 and rhBMP-6-CBD by heparin-sepharose
chromatography yielded almost identical elution profiles, with the maximum of dimeric
molecules obtained when eluting with conductivity values around 28 mS/cm. This indicates that,
in contrast to rhBMP-2 (Visser R et al., 2009), the addition of the CBD to the N-terminus of the
BMP-6 molecule does not alter its heparin-binding properties.
Unfortunately, the fact that the conditioned culture media contained not only dimeric but
also high quantities of trimeric and tetrameric BMP-6 molecules, made the purification of the
dimeric fraction by this technique impossible, since the trimeric BMP-6 only showed a slightly
increased affinity to heparin when compared with the dimers. This behaviour could be
considered a logic consequence of the fact that rhBMP-6 dimers only possess two heparin-
binding domains, while the trimeric and tetrameric forms possess three and four of them,
respectively. This also supports the idea that the heparin-binding properties of BMP-6 are not
due to structural aspects of the heparin-binding site, but are only dependent on the net charge
of the amino acid sequence that forms this domain, since it might be assumed that in the
incorrectly folded, unnatural trimers and tetramers, the folding of the heparin-binding sites is
also compromised.
The selected elution fractions were those containing the highest dimer:trimer ratio. Before
we could test the biological activity or the collagen-binding properties of these samples, the
excess of salts and urea had to be removed. Nevertheless, this has to be done gradually, since
the BMPs are highly hydrophobic and show a great tendency towards aggregation and
precipitation in aqueous solutions. To achieve this, different strategies were tried: direct dialysis
against culture medium, dialysis against ammonium acetate followed by lyophilization and
buffer exchange to 4 mM HCl in a buffer exchange/concentration column. Only in the latter
case an important loss of proteins was observed, though no visible signs of protein precipitation
183
Discussion_____________________________________________________________________
were detected during the process. It seems improbable that the protein was lost by passing the
column filter, since a column with a molecular mass cut-off of 5 KDa was used, so the only
possible explanation is that the BMP-6 molecules were partially lost by being retained by the
filter itself. In fact, when treating E. coli derived, in vitro refolded, purified rhBMP-2(-CBD) in
similar columns, more than 70% of the proteins are lost (unpublished data).
Serial dilutions of all the obtained samples were tested on their ability to induce the
transdifferentiation of cultured C2C12 mouse myoblastic cells into the osteogenic lineage. These
cells are not able to differentiate into osteoblasts by themselves but, in presence of BMPs, they
start expressing osteogenic markers (including ALP) and acquire an osteoblastic phenotype
(Katagiri T et al., 1994).
While the commercial rhBMP-6 produced in CHO cells induced the expression of ALP in a
typical dose-dependent manner, with an estimated ED50 close to 300 ng/mL, none of the tested
samples was able to induce the expression of this osteogenic marker, even at the lowest
dilutions/highest concentrations tested.
There are different possible causes which, alone or in combination, could explain the
inactivity of the recombinant BMP-6 molecules produced in Sf9 cells with the chosen expression
system:
1. The sequencing of the genes cloned in the pAcGP67B shuttle vector showed that they
were correctly inserted into the plasmidic DNA and that no mutations were introduced during
the amplification and/or cloning procedures. Furthermore, the Western blot analyses of the
conditioned culture media with a specific monoclonal anti-BMP-6 antibody revealed a pattern of
bands that corresponds to the expected pattern for a mixture of dimeric, trimeric and tetrameric
BMP-6 molecules. When the Western blot was performed under reducing conditions, almost all
of the proteins became reduced, giving rise to a doublet of bands which molecular mass
corresponds to the expected molecular mass for rhBMP-6 monomers. All these facts made us
assume that the bmp6 and bmp6-cbd constructs were correctly expressed and the peptides
translocated into the endoplasmic reticulum for posttranslational processing. Nevertheless, a
high percentage (or all) of the obtained dimeric rhBMP-6(-CBD) might be incorrectly folded due
to saturation and/or malfunctioning of the cellular protein production and processing machinery
in the late stages of the baculoviral infection cycle, during which the PPolh becomes activated.
Since the quaternary structure of the native BMPs is relatively complex, an incorrectly folded
BMP-6 dimer would probably not have a functional BMPR-binding site and would consequently
not be able to trigger the BMP signal transduction within the target cells.
184
Discussion
2. Even if a certain percentage of the purified dimers would have the correct quaternary
structure, the presence of high concentrations of incorrectly folded dimers or higher oligomers
could be inhibiting the activity of the native molecules by acting as competitive inhibitors. This
possibility is supported by the fact that Weber FE et al. (2001) reported that dimeric BMP-2
molecules with incorrect intracatenary disulfides were able to inhibit both the in vivo heterotopic
ossification induced by BMP-2 and the maturation of the preosteoblastic MC3T3-E1 cell line to
osteoblasts in vitro. Although these aberrant dimers did not have the native quaternary
structure, they were still able to bind the BMP receptors but not to trigger the BMP signal
transduction within the cell, acting as real agonists for the native BMP-2 molecules.
3. Insect cells are able to carry out most of the posttranslational modifications described in
mammalian cells, including signal peptide cleavage, phosphorylation, N- and O- glycosylation,
disulfide bond formation, and substitution of unusual analogs into proteins. Nevertheless,
although the processing of N-glycans in insect and mammalian cells appears to follow a similar
initial pathway, the final processing seems to be different, being the N-glycans from insect cell
lines usually modified to paucimannosidic or oligomannose structures instead of terminally
sialylated complex-type structures (Marchal I et al., 2001; Tomiya N et al., 2004). Since
terminal sialic acid residues are known to play diverse roles in many glycoconjugates and the
glycosylation of BMP-6 seems to be strictly necessary for the binding of the growth factor to
type I BMPRs (Saremba S et al., 2008), it is possible that the glycosylation provided by the Sf9
cells is not sufficient to obtain active rhBMP-6 molecules. If this were the case, a possible
solution would be the expression of rhBMP-6 in a genetically engineered insect cell line that
carries out the terminal sialylation of its N-glycans. These type of cell lines are nowadays being
improved by introducing the genes for the expression of missing glycosyltransferases and of the
enzymes responsible for generating the essential donor sugar nucleotide required for sialylation,
as well as inhibiting the N-acetylglucosaminidase responsible for removing a terminal
N-acetylglucosamine from the N-glycan. In this sense, the aim of these genetically engineered
insect cell lines is to mimic the N-glycosylation pathway that occurs in mammalian cells to
improve the expression of heterologous glycoproteins (Tomiya N et al., 2004).
In conclusion, the chosen baculoviral/insect cell expression system seems not to be suitable
for the production of complex, cysteine knot proteins such as rhBMP-6. In fact, similar attempts
on rhBMP-2 production with this system performed in our group also resulted unsuccessful,
since the obtained proteins were also inactive (unpublished data). Perhaps the election of a
milder and earlier promoter to drive the heterologous protein expression in combination with a
so-called “humanized” insect cell line as a host would have yielded better results. These options
might be taken in consideration if future attempts on rhBMP-6 production in insect cells were
done.
185
Discussion_____________________________________________________________________
5.4. Production of rh-bFGF and rh-bFGF-CBD in Sf9 cells.
In order to produce these growth factors with a non-prokaryotic expression system, we
decided to make an attempt on the production of rh-bFGF and rh-bFGF-CBD in insect cells.
Since the structure of bFGF is much simpler than the one of BMP-6 (monomeric, without
disulfides, not glycosylated), some of the problems that arose during the production of rhBMP-6
might not be an issue for the production of bFGF.
The lack of disulfide bonds in the tertiary structure of the bFGF molecule made us decide to
use a simple baculoviral expression system, with no co-expression of any heterologous
chaperone. Nevertheless, we still used a system in which the proteins carry the GP67 signal
peptide for their translocation into the endoplasmic reticulum. Although in mammalian cells the
secretion of bFGF seems to be by direct translocation through the plasma membrane mediated
by cell surface HSPGs (Backhaus R et al., 2004; Schäfer T et al., 2004; Zehe C et al., 2006), we
were not able to predict if the Sf9 insect cells would have the capacity to secrete the
heterologous bFGF(-CBD) to the culture medium in a vesicle-independent manner. Although
three homologs to FGFs (Pyramus (Pyr), Thisbe (Ths) and Branchless (Bnl)) have been
identified in Drosophila (Kadam S et al., 2009), the secretion mechanisms that affect these
growth factors in insect cells are not known. Thus, the expression of a heterologous bFGF in
insect cells without addition of any signal peptide might lead to accumulation of the proteins in
the form of inclusion bodies within the cells, being this something we wanted to avoid, since
this would have forced us to carry out additional manipulations of the proteins in order to
isolate and solubilize them.
The analysis by Western blot of the production assays performed for rh-bFGF and
rh-bFGF-CBD showed that the specific anti-bFGF antibody recognized one single band in each
sample. The molecular masses of these bands corresponded to the predicted molecular masses
for the rh-bFGF and the rh-bFGF-CBD, according to their amino acid sequences. Thus, it seems
that the passing of these proteins through the endoplasmic reticulum does not provoke
oligomerization by intercatenary disulfide establishment, or apparent unspecific glycosylation.
Nevertheless, we were not able to ensure that the produced proteins exhibited their native
conformation since, for example, the formation of unspecific intracatenary disulfides could have
lead to their incorrect folding.
For both rh-bFGF and rh-bFGF-CBD, the highest concentrations of heterologous proteins in
the culture media were achieved with production times of 72 hours. When the proteins were
harvested after longer production times, the intensity of the bands decreased and a lower
molecular mass smear appeared. The appearance of this smear could be due to partial
proteolytic degradation of the rh-bFGF(-CBD) by proteases secreted by the insect cells or
186
Discussion
187
liberated to the medium by them after their lysis. Another possible explanation is that, while the
infection of the culture progresses, the number of cells that becomes lysed increases. By their
lysis, these cells liberate their total cell content to the culture medium, including truncated or
incompletely synthesized rh-bFGF(-CBD) molecules.
The purification of both rh-bFGF and rh-bFGF-CBD were performed by heparin-sepharose
affinity chromatography, eluting the proteins with a linear gradient of NaCl, from 0.15 to
2.00 M. Since bFGF is known to be much more stable than BMPs in aqueous solutions, its
purification was performed in absence of urea but in presence of DTT to avoid air oxidation of
the cysteine residues. Apparently, the elution profiles for both proteins were more or less
similar, with bFGF found along a great portion of the profile. Since the achieved gradient of
NaCl was almost completely linear, the fact that bFGF molecules were eluted from the column
along almost the entire gradient made us conclude that the conditioned culture media used for
purification contained a heterogeneous mixture of rh-bFGF(-CBD) molecules with different
affinities to heparin. This was further supported by the fact that the concentration of the
heterologous proteins suffered variations along the elution profile, defining at least two distinct
populations for each of the produced bFGFs: a “low heparin-affinity” population (constituted of
the majority of the produced growth factors, which eluted with low to moderate concentrations
of NaCl) and a “high heparin-affinity” population (represented by a smaller percentage of the
produced growth factors, which eluted with high NaCl concentrations). Although the behaviours
of rh-bFGF and rh-bFGF-CBD were slightly different during the purification, these differences
were not great enough to allow us to ensure that the addition of the CBD sequence is
significantly altering the heparin-binding properties of the bFGF molecule. In the case of the
rh-bFGF, the protein was detected in the elution fractions until 138 mS/cm, while in the case of
the rh-bFGF-CBD, all of the proteins bound to the column could be eluted with 121 mS/cm.
Nevertheless, more purifications of both proteins should be performed to determine if these
differences are reproducible.
There are different possible causes which, alone or in combination, could explain the
existence of these populations with different affinities to heparin in the culture media:
1. The fact that the expressed rh-bFGF(-CBD) molecules are driven into the endoplasmic
reticulum might be causing changes to the molecules that could not be detected by Western
blot analysis. It is possible that the special microenvironment inside the endoplasmic reticulum
could be inducing the formation of intracatenary disulfides or partial glycosylation of the
molecules, affecting the tertiary structure of the protein and/or the conformation of the amino
acid residues involved in binding to heparin.
Discussion_____________________________________________________________________
2. As hypothesized for the production of BMP-6 in Sf9 cells, the election of a promoter that
becomes activated during the very late phase of the infection cycle to drive the heterologous
protein expression might be responsible for the synthesis of truncated or misfolded proteins
since, at this stage, the host cell is close to its lysis and the protein production machinery of the
cell might be starting to malfunction.
After purification, we obtained one “low heparin-affinity” and one “high heparin-affinity”
sample for each of the heterologous growth factors. Although the purification of the proteins
was performed in the absence of urea, the high salt concentrations (0.6 - 0.8 M in the “low
heparin-affinity” samples and 1.4 – 1.5 M in the “high heparin-affinity” samples) had to be
reduced to more physiological levels before testing the biological activity or the collagen-binding
properties of the purified proteins. For this purpose, the samples were loaded on buffer
exchange columns and the elution buffer was changed to PBS, pH 7.3, 1 mM DTT, 1 mM EDTA.
By repeated dilution and centrifugation steps, the salt molarity in all the samples was reduced
below 20 mM. Western dot blot analysis of the samples after the buffer exchange showed that,
surprisingly, both “low heparin-affinity” samples suffered an important loss of proteins during
the process, while the proteins in the “high heparin affinity” samples were successfully
concentrated. This indicates that the majority of the heterologous rh-bFGF(-CBD) produced in
Sf9 cells not only has a diminished affinity to heparin, but also a reduced solubility in aqueous
solutions, pointing to more important disorders in the molecular structure than initially thought
which, among others, could have varied the pI of the proteins. In fact, these observations made
us assume that the probabilities of these molecules to have a diminished or lost biological
activity were quite high.
It is known that binding of bFGF to HSPGs present in the extracellular matrix or on the
target cell surface is important for bFGF signal transduction (Folkman J et al., 1988; Dowd CJ et
al., 1999). Furthermore, since the protein concentration in the “low heparin-affinity” samples
after the buffer exchange was too low to allow proper testing of their biological activity and
collagen-binding properties, and so was their probability of being active, we decided to discard
them and focus only on the “high heparin-affinity” samples.
The concentration of the samples was estimated by Western blot and digital image analysis.
With the obtained values, the yields of heterologous proteins per litre of conditioned culture
medium were calculated to be ±33.50 µg/L for rh-bFGF and ±13.80 µg/L for rh-bFGF-CBD.
These values are 3 orders of magnitude below the ones described for typical heterologous
protein productions with baculoviral/insect cell expression systems, which are between 10 and
100 mg/L. Nevertheless, the facts that a very high percentage of the rh-bFGF(-CBD) was
incorrectly synthesized and discarded after purification and buffer exchange and that probably
another percentage of the “high heparin affinity” samples was lost during these processes
could, in part, explain these low yields.
188
Discussion
Since the addition of the sequence of the CBD implies that the rh-bFGF-CBD has an 8%
increase in its molecular mass over the rh-bFGF, the in vitro and in vivo experiments to
determine their biological activity and collagen-binding properties were designed using the
molar concentrations of the samples, in order to compare the effects of equal numbers of
effective molecules.
To determine if the addition of the CBD in the engineered rh-bFGF-CBD conferred to this
molecule an increased affinity to collagen, a collagen-binding affinity test was performed
following a method described by T. Kitajima in 2007. Therefore, we used a 1 mm thick collagen
type I sheet obtained from highly pure, native, bovine skin collagen, from which 5 mm diameter
discs were cut. This collagenic carrier has been recently approved by the FDA for its use in
combination with BMP-2 and is similar to the other ones used in clinical applications.
After loading the samples and washing the ACSs for one hour with buffer, almost no
immunostaining was detected on the sponges incubated with commercial rh-bFGF, indicating
that this growth factor has no natural affinity to collagen type I in this presentation. Very
surprisingly, the sponges that were incubated with 1.25 pmol of the rh-bFGF produced in Sf9
cells showed immunostaining with the anti-bFGF antibody after the washing with the buffer.
This indicates that, although the sequence of the bfgf gene was cloned into the used shuttle
vector without any modifications on the native sequence and the performed PCR analyses and
sequencing revealed no mutations or alterations of the gene, the rh-bFGF molecule produced in
Sf9 insect cells has to have some slight chemical or structural differences when compared with
the commercial rh-bFGF. Nevertheless, since the commercial growth factor used for comparison
was produced in Escherichia coli, these observations might be a simple consequence of the
natural differences between prokaryotic and eukaryotic expression systems.
The immunostaining of the sponges that were incubated with 1.25 pmol of rh-bFGF-CBD
showed that these proteins had a significant higher retention than the non-modified rh-bFGF. It
was not possible to determine if the total affinity to collagen type I of the rh-bFGF-CBD when
compared to the commercial rh-bFGF was due only to the CBD, or if it was the sum of the
effect of the CBD and the effect of the used expression system. In any case, it could be clearly
concluded that the addition of the decapaptidic collagen binding domain to the bFGF molecules
increases its affinity to collagen type I in the form of an absorbable collagen sponge.
Since our goal was the production of an active form of bFGF with the ability of being
retained for longer periods of time at the wound site when implanted in vivo for bone repair
purposes, with a consequent enhanced effect on tissue healing and safety of the clinical
approach, we needed to demonstrate that the binding of the rh-bFGF-CBD to ACSs was stable
in time. Therefore, the same collagen-binding affinity test was repeated, though
immunostaining of the sponges was performed after 6 days of extensive washing with buffer.
According to the results, a high percentage of both rh-bFGF and rh-bFGF-CBD remained bound
189
Discussion_____________________________________________________________________
to the collagen sponges after this period and, also under these conditions, the amount of
rh-bFGF-CBD found in the sponges was higher than the amount of rh-bFGF. These results
indicate that the rh-bFGF and rh-bFGF-CBD not only posses a higher affinity to ACSs compared
to E. coli-derived rh-bFGF, but also that this binding is stable for long periods of time. In
addition, the CBD confers an additional affinity to collagen to the molecule, resulting in over
50% more binding. In consequence, the use of these growth factors for clinical bone repair in
combination with absorbable collagen sponges could possibly allow the implantation of lower
concentrations of them, reducing the system dispersion and, thus, enhancing the effectiveness
and safety of the treatment. Furthermore, the specific binding of the proteins to the carrier
might avoid the great initial loss of proteins that occurs due to manipulation of the sponge by
the surgeon prior to its implantation.
Since bFGF is known to be a mitogen for most cells of mesodermic origin, the biological
activity of the produced growth factors was determined in vitro by a proliferation assay on
MC3T3-E1 murine preosteoblasts, calculating the number of cells in the cultures after 72 hours
of incubation with the different bFGFs or without any growth factor. For this purpose we used
an MTT-based method, which is generally considered reliable and highly reproducible. Since the
use of MTT implies the counting of only living, metabolically active cells, possible cell death
events in the cultures are not taken into account and, in consequence, this was not a
proliferation assay sensu stricto. Nevertheless, by direct observation of the cultures during
incubation with the MTT-labelling reagent, no signs of death cells or debris could be observed in
any of the cultures, so the rate of cell death was considered negligible.
