Properties of catalytic, linker and chitin-binding domains of insect … · 2005. 10. 28. ·...

Insect Biochemistry and Molecular Biology 33 (2003) 631–648www.elsevier.com/locate/ibmb

Properties of catalytic, linker and chitin-binding domains of insectchitinase

Yasuyuki Arakanea, Qingsong Zhua, Masahiro Matsumiyab,Subbaratnam Muthukrishnana, Karl J. Kramerc,∗

a Department of Biochemistry, Kansas State University, Manhattan, KS 66506, USAb College of Bioresource Sciences, Nihon University, Fujisawa, Kanagawa 252-8510, Japan

c Grain Marketing and Production Research Center, ARS-USDA, 1515 College Avenue, Manhattan, KS 66502, USA

Received 22 January 2003; received in revised form 13 March 2003; accepted 14 March 2003

Abstract

Manduca sexta (tobacco hornworm) chitinase is a glycoprotein that consists of an N-terminal catalytic domain, a Ser/Thr-richlinker region, and a C-terminal chitin-binding domain. To delineate the properties of these domains, we have generated truncatedforms of chitinase, which were expressed in insect cells using baculovirus vectors. Three additional recombinant proteins composedof the catalytic domain fused with one or two insect or plant chitin-binding domains (CBDs) were also generated and characterized.The catalytic and chitin-binding activities are independent of each other because each activity is functional separately. When attachedto the catalytic domain, the CBD enhanced activity toward the insoluble polymer but not the soluble chitin oligosaccharide primarilythrough an effect on theKm for the former substrate. The linker region, which connects the two domains, facilitates secretion fromthe cell and helps to stabilize the enzyme in the presence of gut proteolytic enzymes. The linker region is extensively modified byO-glycosylation and the catalytic domain is moderatelyN-glycosylated. Immunological studies indicated that the linker region,along with elements of the CBD, is a major immunogenic epitope. The results support the hypothesis that the domain structure ofinsect chitinase evolved for efficient degradation of the insoluble polysaccharide to soluble oligosaccharides during the molting pro-cess.Published by Elsevier Science Ltd.

Keywords: Insect; Tobacco hornworm; Chitin; Hydrolase; Domain; Carbohydrate; Antibody; Enzyme; Chitinase; Baculovirus; Linker; Binding;Proteolysis; Kinetic analysis; Glycosylation; Circular dichroism; Structure-function

1. Introduction

Chitinolytic enzymes are now being used for biotech-nological applications in agriculture and health care

∗ Corresponding author. Tel.:+1-785-776-2711; fax:+1-785-537-5584.

E-mail address: [email protected] (K.J. Kramer).Abbreviations: CBD, chitin-binding domain; GlcNAc; 2-acetamido-2-deoxyglucopyranoside; GalNAc, 2-acetamido-2-deoxygalactopyrano-side; PVDF, polyvinylidene difluoride; SDS-PAGE, sodium dodecylsulfate-polyacrylamide gel electrophoresis; BSA, bovine serum albu-min; DEAE, diethylaminoethyl; Tris, tris(hydroxylmethyl)amino-methane; PCR, polymerase chain reaction; Chi535, full-length enzyme;Chi376, Chi386, Chi407 and Chi477: proteins consisting of aminoacids 1–376, 1–386, 1–407 and 1–477, respectively; ChiLH, C-ter-minally His-tagged protein consisting of amino acids 377–535; ChiCH,C-terminally His-tagged protein consisting of amino acids 478–535;ChiLCH, C-terminally His-tagged protein consisting of amino acids

0965-1748/03/$ - see front matter Published by Elsevier Science Ltd.doi:10.1016/S0965-1748(03)00049-3

(Patil et al., 2000). Chitinases belonging to family 18glycosylhydrolases (Coutinho and Henrissat, 1999) havebeen isolated from a wide variety of sources includingbacteria, yeasts and other fungi, nematodes, arthropodsand vertebrates such as humans, mice and chickens(Nagono et al., 2002; Suzuki et al., 2002). They areamong a group of proteins that insects use to digest thestructural polysaccharide chitin in their exoskeletons andgut linings during the molting process (Kramer et al.,1985; Kramer and Koga, 1986; Kramer and Muthukrish-

