Articles in Press, J. Med. Biol. Eng. (Jan 30, 2013), doi: 10.5405/jmbe.1334
Proliferation Effects of 42-kHz Radiofrequency Energy on Human Foreskin Fibroblasts 1
(Running Title: RFE on Human Fibroblasts) 2
3
Chun-Yi Chiu1, Po -Hsiang Tsui
2, Chao-Ming Su
1, and Shyh-Liang Lou
1a) 4
5
1 Department of Biomedical Engineering, College of Engineering, 6
Chung Yuan Christian University, Chungli, Taiwan, ROC 7
8
2 Department of Medical Imaging and Radiological Sciences, College of Medicine, 9
Chang Gung University, Taoyuan, Taiwan, ROC 10
11
12
13
14
15
16
17
a) Corresponding author 18
Name: Shyh-Liang Lou Ph. D. 19
Tel: +886-3-265-4517 20
Fax: +886-3-265-2599 21
e-mail: [email protected] 22
23
Articles in Press, J. Med. Biol. Eng. (Jan 30, 2013), doi: 10.5405/jmbe.1334
2
Abstract 24
Radiofrequency (RF), which can penetrate the dermis to induce cell responses, has been 25
frequently used in the field of skin regeneration. The purpose of this study is to determine 26
the potential for skin wound healing using RF treatment. Human fibroblasts were exposed 27
to a 42-kHz RF at various intensities for 30 min. The cell cycle progression, cell viabilities, 28
and c-fos and c-jun gene expressions were evaluated using flow cytometry, an MTT assay, 29
and reverse-transcription polymerase chain reaction (RT-PCR) after individual exposures. 30
The results showed that the DNA synthesis, cell viabilities, and gene expressions were 31
upregulated by a low-level RF, especially at 350 and 450 A/m2 electromagnetic field 32
exposures. Therefore, we conclude that RF may play a predominant role in inducing cell 33
proliferation through cell cycle progression and c-fos and c-jun mRNA activation. 34
Non-thermal RF may be the major cause of generating this type of cell response 35
performance. 36
37
Keywords: Radiofrequency, Fibroblasts, Bio-effects 38
39
40
41
42
43
44
45
46
Articles in Press, J. Med. Biol. Eng. (Jan 30, 2013), doi: 10.5405/jmbe.1334
3
1. Introduction 47
Wound healing is a complex and dynamic process that involves interactions among soluble 48
mediators, blood cells, extracellular matrices (ECM), and parenchymal cells [1]. Inflammation, 49
tissue formation, and tissue remodeling are essential phases during wound healing that overlap 50
each other. To regenerate wound tissue, dermal fibroblasts are activated by cytokines and 51
released from macrophages to support skin healing [1]. After the bleeding and inflammatory 52
phases, fibroblasts migrate to the wound margins, proliferate, and secrete ECM, such as 53
proteoglycans and glycosaminoglycans, to provide a scaffold for directing supportive cells to the 54
injury site and to synthesize more new ECM. However, ischemia, infections, fibroblast inactivity, 55
and wound protease imbalances hinder wound healing. This has been reported in studies on 56
diabetic, burned, and chronic pressure ulcers patients [2,3]. Therefore, developing an effective 57
method for redundancy reduction has become critical. 58
Physical therapy modalities are widely applied to wound healing enhancement, such as 59
electrical, ultrasonic, and low-level laser stimulations [4]. Electrotherapy can stimulate fibroblast 60
growth [5], decrease ulcer size [6], and expedite healing time [7]. Although exogenous electric 61
stimulation assists in the healing process, unstable current density and voltage distributions occur 62
during in vivo applications [8]. Ultrasound, which is a type of mechanical stimulation, has 63
longitudinal waves that are used for diagnosis and therapy. Research has suggested that 64
ultrasound might facilitate chronic wound regeneration in vivo [9], regulate fibroblastic 65
proliferation [10], and induce ECM deposition [11]. The characteristics of being noninvasive and 66
safe from organisms have enabled ultrasound to become one of the most acceptable approaches 67
in clinical applications. However, a medium is necessary for energy propagation, such as water 68
and coupling gels. This approach poses a challenge to avoiding the infection of a medium contact. 69
Articles in Press, J. Med. Biol. Eng. (Jan 30, 2013), doi: 10.5405/jmbe.1334
4
Low-level laser treatment is another promising method for facilitating wound healing [12]. 70
However, the machinery is expensive and the outcomes are controversial. Although these 71
treatments can benefit cell responses, some obstacles must be overcome. Therefore, a novel and 72
effective modality to accelerate wound healing is necessary. 73
Radiofrequency (RF) is one of the most innovative treatments for chronic wound healing and 74
skin regeneration. It has been shown to reduce skin flaccidity, wrinkles, and cutaneous aging 75
[13]. In addition, RF has demonstrated the ability to upregulate human dermal cell proliferation 76
[14,15] and activate expressions of genes and enzymes [16-19]. Moreover, RF generates a 77
non-ionizing electromagnetic field considered a biosafety modality, and has been used in both 78
medicine and communication depending on the radio spectrum. For example, the spectrum 79