The results showed that, at low concentrations (156.25 or 312.50 pM), both rhbFGFs
produced in Sf9 cells and the commercial rh-bFGF were able to significantly increase the
number of cells in the cultures, achieving similar yields in all the three cases. Although these
concentrations are denoted as “low”, they are actually around or even above the ED50 described
for the activity of bFGF in many processes. In contrast, at higher concentrations (625.00 pM or
1.25 nM), the growth factors produced in Sf9 cells were not able to further increase the cell
density in the cultures, whereas the commercial rh-bFGF induced a significantly higher
proliferation. Nevertheless, it should be noticed that the variability was much higher among the
cultures treated with the commercial rh-bFGF than the ones found among the cultures treated
with the rh-bFGFs produced in insect cells.
To further analyze the biological activity of the growth factors in vitro, we decided to test
their ability to inhibit the osteoblastic differentiation of MC3T3-E1 mouse preosteoblasts induced
by ascorbic acid. Since the expression of alkaline phosphatase is considered an early marker of
osteoblastic differentiation, we measured the inhibition by bFGF as the inhibition of the activity
of this enzyme within the culture media and the cells. After 120 hours of incubation with the
190
Discussion
growth factors, both the number of cells and the ALP activity in the cultures were determined
and the average ALP activity per cell calculated.
The results showed that, after 120 hours of incubation with any of the bFGFs, no traces of
ALP activity could be detected in the cultures. In contrast, the control cultures grown in the
absence of bFGF showed very low, though significant levels of ALP activity after this period of
time. The differences between the cultures incubated with bFGF and the control cultures
became higher when comparing the average ALP activity per cell, since the number of cells in
the latter was lower than in the cultures incubated with commercial or Sf9-derived
rh-bFGF(-CBD). Nevertheless the period of time established for this assay was not long enough
to affirm that the ability of the three bFGFs to inhibit the osteoblastic differentiation of the cells
was the same since, at this time, the cells were just starting to express the studied osteogenic
marker. Thus, longer incubations with the growth factors should be performed in future assays
in order to detect possible differences between their activities. The obtained results after 120
hours only allowed us to conclude that both the commercial rh-bFGF and the rh-bFGF(-CBD)
produced in Sf9 cells were able to, at least, delay the osteoblastic differentiation of mouse
preosteoblasts.
5.5. In vivo osteogenic activity of combinations of BMP-6 and bFGF.
In order to evaluate the biological activity of the rh-bFGF and rh-bFGF-CBD produced in Sf9
cells and their capacity to enhance bone formation when administered in combination with
BMP-6, absorbable collagen sponge discs carrying 13.89 pmol (0.5 µg) rhBMP-6 alone, 1.25
pmol of rh-bFGF or rh-bFGF-CBD alone, or combinations of these factors, were implanted into
the dorsal muscles of rats. Commercial rh-bFGF produced in E. coli was used as a positive
control, while ACS discs loaded with vehicle only served as a negative control. Previous works of
our group showed that, when inducing heterotopic osteogenesis with 0.5 µg of rhBMP-2, no
cartilage rests could be found when analyzing the samples 28 days after surgery (unpublished
data). Since we wanted to compare the quality and maturity of the bone induced by the
different combinations of growth factors tested in this work, we decided to analyse the samples
in an earlier stage (21 days after surgery).
As expected, when implanted alone with ACSs, none of the bFGFs were able to induce
heterotopic osteogenesis by themselves. It has been described that low concentrations of bFGF
can act synergically with BMP-2 to enhance osteogenesis in vivo (Fujimura K et al., 2002;
Nakamura Y et al., 2005; Tanaka E et al., 2006; Kakudo N et al., 2006) but, as stated earlier,
BMPs are the only growth factors known to have the capacity to induce ectopic bone formation
191
Discussion_____________________________________________________________________
in adult vertebrates (Wang EA et al., 1990; Volek-Smith H and Urist MR, 1996; Nakase T and
Yoshikawa H, 2006).
Nevertheless, the fact that all of the implanted control sponges, loaded with vehicle only,
were reabsorbed and could not be recovered 21 days after surgery, while most of the implants
loaded with bFGF had formed a fibrotic nodule within the rats muscle, indicated that both the
commercial rh-bFGF and the rh-bFGFs produced in insect cells possess biological activity in vivo.
All the three growth factors induced the formation of a dense, fibrotic tissue in which irregular
accumulations of basic, eosinophyllic extracellular material were observed. These were
especially abundant and apparent in the implants that were loaded with Sf9 cell-derived
rh-bFGF or rh-bFGF-CBD. Since these two growth factors demonstrated to possess specific
affinity to the carrier in vitro, probably the accumulation of this unidentified extracellular
material was due to the retention of these bioactive proteins at the implant site. If this were the
case, it would be indicating that the binding to ACS of both rh-bFGF and rh-bFGF-CBD produced
in insect cells remains stable when implanted within living tissue.
In contrast to the implants with bFGF alone, the implants loaded with 13.89 pmol (0.5 µg)
rhBMP-6 (alone or in combination with bFGF) all gave rise to osteogenic events, resulting in the
formation of a trabecular bony tissue. Nevertheless, clear differences could be observed among
the different combinations assayed.
The implants that were loaded with rhBMP-6 alone were, in general, smaller in size than the
ones that were loaded with BMP-6 and bFGF. In these implants, osteogenesis was mainly
limited to the periphery, where clear bone trabeculae were formed. The fact that only little
staining with alcian blue (which stains the components of the cartilaginous matrix) could be
detected in these trabeculae made us assume that they had reached a certain degree of
maturity. This assumption was based on the work of other authors, which have described that
heterotopic bone formation induced by BMP-2 occurs through endochondral ossification (Wang
EA et al., 1990; Nakagawa T et al., 2003). Furthermore, since traces of hypertrophic cartilage
could be detected in some of the analyzed implants, it seems that BMP-6-mediated ossification
also follows the endochondral pathway.
The inner part of these implants was constituted of a dense accumulation of mesenchymal
cells, not resembling a real bone marrow tissue. Only few disperse adipocytes could be
observed and almost no vascularization. Immunostaining of these implants with a specific anti-
osteopontin antibody revealed the existence of this early marker of osteogenesis mainly in the
edges of the trabeculae. Osteopontin is a cell-to-matrix adhesion molecule which is secreted by
osteoblasts after they start synthesizing ALP. Its expression is maintained during the entire
period of bone matrix synthesis so that the protein diffuses through the new-formed osteoid
and becomes trapped within this osteoid after its mineralization (Roach HI, 1994). According to
this, the presence of osteopontin mainly in the external parts of the trabeculae indicated that,
192
Discussion
although new osteoid was still being synthesized on their surface, the inner areas of the
trabeculae were formed by more mature, mineralized osteoid. In contrast, almost no
osteopontin was detected in the inner part of these implants and only few osteoblasts
expressing this marker could be found, indicating that osteogenesis was very limited in this
area. This is consistent with the observation that almost no angiogenesis occurred within these
implants, since the ingrowth of new blood vessels is known to sustain osteogenesis by providing
osteoprogenitor cells to the new-forming bone.
In contrast, the implants that were loaded with rhBMP-6 in combination with commercial or
insect cell-derived bFGF were not only bigger in size in general, but also showed osteogenic
activity throughout their entire volume, with bony trabeculae being found at the periphery and
at the inner part of the implants. In both cases, these trabeculae were intensely stained with
the light green present in the Masson’s trichrome, but showed only small, heterogenously
distributed alcian blue-positive patches, indicating that they were mainly composed of collagen
but that little glycosaminoglycans were present within them. These observations, together with
the fact that almost no hypertrophic chondrocytes could be detected, were indicating that most
of the trabeculae found in these implants were in an advanced stage of the chondro-osseous
transition. In between the trabeculae, a tissue that resembled bone marrow was found,
presenting many adipocytes and small blood vessels. Immunostaining of these implants with a
specific anti-osteopontin antibody showed that this bone marrow-like tissue contained abundant
osteoblasts expressing this protein and small osteopontin accumulations in the extracellular
matrix, indicating that these implants were exhibiting a greater osteogenic activity than the
ones loaded with rhBMP-6 alone.
One of the differences found between these two implant types was that some of the ones
loaded with rhBMP-6 + commercial rh-bFGF showed areas of osteopontin-containing material
with a fibrous, disorganized appearance, while this was not observed in the implants loaded
with rhBMP-6 + Sf9 cell-derived rh-bFGF.
The second main difference affects the blood vessels found in the samples. Both implant
types showed a high degree of vascularization, presenting immature blood lacunae (in which no
clear defined endothelium could be observed), many small and some big blood vessels.
Nevertheless, vascularization seemed to be slightly lower in the implants loaded with rhBMP-6 +
commercial rh-bFGF than in the ones loaded with rhBMP-6 + Sf9 cell-derived rh-bFGF, with the
latter showing both more and bigger vessels. In any case, some of the blood vessels found in
both implant types showed, on their abluminal side, small groups of periendothelial cells
immediately opposed to the endothelium. This could be interpreted as a sign of maturation of
these blood vessels, what could be important for the osteogenic potential within these samples
since recent studies have given strong evidences of a perivascular origin for mesenchymal stem
cells. According to these studies, pericytes (or adventitial reticular cells in bone marrow) present
in perivascular locations would actually be the MSCs (Crisan M et al., 2008; da Silva Meirelles L
193
Discussion_____________________________________________________________________
et al., 2008). Thus, the presence of more and more mature blood vessels in these samples
could be responsible for the higher osteogenic activity observed and, since almost no
angiogenesis could be detected in the implants loaded with rhBMP-6 alone, it could be
concluded that the formation of these blood vessels was induced by the presence of the
exogenous bFGF. Furthermore, this bFGF might also be contributing to the osteogenic activity
within the samples by inducing the proliferation and/or differentiation of the mesenchymal
osteoprogenitor cells.
From all these facts it could be concluded that, when 1.25 pmol of growth factor are used,
the commercial E. coli-derived rh-bFGF is able to enhance BMP-6-induced osteogenesis in vivo
and that the Sf9 cell-derived rh-bFGF is at least as efficient as the commercial protein.
Surprisingly, although the implants that were loaded with rhBMP-6 + rh-bFGF-CBD were
comparable in size to those loaded with rhBMP-6 + commercial or Sf9 cell-derived rh-bFGF, the
bony tissue they contained showed signs of being less mature. Well defined trabeculae were
found at the periphery and, to a greater or lesser extent, also at the inner part, but not always
throughout the entire implant. Furthermore, staining of the samples with alcian blue revealed
the existence of some extensive positive areas which contained many hypertrophic
chondrocytes, indicating that the chondro-osseous transition in these areas was in a relatively
early stage. Anti-osteopontin immunostaining of these implants showed that this osteogenic
marker was heterogenously localized among the trabeculae. Especially surrounding the areas
containing cartilage, osteopontin was detected as abundant fibrous-like accumulations.
Other signs of the immaturity of these samples were the little angiogenic activity observed
and the lack of adipocytes in the bone marrow-like tissue found in between the trabeculae.
These observations are in opposition to the in vitro properties exhibited by the rh-bFGF-
CBD. The ability of this molecule to induce the proliferation of MC3T3-E1 mouse preosteoblasts
in vitro was equal to that of the Sf9 cell-derived rh-bFGF, so the effectiveness of both molecules
to enhance heterotopic osteogenesis in vivo was expected to be, at least, the same.
Nevertheless the augmented affinity to collagen type I of the rh-bFGF-CBD could explain the
obtained results. Different authors have reported that low concentrations of bFGF enhanced
bone formation in vivo when co-administered with BMP-2, but also that higher concentrations of
bFGF had the opposite effect (Fujimura K et al., 2002; Nakamura Y et al., 2005; Tanaka E et
al., 2006; Kakudo N et al., 2006). In all these studies, above a certain threshold concentration,
bFGF inhibited heterotopic bone formation in a dose-dependent manner. In this line,
Kakudo N et al. showed that co-administration of 2 µg rhBMP-2 and 16 ng (1.00 pmol) rh-bFGF
with a collagenic carrier resulted in more bone formation than when rhBMP-2 alone was used,
whereas bone formation was suppressed when the amount of rh-bFGF was raised to 80 ng
(5 pmol).
194
Discussion
In the present work, 500 ng rhBMP-6 were co-administered with 21.6 ng (1.25 pmol)
rh-bFGF-CBD. This amount of rh-bFGF-CBD should have been low enough to enhance
osteogenesis as observed when the same amount of rh-bFGF was used. Nevertheless, since the
CBD had demonstrate to confer an increased affinity to collagen to the molecule, the
persistency of the rh-bFGF-CBD at the implant site could have caused the same effect as
administering bFGF above the osteogenesis-supressing threshold. If this were the case, the
rh-bFGF-CBD dose should be lowered to obtain the desired enhancement of bone formation
5.6. Perspectives for the future.
Among the BMPs, BMP-6 is one of the most potent osteogenic growth factors known. In
fact, only 300 ng of rhBMP-6 were able to induce the formation of a well-defined bony tissue in
a rat heterotopic osteogenesis model (unpublished data), whereas at least 460 ng of rhBMP-2
are needed to observe some signs of osteogenesis (Wang EA et al., 1990). Nevertheless, the
medical and scientific communities are mainly focused on BMP-2, rather than on other BMPs.
The search in PubMed Central (http://www.ncbi.nlm.nih.gov/pubmed/) for the keywords
“BMP2” or “BMP-2” or “bone morphogenetic protein-2” yielded 4,115 articles until may 2009,
while the search for the keywords “BMP6” or “BMP-6” or “bone morphogenetic protein-6”
yielded only 411 articles.
On the other hand, we and other authors have demonstrated that low doses of bFGF can
enhance bone induction when administered together with BMPs. We have also demonstrated
that the addition of a decapeptidic collagen-binding domain derived from the von Willebrand
Factor to rh-bFGF produced in insect cells increases its affinity to absorbable collagen type I
sponges without affecting its biological activity in vitro.
The results of the heterotopic bone formation assay in rats, implanting ACSs with rhBMP-6
and the different bFGFs used in this work, were stimulating enough to induce us to believe that
the combination of absorbable collagen, BMP-6 and collagen-targeted bFGF could be a more
effective and safer alternative to the today available biomaterials for clinical repair of bone
defects.
Nevertheless, additional studies should be performed in the future to prove this hypothesis.
The aim of these studies would be the optimization of the production and purification of the
heterologous proteins produced in insect cells, as well as further characterization of the
structural and biochemical features of these molecules. Also, additional in vivo heterotopic bone
formation assays should be planned for determination of the most effective dose for each
growth factor and for their combination. Furthermore, both the osteogenic and angiogenic
events occurring in the implants should be studied in detail, analyzing samples recovered earlier
195
Discussion_____________________________________________________________________
and later after surgery, determining the expression of osteogenic markers and the maturity of
the blood vessels and their perivascular structures. At last the combination of ACS, BMP-6 and
collagen-targeted bFGF should be used in a bone defect model.
196
6. Conclusions.
197
198
Conclusions
1. All the combinations of variables tested for the in vitro refolding of the rhBMP-6 produced in
Escherichia coli resulted in low levels of disulfide formation between the monomeric rhBMP-6
molecules, with most of the established disulfides being unspecific. Thus, in vitro refolding of
monomeric rhBMP-6 must require other conditions than those assayed in the present work.
2. The rhBMP-6 and rhBMP-6-CBD dimers produced with a baculoviral/insect cell expression
system were inactive due to incorrect folding or insufficient glycosylation. Thus, this
expression system seems not to be appropriate for the production of these growth factors.
3. The rh-bFGF and rh-bFGF-CBD molecules produced with a baculoviral/insect cell expression
system resulted to be biologically active, although the majority of them were produced with a
low affinity to heparin.
4. The commercially available rh-bFGF produced in Escherichia coli did not show any specific
affinity to absorbable collagen type I sponges, whereas the rh-bFGF molecules produced in
insect cells specifically bound to this material. Furthermore, the addition of the CBD to the
rh-bFGF did not alter its native structure or its affinity to heparin, but enhanced the affinity of
the molecule to absorbable collagen type I sponges.
5. The in vitro biological activity of the bFGFs produced in insect cells was comparable to that
of the commercially available rh-bFGF produced in Escherichia coli when used at low
concentrations. At higher concentrations, the biological activity of the bFGFs produced in
insect cells was slightly lower than that of the commercially available rh-bFGF produced in
Escherichia coli.
6. The combination of rhBMP-6 and rh-bFGF enhanced heterotopic osteogenesis in vivo when
compared to rhBMP-6 alone. The rh-bFGF produced in insect cells was at least as effective as
the commercially available rh-bFGF produced in Escherichia coli, while the use of rh-bFGF-
CBD at the same concentration resulted in the formation of an apparently more immature
bone. This was probably because of an increased retention of the growth factor at the
implant site due to the enhanced affinity to the carrier conferred by the CBD.
199
200
7. Bibliography.
201
202
___________________________________________________________________Bibliography
203
1. Abraham JA, Whang JL, Tumolo A, Mergia A, Friedman J, Gospodarowicz D, Fiddes JC. Human basic fibroblast growth factor: nucleotide sequence and genomic organization. EMBO J. 1986;5(10):2523-8.
2. Akamatsu T, Matsuda Y, Tsumura K, Tada J, Parvin MN, Kanamori N, Hosoi K. Subtilisin-like proprotein convertase PACE4 (SPC4) is a candidate processing enzyme of bone morphogenetic proteins during tooth formation. Dev Dyn. 1999;216(4-5):481-8.
3. Allen SP, Polazzi JO, Gierse JK, Easton AM. Two novel heat shock genes encoding
proteins produced in response to heterologous protein expression in Escherichia coli. J Bacteriol. 1992;174(21):6938-47.
4. Andrades JA, Han B, Becerra J, Sorgente N, Hall FL, Nimni ME. A recombinant human
TGF-beta1 fusion protein with collagen-binding domain promotes migration, growth, and differentiation of bone marrow mesenchymal cells. Exp Cell Res. 1999;250(2):485-98.
5. Andrades JA, Wu LT, Hall FL, Nimni ME, Becerra J. Engineering, expression, and
renaturation of a collagen-targeted human bFGF fusion protein. Growth Factors. 2001;18(4):261-75.
6. Andreshak JL, Rabin SI, Patwardhan AG, Wezeman FH. Tibial segmental defect repair: chondrogenesis and biomechanical strength modulated by basic fibroblast growth factor. Anat Rec. 1997;248(2):198-204.
7. Aono A, Hazama M, Notoya K, Taketomi S, Yamasaki H, Tsukuda R, Sasaki S,
Fujisawa Y. Potent ectopic bone-inducing activity of bone morphogenetic protein-4/7 heterodimer. Biochem Biophys Res Commun. 1995;210(3):670-7.