377–477; ChiMCBD, protein consisting of amino acids 1–386 fusedwith amino acids 478–535; Chi(MCBD)2, protein consisting of aminoacids 1–386 fused with two tandem repeats of amino acids 478–535;ChiRCBD, protein consisting of amino acids 1–386 fused with the ricechitinase CBD. The numbering refers to positions of the amino acidsin the mature enzyme

632 Y. Arakane et al. / Insect Biochemistry and Molecular Biology 33 (2003) 631–648

nan, 1997; Fukamizo, 2000). In plants, these enzymesare generally believed to serve protective functions,although the exact mechanism of such protection isunclear (Kramer et al., 1997; Ding et al., 1998; Gooday,1999). We are interested in using a family 18 insect chi-tinase as a host plant resistance factor in transgenicplants and in improving the catalytic efficiency and stab-ility of this enzyme so that its pesticidal activity wouldbe enhanced. The enzyme of interest is the molting fluidchitinase from Manduca sexta (tobacco hornworm, Gen-Bank accession number, AAC04924), which is a 535-amino acid-long glycoprotein (Chi535) (Koga et al.,1983a; Kramer et al., 1993; Choi et al., 1997; Kramerand Muthukrishnan, 1997).

Besides the cDNA of a chitinase from the tobaccohornworm (Kramer et al., 1993), other insect chitinasecDNAs have been cloned from the silkworm (Kim et al.,1998), the fall webworm (Kim et al., 1998), the commoncutworm (Shinoda et al., 2001), the yellow mealworm(Royer et al., 2002), and the spruce budworm (Zheng etal., 2002). One of the structural features observed inmany of these insect chitinases is a multidomain archi-tecture that includes a signal peptide, one or more cata-lytic domains, cysteine-rich chitin-binding domains(CBD), fibronectin-like domains, and serine/threonine(S/T)-rich linker domains that are generally glycosylated(Tellam, 1996; Henrissat, 1999; Suzuki et al., 1999). Inprior structure-function studies of tobacco hornwormchitinase, we investigated the properties of recombinantenzymes with substitutions of specific amino acids(aspartic acids 142 and 144, tryptophan 145 and glu-tamic acid 146) in the active site and also some C-ter-minal truncated derivatives to help identify residues anddomains required for catalysis (Huang et al., 2000; Zhuet al., 2001; Lu et al., 2002; Zhang et al., 2002). Themature hornworm enzyme also has a modular structure,an N-terminal catalytic domain of about 376 amino acidsand a C-terminal insoluble substrate (chitin)-bindingdomain (CBD) of approximately 58 amino acids, whichare connected by an interdomain Ser/Thr-rich O-glycos-ylated linker of approximately 100 amino acid residuesin length (Fig. 1). A similar domain structure also occursin other insect chitinases, including those of the silk-worm, Bombyx mori (Kim et al., 1998; Mikitani et al.,2000; Abdel-Banat and Koga, 2001), fall webworm,Hyphantria cunea (Kim et al., 1998), common cutworm,Spodoptera litura (Shinoda et al., 2001), and the sprucebudworm, Choristoneura fumiferana (Zheng et al.,2002).

The interaction of insect chitinases with insoluble chi-tin in the exoskeleton and peritrophic matrix is believedto be a dynamic process that involves adsorption via theCBD, hydrolysis, desorption, and positioning of the cata-lytic domain on the surface of the substrate. This degra-dative process apparently requires a coordinated actionof both domains by a mechanism that is not well under-

stood. In addition to the catalytic events, the mechanismof binding of the enzyme onto the heterogeneous surfaceof native chitin is poorly characterized. In this study, weinvestigated some of the properties of recombinant formsof these domains and the linker region, and have alsocharacterized three other recombinant proteins composedof the catalytic domain fused with one or two CBDs inorder to better understand the contributions of the indi-vidual domains to the catalytic and substrate-bindingprocesses.