between 3 and 30 GHz is within the microwave band; a range of 30 to 300 MHz of RF is used 80
for FM radio broadcasts and land mobile stations (emergency and military). Furthermore, the 81
characteristics of non-contact and non-invasion during RF treatment are beneficial to human pain 82
tolerance [20-22]. Thus, RF may play a therapeutic role in inducing cell responses and 83
influencing physiological alterations. 84
The bio-effects of RF are inconclusive [17,24-27]. Particular studies have shown that RF 85
might regulate the behavior of human skin fibroblasts, by enhancing DNA synthesis, inducing 86
intracellular mitogenic second messenger formation [17], increasing the expression of comet tail 87
factors, and accelerating centromere-negative micronuclei with time dependence [26]. In 88
addition, a continuous RF wave at 864 MHz significantly upregulates the growth of V79 cells 89
with 0.08 W/kg SAR and 72 h exposure [3]. However, other researchers have argued that RF can 90
induce either harmful effects or have no effect on mammal cells [23,25,27]. In 2009, Sannino et 91
al. proved that the alkaline comet and cytokinesis-block micronucleus assay of human dermal 92
Articles in Press, J. Med. Biol. Eng. (Jan 30, 2013), doi: 10.5405/jmbe.1334
5
fibroblasts have no changes after 900-MHz RF treatment for 1 h [25]. In 2011, Bourthoumieu et 93
al. reported that human amniotic cells exposed to a 900-MHz RF for 24 h at SAR of 0.25, 1, 2, 94
and 4 W/kg had no significant differences in the aneuploidy rate of chromosomes 11 and 17 [23]. 95
However, a previous study indicated that RF can induce harmful effects on mammal cells [27]. 96
This lack of consensus on the effects of RF on cell responses is probably due to the various RF 97
modes of frequency, intensity, and exposure duration. 98
To distinguish these variances, an RF at a low frequency of 42 kHz was selected in this study 99
to determine the RF energy effects. Because of the lower frequency mode with the longer 100
wavelength, the energy can maintain the magnitude in avoiding attenuation, which compares to 101
the high-frequency mode when the energy is transmitted to a deeper site. A low-frequency RF is 102
more flexible for future applications. In addition, the biosafety and bio-effects of RF have drawn 103
considerable attention recently, and are considered crucial. These biological responses have the 104
potential to influence certain physiological phenomena, such as wound healing. To determine the 105
efficiency of RF, we hypothesize that RF can influence wound healing by regulating cell 106
proliferation. Therefore, this study investigated the bio-effects of RF on human skin fibroblastic 107
proliferation, which is a leading factor in regulating wound healing. 108
This article is organized as follows. We introduce the experimental materials and methods, 109
present the results, and discuss the cell responses of RF exposure. Finally, we present our 110
conclusion on the significant findings and contributions of this study. 111
112
113
114
115
Articles in Press, J. Med. Biol. Eng. (Jan 30, 2013), doi: 10.5405/jmbe.1334
6
2. Materials and Methods 116
2.1 Cells and cell culture 117
Human foreskin fibroblasts, the Hs68 cell line, were obtained from the Bioresearch 118
Collection and Research Center at the Food Industry Research and Development Institute (FIRDI) 119
(Hsinchu, Taiwan). The cells were cultured in a medium composed of Dulbeccos modified 120
Eagles medium (DMEM) (GIBCO, New York, USA), 4 mM of L-glutamine (GIBCO, New 121
York, USA), 1.5 g/L of sodium bicarbonate (GIBCO, New York, USA), and 10% (v/v) fetal 122
bovine serum (FBS) (Biological Industries, Israel) in an incubator at 37 C with 5% CO2 (v/v). 123
Fibroblasts, grown in culture dishes (Corning, New York, USA), were digested with 0.05% (v/v) 124
trypsin-EDTA (GIBCO, New York, USA) for 5 min. The cells were resuspended in a fresh 125
medium, after which they were centrifuged at 1000 rpm for 5 min. All experiments were 126
performed by conducting 2 passages of the cell line after being unfrozen. 127
128
2.2 RF exposure system and procedure 129
The RF induction system consists of an RF generator (GA-15A, Kanwei Machine and Tool 130
Agent Company, Taiwan) connected to a concentric square coil and a temperature control device, 131
as shown in Fig. 1. The output intensity is adjustable in relation to the electric current. In this 132
study, 150, 250, 350, and 450 A/m2 were applied to cell exposures of 30 min each. The 133
temperature differences between the environment and the culture medium were monitored and 134
maintained at 37.0 0.5 oC using a gas-circulating controller, as shown in Fig. 2. After achieving 135
80% confluence, Hs68 was trypsinized, counted, and resuspended in a medium composed of 136
DMEM supplemented with 10% FBS and 1% antibiotics. Aliquots containing 2104 cells/cm
2 137
were seeded in a well of a 24-well culture plate, averaged, and cultured in an incubator 138
Articles in Press, J. Med. Biol. Eng. (Jan 30, 2013), doi: 10.5405/jmbe.1334