8. Arnaud E, Touriol C, Boutonnet C, Gensac MC, Vagner S, Prats H, Prats AC. A new 34-kilodalton isoform of human fibroblast growth factor 2 is cap dependently synthesized by using a non-AUG start codon and behaves as a survival factor. Mol Cell Biol. 1999;19(1):505-14.
9. Babensee JE, McIntire LV, Mikos AG. Growth factor delivery for tissue engineering.
Pharm Res. 2000;17(5):497-504.
10. Backhaus R, Zehe C, Wegehingel S, Kehlenbach A, Schwappach B, Nickel W. Unconventional protein secretion: membrane translocation of FGF-2 does not require protein unfolding. J Cell Sci. 2004;117(Pt 9):1727-36.
11. Basilico C, Moscatelli D. The FGF family of growth factors and oncogenes. Adv Cancer Res. 1992;59:115-65.
12. Becerra J, Guerado E, Claros S, Alonso M, Bertrand ML, Gonzalez C, Andrades JA.
Autologous human-derived bone marrow cells exposed to a novel TGF-beta1 fusion protein for the treatment of critically sized tibial defect. Regen Med. 2006;1(2):267-78.
13. Behnam K, Murray SS, Brochmann EJ. BMP stimulation of alkaline phosphatase
activity in pluripotent mouse C2C12 cells is inhibited by dermatopontin, one of the most abundant low molecular weight proteins in demineralized bone matrix. Connect Tissue Res. 2006;47(5):271-277.
14. Benslimane C, Elias CB, Hawari J, Kamen A. Insights into the central metabolism of
Spodoptera frugiperda (Sf-9) and Trichoplusia ni BTI-Tn-5B1-4 (Tn-5) insect cells by radiolabeling studies. Biotechnol Prog. 2005;21(1):78-86.
Bibliography__________________________________________________________________
204
15. Bertone AL, Pittman DD, Bouxsein ML, Li J, Clancy B, Seeherman HJ. Adenoviral-mediated transfer of human BMP-6 gene accelerates healing in a rabbit ulnar osteotomy model. J Orthop Res. 2004;22(6):1261-70.
16. Bikfalvi A, Klein S, Pintucci G, Rifkin DB. Biological roles of fibroblast growth factor-2. Endocr Rev. 1997;18(1):26-45.
17. Bishop GB, Einhorn TA. Current and future clinical applications of bone morphogenetic
proteins in orthopaedic trauma surgery. Int Orthop. 2007 Dec;31(6):721-7.
18. Bland YS, Critchlow MA, Ashhurst DE. Exogenous fibroblast growth factors-1 and -2 do not accelerate fracture healing in the rabbit. Acta Orthop Scand. 1995;66(6):543-8.
19. Blum B, Moseley J, Miller L, Richelsoph K, Haggard W. Measurement of bone
morphogenetic proteins and other growth factors in demineralized bone matrix. Orthopedics. 2004;27(1 Suppl):161-165.
20. Boden SD, Kang J, Sandhu H, Heller JG. Use of recombinant human bone
morphogenetic protein-2 to achieve posterolateral lumbar spine fusion in humans: a prospective, randomized clinical pilot trial: 2002 Volvo Award in clinical studies. Spine. 2002;27(23):2662-73.
21. Bostrom MP. Expression of bone morphogenetic proteins in fracture healing. Clin Orthop Relat Res. 1998;(355 Suppl):S116-23.
22. Botchkarev VA. Bone morphogenetic proteins and their antagonists in skin and hair follicle biology. J Invest Dermatol. 2003;120(1):36-47.
23. Böttinger EP, Factor VM, Tsang ML, Weatherbee JA, Kopp JB, Qian SW, Wakefield LM,
Roberts AB, Thorgeirsson SS, Sporn MB. The recombinant proregion of transforming growth factor beta1 (latency-associated peptide) inhibits active transforming growth factor beta1 in transgenic mice. Proc Natl Acad Sci U S A. 1996;93(12):5877-82.
24. Braddock M, Houston P, Campbell C, Ashcroft P. Born again bone: tissue engineering for bone repair. News Physiol Sci. 2001;16:208-13.
25. Burkus JK, Transfeldt EE, Kitchel SH, Watkins RG, Balderston RA. Clinical and
radiographic outcomes of anterior lumbar interbody fusion using recombinant human bone morphogenetic protein-2. Spine. 2002;27(21):2396-408.
26. Burkus JK, Dorchak JD, Sanders DL. Radiographic assessment of interbody fusion
using recombinant human bone morphogenetic protein type 2. Spine. 2003;28(4):372-7.
27. Burkus JK, Heim SE, Gornet MF, Zdeblick TA. Is INFUSE bone graft superior to
autograft bone? An integrated analysis of clinical trials using the LT-CAGE lumbar tapered fusion device. J Spinal Disord Tech. 2003;16(2):113-22.
28. Canalis E. Effect of insulin-like growth factor I on DNA and protein synthesis in cultured rat calvaria. J Clin Invest. 1980;66:709-19.
29. Caplan AI. Adult mesenchymal stem cells for tissue engineering versus regenerative
medicine. J Cell Physiol. 2007;213:341-7.
30. Carlisle E, Fischgrund JS. Bone morphogenetic proteins for spinal fusion. Spine J. 2005;5(6 Suppl):240S-249S.
___________________________________________________________________Bibliography
205
31. Carrió MM, Villaverde A. Construction and deconstruction of bacterial inclusion bodies. J Biotechnol. 2002;96(1):3-12.
32. Celeste AJ, Iannazzi JA, Taylor RC, Hewick RM, Rosen V, Wang EA, Wozney JM.
Identification of transforming growth factor beta family members present in bone-inductive protein purified from bovine bone. Proc Natl Acad Sci U S A. 1990;87(24):9843-7.
33. Chang CF, Morales M, Chou J, Chen HL, Hoffer B, Wang Y. Bone morphogenetic
proteins are involved in fetal kidney tissue transplantation-induced neuroprotection in stroke rats. Neuropharmacology. 2002;43(3):418-26.
34. Chen B, Lin H, Zhao Y, Wang B, Zhao Y, Liu Y, Liu Z, Dai J. Activation of
demineralized bone matrix by genetically engineered human bone morphogenetic protein-2 with a collagen binding domain derived from von Willebrand factor propolypeptide. J Biomed Mater Res A. 2007a;80(2):428-34.
35. Chen B, Lin H, Wang J, Zhao Y, Wang B, Zhao W, Sun W, Dai J. Homogeneous
osteogenesis and bone regeneration by demineralized bone matrix loading with collagen-targeting bone morphogenetic protein-2. Biomaterials. 2007;28(6):1027-35.
36. Chen D, Zhao M, Mundy GR. Bone morphogenetic proteins. Growth Factors. 2004;22(4):233-41.
37. Cheng H, Jiang W, Phillips FM, Haydon RC, Peng Y, Zhou L, Luu HH, An N, Breyer B,
Vanichakarn P, Szatkowski JP, Park JY, He TC. Osteogenic activity of the fourteen types of human bone morphogenetic proteins (BMPs). J Bone Joint Surg Am. 2003;85-A(8):1544-52. Erratum in J Bone Joint Surg Am. 2004;86-A(1):141.
38. Chou J, Harvey BK, Chang CF, Shen H, Morales M, Wang Y. Neuroregenerative effects
of BMP7 after stroke in rats. J Neurol Sci. 2006;240(1-2):21-9. 39. Cohen SN, Chang AC, Boyer HW, Helling RB. Construction of biologically functional
bacterial plasmids in vitro. Proc Natl Acad Sci U S A. 1973;70(11):3240-4.
40. Conrad HE. Heparin-binding Proteins, Academic Press, San Diego. 1998.
41. Constam DB, Robertson EJ. Regulation of bone morphogenetic protein activity by pro domains and proprotein convertases. J Cell Biol. 1999;144(1):139-49.
42. Cook SD, Dalton JE, Prewett AB, Whitecloud TS 3rd. In vivo evaluation of
demineralized bone matrix as a bone graft substitute for posterior spinal fusion. Spine. 1995;20(8):877-86.
43. Crisan M, Yap S, Casteilla L, Chen CW, Corselli M, Park TS, Andriolo G, Sun B, Zheng
B, Zhang L, Norotte C, Teng PN, Traas J, Schugar R, Deasy BM, Badylak S, Buhring HJ, Giacobino JP, Lazzari L, Huard J, Péault B. A perivascular origin for mesenchymal stem cells in multiple human organs. Cell Stem Cell. 2008;3(3):301-13.
44. Czubayko F, Liaudet-Coopman ED, Aigner A, Tuveson AT, Berchem GJ, Wellstein A. A secreted FGF-binding protein can serve as the angiogenic switch in human cancer. Nat Med. 1997;3(10):1137-40.
45. Dale L, Howes G, Price BM, Smith JC. Bone morphogenetic protein 4: a ventralizing
factor in early Xenopus development. Development. 1992 Jun;115(2):573-85. 46. da Silva Meirelles L, Caplan AI, Nardi NB. In search of the in vivo identity of
mesenchymal stem cells. Stem Cells. 2008;26(9):2287-99.
Bibliography__________________________________________________________________
206
47. Deckers MM, van Bezooijen RL, van der Horst G, Hoogendam J, van Der Bent C, Papapoulos SE, Löwik CW. Bone morphogenetic proteins stimulate angiogenesis through osteoblast-derived vascular endothelial growth factor A. Endocrinology. 2002;143(4):1545-53.
48. Debiais F, Hott M, Graulet AM, Marie PJ. The effects of fibroblast growth factor-2 on human neonatal calvaria osteoblastic cells are differentiation stage specific. J Bone Miner Res. 1998;13(4):645-54.
49. Delany AM, Canalis E. Basic fibroblast growth factor destabilizes osteonectin mRNA in osteoblasts. Am J Physiol. 1998;274(3 Pt 1):C734-40.
50. Demarquay D, Dumontier MF, Tsagris L, Bourguignon J, Nataf V, Corvol MT. In vitro insulin-like growth factor I interaction with cartilage cells derived from postnatal animals. Horm Res. 1990;33(2-4):111-4
51. Deng C, Wynshaw-Boris A, Zhou F, Kuo A, Leder P. Fibroblast growth factor receptor 3 is a negative regulator of bone growth. Cell. 1996;84(6):911-21.
52. Dickinson ME, Kobrin MS, Silan CM, Kingsley DM, Justice MJ, Miller DA, Ceci JD, Lock LF, Lee A, Buchberg AM, et al. Chromosomal localization of seven members of the murine TGF-beta superfamily suggests close linkage to several morphogenetic mutant loci. Genomics. 1990;6(3):505-20.
53. Dono R, Texido G, Dussel R, Ehmke H, Zeller R. Impaired cerebral cortex development and blood pressure regulation in FGF-2-deficient mice. EMBO J. 1998;17(15):4213-25.
54. Dowd CJ, Cooney CL, Nugent MA. Heparan sulfate mediates bFGF transport through basement membrane by diffusion with rapid reversible binding. J Biol Chem. 1999;274(8):5236-44.
55. Ebisawa T, Tada K, Kitajima I, Tojo K, Sampath TK, Kawabata M, Miyazono K, Imamura T. Characterization of bone morphogenetic protein-6 signaling pathways in osteoblast differentiation. J Cell Sci. 1999;112(20):3519-27.
56. Einhorn TA, Majeska RJ, Rush EB, Levine PM, Horowitz MC. The expression of cytokine activity by fracture callus. J Bone Miner Res. 1995;10(8):1272-81.
57. Einhorn TA, Majeska RJ, Mohaideen A, Kagel EM, Bouxsein ML, Turek TJ, Wozney JM.
A single percutaneous injection of recombinant human bone morphogenetic protein-2 accelerates fracture repair. J Bone Joint Surg Am. 2003;85-A(8):1425-35.
58. Eriksson AE, Cousens LS, Weaver LH, Matthews BW. Three-dimensional structure of human basic fibroblast growth factor. Proc Natl Acad Sci U S A. 1991;88(8):3441-5.
59. Fakhry A, Ratisoontorn C, Vedhachalam C, Salhab I, Koyama E, Leboy P, Pacifici M, Kirschner RE, Nah HD. Effects of FGF-2/-9 in calvarial bone cell cultures: differentiation stage-dependent mitogenic effect, inverse regulation of BMP-2 and noggin, and enhancement of osteogenic potential. Bone. 2005;36(2):254-66.
60. Ferrara N, Davis-Smyth T. The biology of vascular endothelial growth factor. Endocr Rev. 1997;18(1):4-25.
61. Finkemeier CG. Bone-grafting and bone-graft substitutes. J Bone Joint Surg Am.
2002;84-A(3):454-64.
62. Finnern HW, Sykes DP. The hospital cost of vertebral fractures in the EU: estimates using national datasets. Osteoporos Int. 2003;14(5):429-36.
___________________________________________________________________Bibliography
207
63. Folkman J, Klagsbrun M, Sasse J, Wadzinski M, Ingber D, Vlodavsky I. A heparin-binding angiogenic protein -basic fibroblast growth factor- is stored within basement membrane. Am J Pathol. 1988;130(2):393-400.
64. Friedlaender GE, Perry CR, Cole JD, Cook SD, Cierny G, Muschler GF, Zych GA,
Calhoun JH, LaForte AJ, Yin S. Osteogenic protein-1 (bone morphogenetic protein-7) in the treatment of tibial nonunions. J Bone Joint Surg Am. 2001;83-A Suppl 1(Pt 2):S151-8.
65. Friedman MS, Long MW, Hankenson KD. Osteogenic differentiation of human
mesenchymal stem cells is regulated by bone morphogenetic protein-6. J Cell Biochem. 2006;98(3):538-54.
66. Friess W. Collagen--biomaterial for drug delivery. Eur J Pharm Biopharm.
1998;45(2):113-36.
67. Fujimura K, Bessho K, Okubo Y, Kusumoto K, Segami N, Iizuka T. The effect of fibroblast growth factor-2 on the osteoinductive activity of recombinant human bone morphogenetic protein-2 in rat muscle. Arch Oral Biol. 2002;47(8):577-84.
68. Garrison KR, Donell S, Ryder J, Shemilt I, Mugford M, Harvey I, Song F. Clinical effectiveness and cost-effectiveness of bone morphogenetic proteins in the non-healing of fractures and spinal fusion: a systematic review. Health Technol Assess. 2007;11(30):1-150.
69. Gazzerro E, Canalis E. Bone morphogenetic proteins and their antagonists. Rev Endocr
Metab Disord. 2006;7(1-2):51-65. 70. Geiger M, Li RH, Friess W. Collagen sponges for bone regeneration with rhBMP-2. Adv
Drug Deliv Rev. 2003;55(12):1613-29.
71. Gentry LE, Nash BW. The pro domain of pre-pro-transforming growth factor beta 1 when independently expressed is a functional binding protein for the mature growth factor. Biochemistry. 1990;29(29):6851-7.
72. Gerstenfeld LC, Cullinane DM, Barnes GL, Graves DT, Einhorn TA. Fracture healing as a post-natal developmental process: molecular, spatial, and temporal aspects of its regulation. J Cell Biochem. 2003;88(5):873-84.
73. Gitelman SE, Kobrin MS, Ye JQ, Lopez AR, Lee A, Derynck R. Recombinant Vgr-1/BMP-
6-expressing tumors induce fibrosis and endochondral bone formation in vivo. J Cell Biol. 1994;126(6):1595-609.
74. Gospodarowicz D. Purification of a fibroblast growth factor from bovine pituitary. J Biol Chem. 1975;250(7):2515-20.
75. Govender S, Csimma C, Genant HK, Valentin-Opran A, Amit Y, Arbel R, Aro H, Atar D,
Bishay M, Börner MG, Chiron P, Choong P, Cinats J, Courtenay B, Feibel R, Geulette B, Gravel C, Haas N, Raschke M, Hammacher E, van der Velde D, Hardy P, Holt M, Josten C, Ketterl RL, Lindeque B, Lob G, Mathevon H, McCoy G, Marsh D, Miller R, Munting E, Oevre S, Nordsletten L, Patel A, Pohl A, Rennie W, Reynders P, Rommens PM, Rondia J, Rossouw WC, Daneel PJ, Ruff S, Rüter A, Santavirta S, Schildhauer TA, Gekle C, Schnettler R, Segal D, Seiler H, Snowdowne RB, Stapert J, Taglang G, Verdonk R, Vogels L, Weckbach A, Wentzensen A, Wisniewski T; BMP-2 Evaluation in Surgery for Tibial Trauma (BESTT) Study Group. Recombinant human bone morphogenetic protein-2 for treatment of open tibial fractures: a prospective, controlled, randomized study of four hundred and fifty patients. J Bone Joint Surg Am. 2002;84-A(12):2123-34.
Bibliography__________________________________________________________________
208
76. Grace TD. Establishment of four strains of cells from insect tissues grown in vitro. Nature. 1962;195:788-9.
77. Granjeiro JM, Oliveira RC, Bustos-Valenzuela JC, Sogayar MC, Taga R. Bone
morphogenetic proteins: from structure to clinical use. Braz J Med Biol Res. 2005;38(10):1463-73.
78. Gratacòs E, Gavaldà N, Alberch J. Bone morphogenetic protein-6 is a neurotrophic
factor for calbindin-positive striatal neurons. J Neurosci Res. 2002;70(5):638-44.
79. Greenwald J, Groppe J, Gray P, Wiater E, Kwiatkowski W, Vale W, Choe S. The BMP7/ActRII extracellular domain complex provides new insights into the cooperative nature of receptor assembly. Mol Cell. 2003;11(3):605-17.
80. Griffith DL, Keck PC, Sampath TK, Rueger DC, Carlson WD. Three-dimensional structure of recombinant human osteogenic protein 1: Structural paradigm for the transforming growth factor β superfamily. Proc Natl Acad Sci U S A. 1996;93:878-83.
81. Groppe J, Greenwald J, Wiater E, Rodriguez-Leon J, Economides AN, Kwiatkowski W, Affolter M, Vale WW, Belmonte JC, Choe S. Structural basis of BMP signalling inhibition by the cystine knot protein Noggin. Nature. 2002;420(6916):636-42.
82. Gruber CW, Cemazar M, Heras B, Martin JL, Craik DJ. Protein disulfide isomerase: the
structure of oxidative folding. Trends Biochem Sci. 2006;31(8):455-64.
83. Hahn GV, Cohen RB, Wozney JM, Levitz CL, Shore EM, Zasloff MA, Kaplan FS. A bone morphogenetic protein subfamily: chromosomal localization of human genes for BMP5, BMP6, and BMP7. Genomics. 1992;14(3):759-62.
