+ All Categories
Home > Documents > Prof. Prof. h.c. Dr. Wolfgang Schumann University of ...Morbus Crohn Chronic inflammatory disease of...

Prof. Prof. h.c. Dr. Wolfgang Schumann University of ...Morbus Crohn Chronic inflammatory disease of...

Date post: 22-May-2020
Category:
Upload: others
View: 2 times
Download: 0 times
Share this document with a friend
71
The Human Microbiome 1 Prof. Prof. h.c. Dr. Wolfgang Schumann University of Bayreuth Institut of Genetics Truong Trong
Transcript
Page 1: Prof. Prof. h.c. Dr. Wolfgang Schumann University of ...Morbus Crohn Chronic inflammatory disease of the gut preferable present in the large bowel Activating factor unknown so far

The Human Microbiome

1

Prof. Prof. h.c. Dr. Wolfgang SchumannUniversity of Bayreuth

Institut of Genetics

Truong Trong

Page 2: Prof. Prof. h.c. Dr. Wolfgang Schumann University of ...Morbus Crohn Chronic inflammatory disease of the gut preferable present in the large bowel Activating factor unknown so far

2

The Human BiotopWe do not live by ourselves !Many parts of our body serve as biotopes for microorganisms = The Human Microbiome

Numbers:About 10 trillion human cells and 10-100 trillion microorganisms (estimations)

Our microbiome influences • our health• our weight • our behaviour

Page 3: Prof. Prof. h.c. Dr. Wolfgang Schumann University of ...Morbus Crohn Chronic inflammatory disease of the gut preferable present in the large bowel Activating factor unknown so far

3

How do our microorganisms influence our daily life ?

Could we survive without our microorganisms ?

Sterile mice have to life in a miserable way

Phase I: Inventory part: Identification of all of our

inhabitants and their genes

Phase II: Understanding

Phase III: Healing

2008: Human Microbiome Project

Page 4: Prof. Prof. h.c. Dr. Wolfgang Schumann University of ...Morbus Crohn Chronic inflammatory disease of the gut preferable present in the large bowel Activating factor unknown so far

4

The Human Body Harbours a Zoological Garden of Microorganisms

The following groups of microorganisms harbour our body: Bacteria, Archaea, Viruses, Yeasts, Amoebae, Flagellates

The actual research projects concentrate on bacteriaPrimary goal: Identification of all bacterial species and their genes

Page 5: Prof. Prof. h.c. Dr. Wolfgang Schumann University of ...Morbus Crohn Chronic inflammatory disease of the gut preferable present in the large bowel Activating factor unknown so far

5

Program

1. Basics

2. Colonization of our body after birth

3. Analysis phase

- Microorganisms present on our skin

- Microorganisms present in our gastrointestinal

tract – from our mouth to our large bowel

- The bowel – brain axis

4. The optimization phase

5. Summary and Outlook

Page 6: Prof. Prof. h.c. Dr. Wolfgang Schumann University of ...Morbus Crohn Chronic inflammatory disease of the gut preferable present in the large bowel Activating factor unknown so far

6

Program

1. Basics

2. Colonization of our body after birth

3. Analysis phase

- Microorganisms present on our skin

- Microorganisms present in our gastrointestinal

tract – from our mouth to our large bowel

- The bowel – brain axis

4. The optimization phase

5. Summary and Outlook

Page 7: Prof. Prof. h.c. Dr. Wolfgang Schumann University of ...Morbus Crohn Chronic inflammatory disease of the gut preferable present in the large bowel Activating factor unknown so far

7

Time Schedule

Millions of Forms of life Years ago -----------------------------------------------------------------------4600 Origin of our planet Earth

3700 Origin of life

3700 First bacteria

560 First multicellular organisms

2 First humans

Page 8: Prof. Prof. h.c. Dr. Wolfgang Schumann University of ...Morbus Crohn Chronic inflammatory disease of the gut preferable present in the large bowel Activating factor unknown so far

8

Life originated where ?