7
maintained at 37 C in a humidified atmosphere with 5% CO2. After 24 h, the cells were exposed 139
to 42 k RF with different energies for 30 min in a 37 oC environment. 140
141
2.3 Cell responses detection 142
2.3.1 Cell cycle distribution 143
To characterize the cell cycle progression affected by RF, the DNA was stained with 144
propidium iodide (PI) (Invitrogen, California, USA). The Hs68 was fixed using 75% ethanol for 145
30 min and then incubated with a staining solution containing 0.1% Triton X-100 (Sigma, 146
Missouri, USA), 10 g/mL of RNase A (Invitrogen, California, USA), and 50 g/mL of PI for 147
10 min. Subsequently, the diploid and haploid of the stained cells were analyzed using a BD 148
FACS Calibur instrument (Becton Dickinson, California, USA) equipped with CellQuest 149
software. A minimum of 10 000 cells were counted in each sample. 150
151
2.3.2 Cell proliferation 152
For cell viability analysis, the fibroblasts were cultured in a 24-well plate at a concentration 153
of 20000 cells/cm2 with DMEM supplemented with 10% FBS. At 0, 24, 36, and 48 h after RF 154
exposure, the cells were co-cultured with 3-(4,5-dimethythiazol-2-yl)-2,5-diphenyl tetrazolium 155
bromide (MTT) (5 mg/mL) (Sigma, Missouri, USA) for 3 h at various intensities. The succinate 156
dehydrogenase in the mitochondria of the cells was reduced from a yellow MTT solution to an 157
insoluble and purple formazan, specifically in highly activated cells. Finally, the insoluble 158
formazan was dissolved by dimethyl sulfoxide (DMSO) (Sigma, Missouri, USA) and measured 159
using a spectrophotometer at a wavelength of 570 nm. 160
161
Articles in Press, J. Med. Biol. Eng. (Jan 30, 2013), doi: 10.5405/jmbe.1334
8
2.3.3 Gene expression 162
For gene expression analysis, total RNA was extracted using a TRIzol reagent (Invitrogen, 163
California, USA) according to manufacturer instructions. The RNA of 2.5 g was applied in 164
reverse transcription (RT) using a SuperScriptIII RT kit (Invitrogen, California, USA). The PCR 165
amplifications were reacted with Tag polymerase, cDNAs, primers, and other salts for 35 cycles. 166
The primers are c-fos (forward): CCTCACCTTTCGGAGTCCC, and reverse: 167
CTCCTTCAGCAGGTTGGCAATCT, c-jun (forward): GACTGCAAAGATGGAAACGACC, 168
and reverse: GTAGTGGTGATGTGCCCATTGC, Glyceraldehyde 3-phosphate dehydrogenase 169
(GAPDH) (forward): CAGCAATGCATCCTGCACC, and reverse: 170
TGGACTGTGGTCATGAGCCC. 171
172
2.4 Statistics 173
The results represent the averages taken from 3 separate experiments. Data analysis and 174
statistical tests were performed using a t test. 175
176
177
178
179
180
181
182
183
184
Articles in Press, J. Med. Biol. Eng. (Jan 30, 2013), doi: 10.5405/jmbe.1334
9
3. Results 185
3.1 Cell cycle progression after RF exposure 186
To determine the effects of RF treatment on cell cycle progression, Hs68 was cultured in 187
24-well plates with a serum-free medium, which prevented the interference of growth factors and 188
other nutrition during RF exposure. The cells were then exposed to RF for 30 min at multiple 189
outputs. After 24 h, the cells were collected, fixed, and stained by PI, and then detected by using 190
flow cytometry at a wavelength of 530 nm. The results are shown in Fig. 3. The S portions in the 191
RF-treated groups were significantly higher than those in the sham stimulation, reaching 2.8-, 192
2.7-, 3.5-, and 3-fold at 150, 250, 350, and 450 A/m2, respectively. This evidence indicates that 193
the capability of DNA replication might be activated by RF exposure. 194
195
3.2 Cell proliferation after RF exposure 196
The enhancement progression of the cell cycle is observed in several physiological 197
phenomena, such as cell proliferation, tissue formation, malignant transformation, inflammation, 198
and wound healing [28]. Although a portion of the DNA synthesis phase was increased by RF 199
stimulation, the cell fate of entering the mitosis stage or arresting in this stage remains unknown. 200
To determine these effects on cells that were induced from cell cycle progression alteration, cell 201
viabilities were investigated using an MTT assay. The results show that the cell viabilities of the 202
RF exposure groups, particularly those exposed to 450 A/m2, were upregulated significantly 203
within 24 h, as shown in Fig. 4. They reached 1.35-fold and gradually decreased in the next 24 h. 204
In the 250 and 350 A/m2 RF exposure groups, the cell viabilities were 1.2- and 1.3-fold after 36 205
h. Consequently, RF at low frequencies induced DNA synthesis and, subsequently, cell viability 206
increased. In addition, the cell responses appeared to be correlated at the RF intensities. 207
Articles in Press, J. Med. Biol. Eng. (Jan 30, 2013), doi: 10.5405/jmbe.1334
10
3.3 The c-fos and c-jun gene expressions 208
Certain RF-sensitive regulators might be activated by RF exposure to result in the 209
enhancement of DNA synthesis and cell proliferation. It has been speculated that the RF signals 210