84. Hames BD, Rickwood D. Gel electrophoresis of proteins. A practical approach. Hames
BD and Rickwood D, eds. IRL Press, London. 1981. 85. Han B, Hall FL, Nimni ME. Refolding of a recombinant collagen-targeted TGF-beta2
fusion protein expressed in Escherichia coli. Protein Expr Purif. 1997;11(2):169-78. 86. Han B, Perelman N, Tang B, Hall F, Shors EC, Nimni ME. Collagen-targeted BMP3
fusion proteins arrayed on collagen matrices or porous ceramics impregnated with Type I collagen enhance osteogenesis in a rat cranial defect model. J Orthop Res. 2002;20(4):747-55.
87. Hart RA, Rinas U, Bailey JE. Protein composition of Vitreoscilla hemoglobin inclusion
bodies produced in Escherichia coli. J Biol Chem. 1990;265(21):12728-33. 88. Hartman EH, Pikkemaat JA, Van Asten JJ, Vehof JW, Heerschap A, Oyen WJ, et al.
Demineralized bone matrix-induced ectopic bone formation in rats: in vivo study with follow-up by magnetic resonance imaging, magnetic resonance angiography, and dual-energy X-ray absorptiometry. Tissue Eng. 2004;10(5-6):747-754.
89. Hazama M, Aono A, Ueno N, Fujisawa Y. Efficient expression of a heterodimer of bone
morphogenetic protein subunits using a baculovirus expression system. Biochem Biophys Res Commun. 1995;209(3):859-66.
90. Hillger F, Herr G, Rudolph R, Schwarz E. Biophysical comparison of BMP-2, ProBMP-2,
and the free pro-peptide reveals stabilization of the pro-peptide by the mature growth factor. J Biol Chem. 2005;280(15):14974-80.
91. Hink WF. Established insect cell line from the cabbage looper, Trichoplusia ni. Nature.
1970;226(5244):466-7.
___________________________________________________________________Bibliography
209
92. Hogan BL. Bone morphogenetic proteins in development. Curr Opin Genet Dev. 1996;6(4):432-8.
93. Hollinger JO, Uludag H, Winn SR. Sustained release emphasizing recombinant human
bone morphogenetic protein-2. Adv Drug Deliv Rev. 1998;31(3):303-318.
94. Hsu DR, Economides AN, Wang X, Eimon PM, Harland RM. The Xenopus dorsalizing factor Gremlin identifies a novel family of secreted proteins that antagonize BMP activities. Mol Cell. 1998;1(5):673-83.
95. Hsu TA, Watson S, Eiden JJ, Betenbaugh MJ. Rescue of immunoglobulins from
insolubility is facilitated by PDI in the baculovirus expression system. Protein Expr Purif. 1996;7(3):281-8.
96. Huang KK, Shen C, Chiang CY, Hsieh YD, Fu E. Effects of bone morphogenetic
protein-6 on periodontal wound healing in a fenestration defect of rats. J Periodontal Res. 2005;40(1):1-10.
97. Hubbell JA. Biomaterials in tissue engineering. Biotechnology (N Y). 1995;13(6):565-
76.
98. Hurley MM, Abreu C, Harrison JR, Lichtler AC, Raisz LG, Kream BE. Basic fibroblast growth factor inhibits type I collagen gene expression in osteoblastic MC3T3-E1 cells. J Biol Chem. 1993;268(8):5588-93.
99. Iemura S, Yamamoto TS, Takagi C, Uchiyama H, Natsume T, Shimasaki S, Sugino H, Ueno N. Direct binding of follistatin to a complex of bone-morphogenetic protein and its receptor inhibits ventral and epidermal cell fates in early Xenopus embryo. Proc Natl Acad Sci U S A. 1998;95(16):9337-42.
100. Imamura T, Takase M, Nishihara A, Oeda E, Hanai J, Kawabata M, Miyazono K. Smad6 inhibits signalling by the TGF-beta superfamily. Nature. 1997;389(6651):622-6.
101. Ishikawa T, Terai H, Kitajima T. Production of a biologically active epidermal growth
factor fusion protein with high collagen affinity. J Biochem. 2001;129(4):627-33.
102. Ishitani T, Ninomiya-Tsuji J, Nagai S, Nishita M, Meneghini M, Barker N, Waterman M, Bowerman B, Clevers H, Shibuya H, Matsumoto K. The TAK1-NLK-MAPK-related pathway antagonizes signalling between beta-catenin and transcription factor TCF. Nature. 1999;399(6738):798-802.
103. Israel DI, Nove J, Kerns KM, Moutsatsos IK, Kaufman RJ. Expression and
characterization of bone morphogenetic protein-2 in Chinese hamster ovary cells. Growth Factors. 1992;7(2):139-50.
104. Itoh F, Asao H, Sugamura K, Heldin CH, ten Dijke P, Itoh S. Promoting bone morphogenetic protein signaling through negative regulation of inhibitory Smads. EMBO J. 2001;20(15):4132-42.
105. Itoh S, Itoh F, Goumans MJ, Ten Dijke P. Signaling of transforming growth factor-beta
family members through Smad proteins. Eur J Biochem. 2000;267(24):6954-67.
106. Iwamoto M, Shimazu A, Pacifici M. Regulation of chondrocyte maturation by fibroblast growth factor-2 and parathyroid hormone. J Orthop Res. 1995;13(6):838-45.
Bibliography__________________________________________________________________
210
107. Jane JA Jr, Dunford BA, Kron A, Pittman DD, Sasaki T, Li JZ, Li H, Alden TD, Dayoub H, Hankins GR, Kallmes DF, Helm GA. Ectopic osteogenesis using adenoviral bone morphogenetic protein (BMP)-4 and BMP-6 gene transfer. Mol Ther. 2002;6(4):464-70.
108. Jarvis DL, Garcia A Jr. Long-term stability of baculoviruses stored under various
conditions. Biotechniques. 1994;16(3):508-13.
109. Jones WK, Richmond EA, White K, Sasak H, Kusmik W, Smart J, Oppermann H, Rueger DC, Tucker RF. Osteogenic protein-1 (OP-1) expression and processing in Chinese hamster ovary cells: isolation of a soluble complex containing the mature and pro-domains of OP-1. Growth Factors. 1994;11(3):215-25.
110. Kadam S, McMahon A, Tzou P, Stathopoulos A. FGF ligands in Drosophila have distinct
activities required to support cell migration and differentiation. Development. 2009;136(5):739-47.
111. Kakudo N, Kusumoto K, Kuro A, Ogawa Y. Effect of recombinant human fibroblast
growth factor-2 on intramuscular ectopic osteoinduction by recombinant human bone morphogenetic protein-2 in rats. Wound Repair Regen. 2006;14(3):336-42.
112. Kale AA, Di Cesare PE. Osteoinductive agents. Basic science and clinical applications.
Am J Orthop. 1995;24(10):752-761.
113. Kan M, Wang F, Xu J, Crabb JW, Hou J, McKeehan WL. An essential heparin-binding domain in the fibroblast growth factor receptor kinase. Science. 1993;259(5103):1918-21.
114. Kanczler JM, Oreffo ROC. Osteogenesis and angiogenesis: the potential for
engineering bone. Eur Cell Mater. 2008;15:100-14. 115. Kane JF. Effects of rare codon clusters on high-level expression of heterologous
proteins in Escherichia coli. Curr Opin Biotechnol. 1995;6(5):494-500.
116. Katagiri T, Yamaguchi A, Komaki M, Abe E, Takahashi N, Ikeda T, Rosen V, Wozney JM, Fujsawa-Sehara A, Suda T. Bone morphogenetic protein-2 converts the differentiation pathway of C2C12 myoblasts into the osteoblast lineage. J Cell Biol. 1994;127(6 Pt 1):1755-66.
117. Kato Y, Iwamoto M. Fibroblast growth factor is an inhibitor of chondrocyte terminal differentiation. J Biol Chem. 1990;265(10):5903-9.
118. Kawabata M, Imamura T, Miyazono K. Signal transduction by bone morphogenetic
proteins. Cytokine Growth Factor Rev. 1998;9(1):49-61. 119. Kawase Y, Ohdate Y, Shimojo T, Taguchi Y, Kimizuka F, Kato I. Construction and
characterization of a fusion protein with epidermal growth factor and the cell-binding domain of fibronectin. FEBS Lett. 1992;298(2-3):126-8. Erratum in: FEBS Lett 1992;301(1):124.
120. Keller S, Nickel J, Zhang JL, Sebald W, Mueller TD. Molecular recognition of BMP-2
and BMP receptor IA. Nat Struct Mol Biol. 2004;11(5):481-8.
121. Kessler E, Takahara K, Biniaminov L, Brusel M, Greenspan DS. Bone morphogenetic protein-1: the type I procollagen C-proteinase. Science. 1996;271(5247):360-2.
___________________________________________________________________Bibliography
211
122. Kimura N, Matsuo R, Shibuya H, Nakashima K, Taga T. BMP2-induced apoptosis is mediated by activation of the TAK1-p38 kinase pathway that is negatively regulated by Smad6. J Biol Chem. 2000;275(23):17647-52.
123. Kingsley DM. The TGF-beta superfamily: new members, new receptors, and new genetic tests of function in different organisms. Genes Dev. 1994;8(2):133-46.
124. Kirker-Head CA. Potential applications and delivery strategies for bone morphogenetic
proteins. Adv Drug Deliv Rev. 2000;43(1):65-92. 125. Kitajima T, Terai H, Ito Y. A fusion protein of hepatocyte growth factor for
immobilization to collagen. Biomaterials. 2007;28(11):1989-97.
126. Kneser U, Schaefer DJ, Polykandriotis E, Horch RE. Tissue engineering of bone: the reconstructive surgeon's point of view. J Cell Mol Med. 2006;10(1):7-19.
127. Koenig BB, Cook JS, Wolsing DH, Ting J, Tiesman JP, Correa PE, Olson CA, Pecquet AL, Ventura F, Grant RA, et al. Characterization and cloning of a receptor for BMP-2 and BMP-4 from NIH 3T3 cells. Mol Cell Biol. 1994;14(9):5961-74.
128. Kon T, Cho TJ, Aizawa T, Yamazaki M, Nooh N, Graves D, Gerstenfeld LC, Einhorn TA. Expression of osteoprotegerin, receptor activator of NF-kappaB ligand (osteoprotegerin ligand) and related proinflammatory cytokines during fracture healing. J Bone Miner Res. 2001;16(6):1004-14.
129. LaBianco GJ, Vito GR, Kalish SR. Use of the Ilizarov external fixator in the treatment of
lower extremity deformities. J Am Podiatr Med Assoc. 1996;86(11):523-31. 130. Li RH, Wozney JM. Delivering on the promise of bone morphogenetic proteins. Trends
Biotechnol. 2001;19(7):255-65.
131. Lieberman JR, Daluiski A, Einhorn TA. The role of growth factors in the repair of bone. Biology and clinical applications. J Bone Joint Surg Am. 2002;84-A(6):1032-44.
132. Lind M. Growth factor stimulation of bone healing. Effects on osteoblasts, osteomies, and implants fixation. Acta Orthop Scand Suppl. 1998;283:2-37.
133. Long S, Truong L, Bennett K, Phillips A, Wong-Staal F, Ma H. Expression, purification, and renaturation of bone morphogenetic protein-2 from Escherichia coli. Protein Expr Purif. 2006;46(2):374-8.
134. Lu M, Rabie AB. The effect of demineralized intramembranous bone matrix and basic fibroblast growth factor on the healing of allogeneic intramembranous bone grafts in the rabbit. Arch Oral Biol. 2002;47(12):831-41.
135. Luckow VA. Clonong and expression of heterologous genes in insect cells with
baculovirus vectors. In: Prokop A, Bajpai RK and Ho C, editors. Recombinant DNA Technology and Applications. New York, McGraw-Hill. 1991:97-152.
136. Luyten FP, Cunningham NS, Ma S, Muthukumaran N, Hammonds RG, Nevins WB,
Woods WI, Reddi AH. Purification and partial amino acid sequence of osteogenin, a protein initiating bone differentiation. J Biol Chem. 1989;264(23):13377-80.
137. Lyons KM, Pelton RW, Hogan BL. Patterns of expression of murine Vgr-1 and BMP-2a
RNA suggest that transforming growth factor-beta-like genes coordinately regulate aspects of embryonic development. Genes Dev. 1989;3(11):1657-68.
Bibliography__________________________________________________________________
212
138. Lyons KM, Jones CM, Hogan BL. The DVR gene family in embryonic development. Trends Genet. 1991;7(11-12):408-12.
139. Macías-Silva M, Hoodless PA, Tang SJ, Buchwald M, Wrana JL. Specific activation of Smad1 signaling pathways by the BMP7 type I receptor, ALK2. J Biol Chem. 1998;273(40):25628-36.
140. Malitschek B, Schartl M. Rapid identification of recombinant baculoviruses using PCR.
Biotechniques. 1991;11(2):177-8.
141. Mansukhani A, Bellosta P, Sahni M, Basilico C. Signaling by fibroblast growth factors (FGF) and fibroblast growth factor receptor 2 (FGFR2)-activating mutations blocks mineralization and induces apoptosis in osteoblasts. J Cell Biol. 2000;149(6):1297-308.
142. Marchal I, Jarvis DL, Cacan R, Verbert A. Glycoproteins from insect cells: sialylated or not? Biol Chem. 2001 Feb;382(2):151-9
143. Martinez G, Carnazza ML, Di Giacomo C, Sorrenti V, Vanella A. Expression of bone
morphogenetic protein-6 and transforming growth factor-beta1 in the rat brain after a mild and reversible ischemic damage. Brain Res. 2001;894(1):1-11.
144. Maruoka Y, Oida S, Iimura, T, Takeda K, Asahina I, Enomoto S, Sasaki S. Production
of functional human bone morphogenetic protein-2 using a baculovirus/Sf9 insect cell system. Biochem Mol Biol Int. 1995;35(5):957-63.
145. Massague J. TGF-beta signal transduction. Annu Rev Biochem. 1998;67:753-91.
146. Massagué J, Chen YG. Controlling TGF-beta signaling. Genes Dev. 2000;14(6):627-44.
147. McCarthy TL, Casinghino S, Centrella M, Canalis E. Complex pattern of insulin-like
growth factor binding protein expression in primary rat osteoblast enriched cultures: regulation by prostaglandin E2, growth hormone, and the insulin-like growth factors. J Cell Physiol. 1994;160(1):163-75.
148. McDonald NQ, Hendrickson WA. A structural superfamily of growth factors containing a cystine knot motif. Cell. 1993;73(3):421-4.
149. McKeehan WL. Growth factor receptors and prostate cell growth. Cancer Surv 1992;11:165–175.
150. Merino R, Gañan Y, Macias D, Economides AN, Sampath KT, Hurle JM. Morphogenesis of digits in the avian limb is controlled by FGFs, TGFbetas, and noggin through BMP signaling. Dev Biol. 1998;200(1):35-45.
151. Mohan S, Bautista CM, Wergedal J, Baylink DJ. Isolation of an inhibitory insulin-like growth factor (IGF) binding protein from bone cell-conditioned medium: a potential local regulator of IGF action. Proc Natl Acad Sci U S A. 1989;86(21):8338-42.
152. Montero JA, Gañan Y, Macias D, Rodriguez-Leon J, Sanz-Esquerro JJ, Merino R,
Chimal-Monroy J, Nieto MA, Hurle JM. Role of FGFs in the control of programmed cell death during limb development. Development. 2001;128:2075-84.
153. Moscatelli D. Autocrine downregulation of fibroblast growth factor receptors in F9 teratocarcinoma cells. J Cell Physiol. 1994;160(3):555-62.
154. Mundy GR. Regulation of bone formation by bone morphogenetic proteins and other growth factors. Clin Orthop Relat Res. 1996;(324):24-8.
___________________________________________________________________Bibliography
213
155. Murakami G, Watabe T, Takaoka K, Miyazono K, Imamura T. Cooperative inhibition of bone morphogenetic protein signaling by Smurf1 and inhibitory Smads. Mol Biol Cell. 2003;14(7):2809-17.
156. Nagai H, Tsukuda R, Mayahara H. Effects of basic fibroblast growth factor (bFGF) on bone formation in growing rats. Bone. 1995;16(3):367-73.
157. Nakagawa T, Sugiyama T, Shimizu K, Murata T, Narita M, Nakamura S, Tagawa T.
Characterization of the development of ectopic chondroid/bone matrix and chondrogenic/osteogenic cells during osteoinduction by rhBMP-2: a histochemical and ultrastructural study. Oral Diseases. 2003;9:255-63.
158. Nakamura Y, Tensho K, Nakaya H, Nawata M, Okabe T, Wakitani S. Low dose
fibroblast growth factor-2 (FGF-2) enhances bone morphogenetic protein-2 (BMP-2)-induced ectopic bone formation in mice. Bone. 2005;36(3):399-407. Erratum in: Bone. 2006;39(1):222. Bone. 2007;40(1):244-5.
159. Nakase T, Yoshikawa H. Potential roles of bone morphogenetic proteins (BMPs) in
skeletal repair and regeneration. J Bone Miner Metab. 2006;24(6):425-33.
160. Naski MC, Colvin JS, Coffin JD, Ornitz DM. Repression of hedgehog signaling and BMP4 expression in growth plate cartilage by fibroblast growth factor receptor 3. Development. 1998;125(24):4977-88.
161. Nguyen B, Jarnagin K, Williams S, Chan H, Barnett J. Fed-batch culture of insect cells:
a method to increase the yield of recombinant human nerve growth factor (rhNGF) in the baculovirus expression system. J Biotechnol. 1993;31(2):205-17.
162. Nguyen TQ, Goldschmeding R. Bone morphogenetic protein-7 and connective tissue
growth factor: novel targets for treatment of renal fibrosis? Pharm Res. 2008;25(10):2416-26.
163. Nickel J, Kotzsch A, Sebald W, Mueller TD. A single residue of GDF-5 defines binding
specificity to BMP receptor IB. J Mol Biol. 2005;349(5):933-47. 164. Nishi N, Matsushita O, Yuube K, Miyanaka H, Okabe A, Wada F. Collagen-binding
growth factors: production and characterization of functional fusion proteins having a collagen-binding domain. Proc Natl Acad Sci U S A. 1998;95(12):7018-23.
165. Nishita M, Ueno N, Shibuya H. Smad8B, a Smad8 splice variant lacking the SSXS site that inhibits Smad8-mediated signalling. Genes Cells. 1999;4(10):583-91.
166. Nohe A, Hassel S, Ehrlich M, Neubauer F, Sebald W, Henis YI, Knaus P. The mode of bone morphogenetic protein (BMP) receptor oligomerization determines different BMP-2 signaling pathways. J Biol Chem. 2002;277(7):5330-8.
167. Nugent MA, Iozzo RV. Fibroblast growth factor-2. Int J Biochem Cell Biol. 2000;32(2):115-20.
168. Onichtchouk D, Chen YG, Dosch R, Gawantka V, Delius H, Massagué J, Niehrs C. Silencing of TGF-beta signalling by the pseudoreceptor BAMBI. Nature. 1999;401(6752):480-5.