Hypothesis:

Black and White Smokers =

hydrothermal sources on

the surface of the deep sea

Page 9: Prof. Prof. h.c. Dr. Wolfgang Schumann University of ...Morbus Crohn Chronic inflammatory disease of the gut preferable present in the large bowel Activating factor unknown so far

9

Where the first forms of life have been detected ?

Stromatolithes = sedimentary rocks build by

microorganisms; 3,4 – 3,7 billion years old

Page 10: Prof. Prof. h.c. Dr. Wolfgang Schumann University of ...Morbus Crohn Chronic inflammatory disease of the gut preferable present in the large bowel Activating factor unknown so far

10

Antoni van Leeuwenhoek – Discoverer of Bacteria

1683: Discovered bacteria in his dental plaques =

Animalcules

Page 11: Prof. Prof. h.c. Dr. Wolfgang Schumann University of ...Morbus Crohn Chronic inflammatory disease of the gut preferable present in the large bowel Activating factor unknown so far

11

Robert Koch (1843 – 1910)

Proof of pathogens of

- Antrax: Bacillus anthracis

- Tuberculosis: Mycobacterium

tuberculosis

- Cholera: Vibrio cholerae

Nobel Price of Medicine in 1905

Page 12: Prof. Prof. h.c. Dr. Wolfgang Schumann University of ...Morbus Crohn Chronic inflammatory disease of the gut preferable present in the large bowel Activating factor unknown so far

12

Nucleus

Friedrich Miescher (1844 – 1895)

Discovered in 1869 an acid in the nuclei of

eukaryotic cells = nucleic acid

Page 13: Prof. Prof. h.c. Dr. Wolfgang Schumann University of ...Morbus Crohn Chronic inflammatory disease of the gut preferable present in the large bowel Activating factor unknown so far

13

DNA = Molecule of Life

F. Crick J. WatsonNobel Price in 1962

ACGTATTGCGATCGATTGCATAACGCTAGCTA

TGCATAACGCTAGCTAACGTATTGCGATCGAT

Page 14: Prof. Prof. h.c. Dr. Wolfgang Schumann University of ...Morbus Crohn Chronic inflammatory disease of the gut preferable present in the large bowel Activating factor unknown so far

14

Genes Are Defined Parts of the DNA

Bacteria: 90-95% of the DNA consists of genes

Humans: only about 7% of the DNA consists of genes

A B C D E F G

NML? ?

The length of the genes is quite different

Page 15: Prof. Prof. h.c. Dr. Wolfgang Schumann University of ...Morbus Crohn Chronic inflammatory disease of the gut preferable present in the large bowel Activating factor unknown so far

15

Synthesis of Proteins

Ribosomes = Machines to synthesis proteins

DNA

mRNA

ProteinAmino acids: 20GCG = Alanine

GCG TAT CTA

CGC AUA GAU

Page 16: Prof. Prof. h.c. Dr. Wolfgang Schumann University of ...Morbus Crohn Chronic inflammatory disease of the gut preferable present in the large bowel Activating factor unknown so far

16

Promoter = Switch to Turn on and off Genes

Gene A

Promoter: ON = Protein synthesis

OFF = No protein synthesis

Promoter = can be compared with a „Dimmer“

Page 17: Prof. Prof. h.c. Dr. Wolfgang Schumann University of ...Morbus Crohn Chronic inflammatory disease of the gut preferable present in the large bowel Activating factor unknown so far

17

Identification and Analysis of Bacteria:

Sequencing of the DNA

Sequencing of the DNA = Analysis of the

sequence of the four nucleotides A, C, G and T

…ATTCGCATTGCACTACGGCTA……TAAGCGTAACGTGATGCCGAT…

Examples:

Human ~ 3 000 000 000 nucleotides; Genes ~23 000

Escherichia coli ~ 4 300 000 nucleotides; Genes

~4 300

Page 18: Prof. Prof. h.c. Dr. Wolfgang Schumann University of ...Morbus Crohn Chronic inflammatory disease of the gut preferable present in the large bowel Activating factor unknown so far

18

Computer programs are needed

What is the function of each single protein ?