were transmitted to intracellular sites to generate these cell responses. Thus, immediate early 211
gene families of transcription factors c-fos and c-jun were selected to determine the relevant 212
bio-effects of RF. The results show that the c-fos expressions in the RF exposure groups were 213
significantly activated by 3.5-fold at 150 and 250 A/m2, and by 6-fold at 350 and 450 A/m
2, as 214
shown in Figs. 5(a) and 5(b). The c-jun was significantly activated by RF at 350 and 450 A/m2 215
groups, by 3- and 2-fold, respectively. These results suggest that the upregulation of c-fos and 216
c-jun gene expressions may correlate with cell cycle progression and cell proliferation. 217
218
219
220
221
222
223
224
225
226
227
228
229
230
Articles in Press, J. Med. Biol. Eng. (Jan 30, 2013), doi: 10.5405/jmbe.1334
11
4. Discussion 231
RF is an innovative method used in wound healing. Several auxiliary treatments have 232
recently been developed to regenerate wounds. Whirlpool, subatmospheric pressure, pulsed 233
lavage, and hyperbaric oxygen therapy have potential in becoming mainstay therapies, despite 234
limitations such as cost, complications, and diversity of effects [29]. In addition, ultrasound (US), 235
electrical stimulation (ES), and RF have been proven to have positive effects on wound healing. 236
However, additional advanced experiments in vitro and in vivo are required to determine the 237
efficiencies of US, ES, and RF in additional applications. We selected a low-frequency RF 238
because of non-contact, noninvasiveness, and a lack of side effects. There was also little 239
evidence of determining RF bio-effects. Therefore, we created an apparatus and designed a 240
procedure for efficiently exploring RF stimulation in vitro to investigate cell responses. 241
Furthermore, RF is expected to be used in chronic wound healing applications. 242
The results show that the progression of DNA synthesis was induced after RF exposure. An 243
entire cell cycle consists of 4 Phases, including Gap1 (G1), DNA synthesis (S), Gap2 (G2), and 244
Mitosis (M), which are regulated by the coordinated activation of cyclins and cyclin-dependent 245
kinases (CDK) [30]. For example, cyclin C, cyclin D1, and cyclin E are the checkpoint proteins 246
that determine the transition from the G1 to the S phase; cyclin A and cyclin B1 regulate mitotic 247
G2/M transition and mitosis [31]. Certain growth factors and physical stimuli can regulate the 248
quiescent cell reentrance into cell cycle progression. In addition, RF exposure-enhanced cell 249
cycle progression was demonstrated in this study. Therefore, RF could be the main cause in the 250
regulation of DNA synthesis. Certain studies have shown results that are consistent with those of 251
this study. Cao et al. [32] reported that a 27-MHz RF at 25 W/kg altered the cell cycle 252
progression of Chinese hamster ovary cells, which is consistent with our results. However, 253
Articles in Press, J. Med. Biol. Eng. (Jan 30, 2013), doi: 10.5405/jmbe.1334
12
neither single (837-MHz) nor combined (837- and 1950-MHz) RF modes altered both the cell 254
cycle distributions and the cell cycle regulatory proteins at SAR of 4 W/kg for 1 h of exposure 255
[33]. The cell cycle-related genes of HL-60 cells were downregulated when the cells were 256
exposed to a 2.45-GHz RF in a 2-h treatment [34]. However, the various RF parameters, such as 257
frequency and duration of stimulation, may lead to such inconsistent results. Therefore, the RF 258
frequency band in the low range appears to have great potential in accelerating cell cycle 259
progression. 260
The cell proliferation results show that RF may play a vital role in cell proliferation 261
enhancement. Numerous causes could induce increases in cell numbers. First, the 262
electromagnetic fields may directly affect the gene expressions related to cell proliferation in the 263
nucleus and, consequently, increase cell growth. Second, certain potential RF-sensitive receptors 264
distributed in the cell membrane are activated by electromagnetic field exposure. Cytoskeletons, 265
such as proteoglycan and F-actin, translate the signals to induce cell responses. Third, 266
electromagnetic fields can stimulate particular soluble-growth factor secretions in the culture 267
medium. These growth factors can possibly benefit cell proliferation. Finally, the final possibility 268
is that RF may cause perturbation of the culture medium, which could accelerate the exchange 269
and metabolism of ions and nutrition. However, additional experiments are required to 270
demonstrate the mechanisms of these potential pathways occurring either individually or in 271
relation to one another. 272
Other studies have shown that RF exposure upregulates cell proliferation, and these findings 273
are consistent with those of our study [35-37]. With exposure to a 72-GHz microwave in 274
continuous-wave (CW) mode, Candida albicans resulted in a 25% increase in cell growth rate 275
[36]. An increasing concentration in bacterial cultures, which were exposed to a 2.45-GHz CW 276