169. O’Reilly DR, Miller RK, Luckow MA. Baculovirus expression vectors: a laboratory
manual. Wh Feeman and company, New York. 1994.
170. Ornitz DM, Itoh N. Fibroblast growth factors. Genome Biol. 2001;2(3):reviews3005.
Bibliography__________________________________________________________________
214
171. Padgett RW, Wozney JM, Gelbart WM. Human BMP sequences can confer normal dorsal-ventral patterning in the Drosophila embryo. Proc Natl Acad Sci U S A. 1993;90(7):2905-9.
172. Patel K. Follistatin. Int J Biochem Cell Biol. 1998;30(10):1087-93. 173. Pecina M, Giltaij LR, Vukicevic S. Orthopaedic applications of osteogenic protein-1
(BMP-7). Int Orthop. 2001;25(4):203-8. 174. Pecina M, Haspl M, Jelic M, Vukicevic S. Repair of a resistant tibial non-union with a
recombinant bone morphogenetic protein-7 (rh-BMP-7). Int Orthop. 2003;27(5):320-1.
175. Peel SA, Hu ZM, Clokie CM. In search of the ideal bone morphogenetic protein
delivery system: in vitro studies on demineralized bone matrix, purified, and recombinant bone morphogenetic protein. J Craniofac Surg. 2003;14(3):284-91.
176. Peterson GL. Determination of total protein. Methods Enzymol. 1983;91:95-119.
177. Piccolo S, Sasai Y, Lu B, De Robertis EM. Dorsoventral patterning in Xenopus:
inhibition of ventral signals by direct binding of chordin to BMP-4. Cell. 1996;86(4):589-98.
178. Piedra ME and Ros MA. BMP signalin positively regulates Nodal expression during left
right specification in the chick embryo. Development. 2002;129:3431-40.
179. Pitaru S, Kotev-Emeth S, Noff D, Kaffuler S, Savion N. Effect of basic fibroblast growth factor on the growth and differentiation of adult stromal bone marrow cells: enhanced development of mineralized bone-like tissue in culture. J Bone Miner Res. 1993;8(8):919-29.
180. Pri-Chen S, Pitaru S, Lokiec F, Savion N. Basic fibroblast growth factor enhances the growth and expression of the osteogenic phenotype of dexamethasone-treated human bone marrow-derived bone-like cells in culture. Bone. 1998;23(2):111-7.
181. Polinder S, Meerding WJ, van Baar ME, Toet H, Mulder S, van Beeck EF; EUROCOST Reference Group. Cost estimation of injury-related hospital admissions in 10 European countries. J Trauma. 2005;59(6):1283-90.
182. Power RA, Iwaniec UT, Magee KA, Mitova-Caneva NG, Wronski TJ. Basic fibroblast growth factor has rapid bone anabolic effects in ovariectomized rats. Osteoporos Int. 2004;15(9):716-23.
183. Prisell PT, Edwall D, Lindblad JB, Levinovitz A, Norstedt G. Expression of insulin-like growth factors during bone induction in rat. Calcif Tissue Int. 1993;53(3):201-5.
184. Raval P, Hsu HH, Schneider DJ, Sarras MP Jr, Masuhara K, Bonewald LF, Anderson
HC. Expression of bone morphogenetic proteins by osteoinductive and non-osteoinductive human osteosarcoma cells. J Dent Res. 1996;75(7):1518-23.
185. Reddi AH. Bone morphogenetic proteins: an unconventional approach to isolation of
the first mammalian morphogens. Cytokine Growth Factor Rev. 1997;8(1):11-20.
186. Reddi AH. Morphogenetic messages are in the extracellular matrix: biotechnology from bench to bedside. Biochem Soc Trans. 2000;28(4):345-9.
187. Reddi AH. Bone morphogenetic proteins: from basic science to clinical applications. J
Bone Joint Surg Am. 2001; 83-A Suppl 1(Pt 1):S1-6.
___________________________________________________________________Bibliography
215
188. Reed L, Muench H. A simple method for estimating fifty percent endpoints. Am J Hyg. 1938;27:493-7.
189. Rengachary SS. Bone morphogenetic proteins: basic concepts. Neurosurg Focus.
2002;13(6):e2. 190. Rinas U, Bailey JE. Protein compositional analysis of inclusion bodies produced in
recombinant Escherichia coli. Appl Microbiol Biotechnol. 1992;37(5):609-14. 191. Roach HI. Why does bone matrix contain non-collagenous proteins? The possible role
of osteocalcin, osteonectin, osteopontin and bone sialoprotein in bone mineralisation and resorption. Cell Biol Int. 1994;18(6):617-28.
192. Rodan SB, Wesolowski G, Yoon K, Rodan GA. Opposing effects of fibroblast growth factor and pertussis toxin on alkaline phosphatase, osteopontin, osteocalcin, and type I collagen mRNA levels in ROS 17/2.8 cells. J Biol Chem. 1989;264(33):19934-41.
193. Ross MH and Pawlina W. Histología. Texto y atlas color con biología celular y
molecular. 5th ed. Editorial Médica Panamericana, Madrid. 2007. 194. Ruppert R, Hoffmann E, Sebald W. Human bone morphogenetic protein 2 contains a
heparin-binding site which modifies its biological activity. Eur J Biochem. 1996;237(1):295-302.
195. Sakano S, Hasegawa Y, Murata Y, Ito T, Genda E, Iwata H, Ishiguro N, Seo H. Inhibitory effect of bFGF on endochondral heterotopic ossification. Biochem Biophys Res Commun. 2002;293(2):680-5.
196. Sampath TK, DeSimone DP, Reddi AH. Extracellular bone matrix-derived growth
factor. Exp Cell Res. 1982;142(2):460-4.
197. Sampath TK, Reddi AH. Homology of bone-inductive proteins from human, monkey, bovine, and rat extracellular matrix. Proc Natl Acad Sci U S A. 1983;80(21):6591-5.
198. Sampath TK, Maliakal JC, Hauschka PV, Jones WK, Sasak H, Tucker RF, White KH,
Coughlin JE, Tucker MM, Pang RH, et al. Recombinant human osteogenic protein-1 (hOP-1) induces new bone formation in vivo with a specific activity comparable with natural bovine osteogenic protein and stimulates osteoblast proliferation and differentiation in vitro. J Biol Chem. 1992;267(28):20352-62.
199. Sampath TK, Rashka KE, Doctor JS, Tucker RF, Hoffmann FM. Drosophila
transforming growth factor beta superfamily proteins induce endochondral bone formation in mammals. Proc Natl Acad Sci U S A. 1993 Jul 1;90(13):6004-8.
200. Sandberg MM, Aro HT, Vuorio EI. Gene expression during bone repair. Clin Orthop Relat Res. 1993;(289):292-312.
201. Sanders MM, Kon C. Glutamine and glutamate metabolism in normal and heat shock
conditions in Drosophila Kc cells: conditions supporting glutamine synthesis maximize heat shock polypeptide expression. J Cell Physiol. 1992;150(3):620-31.
202. Saremba S, Nickel J, Seher A, Kotzsch A, Sebald W, Mueller TD. Type I receptor
binding of bone morphogenetic protein 6 is dependent on N-glycosylation of the ligand. FEBS J. 2008;275(1):172-83.
203. Schäfer T, Zentgraf H, Zehe C, Brügger B, Bernhagen J, Nickel W. Unconventional secretion of fibroblast growth factor 2 is mediated by direct translocation across the plasma membrane of mammalian cells. J Biol Chem. 2004;279(8):6244-51.
Bibliography__________________________________________________________________
216
204. Schedlich LJ, Flanagan JL, Crofts LA, Gillies SA, Goldberg D, Morrison NA, Eisman JA. Transcriptional activation of the human osteocalcin gene by basic fibroblast growth factor. J Bone Miner Res. 1994;9(2):143-52.
205. Schmoekel HG, Weber FE, Schense JC, Grätz KW, Schawalder P, Hubbell JA. Bone
repair with a form of BMP-2 engineered for incorporation into fibrin cell ingrowth matrices. Biotechnol Bioeng. 2005;89(3):253-62.
206. Senn N. On the healing of aseptic bone cavities by implantation of antiseptic
decalcified bone. Ann Surg. 1889;10(5):352-68.
207. Shen ZJ, Nakamoto T, Tsuji K, Nifuji A, Miyazono K, Komori T, Hirai H, Noda M. Negative regulation of bone morphogenetic protein/Smad signaling by Cas-interacting zinc finger protein in osteoblasts. J Biol Chem. 2002;277(33):29840-6.
208. Solloway MJ, Dudley AT, Bikoff EK, Lyons KM, Hogan BL, Robertson EJ. Mice lacking
Bmp6 function. Dev Genet. 1998;22(4):321-39.
209. Spinella-Jaegle S, Roman-Roman S, Faucheu C, Dunn FW, Kawai S, Galléa S, Stiot V, Blanchet AM, Courtois B, Baron R, Rawadi G. Opposite effects of bone morphogenetic protein-2 and transforming growth factor-beta1 on osteoblast differentiation. Bone. 2001;29(4):323-30.
210. Stein GS, Lian JB. Molecular mechanisms mediating proliferation/differentiation
interrelationships during progressive development of the osteoblast phenotype. Endocr Rev. 1993;14(4):424-42.
211. Sutherland MK, Geoghegan JC, Yu C, Turcott E, Skonier JE, Winkler DG, Latham JA. Sclerostin promotes the apoptosis of human osteoblastic cells: a novel regulation of bone formation. Bone. 2004;35(4):828-35.
212. Swiontkowski MF, Aro HT, Donell S, Esterhai JL, Goulet J, Jones A, Kregor PJ,
Nordsletten L, Paiement G, Patel A. Recombinant human bone morphogenetic protein-2 in open tibial fractures. A subgroup analysis of data combined from two prospective randomized studies. J Bone Joint Surg Am. 2006;88(6):1258-65.
213. Takagi J, Asai H, Saito Y. A collagen/gelatin-binding decapeptide derived from bovine
propolypeptide of von Willebrand factor. Biochemistry. 1992 Sep;31(36):8530-4.
214. Tanabe N, Ito-Kato E, Suzuki N, Nakayama A, Ogiso B, Maeno M, Ito K. IL-1alpha affects mineralized nodule formation by rat osteoblasts. Life Sci. 2004;75(19):2317-27.
215. Tanaka E, Ishino Y, Sasaki A, Hasegawa T, Watanabe M, Dalla-Bona DA, Yamano E,
van Eijden TM, Tanne K. Fibroblast growth factor-2 augments recombinant human bone morphogenetic protein-2-induced osteoinductive activity. Ann Biomed Eng. 2006;34(5):717-25.
216. Tanaka H, Wakisaka A, Ogasa H, Kawai S, Liang CT. Effects of basic fibroblast growth factor on osteoblast-related gene expression in the process of medullary bone formation induced in rat femur. J Bone Miner Metab. 2003;21(2):74-9.
217. ten Dijke P, Yamashita H, Sampath TK, Reddi AH, Estevez M, Riddle DL, Ichijo H, Heldin CH, Miyazono K. Identification of type I receptors for osteogenic protein-1 and bone morphogenetic protein-4. J Biol Chem. 1994;269(25):16985-8.
218. ten Dijke P, Goumans MJ, Itoh F, Itoh S. Regulation of cell proliferation by Smad
proteins. J Cell Physiol. 2002;191(1):1-16.
___________________________________________________________________Bibliography
217
219. Terkeltaub RA, Johnson K, Rohnow D, Goomer R, Burton D, Deftos LJ. Bone morphogenetic proteins and bFGF exert opposing regulatory effects on PTHrP expression and inorganic pyrophosphate elaboration in immortalized murine endochondral hypertrophic chondrocytes (MCT cells). J Bone Miner Res. 1998;13(6):931-41.
220. Tomiya N, Narang S, Lee YC, Betenbaugh MJ. Comparing N-glycan processing in
mammalian cell lines to native and engineered lepidopteran insect cell lines. Glycoconj J. 2004;21(6):343-60.
221. Towbin H, Staehelin T, Gordon J. Electrophoretic transfer of proteins from
polyacrylamide gels to nitrocellulose sheets: procedure and some applications. Proc Natl Acad Sci U S A. 1979;76(9):4350-4.
222. Tsiridis E, Upadhyay N, Giannoudis P. Molecular aspects of fracture healing: which are the important molecules? Injury. 2007;38 Suppl 1:S11-25.
223. Tuan TL, Cheung DT, Wu LT, Yee A, Gabriel S, Han B, Morton L, Nimni ME, Hall FL.
Engineering, expression and renaturation of targeted TGF-beta fusion proteins. Connect Tissue Res. 1996;34(1):1-9.
224. Uludag H, D'Augusta D, Golden J, Li J, Timony G, Riedel R, Wozney JM. Implantation
of recombinant human bone morphogenetic proteins with biomaterial carriers: A correlation between protein pharmacokinetics and osteoinduction in the rat ectopic model. J Biomed Mater Res. 2000;50(2):227-38.
225. Uludag H, Gao T, Porter TJ, Friess W, Wozney JM. Delivery systems for BMPs: factors
contributing to protein retention at an application site. J Bone Joint Surg Am. 2001;83-A Suppl 1(Pt 2):S128-35.
226. Urist MR. Bone: formation by autoinduction. Science. 1965;150(698):893-9.
227. Urist MR, Nogami H, Mikulski A. A bone morphogenetic polypeptide. Calcif Tissue Res.
1976;21 Suppl:81-7. 228. Vaccaro AR, Anderson DG, Toth CA. Recombinant human osteogenic protein-1 (bone
morphogenetic protein-7) as an osteoinductive agent in spinal fusion. Spine. 2002;27(16 Suppl 1):S59-65.
229. Vaccaro AR, Patel T, Fischgrund J, Anderson DG, Truumees E, Herkowitz HN, Phillips
F, Hilibrand A, Albert TJ, Wetzel T, McCulloch JA. A pilot study evaluating the safety and efficacy of OP-1 Putty (rhBMP-7) as a replacement for iliac crest autograft in posterolateral lumbar arthrodesis for degenerative spondylolisthesis. Spine. 2004;29(17):1885-92.
230. Vaccaro AR, Patel T, Fischgrund J, Anderson DG, Truumees E, Herkowitz H, Phillips F,
Hilibrand A, Albert TJ. A 2-year follow-up pilot study evaluating the safety and efficacy of op-1 putty (rhbmp-7) as an adjunct to iliac crest autograft in posterolateral lumbar fusions. Eur Spine J. 2005;14(7):623-9.
231. Valentin-Opran A, Wozney J, Csimma C, Lilly L, Riedel GE. Clinical evaluation of
recombinant human bone morphogenetic protein-2. Clin Orthop Relat Res. 2002;(395):110-20.
232. Vallejo LF, Brokelmann M, Marten S, Trappe S, Cabrera-Crespo J, Hoffmann A, Gross G, Weich HA, Rinas U. Renaturation and purification of bone morphogenetic protein-2 produced as inclusion bodies in high-cell-density cultures of recombinant Escherichia coli. J Biotechnol. 2002;94(2):185-94.
Bibliography__________________________________________________________________
218
233. Vallejo LF, Rinas U. Strategies for the recovery of active proteins through refolding of bacterial inclusion body proteins. Microb Cell Fact. 2004;3(1):11.
234. van der Horst G, van Bezooijen RL, Deckers MM, Hoogendam J, Visser A, Löwik CW,
Karperien M. Differentiation of murine preosteoblastic KS483 cells depends on autocrine bone morphogenetic protein signaling during all phases of osteoblast formation. Bone. 2002;31(6):661-9.
235. van de Wijngaert FP, Tas MC, Burger EH. Characteristics of osteoclast precursor-like cells grown from mouse bone marrow. Bone Miner. 1987;3(2):111-23.
236. Vaughn JL, Goodwin RH, Tompkins GJ, McCawley P. The establishment of two cell
lines from the insect Spodoptera frugiperda (Lepidoptera; Noctuidae). In Vitro. 1977;13(4):213-7.
237. Villaverde A, Carrió MM. Protein aggregation in recombinant bacteria: biological role of
inclusion bodies. Biotechnol Lett. 2003;25(17):1385-95.
238. Visser R, Arrabal PM, Becerra J, Rinas U, Cifuentes M. The effect of an rhBMP-2 absorbable collagen sponge-targeted system on bone formation in vivo. Biomaterials. 2009;30(11):2032-7.
239. Vistica DT, Skehan P, Scudiero D, Monks A, Pittman A, Boyd MR. Tetrazolium-based
assays for cellular viability: a critical examination of selected parameters affecting formazan production. Cancer Res. 1991;51(10):2515-20. Erratum in: Cancer Res 1991;51(16):4501.
240. Volek-Smith H, Urist MR. Recombinant human bone morphogenetic protein (rhBMP)
induced heterotopic bone development in vivo and in vitro. Proc Soc Exp Biol Med. 1996;211(3):265-72.
241. Wang C, Shamah SM, Stiles CD. Recombinant PDGF from lower vertebrates: receptor
binding and immunochemical analysis with metabolically labeled growth factor. Growth Factors. 1992;7(4):279-88.
242. Wang EA, Rosen V, Cordes P, Hewick RM, Kriz MJ, Luxenberg DP, Sibley BS, Wozney
JM. Purification and characterization of other distinct bone-inducing factors. Proc Natl Acad Sci U S A. 1988;85(24):9484-8.
243. Wang EA, Rosen V, D'Alessandro JS, Bauduy M, Cordes P, Harada T, Israel DI, Hewick RM, Kerns KM, LaPan P, et al. Recombinant human bone morphogenetic protein induces bone formation. Proc Natl Acad Sci U S A. 1990;87(6):2220-4.
244. Wang JS, Aspenberg P. Basic fibroblast growth factor enhances bone-graft incorporation: dose and time dependence in rats. J Orthop Res. 1996;14(2):316-23.
245. Wang W, Mariani FV, Harland RM, Luo K. Ski represses bone morphogenic protein signaling in Xenopus and mammalian cells. Proc Natl Acad Sci U S A. 2000;97(26):14394-9.
246. Wang Y, Chang CF, Morales M, Chou J, Chen HL, Chiang YH, Lin SZ, Cadet JL, Deng
X, Wang JY, Chen SY, Kaplan PL, Hoffer BJ. Bone morphogenetic protein-6 reduces ischemia-induced brain damage in rats. Stroke. 2001;32(9):2170-8.
247. Webb AC, Bradley MK, Phelan SA, Wu JQ, Gehrke L. Use of the polymerase chain
reaction for screening and evaluation of recombinant baculovirus clones. Biotechniques. 1991;11(4):512-9.