Under which circumstances the protein will be

synthesized ?

How many copies of the protein will be

synthesized under which situations ?

Identification and Analysis of Bacteria:

Identification of the Genes and their

Functions

Page 19: Prof. Prof. h.c. Dr. Wolfgang Schumann University of ...Morbus Crohn Chronic inflammatory disease of the gut preferable present in the large bowel Activating factor unknown so far

19

Program

1. Basics

2. Colonization of our body after birth

3. Analysis phase

- Microorganisms present on our skin

- Microorganisms present in our gastrointestinal

tract – from our mouth to our large bowel

- The bowel – brain axis

4. The optimization phase

5. Summary and Outlook

Page 20: Prof. Prof. h.c. Dr. Wolfgang Schumann University of ...Morbus Crohn Chronic inflammatory disease of the gut preferable present in the large bowel Activating factor unknown so far

20

We Are Borne

The foetus is sterile in the amniotic sac

There are two possibilities to be borne:

1. Normal birth

2. Caesarian cut

Page 21: Prof. Prof. h.c. Dr. Wolfgang Schumann University of ...Morbus Crohn Chronic inflammatory disease of the gut preferable present in the large bowel Activating factor unknown so far

21

Normal BirthPregnancy: • The cells of the mucous membrane of the

vagina produces high amounts of sugar• Lactobacilli: convert sugar in lactic acid →

acidic environment → prevents growth of pathogenic bacteria = perfect chemical barrier

Functions of the bacteria colonizing the baby during normal birth:• Defense against pathogenic bacteria • Use of the nutrients present in the mother‘s milk

Page 22: Prof. Prof. h.c. Dr. Wolfgang Schumann University of ...Morbus Crohn Chronic inflammatory disease of the gut preferable present in the large bowel Activating factor unknown so far

22

Normal BirthBacteria present in the vagina are transferred on the skin of the baby and via its mouth into its gut, e. g. Lactobacilli

Mother‘s milk:Up to 600 bacterial species present • Some sugars present in the milk are used only

by bacteria present in the gut Oral Phase:During their first years of life, the babies put everything with their hands into their mouth → individual bacterial mixture

Page 23: Prof. Prof. h.c. Dr. Wolfgang Schumann University of ...Morbus Crohn Chronic inflammatory disease of the gut preferable present in the large bowel Activating factor unknown so far

23

Babies Borne via Caesarian Cut

These babies are more prone to :

- Asthma

- Allergies

- Diabetes I

- Adipositas

- Chronical colon diseases

Germany: About 1/3 of all babies with increasing

tendency

Page 24: Prof. Prof. h.c. Dr. Wolfgang Schumann University of ...Morbus Crohn Chronic inflammatory disease of the gut preferable present in the large bowel Activating factor unknown so far

24

Babies Borne via Caesarian Cut

Recomended treatments

• Leave a wet tampon 1-2 h in the birth channel of

the mother

• Wipe the face of the newborn baby with the

tampon

Page 25: Prof. Prof. h.c. Dr. Wolfgang Schumann University of ...Morbus Crohn Chronic inflammatory disease of the gut preferable present in the large bowel Activating factor unknown so far

25

Program

1. Basics

2. Colonization of our body after birth

3. Analysis phase

- Microorganisms present on our skin

- Microorganisms present in our gastrointestinal

tract – from our mouth to our large bowel

- The bowel – brain axis

4. The optimization phase

5. Summary and Outlook

Page 26: Prof. Prof. h.c. Dr. Wolfgang Schumann University of ...Morbus Crohn Chronic inflammatory disease of the gut preferable present in the large bowel Activating factor unknown so far

26

Functions:• Boundary between in and out • Protection against dessication • Protection against toxic substances and

pathogenic bacteria • Production of sebum = fat • Propionibacterium acnes → acid mantle (~pH5)• Synthesis of vitamin D when exposed to sun light

Our SkinSkin surface: 1,5 – 2 m2 , 2 – 3 mm thickColonized by about 8 billion of bacteria→corresponds to the number of humans leaving on Earth