Articles in Press, J. Med. Biol. Eng. (Jan 30, 2013), doi: 10.5405/jmbe.1334
13
and a 3.10-GHz pulsed microwave radiation, also occurred [37]. Therefore, non-ionizing 277
exposure enhanced cell proliferation, which is consistent with this study. However, certain 278
studies have also reported that RF played a different role in cell proliferation [33,38,39]. The 279
proliferation of human lens epithelial cells (hLEC) remained unchanged with 1.8 GHz of RF 280
exposure [38]. However, V79 proliferation, which was exposed to a 935-MHz RF, was 281
downregulated [39]. Various characteristics in the RF and target cells might be the cause of these 282
conflicting results. 283
To determine how RF influences cell proliferation initially, c-fos and c-jun genes were 284
considered potential mediators and selected to determine the outcome of RF exposure. The 285
results show that RF enhanced c-fos and c-jun gene expressions. The c-fos, c-jun, and c-myc are 286
the family of the immediate early proto-oncogenes, which are mediated by mechanical signals 287
and may initiate cell growth [40,41]. The results show that both the immediate early gene 288
expressions and cell proliferation were stimulated by low-level RF. In addition, cell growth (24 h 289
after RF exposure) appeared to occur directly after gene expression (2 h after RF exposure). This 290
shows that cell proliferation is a downstream consequence of gene expression. However, the RF 291
mechanisms regulating cell proliferation through immediate early gene pathways are unclear. 292
Additional experiments are necessary to confirm the connections among these cell responses. 293
Gene expression alterations after RF exposure have been reported since the global system for 294
communication (GSM) became widespread. In 2002, the gene expression of cell cycle regulators, 295
mitogen-activated protein kinase 3, ERK activator kinase 3, and transforming growth 296
factor-TGF were activated by a 902.4-MHz RF on human skin fibroblasts [17]. Similarly, 297
an increase in c-jun transcript levels of PC12 cells caused by a 836.55-MHz RF exposure has 298
been observed [16]. The upregulation of inflammation gene expressions have also been 299
Articles in Press, J. Med. Biol. Eng. (Jan 30, 2013), doi: 10.5405/jmbe.1334
14
confirmed to be induced by a 27.12-MHz RF for 30-min exposures [42]. This shows that RF has 300
the potency to enhance the expression of specific genes. However, numerous studies using 301
various RF fields and cell types have discovered diverse effects on gene expression [43-46]. For 302
example, FOS expression was not significantly changed when C3H 10T1/2 cells were exposed to 303
RF fields of 847.74-836.55 MHz [45], the c-fos and c-jun mRNAs expressions were not affected 304
by 900-MHz electromagnetic field exposures [44], and no significant gene alterations were 305
observed in normal human glial cell lines using 2.45-GHz RF fields [43]. The RF effects from 306
different studies are inconclusive, and additional studies are required to distinguish the 307
bio-effects in clinical applications. 308
The enhancement of cell cycle progression, increases in cell proliferation, and induction of 309
c-fos and c-jun gene expression were expected to be affected by the thermal and non-thermal 310
effects of RF. Because the temperature differences of culture media among the sham and 311
exposure groups were less than 0.5 oC (Fig. 2), the non-thermal effect appears to be the main 312
cause of inducing an Hs68 biological response. Electromagnetic fields consist of electrical and 313
magnetic fields, which may induce different bio-effects. Alternative electrical fields of high 314
frequencies raise water temperature because of the friction of rapidly rotating dipolar molecules 315
in water. However, the temperature did not change during the 42-kHz RF exposure in this study. 316
Previous studies have shown that the electrical field did not alter cell concentration at 27 MHz 317
[37]. They have also shown that electrical fields with lower frequencies do not affect cell 318
viability. Therefore, it appears that magnetic fields may be the primary causes of cell response 319
induction. 320
An RF at 42 kHz demonstrated its effectiveness in enhancing DNA synthesis, cell 321
proliferation, and gene expression; additional experiments are necessary to prove the correlation 322
Articles in Press, J. Med. Biol. Eng. (Jan 30, 2013), doi: 10.5405/jmbe.1334
15
among cell cycle progression, cell number up-regulation, gene expressions, and the magnetic 323
field mechanisms that induce cell responses. Presently, the potential bio-effects of the 324
surrounding cells of skin tissue, such as the keratinocytes, blood cells, and lymphocytes, which 325
result from RF exposure, were unclear in this study. However, certain studies have shown that 326
RF has no alteration of lymphocyte proliferation [26,47], no apoptosis in peripheral blood 327
mononuclear [48], and no protein expression in MCF-7 [49]. Although these pieces of evidence 328