___________________________________________________________________Bibliography
219
248. Weber FE, Eyrich G, Gratz KW, Thomas RM, Maly FE, Sailer HF. Disulfide bridge conformers of mature BMP are inhibitors for heterotopic ossification. Biochem Biophys Res Commun. 2001;286(3):554-8.
249. Whitman M. Smads and early developmental signalin by the TGFbeta superfamily.
Genes Dev. 1998;12(16):2445-62. 250. Williams DF. On the mechanisms of biocompatibility. Biomaterials. 2008;29(20):2941-
53. 251. Woo BH, Fink BF, Page R, Schrier JA, Jo YW, Jiang G, DeLuca M, Vasconez HC,
DeLuca PP. Enhancement of bone growth by sustained delivery of recombinant human bone morphogenetic protein-2 in a polymeric matrix. Pharm Res. 2001;18(12):1747-53. Erratum in: Pharm Res. 2003;20(2):334.
252. Wozney JM, Rosen V, Celeste AJ, Mitsock LM, Whitters MJ, Kriz RW, Hewick RM,
Wang EA. Novel regulators of bone formation: molecular clones and activities. Science. 1988;242(4885):1528-34.
253. Wozney JM, Rosen V, Byrne M, Celeste AJ, Moutsatsos I, Wang EA. Growth factors
influencing bone development. J Cell Sci Suppl. 1990;13:149-56.
254. Wozney JM. The bone morphogenetic protein family and osteogenesis. Mol Reprod Dev. 1992;32(2):160-7.
255. Wutzl A, Brozek W, Lernbass I, Rauner M, Hofbauer G, Schopper C, Watzinger F,
Peterlik M, Pietschmann P. Bone morphogenetic proteins 5 and 6 stimulate osteoclast generation. J Biomed Mater Res A. 2006;77(1):75-83.
256. Xiao YT, Xiang LX, Shao JZ. Bone morphogenetic protein. Biochem Biophys Res
Commun. 2007;362(3):550-3. 257. Yabe T, Samuels I, Schwartz JP. Bone morphogenetic proteins BMP-6 and BMP-7 have
differential effects on survival and neurite outgrowth of cerebellar granule cell neurons. J Neurosci Res. 2002;68(2):161-8.
258. Yaffe D, Saxel O. Serial passaging and differentiation of myogenic cells isolated from
dystrophic mouse muscle. Nature. 1977;270(5639):725-7. 259. Yamaguchi A, Ishizuya T, Kintou N, Wada Y, Katagiri T, Wozney JM, Rosen V, Yoshiki
S. Effects of BMP-2, BMP-4, and BMP-6 on osteoblastic differentiation of bone marrow-derived stromal cell lines, ST2 and MC3T3-G2/PA6. Biochem Biophys Res Commun. 1996;220(2):366-71.
260. Yamaguchi K, Nagai S, Ninomiya-Tsuji J, Nishita M, Tamai K, Irie K, Ueno N, Nishida
E, Shibuya H, Matsumoto K. XIAP, a cellular member of the inhibitor of apoptosis protein family, links the receptors to TAB1-TAK1 in the BMP signaling pathway. EMBO J. 1999;18(1):179-87.
261. Yamamoto Y, Oelgeschläger M. Regulation of bone morphogenetic proteins in early
embryonic development. Naturwissenschaften. 2004;91(11):519-34.
262. Yamashita H, Ten Dijke P, Heldin CH, Miyazono K. Bone morphogenetic protein receptors. Bone. 1996;19(6):569-74.
Bibliography__________________________________________________________________
220
263. Yoshida Y, Tanaka S, Umemori H, Minowa O, Usui M, Ikematsu N, Hosoda E, Imamura T, Kuno J, Yamashita T, Miyazono K, Noda M, Noda T, Yamamoto T. Negative regulation of BMP/Smad signaling by Tob in osteoblasts. Cell. 2000;103(7):1085-97.
264. Zachos TA, Shields KM, Bertone AL. Gene-mediated osteogenic differentiation of stem
cells by bone morphogenetic proteins-2 or -6. J Orthop Res. 2006;24(6):1279-91. 265. Zehe C, Engling A, Wegehingel S, Schäfer T, Nickel W. Cell-surface heparan sulfate
proteoglycans are essential components of the unconventional export machinery of FGF-2. Proc Natl Acad Sci U S A. 2006;103(42):15479-84.
266. Zellin G, Linde A. Effects of recombinant human fibroblast growth factor-2 on
osteogenic cell populations during orthopic osteogenesis in vivo. Bone. 2000;26(2):161-8.
267. Zhang D, Gaussin V, Taffet GE, Belaguli NS, Yamada M, Schwartz RJ, Michael LH,
Overbeek PA, Schneider MD. TAK1 is activated in the myocardium after pressure overload and is sufficient to provoke heart failure in transgenic mice. Nat Med. 2000;6(5):556-63.
268. Zhao B, Katagiri T, Toyoda H, Takada T, Yanai T, Fukuda T, Chung UI, Koike T,
Takaoka K, Kamijo R. Heparin potentiates the in vivo ectopic bone formation induced by bone morphogenetic protein-2. J Biol Chem. 2006;281(32):23246-53.
269. Zhao GQ. Consequences of knocking out BMP signaling in the mouse. Genesis.
2003;35(1):43-56.
270. Zhao M, Qiao M, Oyajobi BO, Mundy GR, Chen D. E3 ubiquitin ligase Smurf1 mediates core-binding factor alpha1/Runx2 degradation and plays a specific role in osteoblast differentiation. J Biol Chem. 2003;278(30):27939-44.
271. Zhao W, Han Q, Lin H, Gao Y, Sun W, Zhao Y, Wang B, Chen B, Xiao Z, Dai J.
Improved neovascularization and wound repair by targeting human basic fibroblast growth factor (bFGF) to fibrin. J Mol Med. 2008;86(10):1127-38.
272. Zhu H, Kavsak P, Abdollah S, Wrana JL, Thomsen GH. A SMAD ubiquitin ligase targets
the BMP pathway and affects embryonic pattern formation. Nature. 1999;400(6745):687-93.
273. Zimmerman LB, De Jesús-Escobar JM, Harland RM. The Spemann organizer signal
noggin binds and inactivates bone morphogenetic protein 4. Cell. 1996;86(4):599-606.
274. Ziran BH, Smith WR, Morgan SJ. Use of calcium-based demineralized bone
matrix/allograft for nonunions and posttraumatic reconstruction of the appendicular skeleton: preliminary results and complications. J Trauma. 2007;63(6):1324-8.
Appendix III. Abstract in Spanish.
Apéndice III.
Resumen en español.
221
222
Appendix III. Abstract in Spanish / Resumen en español
1. Introducción.
1.1. El tejido óseo y su regeneración tras una fractura.
El tejido óseo es un tipo especializado de tejido conectivo cuyo constituyente mayoritario es
matriz extracelular. La parte orgánica de esta matriz, denominada osteoide, está formada
principalmente por colágeno tipo I, aunque también es posible encontrar otros tipos de
colágeno y proteínas no colagénicas como proteoglicanos, osteonectina, osteopontina,
sialoproteínas, osteocalcina y determinados factores de crecimiento. La parte inorgánica está
constituida por fosfato cálcico en forma de hidroxiapatita, la cual se encuentra depositada sobre
la fase proteica.
Las células osteoprogenitoras derivan de células tronco mesenquimales que se encuentran
en la médula ósea. Estos osteoprogenitores pueden dar lugar a osteoblastos en respuesta a los
estímulos adecuados. Los osteoblastos, que mantienen la capacidad de dividirse, son las células
que secretan los componentes de la matriz osteoide, al igual que vesículas matriciales con altos
contenidos en fosfatasa alcalina (ALP), el enzima responsable de la mineralización de la matriz
por depósito de hidroxiapatita. Una vez mineralizado el osteoide que rodea a un osteoblasto,
éste se convierte en un osteocito, el cual posee una limitada capacidad de formación y
reabsorción de matriz extracelular, y está implicado en fenómenos de mecanotransducción,
respondiendo a estímulos mecánicos ejercidos sobre el hueso. El tercer tipo celular presente en
el hueso es el osteoclasto, que deriva de progenitores hematopoyéticos mononucleados de la
médula ósea. Estas células son las principales encargadas de reabsorber la matriz ósea,
contribuyendo así a la homeostasis del sistema esquelético.
Cuando un hueso resulta fracturado se desencadena una compleja cascada de eventos
biológicos que, en la mayoría de los casos, culmina con la completa recuperación del hueso,
tanto a nivel estructural como funcional, tras un periodo de seis a doce semanas. En este
proceso intervienen tanto factores mecánicos como de señalización intra- y extracelular para
promover la osteoinducción y la osteoconducción. La regulación de esta compleja cadena de
eventos es llevada a cabo por una gran cantidad de factores locales y sistémicos, tales como
factores de crecimiento y de diferenciación, hormonas y citoquinas.
Las moléculas que promueven la osteogénesis durante la reparación de una fractura ósea
pueden dividirse en tres grupos principales:
- Citoquinas pro-inflamatorias, tales como el factor de necrosis tumoral alfa (TNF-α) o
las interleucinas 1 y 6 (IL-1 e IL-6), que ejercen quimiotaxis sobre células
fibrogénicas endógenas y células de la respuesta inflamatoria, promueven la síntesis
de matriz extracelular y estimulan la angiogénesis.
223
Appendix III. Abstract in Spanish / Resumen en español____________________________________________________
- Factores de crecimiento y diferenciación, tales como el factor de crecimiento
transformante beta (TGF-β), proteínas morfogenéticas de hueso (BMPs), factores de
crecimiento fibroblástico (FGFs), el factor de crecimiento derivado de plaquetas
(PDGF) o los factores de crecimiento tipo insulina (IGFs).
- Metaloproteinasas y factores angiogénicos. De éstos, las metaloproteinasas son las
encargadas de degradar el cartílago y el hueso para permitir la entrada de nuevos
vasos sanguíneos, mientras que los factores angiogénicos (factor de crecimiento de
endotelio vascular o VEGF y las angiopoyetinas) promueven la formación, crecimiento
y ramificación de dichos vasos.
Obviamente, para conseguir la restauración de la forma y función original del hueso dañado
no sólo se requiere la acción de moléculas osteogénicas, sino también la modulación por parte
de moléculas inhibidoras, las cuales pueden ser clasificadas en dos grupos:
- Inhibidores de BMPs, tales como nogina, gremlin, cordina, esclerostina, folistatina y el
inhibidor de BMP y activina unido a membrana (BAMBI), que antagonizan a las BMPs
de una u otra manera a nivel extracelular. Otros inhibidores de BMPs actúan a nivel
intracelular, interfiriendo con la cascada de señalización que se desencadena cuando
las BMPs se unen a sus receptores en las células diana.
- Otras moléculas inhibidoras, tales como la interleucina 1 alfa (IL-1α) o las proteínas
de unión a IGF (IGFBPs).
Ciertos estudios apuntan a que varios de estos factores pueden tener un comportamiento
dual durante la reparación de fracturas. Así, se ha descrito que el TGF-β puede bloquear la
diferenciación osteoblástica inducida por BMP-2, mientras que los FGFs podrían estimular la
diferenciación temprana de precursores osteogénicos, pero inhibir los procesos de
diferenciación tardía y la mineralización.
1.2. Aspectos clínicos y económicos de la reparación de fracturas óseas.
La reparación de defectos óseos tiene enormes implicaciones a nivel socio-económico. Se
estima que, sólo en la Unión Europea, el coste derivado del tratamiento de fracturas de cadera
(el tipo de fractura de mayor incidencia) supera los 598 millones de euros anuales.
Si bien el tiempo esperado de reparación de forma natural de una fractura oscila entre seis
y doce semanas, hay una alta incidencia de reparaciones retardadas o de fracturas que no
llegan a soldar. Estos casos no sólo suponen una considerable disminución de la calidad de vida
de los pacientes, sino que también incrementan enormemente el coste económico a los
sistemas sanitarios.
224
Appendix III. Abstract in Spanish / Resumen en español
Mientras que ciertos casos menos severos pueden ser tratados mediante el uso de
estabilizadores mecánicos, los casos más graves suelen requerir tratamientos más sofisticados,
tales como distractores óseos, injertos óseos o la aplicación de biomateriales.
Actualmente, el injerto óseo, mediante el cual el hueso que falta es reemplazado por
material extraído del propio paciente o de donantes, es considerado el tratamiento más eficaz
para la reparación de fracturas que no sueldan. Sin embargo, la escasa cantidad de tejido que
puede ser extraído del donante y la alta morbilidad asociada a la extracción convierten en
patente la necesidad de desarrollar nuevas estrategias alternativas.
Recientemente, la comunidad médica ha centrado su atención en el uso de biomateriales
(materiales compatibles con células y tejidos vivos) naturales o sintéticos para la reparación del
tejido óseo, pretendiendo que estos materiales simulen la acción osteoconductora de los
injertos óseos. Para, además, conferirle a estos materiales propiedades osteoinductoras, se está
estudiando extensamente el uso de éstos en combinación con factores de crecimiento
osteogénicos.
1.3. Las proteínas morfogenéticas de hueso (BMPs).
Las proteínas morfogenéticas de hueso (BMPs) constituyen una familia de más de 20
factores de crecimiento, perteneciente a la superfamilia del TGF- β. Estas proteínas presentan
una estructura altamente conservada, siendo todas ellas producidas como grandes pre-pro-
proteínas monoméricas. El dominio maduro de estas proteínas contiene siete residuos
conservados de cisteína, los cuales determinan la formación de un motivo estructural
característico de estos factores: el nudo cisteínico. Este nudo constituye el núcleo del
monómero y se debe a la formación de tres puentes disulfuro intracatenarios que involucran a
seis de las cisteínas. El séptimo residuo de cisteína interviene en la formación de un único
puente disulfuro intercatenario, lo cual permite la dimerización de la molécula una vez
escindidos los dominios maduros de las pre-pro-proteínas precursoras. Se ha demostrado que la
forma dimérica de la molécula es la única que posee actividad biológica.
Si bien las BMPs poseen varios sitios susceptibles de ser N-glucosilados, en la mayoría de
los casos (BMP-2, BMP-7, BMP-7, etc), sólo uno de estos sitios se encuentra glucosilado.
Aunque esta glucosilación no parece ser esencial para la actividad biológica de BMP-2,
investigaciones muy recientes le otorgan mayor importancia a la glucosilación de la BMP-6.
La señalización por BMPs se debe a la unión de estos factores a dos receptores
serín/treonín quinasas distintas (tipo I y tipo II). El ligando se une primero a dos copias de su
receptor de alta afinidad, tras lo cual se asocian al complejo dos receptores de baja afinidad,
constituyéndose así un complejo de seis cadenas polipeptídicas. En este punto, los receptores
tipo II, que son constitutivamente activos, fosforilan a los receptores tipo I, lo cual puede
conllevar a la activación de dos vías de señalización intracelular distintas: una vía “canónica”
225
Appendix III. Abstract in Spanish / Resumen en español____________________________________________________
mediada por proteínas Smads, o una vía “no canónica” mediada por BMP-MAPK. Cuál de estas
vías resulta activada parece depender de los mecanismos particulares de oligomerización del
complejo BMPR.
Las BMPs son factores de crecimiento pleiotrópicos que ejercen multitud de funciones
distintas durante el desarrollo embrionario y en la vida adulta.
En el desarrollo, las BMPs están implicadas en el establecimiento del eje dorsoventral
durante las primeras fases de la ontogénesis. Igualmente, participan en la organización del
mesodermo ventral y en el desarrollo de casi todos los tejidos y órganos, controlando procesos
de proliferación, diferenciación, migración, apoptosis y adhesión celular.
En el organismo adulto, las BMPs parecen estar implicadas en la regeneración de una gran
variedad de tejidos y en la protección y recuperación tras un daño tisular. De todas estas
funciones, la más estudiada es su participación en la regeneración del sistema esquelético,
siendo algunas de estas proteínas las únicas descritas con capacidad de inducir la formación de
hueso ectópico en vertebrados adultos. Se ha demostrado que la señalización por BMPs es
necesaria durante todas las fases de la diferenciación osteoblástica, incluyendo la proliferación y
la formación, maduración y mineralización de la matriz. Sin embargo, se ha visto que las
distintas BMPs actúan en distintas etapas de este proceso, siendo BMP-2, -6 y -9 las que
poseen una mayor capacidad de inducir la expresión de marcadores osteogénicos, tanto
tempranos como tardíos, y la mineralización de la matriz.
La BMP-6 es principalmente expresada en condrocitos hipertróficos durante el proceso de
osificación endocondral y se ha demostrado su capacidad de estimular la expresión de fenotipos
condrogénicos y osteogénicos in vitro, y de inducir la formación de cartílago y hueso in vivo.
1.4. Los factores de crecimiento fibroblástico (FGFs).
Los factores de crecimiento fibroblástico (FGFs) constituyen una familia de 22 miembros de
proteínas de gran importancia en procesos de proliferación, diferenciación, migración y
supervivencia de una gran variedad de tipos celulares durante el desarrollo embrionario,
mientras que actúan como factores homeostáticos durante la reparación tisular y las respuestas
ante daños en los organismos adultos. De entre todos estos factores, los más estudiados son el
FGF básico (bFGF) y el FGF ácido (aFGF), que tienen especial relevancia en los procesos de
cicatrización y de formación de vasos sanguíneos, teniendo un potencial angiogénico mayor que
el del VEGF.
El bFGF presenta 5 isoformas debido a procesos de traducción alternativa del ARN
mensajero, aunque la isoforma de menor masa molecular (18 KDa) es la única que no es
dirigida al núcleo celular tras su síntesis y es la más estudiada. Esta proteína es un monómero
226
Appendix III. Abstract in Spanish / Resumen en español
que presenta 12 láminas beta en su estructura terciaria, sin puentes disulfuro ni glucosilaciones.
En el extremo carboxilo presenta una región rica en lisinas, responsable de la afinidad de esta
molécula por proteoglucanos heparán sulfatados (HSPGs).
Al contrario que la mayoría de proteínas cuyo destino sea ser secretadas al espacio
extracelular, el bFGF no posee ninguna secuencia señal que la dirija al retículo endoplásmico.
Por lo tanto, en vez de ser secretado por una vía vesicular, se cree que el bFGF es exportado al
exterior de la célula por translocación directa a través de la membrana plasmática, en un
proceso independiente de ATP. En este fenómeno parecen estar involucrados los HSPGs de la
superficie celular, los cuales actuarían a modo de “trampas moleculares”, dirigiendo el
transporte unidireccional del bFGF hacia el ambiente extracelular.
El bFGF se une a su receptor FGFR2-IIIc en las células diana. La unión del bFGF a las
moléculas de HSPGs de la membrana celular parece aumentar la afinidad del ligando por su
receptor, de forma que la magnitud y tipo de respuesta celular podría depender de la formación
de complejos ternarios entre el bFGF, los HSPGs y el FGFR. El bFGF también tiene afinidad
específica por heparina y heparán sulfato. La unión del bFGF a estas moléculas protege al factor
frente a la desnaturalización por calor o ácidos, al igual que frente a la acción de proteasas,
manteniendo un reservorio extracelular de bFGF activo.