Page 27: Prof. Prof. h.c. Dr. Wolfgang Schumann University of ...Morbus Crohn Chronic inflammatory disease of the gut preferable present in the large bowel Activating factor unknown so far

27

Colonization of our Skin, Part 1

• ~ 1000 different bacterial species + fungi +

viruses

• Staphylococcus epidermidis: produces anti-

microbial peptides → inhibit growth of

pathogenic skin bacteria

• 1 000 – 1 billion bacteria per cm2

• Cleaning with soap: weak reduction of our

permanent colonizers and removal of

potential pathogenic bacteria

Page 28: Prof. Prof. h.c. Dr. Wolfgang Schumann University of ...Morbus Crohn Chronic inflammatory disease of the gut preferable present in the large bowel Activating factor unknown so far

28

Colonization of our Skin, Part 2

• Composition of our microbiome is dependent

of our lifestyle, our geography and our ethnic,

affiliation

• Production of our body smells

Page 29: Prof. Prof. h.c. Dr. Wolfgang Schumann University of ...Morbus Crohn Chronic inflammatory disease of the gut preferable present in the large bowel Activating factor unknown so far

29

Colonization of the Different Parts of our Body

M. Egert (2016) Adv Experi Med Biol 902: 61

Page 30: Prof. Prof. h.c. Dr. Wolfgang Schumann University of ...Morbus Crohn Chronic inflammatory disease of the gut preferable present in the large bowel Activating factor unknown so far

30

Skin and Skin is DifferentThe bacterial populations differ on the

upper arm

lower arm

bend of our elbow

armpit: up to 1 billion bacteria/ cm2

belly buttom: a few 1000/ cm2

etc.

The human biotop consists of many subbiotops

Page 31: Prof. Prof. h.c. Dr. Wolfgang Schumann University of ...Morbus Crohn Chronic inflammatory disease of the gut preferable present in the large bowel Activating factor unknown so far

31

Bacteria Present in the BellyButtoms of Different Humans

Page 32: Prof. Prof. h.c. Dr. Wolfgang Schumann University of ...Morbus Crohn Chronic inflammatory disease of the gut preferable present in the large bowel Activating factor unknown so far

32

Program

1. Basics

2. Colonization of our body after birth

3. Analysis phase

- Microorganisms present on our skin

- Microorganisms present in our gastrointestinal

tract – from our mouth to our large bowel

- The bowel – brain axis

4. The optimization phase

5. Summary and Outlook

Page 33: Prof. Prof. h.c. Dr. Wolfgang Schumann University of ...Morbus Crohn Chronic inflammatory disease of the gut preferable present in the large bowel Activating factor unknown so far

33

Our Oral Flora

Mouth: About 700 different bacterial species1 ml of saliva contains about 140 million bacteria

Surface of a tooth

Analysis of the bacteria in our saliva may provide a hint of- Caries- Parodontosis- Pancreas tumor - Cause of bad breath (halitosis)

Page 34: Prof. Prof. h.c. Dr. Wolfgang Schumann University of ...Morbus Crohn Chronic inflammatory disease of the gut preferable present in the large bowel Activating factor unknown so far

34

Mouth Flora and SmokingAnalysis of the mouth flora of more than 1500 US-Americans: Smokers and non-smokers Result:

Smokers have an altered mouth microbiome

• >150 bacterial species are present in

increased amounts, e.g. Streptococci

(promote caries)

• about 70 species present in reduced amounts,

e.g. Proteobacteria (help to degrade toxic

substances ) 

Page 35: Prof. Prof. h.c. Dr. Wolfgang Schumann University of ...Morbus Crohn Chronic inflammatory disease of the gut preferable present in the large bowel Activating factor unknown so far

35

Microbiome of our Digestive Tract

Stomach: 103/gSmall intestine: 105-107/gLarge intestine: 1010-1012/g

Page 36: Prof. Prof. h.c. Dr. Wolfgang Schumann University of ...Morbus Crohn Chronic inflammatory disease of the gut preferable present in the large bowel Activating factor unknown so far