show that the RF did not play a role in cell fate alteration, the variety of bio-effects still depends 329
on different RF exposure systems. Therefore, the bio-effects of surrounding cells must be 330
investigated in future studies to avoid abnormal responses and maintain physiological 331
homeostasis. In addition, the criteria of RF treatments are crucial for future in vitro and in vivo 332
applications. 333
5. Conclusion 334
We confirmed the cell response of Hs68 exposed to a 42-kHz RF at various intensities. The 335
results show that the portions of the DNA synthesis phases of the cell cycle, cell number, and 336
c-fos and c-jun gene expressions increased significantly when the cells were exposed to RF for 337
30 min. We showed that RF might induce c-fos and c-jun gene expressions, resulting in cell 338
cycle progression and an increase in cell numbers. Additional studies are required to quantify the 339
interactions between cell responses and RF exposure animal models to determine whether these 340
effects may play an essential role in regulating wound healing. 341
342
Acknowledgments 343
The authors acknowledge the financial support of this work was from the National Science 344
Council of Taiwan under grants NSC 95-2221-E-033-009. 345
Articles in Press, J. Med. Biol. Eng. (Jan 30, 2013), doi: 10.5405/jmbe.1334
16
References 346
[1] A. J. Singer and R. A. F. Clark, Cutaneous wound healing, N. Engl. J. Med., 341: 738-746, 347
1999. 348
[2] W. J. Jeffcoate, P. Price, and K. G. Harding, Wound healing and treatments for people with 349
diabetic foot ulcers, Diabetes-Metab. Res. Rev., 20: S78-S89, 2004. 350
[3] M. A. Loots, E. N. Lamme, J. Zeegelaar, J. R. Mekkes, J. D. Bos and E. Middelkoop, 351
Differences in cellular infiltrate and extracellular matrix of chronic diabetic and venous ulcers 352
versus acute wounds, J. Invest. Dermatol., 111: 850-857, 1998. 353
[4] P. P. Gogia, Physical therapy modalities for wound management, Ostomy Wound Manag., 354
42: 46-48, 50-52, 54, 1996. 355
[5] G. J. Bourguignon and L. Y. W. Bourguignon, Electric stimulation of protein and DNA 356
synthesis in human fibroblasts, Faseb J., 1: 398-402, 1987. 357
[6] P. E. Houghton, C. B. Kincaid, M. Lovell, K. E. Campbell, D. H. Keast, M. G. Woodbury 358
and K. A. Harris, Effect of electrical stimulation on chronic leg ulcer size and appearance, 359
Phys. Ther., 83: 17-28, 2003. 360
[7] L. C. Kloth and J. A. Feedar, Acceleration of wound healing with high voltage, monophasic, 361
pulsed current, Phys. Ther., 68: 503-508, 1988. 362
[8] L. C. Kloth, Electrical stimulation for wound healing: a review of evidence from in vitro 363
studies, animal experiments, and clinical trials, Int. J. Low. Extrem. Wounds, 4: 23-44, 2005. 364
[9] S. J. Kavros, D. A. Liedl, A. J. Boon, J. L Miller, J. A. Hobbs and K. L. Andrews, Expedited 365
wound healing with noncontact, low-frequency ultrasound therapy in chronic wounds: a 366
retrospective analysis, Adv. Skin Wound Care, 21: 416-423, 2008. 367
Articles in Press, J. Med. Biol. Eng. (Jan 30, 2013), doi: 10.5405/jmbe.1334
17
[10] S. Zhou, A. Schmelz, T. Seufferlein, Y. Li, J. Zhao and M. G. Bachem, Molecular 368
mechanisms of low intensity pulsed ultrasound in human skin fibroblasts, J. Biol. Chem., 279: 369
54463-54469, 2004. 370
[11] A. Ramirez, J. A. Schwane, C. McFarland and B. Starcher, The effect of ultrasound on 371
collagen synthesis and fibroblasts proliferation in vitro, Med. Sci. Sports Exerc., 29: 326-332, 372
1997. 373
[12] X. Gao and D. Xing, Molecular mechanisms of cell proliferation induced by low power 374
laser irradiation, J. Biomed. Sci., 16: 4-20, 2009. 375
[13] N. S. Sadick, Update on non-ablative light therapy for rejuvenation: a review, Lasers Surg. 376
Med., 32: 120-128, 2003. 377
[14] L. C. Kloth and A. A. Pilla, Electromagnetic stimulation for wound healing, in J. M. 378
McCulloch and L. C. Kloth (Ed.), Would Healing: Evidence Based Management, Philadelphia: F. 379
A. Davis Company, 271-311, 2002. 380
[15] L. C. Kloth, J. E. Berman, C. H. Sutton, D. C. Jeutter, A. A. Pilla and M. E. Epner, Effect 381
of pulsed radio frequency stimulation on wound healing: a double-blind pilot clinical study, in: 382
F. Bersani (Ed.), Electricity and Magnetism in Biology and Medicine, New York: Plenum, 383
875-878, 1999. 384
[16] O. I. Ivaschuk, R. A. Jones, T. Ishida-Jones, W. Haggren, W. R. Adey and J. L. Phillips, 385
Exposure of nerve growth factor-treated PC12 rat pheochromocytoma cells to a modulated 386
radiofrequency field at 836.55 MHz: effects on c-jun and c-fos expression, Bioelectromagnetics, 387
18: 223-229, 1997. 388
[17] S. Pacini, M. Ruggiero, I. Sardi, S. Aterini, F. Gulisano and M. Gulisano, Exposure to 389
global system for mobile communication (GSM) cellular phone radiofrequency alters gene 390
Articles in Press, J. Med. Biol. Eng. (Jan 30, 2013), doi: 10.5405/jmbe.1334
18
expression, proliferation, and morphology of human skin fibroblasts, Oncol. Res., 13: 19-24, 391
2002. 392