La señalización intracelular por bFGF presenta dos vías principales: una vía dependiente de
MAPK y una vía dependiente de PKC. El tipo específico de transducción de señal que se
desencadena puede depender del tipo de FGFR que sea activado, al igual que del tipo de
HSPGs de la superficie celular involucrado y de la acción directa de bFGFs intracelulares e
intranucleares. Debido a esta complejidad, la activación de varios tipos celular por bFGF puede
desencadenar una gran variedad de respuestas celulares distintas, tales como proliferación,
migración y/o el estímulo/inhibición de la expresión de un determinado fenotipo.
Una de las actividades mejor caracterizadas de este factor de crecimiento es la de regular el
crecimiento y la función de células vasculares, tales como células endoteliales y musculares
lisas. Durante la regeneración del tejido óseo, el bFGF podría desempeñar un doble papel, ya
que su actividad angiogénica puede estimular la neovascularización del hueso neoformado,
mientras que también podría ser importante para inducir la proliferación y/o diferenciación de
células osteoprogenitoras mesenquimales. Además, la invasión del hueso en formación por
nuevos vasos sanguíneos se considera una fuente de potenciales células osteoprogenitoras.
En lo que respecta a la acción directa del bFGF sobre las propias células osteogénicas hay
una gran controversia. Muchos estudios in vitro han descrito efectos inhibitorios del bFGF sobre
osteoblastos, al igual que varios estudios in vivo han mostrado una disminución de la cantidad
de hueso formado al aplicar altas concentraciones de bFGF. Sin embargo, otros estudios han
encontrado efectos positivos del bFGF sobre la diferenciación de células osteoprogenitoras in
227
Appendix III. Abstract in Spanish / Resumen en español____________________________________________________
vitro, y se han descrito tasas mayores de formación de hueso in vivo al implantar dosis bajas de
este factor. Probablemente, estos efectos contradictorios simplemente reflejen la complejidad
de la señalización por bFGF, siendo el efecto de este factor altamente impredecible y
dependiente de la concentración empleada, del estadio de diferenciación de las células diana y
de la influencia de otros factores de crecimiento. Sin embargo, in vivo, se ha demostrado en
numerosas ocasiones el efecto bifásico del bFGF, estimulando la formación neta de hueso a
bajas concentraciones e inhibiéndola a altas concentraciones.
1.5. Terapias para la reparación de fracturas óseas.
Para el tratamiento de fracturas que no consolidan por sí mismas, los injertos óseos son
considerados la mejor opción, aunque las limitaciones que presentan, comentadas
anteriormente, han obligado a la búsqueda de terapias alternativas. La matriz ósea
desmineralizada (DBM) es una sustancia comercializada aunque, cuando se emplea sola, no
posee la misma eficacia que los injertos de hueso autólogos. Por otra parte, los injertos
sintéticos, como los de fosfato cálcico, sulfato cálcico, hidroxiapatita o composites de colágeno
y calcio, pueden simular las propiedades osteoconductoras de los injertos óseos, pero no
poseen capacidad osteoinductora.
Gracias a la tecnología del ADN recombinante, muchos factores de crecimiento relacionados
con la osteogénesis, angiogénesis y cicatrización han sido comercializados y su uso para
aplicaciones clínicas está siendo extensamente estudiado. Combinaciones de estos factores con
biomateriales están siendo considerados alternativas muy prometedoras a los autoinjertos.
Actualmente, las Agencias del Medicamento Europea y Americana (EMEA y FDA,
respectivamente) aprueban el uso de BMP-2 en combinación con esponjas absorbibles de
colágeno (ACS) para el tratamiento de fracturas severas de tibia en humanos adultos.
Igualmente, la FDA aprueba el empleo de BMP-2 en combinación con ACS para las fusiones
espinales. Por su parte, en los casos de fracturas recalcitrantes de huesos largos, se ha
aprobado el uso compasivo de BMP-7.
Por otro lado, es bien conocida la importancia de la angiogénesis durante la reparación del
hueso y numerosos estudios han demostrado que la co-administración de BMP-2 con bajas
concentraciones de bFGF mejora este proceso.
En la clínica, la BMP-2 es usada a concentraciones de 1.5 mg por mililitro de ACS, lo que
supone un incremento a nivel local de más de seis órdenes de magnitud sobre los niveles
fisiológicos. Si bien el tratamiento con BMP-2 o BMP-7 se considera seguro, los efectos a largo
plazo de la aplicación de estas cantidades de unos factores tan altamente pleiotrópicos aún se
desconocen. Además, parece que estos tratamientos estimulan al sistema inmune, pudiéndose
228
Appendix III. Abstract in Spanish / Resumen en español
detectar anticuerpos anti-BMP en un cierto porcentaje de los pacientes. Otra desventaja del uso
de estas grandes cantidades de BMPs es el astronómico coste económico de los tratamientos,
habiéndose estimado que, en el Reino Unido, el uso de BMPs para el tratamiento de fracturas
abiertas de tibia supone un gasto anual adicional de 3.5 millones de libras esterlinas sobre el
gasto de los tratamientos estándar.
Una forma de disminuir la cantidad de factor necesaria para un tratamiento y de
incrementar su eficacia es la aplicación de estas proteínas en combinación con un transportador
osteoconductor que las retenga en el lugar del implante, manteniendo sus concentraciones
locales. Desafortunadamente, ningún transportador disponible puede ser considerado ideal.
De entre los posibles transportadores orgánicos, la DBM ha demostrado tener excelentes
propiedades de retención/liberación de BMPs, pero falla como transportador útil al contener
numerosos factores de crecimiento que no son eliminados durante el proceso de
desmineralización. Esto hace que los efectos de la implantación de DBM sean altamente
impredecibles. Por el contrario, a pesar de sus pobres propiedades biomecánicas, el colágeno es
el único transportador aprobado para la aplicación clínica de BMPs debido a su alta
biocompatibilidad y biodegradabilidad y a su baja inmunogenicidad.
Por desgracia, la mayoría de los factores de crecimiento tienen una baja afinidad natural
por el colágeno. Para remediar esto, muchas citoquinas han sido producidas en el laboratorio
con dominios adicionales que les confieren una mayor afinidad por el colágeno. Uno de estos
dominios es el decapéptido de unión al colágeno/gelatina (CBD) del factor de von Willebrand
(vWF), que ya ha sido empleado para producir una proteína de fusión bFGF-CBD en un sistema
de expresión procariótico, al igual que proteínas de fusión con distintos miembros de la
superfamilia del TGF- β, incluyendo BMPs. Tanto en el caso del bFGF como de la BMP-2, el CBD
fue añadido al extremo N-terminal del factor y la cisteína presente en la secuencia del CBD fue
reemplazada por una metionina para impedir la formación de puentes disulfuro inespecíficos
durante los procesos de producción de las proteínas. En el caso del bFGF, la proteína fue
además producida con un domino de purificación consistente en una secuencia hexahistidínica y
un sitio de corte con trombina. Esto ya fue evitado para la producción de la BMP-2-CBD, la cual
fue purificada gracias a su afinidad natural por heparina.
Al ser el colágeno no sólo el único transportador aprobado por la FDA y la EMEA para
aplicaciones clínicas para la reparación ósea, sino también uno de los componentes principales
del hueso, los factores recombinantes con afinidad añadida por colágeno son considerados de
gran interés. Tras su administración en forma soluble, estas moléculas podrían ser usadas para
aumentar su concentración local al unirse directamente al colágeno propio del tejido en el lugar
del implante. Por otro lado, al ser administradas en combinación con un transportador
colagénico, este último podría retener parcialmente a los factores, limitando su acción al lugar
229
Appendix III. Abstract in Spanish / Resumen en español____________________________________________________
del implante. Por tanto, estas estrategias podrían reducir la cantidad de factores necesarios
para conseguir la regeneración tisular, aumentando la seguridad de estos tratamientos y
disminuyendo su coste.
2. Objetivos.
Los objetivos concretos que se plantearon para el presente trabajo fueron:
1. Obtener los genes que codifican para los factores bFGF y BMP-6 humanos, añadir a estas
secuencias la que codifica para el dominio de afinidad por el colágeno derivado del factor
de von Willbrand y clonarlas en vectores de expresión.
2. Expresar de manera heteróloga y purificar la rhBMP-6 y el rh-bFGF tanto en forma nativa
como con el dominio de afinidad por el colágeno.
3. Determinar la afinidad por el colágeno de los factores producidos con el domino adicional
de afinidad por el colágeno.
4. Caracterizar la actividad osteogénica de los factores dirigidos a colágeno in vitro e in vivo y
compararla con la de los factores nativos.
5. Comparar la actividad osteogénica in vivo de combinaciones de bFGF y BMP-6 con BMP-6
solo.
3. Material y métodos.
3.1. Producción de rhBMP-6 y rh-BMP-6-CBD en un sistema de expresión en
Escherichia coli.
En primer lugar, se trataron de producir las proteínas rhBMP-6 y rhBMP-6-CBD en un
sistema de expresión en Escherichia coli, el cual rinde las proteínas heterólogas en forma de
cuerpos de inclusión insolubles que, posteriormente, han de ser solubilizados para obtener las
moléculas monoméricas solubles. Finalmente, estos monómeros han de ser replegados in vitro
para conseguir los dímeros activos, que deberán ser purificados para separarlos de los
monómeros remanentes y otros posibles contaminantes.
El gen codificante para la BMP-6 humana se obtuvo mediante RT-PCR sobre muestras de
ARN total de células de osteosarcoma humano U-2 OS y la secuencia obtenida fue clonada en
un vector de mantenimiento (pBIISK). Mediante PCR se generaron las secuencias necesarias
para obtener los genes de la BMP-6 y la BMP-6-CBD con los sitios de restricción apropiados
230
Appendix III. Abstract in Spanish / Resumen en español
para poder ser clonados en el plásmido pET17b. Las construcciones obtenidas se usaron para
transformar la cepa de E. coli Rosetta™ (DE3).
Se seleccionó un clon para cada una de las proteínas a expresar y se analizó el plásmido
que contenían para comprobar la correcta inserción de la secuencia heteróloga y descartar
posibles mutaciones.
El clon seleccionado para la expresión de rhBMP-6 fue crecido en cultivo líquido e inducido
a expresar la proteína por adición de IPTG. Cuatro horas tras la adición del IPTG se analizó la
producción mediante SDS-PAGE y tinción con azul de Coomassie, y se aislaron los cuerpos de
inclusión generados, los cuales fueron solubilizados con 6 M guanidina hidrocloruro. Los
monómeros de rhBMP-6 fueron finalemente cuantificados por SDS-PAGE, tinción con azul de
Coomassie y análisis de imagen digital y densitometría.
Con los monómeros así obtenidos, se probaron 41 condiciones de replegamiento in vitro,
empleando combinaciones de distintas variables: concentración de proteínas, temperatura, pH,
tipo y concentración de antiagregantes, tipo y concentración de par redox, y degaseado o no
del tampón de replegamiento. El resultado de cada uno de estos intentos de replegamiento fue
analizado mediante SDS-PAGE y tinción con azul de Coomassie.
3.2. Producción de rhBMP-6 y rh-BMP-6-CBD en un sistema de expresión en células
de insecto/baculovirus.
Para la producción de rhBMP-6 y rhBMP-6-CBD en un sistema de expresión en células de
insecto, las secuencias de ambos genes fueron clonadas en un vector donador de un sistema
basado en baculovirus (pACGP67B). A continuación se cotransfectaron células de insecto Sf9
con las construcciones obtenidas y ADN baculoviral Sapphire™ linealizado. En el interior de la
células, la existencia de secuencias virales en el plásmido donador, flanqueando el sitio de
restricción múltiple, permite su recombinación homóloga con el ADN vírico, generándose una
partícula vírica infectiva que porta el gen heterólogo bajo el control del promotor de la
polihedrina, el cual se activa intensamente durante las últimas fases del ciclo infectivo de los
baculovirus. Los baculovirus Sapphire™ coexpresan, junto con la proteína heteróloga, la
proteína isomerasa de puentes disulfuro (PDI), que es una chaperona que contribuye a la
correcta formación de puentes disulfuro en las proteínas. Además el uso del pACGP67B implica
que las proteínas producidas portan el péptido señal GP67, que dirige a las proteínas hacia el
retículo endoplásmico y aparato de Golgi para su secreción al medio de cultivo por vía vesicular.
Antes de la secreción, el péptido señal es escindido de la proteína por endopeptidasas propias
del virus.
Los sobrenadantes de transfección se emplearon para aislar clones individuales de
baculovirus recombinantes mediante un ensayo de placas de lisis en cultivos de Sf9 cubiertos
con agarosa y los clones seleccionados fueron analizados mediante PCR. Un clon para cada
231
Appendix III. Abstract in Spanish / Resumen en español____________________________________________________
proteína a expresar fue amplificado y la suspensión vírica obtenida fue titulada mediante un
ensayo de infección por dilución limitante. Una vez conocido el título de ambas suspensiones,
los virus fueron nuevamente amplificados usando una multiplicidad de infección (MOI; es decir,
el número de partículas víricas por célula empleado para realizar la infección) de 0.1. Se
obtuvieron así suspensiones de virus de gran volumen, que fueron igualmente titulados. Estas
suspensiones permitieron realizar todas las producciones posteriores de forma reproducible y
con un MOI conocido.
Para determinar las condiciones óptimas de tiempo de producción y MOI para cada
proteína, se realizaron ensayos de producción, infectando cultivos de Sf9 con valores de MOI de
2.5 y 10 y recogiendo los medios de cultivo condicionados tras 48, 72, 96 y 120 horas de
tiempo de producción. Estas muestras fueron analizadas mediante Western blot con un
anticuerpo específico anti-BMP-6.
Una vez establecidas las condiciones óptimas para cada proteína, se realizaron
producciones de rhBMP-6 y rhBMP-6-CBD. Para su purificación, se añadió 6 M urea a los medios
condicionados y éstos se cargaron en columnas de heparín-sefarosa. Las proteínas retenidas en
la columna se eluyeron en dos pasos, con tampones con concentraciones incrementadas de
NaCl y las fracciones de elución se analizaron mediante Western blot.
Las fracciones de elución con mayor contenido en dímeros de rhBMP-6 o rhBMP-6-CBD
fueron tratadas para eliminar el exceso de urea y NaCl. Para ello se probaron los siguientes
métodos:
- Diálisis frente a medio DMEM, pH 7.0 ó pH 4.9.
- Diálisis frente a 4 mM HCl.
- Diálisis frente a 10 mM acetato amónico, pH 4.0, liofilización y resuspensión en agua,
agua con 0.1 % BSA, 4 mM HCl ó 4 mM HCl con 0.1% BSA.
- Cambio de tampón a 4 mM HCl en columnas Vivaspin 2.
La actividad biológica de todas las muestras fue probada mediante un ensayo de inducción
de expresión de fosfatasa alcalina (ALP) en mioblastos de ratón C2C12.
3.3. Producción de rh-bFGF y rh-bFGF-CBD en un sistema de expresión en células de
insecto/baculovirus.
Los genes codificantes para el bFGF y el bFGF-CBD fueron clonados en el plásmido donador
del sistema de expresión baculoviral pACGP67B y las construcciones obtenidas se usaron para
232
Appendix III. Abstract in Spanish / Resumen en español
cotransfectar células Sf9 junto con ADN de baculovirus BacPak6™. Los virus BacPak6™ no
coexpresan la PDI, ya que el bFGF no presenta puentes disulfuro en su estructura nativa.
Al igual que para el caso de la rhBMP-6 y la rhBMP-6-CBD, se aislaron clones productores
de rh-bFGF y rh-bFGF-CBD mediante ensayos de placas de lisis, se analizaron los clones
mediante PCR, y se amplificaron y titularon los virus seleccionados. Igualmente, se
determinaron las condiciones óptimas de producción mediante ensayos de producción y análisis
por Western blot con un anticuerpo específico anti-bFGF.
Una vez producidas las proteínas, se purificaron en columnas de heparín-sefarosa en
ausencia de urea y se eluyeron las proteínas retenidas en la columna mediante un gradiente de
NaCl. Las fracciones de elución fueron analizadas mediante dot blot y las muestras de rh-bFGF
y rh-bFGF-CBD obtenidas se cargaron en columnas de filtración Vivaspin 2 para sustituir el
tampón de elución por PBS, pH 7.2 con 1 mM DTT y 1 mM EDTA.
Para determinar la afinidad de las proteínas producidas por el colágeno tipo I se cargaron
1.25 pmoles de cada una de ellas y de bFGF comercial en esponjas de colágeno tipo I de 1 mm
de grosor y 5 mm de diámetro. Las esponjas fueron lavadas con PBS + tween-20 durante una
hora o 6 días y la cantidad de proteínas retenidas cuantificadas mediante inmunotinción con un
anticuerpo anti-bFGF y análisis densitométrico digital.
La actividad biológica de las proteínas obtenidas se probó in vitro mediante un ensayo de
proliferación sobre preosteoblastos de ratón MC3T3-E1, comparando el número de células de
los cultivos tras 72 horas de incubación con los factores con cultivos incubados con bFGF
comercial o sin factor. Para ello se empleó un método colorimétrico basado en MTT.
Igualmente, se determinó la capacidad de los factores producidos de inhibir la
diferenciación osteoblástica de las células MC3T3-E1 en presencia de ácido ascórbico. Para ello
se determinó el número de células en los cultivos incubados durante 120 horas con los factores
recombinantes, con bFGF comercial o sin factor. Igualmente, se cuantificó la expresión de ALP
en estos cultivos mediante un método basado en pNPP y se calculó la actividad ALP/célula.
3.4. Determinación de la capacidad osteogénica de combinaciones de rh-bFGF o
rh-bFGF-CBD con rhBMP-6 in vivo.
Para determinar el efecto de las proteínas bFGF producidas en combinación con rhBMP-6 se
realizó un ensayo de osificación ectópica en ratas. Para ello, seis ratas Wistar macho de 4
meses de edad y 250-280 gramos de peso fueron anestesiadas e implantadas con discos de
ACS de 5 mm de diámetro y 1 mm de grosor, a las que se habían añadido los factores a probar.