36

Barry Marshall John Robin Warren

Discovered H. pylori in 1983

2005 Nobel Price for Physiology and Medicine

Stomach: Helicobacter pylori

Page 37: Prof. Prof. h.c. Dr. Wolfgang Schumann University of ...Morbus Crohn Chronic inflammatory disease of the gut preferable present in the large bowel Activating factor unknown so far

37

Microbiome of our Stomach

• Up to 128 different bacterial species in the mucus (slime) of our stomach wall

• Gastric juice (hypochloric acid; pH 1-1,5) contains less than 10 bacteria per ml

• Helicobacter pylori present in the stomach of more than 50% of the population

• H. pylori produces poisonous substances and lyses, whenpathogenic bacteria show upin the stomach

Page 38: Prof. Prof. h.c. Dr. Wolfgang Schumann University of ...Morbus Crohn Chronic inflammatory disease of the gut preferable present in the large bowel Activating factor unknown so far

38

Gut = Hotspot of Bacteria• Weight of about 2 kg• More than 1000 different bacterial species • Analysis of stool samples: 3 groups dominate

= 3 gut types

Bacteroides: People eating meat

Prevotella: Vegetarians Ruminococcus: ~70%

Page 39: Prof. Prof. h.c. Dr. Wolfgang Schumann University of ...Morbus Crohn Chronic inflammatory disease of the gut preferable present in the large bowel Activating factor unknown so far

39

Intestinal Flora

Intestinal flora = „Organ“ at the interface between

digestive tract and eaten food

Surface:

400 – 500 m2

Page 40: Prof. Prof. h.c. Dr. Wolfgang Schumann University of ...Morbus Crohn Chronic inflammatory disease of the gut preferable present in the large bowel Activating factor unknown so far

40

Known Functions of our Intestinal Flora

• Synthesize vitamins: B1, B2, B6, B12, K2 and H

• Synthesize essential amino acids (eight)

• Help to degrade our food: ~ 30% of the food

(metabolites) in our blood are produced by

microorganisms

• Limit the resources for pathogens

• Stimulate our immune system (recognize and

eliminate pathogenic microorganisms)

Page 41: Prof. Prof. h.c. Dr. Wolfgang Schumann University of ...Morbus Crohn Chronic inflammatory disease of the gut preferable present in the large bowel Activating factor unknown so far

41

Clostridium difficile: Synthesizes the Toxins A und B

A BA: Intact intestinal flora prohibits contact with the mucous intestinal membrane and secretion of the two toxins into the intestinal cellsB: antibiotic destroyed the intestinal flora → life-threatening colitis

~ 200 death humans in Germany per year

Page 42: Prof. Prof. h.c. Dr. Wolfgang Schumann University of ...Morbus Crohn Chronic inflammatory disease of the gut preferable present in the large bowel Activating factor unknown so far

42

Clostridium difficile: Treatment

1. Phase: antibiotics

2. Phase: stool transplant; intestinal flora of a

relative containing a healthy intestinal flora

possible problems: HIV-infected; overweight

Future: Construction of donor samples

Page 43: Prof. Prof. h.c. Dr. Wolfgang Schumann University of ...Morbus Crohn Chronic inflammatory disease of the gut preferable present in the large bowel Activating factor unknown so far

43

Stool- or Rectal Transplantation after a Severe Damage of the Intestinal Flora

Future:

Development of acid-

resistent pills

containing the

intestinal flora of

healthy humans

Page 44: Prof. Prof. h.c. Dr. Wolfgang Schumann University of ...Morbus Crohn Chronic inflammatory disease of the gut preferable present in the large bowel Activating factor unknown so far

44

Connection Between Intestinal Flora and Corpulence (Obesity)

Experiment:• Sterile mouse with normal weight + intestinal

flora of a mouse with overweight → weight increase

• Sterile mouse with normal weight + intestinal flora of a human with overweight → weight increase

Goal: Loss of weight with optimized intestinal

flora

Page 45: Prof. Prof. h.c. Dr. Wolfgang Schumann University of ...Morbus Crohn Chronic inflammatory disease of the gut preferable present in the large bowel Activating factor unknown so far

45

What does the Intestinal Flora tell us ?