[18] R. Paulraj and J. Behari, Radio frequency radiation effects on protein kinase C activity in 393
rats' brain, Mutat. Res.-Fundam. Mol. Mech. Mutagen., 545: 127-130, 2004. 394
[19] R. Paulraj, J. Behari and A. R. Rao, Effect of amplitude modulated RF radiation on 395
calcium ion efflux and ODC activity in chronically exposed rat brain, Indian J. Biochem. 396
Biophys., 36: 337-340, 1999. 397
[20] S. D. Shapiro, Y. Eros, Y. Abrahami and A. Leviav, Evaluation of safety and efficacy of 398
the TriPollar technology for treatment of wrinkles, Lasers Surg. Med., 44: 453-458, 2012. 399
[21] B. S. Bloom, J. Emer and D. J. Goldberg, Assessment of safety and efficacy of a bipolar 400
fractionated radiofrequency device in the treatment of photodamaged skin, J. Cosmet. Laser 401
Ther., 14: 208-211, 2012. 402
[22] N. Krueger, H. Levy and N. S. Sadick, Safety and efficacy of a new device combining 403
radiofrequency and low-frequency pulsed electromagnetic fields for the treatment of facial 404
rhytides, J. Drugs Dermatol., 11: 1306-1309, 2012. 405
[23] S. Bourthoumieu, F. Terro, P. Leveque, A. Collin, V. Joubert and C. Yardin, Aneuploidy 406
studies in human cells exposed in vitro to GSM-900 MHz radiofrequency radiation using FISH, 407
Int. J. Radiat. Biol., 87: 400-408, 2011. 408
[24] I. Pavicic and I. Trosic, Impact of 864 MHz or 935 MHz radiofrequency microwave 409
radiation on the basic growth parameters of V79 cell line, Acta Biol. Hung., 59: 67-76, 2008. 410
[25] A. Sannino, G. Di Costanzo, F. Brescia, M. Sarti, O. Zeni, J. Juutilainen and M. R. Scarfi, 411
Human fibroblasts and 900 MHz radiofrequency radiation: evaluation of DNA damage after 412
Articles in Press, J. Med. Biol. Eng. (Jan 30, 2013), doi: 10.5405/jmbe.1334
19
exposure and co-exposure to 3-chloro-4-(dichloromethyl)-5-hydroxy-2(5h)-furanone (MX), 413
Radiat. Res., 171: 743-751, 2009. 414
[26] C. Schwarz, E. Kratochvil, A. Pilger, N. Kuster, F. Adlkofer and H. W. Rudiger, 415
Radiofrequency electromagnetic fields (UMTS, 1,950 MHz) induce genotoxic effects in vitro in 416
human fibroblasts but not in lymphocytes, Int. Arch. Occup. Environ. Health., 81: 755-767, 417
2008. 418
[27] D. Y. Zhang, Z. P. Xu, H. Chiang, D. Q. Lu and Q. L. Zeng, Effects of GSM 1800 MHz 419
radiofrequency electromagnetic fields on DNA damage in Chinese hamster lung cells, 420
Zhonghua Yu Fang Yi Xue Za Zhi., 40: 149-152, 2006. 421
[28] Cell Signalling Biology: Chap9 Cell cycle and proliferation, 2009. Available: 422
http://www.biochemj.org/csb/ 423
[29] G. II. Broughton, J. E. Janis and C. E. Attinger, Wound healing: an overview, Plast. 424
Reconstr. Surg., 117: 1e-S-32e-S, 2006. 425
[30] T. Samuel, H. O. Weber and J. O. Funk, Linking DNA damage to cell cycle checkpoints, 426
Cell Cycle, 1: 162-168, 2002. 427
[31] A. J. Obaya and J. M. Sedivy, Regulation of cyclin-Cdk activity in mammalian cells, Cell. 428
Mol. Life Sci., 59: 126-142, 2002. 429
[32] G. Cao, L. M. Liu and S. F. Cleary, Cell cycle alterations induced by isothermal 27 MHz 430
radiofrequency radiation, Bioelectrochem and Bioenerg., 37: 131-140, 1995. 431
[33] K. Y. Lee, B. C. Kim, N. K. Han, Y. S. Lee, T. Kim, J. H. Yun, N. Kim, J. K. Pack and J. S. 432
Lee, Effects of Combined radiofrequency radiation exposure on the cell cycle and its regulatory 433
proteins, Bioelectromagnetics., 32: 169-178, 2011. 434
Articles in Press, J. Med. Biol. Eng. (Jan 30, 2013), doi: 10.5405/jmbe.1334
20
[34] S. Lee, D. Johnson, K. Dunbar, H. Dong, X. Ge, Y. C. Kim, C. Wing, N. Jayathilaka, N. 435
Emmanuel, C. Q. Zhou, H. L. Gerber, C. C. Tseng and S. M. Wang, 2.45 GHz radiofrequency 436
fields alter gene expression in cultured human cells, FEBS Lett., 579: 4829-4836, 2005. 437
[35] S. Velizarov, P. Raskmark and S. Kwee, The effects of radiofrequency fields on cell 438
proliferation are non-thermal, Bioelectrochem. Bioenerg., 48: 177-180, 1999. 439
[36] L. Dardanonl, M. V. Torregrossa and L. Zanforlin, Millimeter-wave effects on Candida 440
Albicans cells, Electromagn. Biol. Med., 4: 171-176, 1985. 441
[37] Y. Hamnerius, A. Rasmuson and B. Rasmuson, Biological effects of high-frequency 442
electromagnetic fields on Salmonella typhimurium and Drosophila melanogaster, 443
Bioelectromagnetics, 6: 405-414, 1985. 444
[38] L. Sun, K. Yao, K. Wang, D. Lu, H. Hu, X. Gao, B. Wang, W. Zheng, J. Lou and W. Wu, 445
Effects of 1.8 GHz radiofrequency field on DNA damage and expression of heat shock protein 446
70 in human lens epithelial cells, Mutat. Res., 602: 135-142, 2006. 447
[39] I. Troi and I. Pavii, Disturbance of cell proliferation in response to mobile phone 448
frequency radiation, Arh. Hig. Rada. Toksikol., 60: 109-115, 2009. 449
[40] H. Schunkert, L. Jahn, S. Izumo, C. S. Apstein and B. H. Lorell, Localization and 450
regulation of c-fos and c-jun protooncogene induction by systolic wall stress in normal and 451
hypertrophied rat hearts, Proc. Natl. Acad. Sci. USA, 88: 11480-11484, 1991. 452
[41] I. Komuro, T. Kaida, Y. Shibazaki, M. Kurahayashi, Y. Katoh, E. Hoh, F. Takaku and Y. 453