2. Materials and methods

2.1. Construction of recombinant baculovirusescontaining truncated, extended and individual domainforms of the M. sexta chitinase gene

Every expression construct was designed to have asignal peptide at the N-terminus. Their signal peptidesallowed the expressed proteins to be secreted into themedium except for those with a deletion of the Ser/Thr-rich linker domain. Primers were synthesized at theBiotech Core Facility, Kansas State University. Primersused for the amplification of specific domain(s) areshown in Table 1. All DNA fragments with the excep-tion of CBD2 were amplified by PCR using M. sextachitinase cDNA clone no. 10 as template. PCR reactionswere conducted in a final volume of 50 µl containing 10ng plasmid template, 0.4 µM of the primers, 0.2 mMdNTPs, 1× pfu buffer (20 mM Tris–HCl, pH 8, 2 mMMgSO4, 10 mM KCl, 10 mM (NH4)2SO4, 0.1% TritonX-100 and 0.01% BSA), and 2.5 units of pfu polymeraseusing the PCR Gene Mate instrument (ISC Bio Express)as follows: denaturation at 94°C for 1 min, annealing at60°C for 1 min and polymerization at 72°C for 1.5 minand 25 cycles. The PCR amplified fragments were pur-ified from a low melting agarose gel after separation byelectrophoresis, digested with EcoRI and PstI, and lig-ated to similarly digested pVL1393 DNA. The desiredcombination of DNA fragments and the linearizedpVL1393 vector DNA were ligated under standard con-ditions. The ligation mixtures were used to transformcompetent cells of E. coli JM 109 and recombinantclones were identified by standard methods. Table 1shows the different constructs utilized for expression ininsect cells of truncated and extended forms of M.sexta chitinase.

Recombinant baculoviruses were obtained by co-transfection of Sf21 cells with the appropriate transferplasmid DNAs (pVL1393 constructs described above)and BaculoGold DNA from Pharmingen (San Diego,CA) (Gopalakrishnan et al., 1995). BaculoGold DNA isa modified baculoviral DNA (AcMNPV) with a lethaldeletion. Recombination of the transfer plasmidpVL1393 DNA with BaculoGold DNA can rescue the

633Y. Arakane et al. / Insect Biochemistry and Molecular Biology 33 (2003) 631–648

Table 1Primers used for the amplification of DNAs for specific domains of insect chitinase

Construct/ Domains amplified Forward primer (5�–3�)a Reverse primer (5�–3�)a

fragment

Chi386 LP/CAT+10 TCTGAATTCAAGATGCGAC TCTCTGCAGATTATGTATGAGGAGGCGChi396 LP/CAT+20 TCTGAATTCAAGATGCGAC TCTCTGCAGTTAGGCCC ATTCAGGAGMCBD M. sexta CBD TCTAAGCTTATCTGCAACTCAGACCAA TCTCTGCAGTTAGGGTTGTTGACATTCM(CBD)2 M. sexta CBD TCTATGCATATCTGCAACTCAGACC TCTCTGCAGTTAGGGTTGTTGACATTCRCBD Rice CBD TCTAAGCTTGAGCAGTGCGGCAGC TCTATGCATTTAGGGCGGGGTCLH LP/His6 TCTAAGCTTAGCTCTTACACAAGTGCCG TCTCTGCAGTTAATGATGATGATG

ATGATGTTCGCTACCATCGACCH CBD/His6 TCTAAGCTTATCTGCAAC TCAGAC CAA TCTCTGCAG TTAATGATGATGATG

ATGATGGGGTTGTTGACATTCLCH Linker/MCBD/His6 TCTAAGCTTATCTGCAAC TCAGAC CAA TCTCTGCAGTTAATGATGATGATG

ATGATGGGGTTGTTGACATTC

a Restriction enzyme sites are underlined. The translation start codon (ATG) and the complement of the translation stop codon (TTA) are notedin bold.

lethal deletion as a result of integration of the transferplasmid segments into AcMNPV DNA. Recombinantviruses were amplified 3–4 rounds in Sf 21 cells toobtain high titer viruses (about 1 × 108 pfu /ml). Theplaque assay method was used to check the virus titer.

Viral DNA was prepared from the high titer virus byphenol/chloroform extraction. PCR was used to amplifythe construct using primers that were designed to ampl-ify the entire chitinase-coding region. Fragments derivedfrom the recombinant viral DNA had the same size asthose obtained from the corresponding vector plasmids.Each viral PCR product was purified from a low meltingagarose gel and analyzed by DNA sequencing usingappropriate forward and reverse primers. The sequencingresults confirmed that all fragments were ligated cor-rectly as designed and encoded the desired protein (datanot shown).