The analysis of our intestinal flora allows statements whether a human

• Suffers with certain diseases, e.g. diabetes or chronic inflammatory intestine diseases

• Suffers from overweight or is slim• Vegetarian (Prevotella) oder meat eater

(Bacteroides)

General statement:A low variety in our intestinal flora is associated with many diseases

Page 46: Prof. Prof. h.c. Dr. Wolfgang Schumann University of ...Morbus Crohn Chronic inflammatory disease of the gut preferable present in the large bowel Activating factor unknown so far

46

Body Weight and DiabetesOur body weight will be influenced by - our genes (~10%)- our way of living - Our microbiome - Details are still unknown

Native people: - Overweight very rare - do not eat civilized products China: - Diabetes nearly unkown up to 10-20 years- taking over our habits → diabetes = big problem

Page 47: Prof. Prof. h.c. Dr. Wolfgang Schumann University of ...Morbus Crohn Chronic inflammatory disease of the gut preferable present in the large bowel Activating factor unknown so far

47

Hints

1. Do Fusobacteria play a role to develop gut

cancer ?

2. Do missing bacteria play a role in the

development of Morbus Crohn ?

3. Intestinal bacteria and Morbus Alzheimer ?

4. Intestinal bacteria and Parkinson ?

Page 48: Prof. Prof. h.c. Dr. Wolfgang Schumann University of ...Morbus Crohn Chronic inflammatory disease of the gut preferable present in the large bowel Activating factor unknown so far

48

Fusobacteria and Gut Cancer ?

Observation: Patients suffering from gut cancer (Colitis ulcerosa) contain Fusobacteria (Fusobacterium necrophorum)

Question: Responsible for or established after development of gut cancer ?

Page 49: Prof. Prof. h.c. Dr. Wolfgang Schumann University of ...Morbus Crohn Chronic inflammatory disease of the gut preferable present in the large bowel Activating factor unknown so far

49

Morbus Crohn Chronic inflammatory disease of the gut preferable present in the large bowel Activating factor unknown so far

Observation:In tissue samples prepared from patients the gut bacteria Faecalibacterium prausnitzii were missingExperiment:F. prausnitzii transferred into the gut of mice → animals were protected against experimentally induced gut inflammations

Page 50: Prof. Prof. h.c. Dr. Wolfgang Schumann University of ...Morbus Crohn Chronic inflammatory disease of the gut preferable present in the large bowel Activating factor unknown so far

50

Do changes in our intestinal flora can cause Alzheimer ?

Symptoms of Alzheimer:Formation of amyloid-β protein aggregates and tau-protein fibrills

A Cattaneo (2017) Neurobiol Aging 49: 60

Observations with Alzheimer Patients:

• Reduced amounts of Eubacterium rectale

• Increased amounts of Escherichia und

Shigella

• Healthy humans: the opposite direction

Page 51: Prof. Prof. h.c. Dr. Wolfgang Schumann University of ...Morbus Crohn Chronic inflammatory disease of the gut preferable present in the large bowel Activating factor unknown so far

51

Is Parkinson induced by intestinal bacteria ?

Trigger for Parkinson:

Protein alpha-synuclein

Healthy nerve cells:

Alpha-synuclein is solubilized in the nerve cells

Parkinson patients:

• Alpha-synuclein aggregates and forms fibres

• These fibres destroy our nerve cells

Page 52: Prof. Prof. h.c. Dr. Wolfgang Schumann University of ...Morbus Crohn Chronic inflammatory disease of the gut preferable present in the large bowel Activating factor unknown so far