Los discos fueron implantados en pequeñas incisiones realizadas en los músculos dorsales de
233
Appendix III. Abstract in Spanish / Resumen en español____________________________________________________
los animales, cerrándose posteriormente las heridas con puntos de sutura y la piel dorsal con
grapas quirúrgicas. Las combinaciones de factores probados fueron:
- C- (discos incubados con PBS)
- 13.89 pmol (0.5 µg) de rhBMP-6 comercial (R&D Systems)
- 1.25 pmol de rh-bFGF comercial (R&D Systems)
- 1.25 pmol de rh-bFGF producido en células Sf9
- 1.25 pmol de rh-bFGF-CBD producido en células Sf9
- 13.89 pmol de rhBMP-6 comercial + 1.25 pmol de rh-bFGF comercial
- 13.89 pmol de rhBMP-6 comercial + 1.25 pmol de rh-bFGF producido en células Sf9
- 13.89 pmol de rhBMP-6 comercial + 1.25 pmol de rh-bFGF-CBD producido en células
Sf9
Al cabo de 21 días, los animales fueron sacrificados y los implantes diseccionados y fijados
en formaldehído tamponado al 4%. Los implantes que portaban rhBMP-6 fueron descalcificados
antes de continuar el proceso de inclusión, mientras que los demás implantes fueron
directamente deshidratados con alcohol de gradación creciente e incluídos en parafina. Se
realizaron secciones de 10 µm de grosor, que fueron montados en portaobjetos para su
posterior análisis histológico mediante las siguientes técnicas:
Tinciones histoquímicas:
- Hematoxilina-eosina. Tinción general para la observación de los tejidos.
- Tricrómico de Masson. Tinción triple que tiñe al osteoide de rojo, y al hueso
mineralizado de verde.
- Azul alciano. Tiñe los mucopolisacáridos ácidos y los glucosaminoglucanos de la
matriz cartilaginosa de azul.
-
Tinciones inmunohistoquímicas:
- Inmunotinción del marcador de osteogénesis osteopontina.
234
Appendix III. Abstract in Spanish / Resumen en español
4. Resultados y Discusión.
4.1. Producción de rhBMP-6 en Escherichia coli.
Tras la obtención y clonación de los genes para la rhBMP-6 y la rhBMP-6-CBD en el vector
de expresión pET17b, las construcciones fueron usadas para transformar la cepa de E. coli
Rosetta™ (DE3). Se seleccionó un clon que contuviera la construcción pET17b:BMP-6 y se
procedió a la producción de la proteína heteróloga en cultivos líquidos. El análisis por SDS-PAGE
reveló que, cuatro horas tras la adición de IPTG al cultivo, las bacterias contenían una gran
cantidad (40-50% del contenido de proteína total) de una proteína cuya masa molecular podría
corresponder a la predicha para los monómeros de BMP-6 (±16.5 KDa). Esta proteína se
encontraba en la fracción de proteínas insolubles en forma de cuerpos de inclusión y pudo ser
aislada con alta pureza tras lavar esta fracción con un tampón con triton x-100.
Los cuerpos de inclusión fueron solubilizados con 6 M guanidina hidrocloruro y la rhBMP-6
monomérica soluble cuantificada por análisis digital de imagen sobre geles de poliacrilamida
teñidas con azul de Coomassie, estimándose un rendimiento de aproximadamente 108 mg/L.
Se probaron 41 condiciones de replegamiento in vitro de la rhBMP-6, obteniéndose en casi
todos los casos resultados similares: la mayoría de la rhBMP-6 permanecía en su forma
monomérica; sólo una pequeña fracción de las proteínas pasaba a formar parte de
organizaciones oligoméricas, constituyendo dímeros, trímeros, tetrámeros o polímeros
superiores. Estas agregaciones se debían a la formación de puentes disulfuro intercatenarios
inespecíficos ya que el análisis por SDS-PAGE de estas muestras en presencia de un agente
reductor mostraba la reversión total del proceso de oligomerización.
El hecho de que se formaran gran cantidad de puentes disulfuro inespecíficos nos hizo
suponer que la fracción dimérica probablemente estaría constituida de una mezcla heterogénea
de proteínas correcta e incorrectamente plegadas. Esto, junto con el hecho de que en todos los
casos esta fracción dimérica era muy minoritaria, nos hizo considerar inviable su purificación ya
que nuestra experiencia previa con proteínas de la misma familia expresadas con este mismo
sistema nos había indicado que un alto porcentaje de proteínas se pierden durante la
purificación y posterior manipulación.
4.2. Producción de rhBMP-6 y rhBMP-6-CBD en células Sf9.
Al haber resultado el replegamiento de rhBMP-6 producido en Escherichia coli infructuoso,
decidimos abordar la producción de estos factores de crecimiento en un sistema de expresión
eucariótico, en el que las proteínas son plegadas en el interior de la célula para obtener su
estructura cuaternaria nativa.
235
Appendix III. Abstract in Spanish / Resumen en español____________________________________________________
Una vez que los genes codificantes para el rhBMP-6 y el rhBMP-6-CBD fueron
correctamente clonados en el plásmido pAcGP67B se cotransfectaron células Sf9 con el
plásmido donador recombinante y ADN baculoviral Sapphire™ linealizado para obtener
baculovirus recombinantes capaces de expresar las proteínas heterólogas. Los sobrenadantes
de transfección fueron empleados para realizar un ensayo de placas de lisis mediante el cual se
aislaron clones de baculovirus recombinantes. Estos clones fueron amplificados y titulados como
descrito anteriormente.
Los ensayos de producción mostraron que, en ambos casos, las proteínas heterólogas eran
secretadas al medio de cultivo en forma de dímeros, trímeros y tetrámeros, no detectándose
moléculas monoméricas. Estos oligómeros se encontraban estabilizados por puentes disulfuro
ya que el análisis de las muestras por Western blot en condiciones reductoras mostró una
reversión total de la oligomerización.
Para determinar si la excesiva formación de puentes disulfuro se debía a la coexpresión de
la PDI, generamos un baculovirus BacPak6™ recombinante con el fin de expresar la rhBMP-6
sin esta chaperona. El análisis por Western blot de la producción con este baculovirus mostró
que la PDI no era responsable de la formación de puentes disulfuro inespecíficos, ya que el
patrón de oligómeros obtenido con este virus era igual que con el anterio.
Los dímeros de rhBMP-6(-CBD) fueron purificados mediante cromatografía de afinidad a
heparina. Sin embargo, no nos fue posible separar completamente la fracción dimérica de la
trimérica mediante FPLC. Las fracciones enriquecidas en dímeros fueron tratados como se
describe en “material y métodos” para eliminar el exceso de urea y NaCl. Ninguna de las
muestras así obtenidas resultó tener actividad biológica en un ensayo de inducción de actividad
ALP sobre mioblastos de ratón C2C12.
Hay distintas posibles causas que, solas o en combinación, podrían explicar la ausencia de
actividad biológica de las proteínas heterólogas expresadas en células Sf9:
- La elección del promotor de la polihedrina para controlar la expresión de las proteínas
heterólogas. Un alto porcentaje (o todo) de la rhBMP-6(-CBD) dimérica podría estar
incorrectamente plegada debido a saturación y/o desregulación de la maquinaria
celular de producción y procesamiento de proteínas durante las fases tardías del ciclo
infectivo del virus, durante las cuales se activa el promotor de la polihedrina.
- Incluso aunque un cierto porcentaje de los dímeros purificados tuvieran la estructura
cuaternaria correcta, la presencia de altas concentraciones de dímeros incorrectos u
oligómeros superiores podría estar inhibiendo la actividad de las moléculas nativas al
actuar como inhibidores competitivos.
236
Appendix III. Abstract in Spanish / Resumen en español
- Dado que los residuos de ácido siálico terminales juegan un importante papel en
muchos glucoconjugados y la glucosilación de la BMP-6 parece ser fundamental para
su unión a los receptores de BMPs, es posible que la glucosilación llevada a cabo por
las células Sf9 no sea suficiente para obtener moléculas de rhBMP-6 activas.
4.3. Producción de rh-bFGF y rh-bFGF-CBD en células Sf9.
Como la producción de un rh-bFGF-CBD en Escherichia coli ya ha sido publicada y se probó
que esta proteína tenía actividad biológica y afinidad por el colágeno, decidimos producir el rh-
bFGF y rh-bFGF-CBD en un sistema de expresión eucariótico, que recuerda más a las células
humanas productoras de bFGF que E. coli.
Las secuencias codificantes para rh-bFGF y rh-bFGF-CBD fueron obtenidas mediante PCR
sobre las construcciones usadas para su producción en E. coli y clonadas en el plásmido
donador del sistema de baculovirus pAcGP67B. El bFGF nativo es una proteína monomérica que
no presenta ningún puente disulfuro, pero sí varios residuos de cisteína susceptibles de formar
puentes disulfuro inespecíficos bajo condiciones permisivas. Este hecho nos condujo a emplear
un sistema de expresión con baculovirus que no coexpresara la PDI, ya que la presencia de
esta chaperona podría provocar el incorrecto plegamiento de las proteínas.
Una vez obtenidos los baculovirus recombinantes para la expresión de las proteínas
heterólogas mediante cotransfección de células Sf9 con las construcciones de pAcGP67B y ADN
viral linealizado, se aislaron clones infectivos de virus mediante ensayos de placas de lisis. Estos
clones fueron después amplificados y titulados.
Los análisis por Western blot de los ensayos de producción para ambas proteínas revelaron
que el anticuerpo anti-bFGF reconocía una única proteína en los medios de cultivo
condicionados, cuya masa molecular correspondía con la predicha para el rh-bFGF o el rh-bFGF-
CBD, respectivamente. Una vez que se habían determinado las mejores condiciones de MOI y
tiempo de producción se realizaron producciones de gran volumen de las dos proteínas y éstas
fueron purificadas mediante cromatografía de afinidad por heparina. Para eluir las proteínas de
la columna se empleó un gradiente lineal de NaCl.
En ambos casos, esto resultó en la elución de, al menos, dos poblaciones distintas de bFGF:
una mayoritaria, con “baja afinidad por heparina” y una minoritaria, con “alta afinidad por
heparina”. Ambas fracciones con “baja afinidad por heparina” se perdieron durante el proceso
de cambio de tampón en columnas Vivaspin2, mientras que las fracciones con “alta afinidad por
heparina” pudieron ser satisfactoriamente concentradas y recuperadas. En cualquier caso, como
la unión a heparina parece ser importante para la actividad biológica de estos factores,
quisimos centrarnos especialmente en las muestras con mayor afinidad por la heparina.
237
Appendix III. Abstract in Spanish / Resumen en español____________________________________________________
Las muestras recuperadas fueron cuantificadas mediante Western blot y análisis de imagen
digital antes de realizar con ellas un ensayo de pegada a colágeno para determinar su afinidad
por el colágeno tipo I. Para ello se cargaron discos de ACS con rh-bFGF o rh-bFGF-CBD y se
lavaron con PBS + tween-20 durante 1 hora ó 6 días. Discos cargados con rh-bFGF comercial,
producido en E. coli, o únicamente con tampón se emplearon como controles. Mientras que
prácticamente todo el rh-bFGF comercial era lavado de las esponjas tras una hora, cantidades
significativas de los rh-bFGF y rh-bFGF-CBD producidos en células Sf9 permanecían retenidas
en ellas. Sin embargo, la cantidad de rh-bFGF-CBD que quedaba retenida era significativamente
mayor que la de rh-bFGF. Además, esta unión al colágeno era estable en el tiempo ya que, tras
seis días de lavado, aún se podían detectar ambas proteínas en las esponjas. Estos resultados
nos indicaron, por tanto, que los factores rh-bFGF y rh-bFGF-CBD producidos en células Sf9 no
sólo poseen una mayor afinidad por ACS comparadas con el rh-bFGF producido en E. coli, sino
que esta unión es perdurable en el tiempo. Además, el CBD le confiere a la molécula una
afinidad por el colágeno tipo I adicional que resulta en un, aproximadamente, un 50% más de
unión. En consecuencia, el empleo de estos factores en combinación con esponjas absorbibles
de colágeno para la reparación clínica de fracturas óseas podría permitir la implantación de
menores concentraciones, reduciendo la dispersión sistémica y, por tanto, aumentando la
eficiencia y seguridad del tratamiento. Por último, la pegada específica de las proteínas al
biomaterial transportador podría evitar la gran pérdida de proteína que ocurre debido a la
manipulación de las esponjas por parte del cirujano antes de su implantación.
Para determinar la actividad biológica de los factores de crecimiento obtenidos se realizó un
ensayo de proliferación sobre la línea celular de preosteoblastos de ratón MC3T3-E1. No se
observaron diferencias entre el efecto de las dos proteínas, ni entre ellas y el factor comercial,
cuando eran usadas a bajas concentraciones (156.25 o 312.50 pM). Sin embargo, a mayores
concentraciones (625.00 pM o 1.25 nM), el rh-bFGF comercial presentaba una actividad ligera,
aunque significativamente, mayor que los factores producidos en células Sf9.
4.4. Formación de hueso heterotópico in vivo con rh-bFGF and rhBMP-6.
Para evaluar la actividad biológica del rh-bFGF y rh-bFGF-CBD producidos en células Sf9 y
su capacidad para aumentar la formación de hueso en combinación con rhBMP-6, se prepararon
discos de ACS con 13.89 pmoles de rhBMP-6, 1.25 pmoles de rh-bFGF o rh-bFGF-CBD o
combinaciones de estos factores, que fueron implantados en los músculos dorsales de ratas
Wistar jóvenes. Como control positivo se empleó el rh-bFGF comercial producido en E. coli y,
como control negativo, esponjas cargadas únicamente con tampón.
21 días tras la cirugía, todos los implantes que habían sido cargados con factores de
crecimiento pudieron ser recuperados sin que se percibieran signos de rechazo inmune ni
238
Appendix III. Abstract in Spanish / Resumen en español
encapsulación fibrótica. Por el contrario, ninguno de los implantes cargados con sólo tampón
pudo ser recuperado debido a la reabsorción del colágeno. Los implantes cargados con rhBMP-6
(sola o en combinación con cualquier bFGF) mostraban unos bordes bien definidos y
consistencia dura, aunque variaban en tamaño. En contraposición, la mayoría de los implantes
que fueron cargados con rh-bFGF comercial o rh-bFGF o rh-bFGF-CBD producidos en células de
insecto fueron difíciles de localizar en el músculo y solían encontrarse como partículas de menos
consistencia, en ocasiones dispersas.
El análisis histológico de los implantes mostró que, aquellos que sólo habían sido cargados
con bFGF, habían formado un tejido fibroso más o menos denso, sin mostrar indicios de
osteogenésis ni angiogénesis. Por el contrario, todas las esponjas cargadas con BMP-6 sola o
con bFGF habían formado tejido óseo.
Los implantes cargados con sólo BMP-6 mostraban trabéculas óseas fundamentalmente en
la superficie, estando la zona central llena de densas acumulaciones de células mesenquimales
indiferenciadas. Aunque era posible encontrar algunos vasos sanguíneos en estos implantes,
éstos eran relativamente pequeños y se encontraban de forma dispersa. El marcador temprano
de osteogénesis osteopontina se localizaba fundamentalmente en las trabéculas y únicamente
en algunas células aisladas en el interior del implante.
Todos los implantes con BMP-6 y bFGF mostraban trabéculas óseas no sólo en la superficie
exterior, sino también por todo el interior. En la mayoría de los casos era posible distinguir un
tejido con apariencia de médula ósea entre las trabéculas, con gran cantidad de lagunas
vasculares o vasos sanguíneos grandes, adipocitos y osteoblastos expresando osteopontina.
En el caso de los implantes cargados con rhBMP-6 y rh-bFGF-CBD se encontraban algunas
zonas de cartílago hipertrófico, al igual que acumulaciones de osteopontina de aspecto fibroso.
Se pudo concluir que el uso de 1.25 pmoles de bFGF puede aumentar la formación de
hueso en combinación con BMP-6 y que el rh-bFGF producido en células Sf9 era, al menos,
igual de efectivo que el rh-bFGF comercial, producido en E. coli. Los implantes con rhBMP-6 y
rh-bFGF-CBD mostraban una apariencia intermedia entre los implantes con rhBMP-6 + rh-bFGF
y los que habían sido cargados con sólo bFGF. Como se ha demostrado que altas
concentraciones de bFGF pueden inhibir la osteogénesis inducida por BMP-2, podría pensarse
que la mayor afinidad por el colágeno del rh-bFGF-CBD supone un aumento de la concentración
efectiva local del factor por encima del límite osteogénico. Si este fuera el caso, podrían usarse
cantidades menores de este factor para alcanzar los mismos resultados que con cantidades
mayores del factor sin modificar. En cualquier caso, el hecho de que el rh-bFGF producido en
células Sf9 tenga una cierta afinidad por el colágeno tipo I ya podría incrementar la seguridad
de los tratamientos con este factor en comparación con el rh-bFGF comercial a las mismas
concentraciones.
239
Appendix III. Abstract in Spanish / Resumen en español____________________________________________________
5. Conclusiones.
1. Todas las combinaciones de variables probadas para el plegamiento in vitro de la rhBMP-6
producida en Escherichia coli resultaron en bajos niveles de formación de puentes disulfuro,
siendo la mayoría de las formadas inespecíficas. Por tanto, el plegamiento in vitro de la
rhBMP-6 monomérica debe requerir otras condiciones distintas a las empleadas en el
presente trabajo.
2. Los dímeros de rhBMP-6 y rhBMP-6-CBD producidas con un sistema de expresión en
baculovirus/células de insecto resultaron ser inactivos debido a un plegamiento incorrecto o
a una glucosilación insuficiente. Por tanto, este sistema de expresión no parece ser
apropiado para la expresión heteróloga de estos factores de crecimiento.
3. Las moléculas de rh-bFGF y rh-bFGF-CBD producidas con un sistema de expresión en
baculovirus/células de insecto resultaron poseer actividad biológica, aunque la mayoría de
ellas presentaban una baja afinidad por la heparina.
4. El rh-bFGF comercial producido en Escherichia coli no mostró tener ninguna afinidad
específica por esponjas absorbibles de colágeno tipo I, mientras que las moléculas de
rh-bFGF producidas en células de insecto se pegaban de manera específica a este material.
Además, la adición del CBD al rh-bFGF no alteró su estructura nativa ni su afinidad por la
heparina, pero sí aumentó aún más la afinidad de la molécula por las esponjas absorbibles
de colágeno tipo I.
5. La actividad biológica in vitro de los bFGFs producidos en células de insecto fue comparable
a la de la proteína comercial, producida en Escherichia coli, a bajas concentraciones. A
mayores concentraciones, la actividad biológica de los bFGFs producidos en células de
insecto fue ligeramente inferior a la del factor comercial.
6. La combinación de rhBMP-6 y rh-bFGF incrementó la osteogénesis heterotópica in vivo frente
a la rhBMP-6 en solitario. El rh-bFGF producido en células de insecto fue, al menos, igual de
efectivo que el factor comercial producido en Escherichia coli, mientras que el uso del
rh-bFGF-CBD a la misma concentración resultó en la formación de un hueso de apariencia
más inmadura. Esto probablemente se debió a una mayor retención del factor de crecimiento
en el sitio del implante debido al incremento de su afinidad por el material transportador
que le transfiere el CBD.
240