Yazaki, Stretching cardiac myocytes stimulates proto-oncogene expression, J. Blot. Chem., 454
265: 3595-3598, 1990. 455
[42] J. Moffett, N. J. Kubat, N. E. Griffin, M. C. Ritz and F. R. George, Pulsed radio frequency 456
energy field treatment of cells in culture results in increased expression of genes involved in the 457
Articles in Press, J. Med. Biol. Eng. (Jan 30, 2013), doi: 10.5405/jmbe.1334
21
inflammation phase of lower extremity diabetic wound healing, J. Diabetes foot Complications, 458
3: 30-39, 2011. 459
[43] T. Sakurai, T. Kiyokawa, E. Narita, Y. Suzuki, M. Taki and J. Miyakoshi, Analysis of gene 460
expression in a human-derived glial cell line exposed to 2.45 GHz continuous radiofrequency 461
electromagnetic fields, J. Radiat. Res., 52: 185-192, 2011. 462
[44] G. D. Vecchio, A. Giuliani, M. Fernandez, P. Mesirca, F. Bersani, R. Pinto, L. Ardoino, G. 463
A. Lovisolo, L. Giardino and L. Calza, Continuous exposure to 900 MHz GSM-modulated 464
EMF alters morphological maturation of neural cells, Neurosci. Lett., 455: 173-177, 2009. 465
[45] T. D. Whitehead, B. H. Brownstein, J. J. Parry, D. Thompson, B. A. Cha, E. G. Moros, B. E. 466
Rogers and J. L. Roti Rotil, Expression of the proto-oncogene Fos after exposure to 467
radiofrequency radiation relevant to wireless communications, Radiat. Res., 164: 420-430, 468
2005. 469
[46] Q. Zeng, G. Chen, Y. Weng, L. Wang, H. Chiang, D. Lu and Z. Xu, Effects of global 470
system for mobile communications 1800 MHz radiofrequency electromagnetic fields on gene 471
and protein expression in MCF-7 cells, Proteomics., 6: 4732-4738, 2006. 472
[47] M. R. Scarf, A. M. Fresegna, P. Villani, R. Pinto, C. Marino, M. Sarti, P. Altavista, A. 473
Sannino and G. A. Lovisolo, Exposure to radiofrequency radiation (900 MHz, GSM signal) 474
does not affect micronucleus frequency and cell proliferation in human peripheral blood 475
lymphocytes: an interlaboratory study, Radiat. Res., 165: 655-663, 2006. 476
[48] M. Capri, E. Scarcella, E. Bianchi, C. Fumelli, P. Mesirca, C. Agostini, D. Remondini, J. 477
Schuderer, N. Kuster, C. Franceschi and F. Bersani, 1800MHz radiofrequency (mobile phones, 478
different Global System for Mobile communication modulations) does not affect apoptosis and 479
Articles in Press, J. Med. Biol. Eng. (Jan 30, 2013), doi: 10.5405/jmbe.1334
22
heat shock protein 70 level in peripheral blood mononuclear cells from young and old donors, 480
Int. J. Radiat. Biol., 80: 389-397, 2004. 481
[49] K. B. Kimi, H. O. Byun, N. K. Han, Y. G. Ko, H. D. Choi, N. Kim, J. K. Pack and J. S. Lee, 482
Two-dimensional electrophoretic analysis of radio frequency radiation-exposed MCF7 breast 483
cancer cells, J. Radiat. Res., 51: 205-213, 2010. 484
485
486
487
488
489
490
491
492
493
494
495
496
497
498
499
500
501
502
Articles in Press, J. Med. Biol. Eng. (Jan 30, 2013), doi: 10.5405/jmbe.1334
23
Figure Legends 503
Figure 1. Apparatus for RF exposure to cells. An electromagnetic field was produced by the coil, 504
through which the current passed. A plate was placed above the coil to be exposed. All of the 505
materials were in a sealed Styrofoam box, and the temperature was maintained at 37 oC during 506
stimulation. 507
508
Figure 2. Average temperature differences in each group during 0, 150, 250, 350, and 450 A/cm2 509
RF exposure for 30 min. 510
511
Figure 3. S Phase portion in cell cycle progression. DNA was stained by PI and detected using 512
flow cytometry. Values are given as the mean of 3 samples standard deviation. Statistically 513
significant values are designated as *, p < 0.05; **, p < 0.005; ***, p < 0.001. 514
515
Figure 4. Cell viability of Hs68 exposed to a 42 kHz-RF at different electromagnetic fields with 516
time dependence. Xsn: the cell number under RF treated at Day n; Xcn: the cell number of 517
control group at Day n; Xs0: the cell number under RF treated at Day 0; Xc0: the cell number of 518
RF control groups at Day 0. Values are given as the mean of 3 samples standard deviation. 519
Statistically significant values are designated as *, p < 0.05; **, p < 0.005; ***, p < 0.001. 520
521
Figure 5. Gene expressions of Hs 68 exposed to RF. RNAs were extracted using a TRIzol 522
reagent, and the c-fos and c-jun expressions were analyzed using RT-PCR. (a) Expressions of 523
c-fos and c-jun genes observed by electrophoresis in 1.5% agarose gel, (b) and (c) quantified 524
expressions related to untreated cells and GAPDH. 525
Articles in Press, J. Med. Biol. Eng. (Jan 30, 2013), doi: 10.5405/jmbe.1334
24
Figures 526
527
528
529
530
531
532
533
534
535
536
Articles in Press, J. Med. Biol. Eng. (Jan 30, 2013), doi: 10.5405/jmbe.1334
25
537
538
539
540
541
542
543
544
545
546
547
Articles in Press, J. Med. Biol. Eng. (Jan 30, 2013), doi: 10.5405/jmbe.1334
26
548
549
550
551
552
553
554
555
556
557
558
559
Articles in Press, J. Med. Biol. Eng. (Jan 30, 2013), doi: 10.5405/jmbe.1334
27
560
561
562
563
564
565
566
567
568
569
570
571
Articles in Press, J. Med. Biol. Eng. (Jan 30, 2013), doi: 10.5405/jmbe.1334
28
572
573
574
575
576
577
578
579