52

Experiments with Mice Containing an Increased Amount of Alpha-synuclein

1. Experiment:

• Sterile mice move more freely and accumulate

less alpha-synuclein in their brain as

compared with normale mice

Comparison sterile – normal mice

Page 53: Prof. Prof. h.c. Dr. Wolfgang Schumann University of ...Morbus Crohn Chronic inflammatory disease of the gut preferable present in the large bowel Activating factor unknown so far

53

2. Experiment:

• Sterile mice + feces of normal humans →

normal movements

• Sterile mice + feces of Parkinson patients →

staggering movements

T.R. Sampson (2016) Cell 167: 1469

Experiments with Mice Containing an Increased Amount of Alpha-synuclein

Page 54: Prof. Prof. h.c. Dr. Wolfgang Schumann University of ...Morbus Crohn Chronic inflammatory disease of the gut preferable present in the large bowel Activating factor unknown so far

54

Parkinson

Later Parkinson patients complain up to ten years

before the breakout of the disease about

digestive problems and severe constipations

Next step:

Identification of those bacteria responsible for the

disease

Page 55: Prof. Prof. h.c. Dr. Wolfgang Schumann University of ...Morbus Crohn Chronic inflammatory disease of the gut preferable present in the large bowel Activating factor unknown so far

55

Program

1. Basics

2. Colonization of our body after birth

3. Analysis phase

- Microorganisms present on our skin

- Microorganisms present in our gastrointestinal

tract – from our mouth to our large bowel

- The bowel – brain axis

4. The optimization phase

5. Summary and Outlook

Page 56: Prof. Prof. h.c. Dr. Wolfgang Schumann University of ...Morbus Crohn Chronic inflammatory disease of the gut preferable present in the large bowel Activating factor unknown so far

56

Bowel and Brain Talk to Each Other

Page 57: Prof. Prof. h.c. Dr. Wolfgang Schumann University of ...Morbus Crohn Chronic inflammatory disease of the gut preferable present in the large bowel Activating factor unknown so far

57

DysbiosisDefinition:Disturbed balances in the gut flora Symptoms:Functional disorders in our brain cause- State of panic - Conspicious mood - Cognitive problems

Trigger mechanism:Production of unusual amounts of harmful substances such as e.g. ammonia (enrichment in the blood and in the brain)

Page 58: Prof. Prof. h.c. Dr. Wolfgang Schumann University of ...Morbus Crohn Chronic inflammatory disease of the gut preferable present in the large bowel Activating factor unknown so far

58

The Gut Flora Influences our Social Behaviour: Experiments with Mice

Example 1:• Sterile mice avoid foreign mice and form

significantly more of the stress hormone corticosteroide

• Mice with gut flora look for contact

Example 2: Mice in a labyrinth • Sterile mice are careful and look for dark parts

to hide there • Normal mice are curious and look around the

whole labyrinth

Page 59: Prof. Prof. h.c. Dr. Wolfgang Schumann University of ...Morbus Crohn Chronic inflammatory disease of the gut preferable present in the large bowel Activating factor unknown so far

59

Example 3:

• Transfer gut bacteria of humans suffering with

irritable bowel syndrome into mice: causes

state of panic in the mice

• Transfer gut bacteria of healthy humans: no

reaction in the mice

The Gut Flora Influences our Social Behaviour: Experiments with Mice

Page 60: Prof. Prof. h.c. Dr. Wolfgang Schumann University of ...Morbus Crohn Chronic inflammatory disease of the gut preferable present in the large bowel Activating factor unknown so far

60

Program

1. Basics

2. Colonization of our body after birth

3. Analysis phase

- Microorganisms present on our skin

- Microorganisms present in our gastrointestinal

tract – from our mouth to our large bowel

- The bowel – brain axis

4. The optimization phase

5. Summary and Outlook

Page 61: Prof. Prof. h.c. Dr. Wolfgang Schumann University of ...Morbus Crohn Chronic inflammatory disease of the gut preferable present in the large bowel Activating factor unknown so far

61

How can we optimize our microbiome ?