2.2. Expression of wild-type, truncated and extendedforms in baculovirus-insect cell line gene expressionsystem

Baculovirus-mediated recombinant chitinase geneexpression was done by following the method of Zhu etal. (2001) using Hi-5 insect cells cultured in EX-CELL405 serum-free medium containing l-glutamine (JRHBioscience, Lenexa, KS) in 225 cm2 flasks. Culturemedia were collected 3 d after incubation with recombi-nant viruses and clarified by centrifugation at 10,000 gfor 10 min at 4°C. Each construct containing the signalpeptide was predicted to result in secretion of the corre-sponding protein into the medium. Monolayers of Hi-5cells were used as host cells to express the proteins enco-ded in the recombinant baculoviruses as described inSection 2. Previous results showed that the Hi-5 cell linehad a higher level of expression than other cell lines(Gopalakrishnan et al., 1995). Another advantage was

that the Hi-5 cell line could be cultured in serum-freemedium, which facilitates protein purification. All of theproteins were secreted into the medium by baculovirus-infected Hi-5 cells except for ChiLH, which was retainedinside the Hi-5 cells for unknown reasons.

2.3. Purification of chitinases

The supernatants collected by centrifugation of culturemedia were dialyzed against 20 mM sodium phosphatebuffer, pH 8 for wild-type and truncated forms or against20 mM Tris–HCl buffer, pH 9 for the extended forms.The dialyzed samples were subjected to anion-exchangechromatography on a DEAE-Sepharose column (2 × 7cm, Pharmacia), which was previously equilibrated withthe same buffer used for dialysis. The proteins wereeluted using a linear gradient of NaCl from 0 to 0.4 Min the same buffer at a flow rate of 0.8 ml/min. Fractionsof 1.8 ml were collected and analyzed by SDS-PAGE.Fractions containing the protein of interest were pooledand dialyzed against 10 mM sodium phosphate buffer,pH 8, and then subjected to chromatography on ahydroxylapatite column (1 × 8 cm, Bio-Rad) equilibratedwith 10 mM sodium phosphate buffer, pH 8. Protein waseluted with a linear gradient of sodium phosphate buffer,pH 8, from 10 to 300 mM, after washing the columnwith 10 mM sodium phosphate buffer, pH 8. Fractionscontaining the protein of interest were pooled, desaltedand concentrated by ultrafiltration.

The culture media supernatants containing eitherChiLCH or ChiCH proteins were passed through a Ni-NTA agarose column and the bound proteins with C-terminal His-tags were eluted with an imidazole gradi-ent. ChiLCH was eluted with a gradient of 10–50 mMimidazole, as a rather heterogeneous mixture of proteinswith apparent molecular weights ranging from 21 to 46kDa. ChiCH was eluted with an imidazole gradient of


50–250 mM. ChiCH was homogeneous and had anapparent size of 13 kDa.

ChiLH was not secreted into the medium. Therefore,the Hi-5 cell pellet containing the ChiLH protein wascollected 72 h after virus infection and used as the start-ing material for purification of this protein. The cellswere lysed by sonication for 2 mm at 40 W and 20 kHz.The lysate was centrifuged at 10,000 g for 10 mm at4°C. The supernatant that contained the ChiLH proteinwas passed through a Ni-NTA agarose column. ChiLHwas eluted by buffer containing 250 mM imidazole andhad an apparent molecular weight of 20 kDa.

2.4. Protein determination

Absorbance at 280 nm was measured to monitor pro-teins during chromatographic separations. Protein con-centration was measured using the bicinchoninic acidassay reagent (Pierce, Rockford, IL) using BSA as thestandard protein.

2.5. Molecular weight and N-terminal sequencedeterminations

Protein samples obtained from hydroxylapatite col-umn chromatography were used for molecular massdetermination by laser desorption mass spectrometry andfor N-terminal sequence analysis at the BiotechnologyCore Facility, Kansas State University, Manhattan, KS.The proteins were resolved using SDS-PAGE and trans-ferred onto a PVDF membrane. Coomassie BrilliantBlue R-250 staining was used to locate the proteinbands, which were cut out from the membrane and sub-jected to N-terminal sequence analysis by automatedEdman degradation using an Applied BiosystemSequencer.