Possibilities:

1. Adding of appropriate bacterial species

2. Removal of bacterial species

3. Addition or removal of one or more genes in

bacterial species already present

4. Trying to influence gene expression

(„Dimmer“)

Page 62: Prof. Prof. h.c. Dr. Wolfgang Schumann University of ...Morbus Crohn Chronic inflammatory disease of the gut preferable present in the large bowel Activating factor unknown so far

62

Addition of Bacterial Species

Example: Intestinal flora

Technique: Rectal transplantation

Page 63: Prof. Prof. h.c. Dr. Wolfgang Schumann University of ...Morbus Crohn Chronic inflammatory disease of the gut preferable present in the large bowel Activating factor unknown so far

63

Removal of Bacterial Species

Example: Intestinal flora

Observation:All bacterial species contain a suicide program called programmed cell death (PCD)

Components: Toxin and antitoxinAntitoxin neutralizes the toxin Destruction of the antitoxin → toxin kills the cell

ToxinAntitoxin

Page 64: Prof. Prof. h.c. Dr. Wolfgang Schumann University of ...Morbus Crohn Chronic inflammatory disease of the gut preferable present in the large bowel Activating factor unknown so far

64

Addition or Removal of Single Genes

Aim: Optimized degradation of our food

Using gene technology methods, any gene can

be removed or added to any bacterial strain

Page 65: Prof. Prof. h.c. Dr. Wolfgang Schumann University of ...Morbus Crohn Chronic inflammatory disease of the gut preferable present in the large bowel Activating factor unknown so far

65

To Influence Gene Expression

Aims: Three possibilities

1. To turn on a gene when necessary (e.g.

degradation of certain compounds of

the food)

2. Gene should be constitutively

expressed

3. To turn off a gene permanent or to

remove it

Page 66: Prof. Prof. h.c. Dr. Wolfgang Schumann University of ...Morbus Crohn Chronic inflammatory disease of the gut preferable present in the large bowel Activating factor unknown so far

66

Program

1. Basics

2. Colonization of our body after birth

3. Analysis phase

- Microorganisms present on our skin

- Microorganisms present in our gastrointestinal

tract – from our mouth to our large bowel

- The bowel – brain axis

4. The optimization phase

5. Summary and Outlook

Page 67: Prof. Prof. h.c. Dr. Wolfgang Schumann University of ...Morbus Crohn Chronic inflammatory disease of the gut preferable present in the large bowel Activating factor unknown so far

67

Summary• Bacteria are the oldest form of life on our

planet• A normal birth is important for colonization by

microorganisms• The microbiome of each individual can be

compared with his finger print • Western humans have a reduced microbiome

as compared to native humans leaving in Africa or South-America

• The microbiome of many plants and animals is studied as well

Page 68: Prof. Prof. h.c. Dr. Wolfgang Schumann University of ...Morbus Crohn Chronic inflammatory disease of the gut preferable present in the large bowel Activating factor unknown so far

68

Outlook: What will happen in the near future?

1.Demonstration of additional correlations

between microbiome and chronic diseases

2.How our microbiome can influence chronic

diseases?

3.Prediction of certain risks

4.To obtain more informations about food and

medicine

Page 69: Prof. Prof. h.c. Dr. Wolfgang Schumann University of ...Morbus Crohn Chronic inflammatory disease of the gut preferable present in the large bowel Activating factor unknown so far

69

Outlook: What will happen in the near future?

5. To increase resistance against pathogenic

microorganisms

6. Does an optimal personal microbiome exist ?

7. May be, in the near future we will have a new

type of medical doctor, the microbiome doctor ?

Page 70: Prof. Prof. h.c. Dr. Wolfgang Schumann University of ...Morbus Crohn Chronic inflammatory disease of the gut preferable present in the large bowel Activating factor unknown so far

70

Long Term Objective

To build our microbiome in such a way that it will

keep us healthy and heal us if necessary

Page 71: Prof. Prof. h.c. Dr. Wolfgang Schumann University of ...Morbus Crohn Chronic inflammatory disease of the gut preferable present in the large bowel Activating factor unknown so far

71

Thank you for your attention !

Questions ?


Recommended