2.6. Carbohydrate analysis

Glycosyl composition analysis was performed at theComplex Carbohydrate Research Center, University ofGeorgia, Athens, GA, by combined gaschromatography/mass spectrometry (GC/MS) of the per-O-trimethylsilyl (TMS) derivatives of the monosacchar-ide methyl glycosides produced from the samples byacidic methanolysis. Methyl glycosides were first pre-pared from dried samples by methanolysis in 1 M HClin methanol at 80°C for 18–22 h, followed by re-N-acetylation with acetic anhydride in pyridine/methanolfor detection of amino sugars. The samples were thenper-O-trimethylsilylated by treatment with Tri-Silreagent (Pierce Chem., Rockford, IL) at 80 °C for 0.5 h(York et al., 1985). GC/MS analysis of the TMS methylglycosides was performed on an HP 5890 GC equippedwith a Supelco EB 1 fused silica capillary column inter-faced to an HP 5970 MSD detector.

Glycosidases were also used for enzymatic deglycos-ylation to digest carbohydrate side chains of the polypep-tide backbone of the recombinant glycoproteins using theGlycopro deglycosylation kit from Prozyme (San Lean-dro, CA). PNGase F (Glycopro GE41 PNGase) was usedto remove intact N-linked oligosaccharides, whereas amixture of O-glycosidases was used to remove O-linkedsugars (Tarentino and Plummer, 1994). Because therewas no single enzyme available for removing the intactO-linked oligosaccharides, a mixture of exoglycosidasesincluding sialidase A , β(1-4) galactosidase, N-acetyl-glucosaminidase and endo-O-glycosidase (ProZyme,Inc., San Leandro, CA) was used to remove both simpleand complex O-linked carbohydrates. First, β(1-4)galactosidase, glucosaminidase, sialidase A were usedto remove side chain sugars until the Gal β(1-3)GalNAccore remained attached to the serine or threonine sidechain. β(1-4) Galactosidase released any β(l-4) linked,non-reducing terminal galactose residues from complexcarbohydrates and glycoproteins. Glucosaminidasecleaved any non-reducing terminal β-linked N-acetylglu-cosamine residues. Sialidase A removed any N-acetyl-neuraminic acid residues. Secondly, endo-O-glycosidaseremoved any core Gal β(1-3)GalNAc residues from theserine or threonine residues.

2.7. Immunoblotting

Immunoblotting was done by the method of Koga etal. (1992). After electrophoresis, the proteins in the gelwere transblotted to a PVDF membrane (Millipore Co.,Bedford, MA) using a semi-dry blotting apparatus (Bio-Rad) at 2.5 mA/cm2 for 1 h in Tris–glycine–methanolbuffer, pH 7.5. Two separate rabbit anti-sera that wereraised against either purified Chi535 (wild-type) or thetruncated form, Chi386, were used as the primary anti-bodies.

2.8. Kinetic analysis of truncated and extended forms

Previously, we had utilized pH 6 for kinetic analyseswhen using CM-Chitin-RBV as the substrate (Zhu et al.,2001; Zhang et al., 2002). However, because that pHwas not intermediate to the pH of the locations, whereinsect chitinase is physiologically functional, i.e. themolting fluid (pH ~7) and midgut lumen (pH ~10), wechanged the pH of the CM-Chitin-RBV and colloidalchitin assays to pH 9. Also, for the trisaccharide sub-strate, previously, a three parameter substrate inhibitionmodel was used to calculate the kinetic parameters overa substrate concentration range of 0–50 µM. However,for this study, we used the Lineweaver–Burk modelinstead and a substrate concentration range of 20–200µM.


2.8.1. CM-Chitin-RBV as the substrateKinetic experiments were done on the enzymatic

hydrolysis of CM-Chitin-RBV (Loewe BiochemicaGmbH, Sauerlach, Germany) in 50 mM Tris–HCl, pH9. One-tenth milliliter of a reaction mixture consisting ofsubstrate (0.1–1.0 mg/ml) and 0.5 µg of purified enzymeprotein was incubated at 37°C for 1 h, and the reactionwas stopped by adding 0.1 ml of 2 N HCl. The mixturewas cooled on ice for 15 min and then centrifuged at12,000 rpm for 5 min. The supernatant was collectedand absorbance at 550 nm was measured.

2.8.2. MU-(GlcNAc)3 as the substrateKinetic assays were conducted by the method of Zhu

et al. (2001) with minor modifications. The assays weredone using 4-methylumbelliferyl β-N, N�, N�-triacetylch-itotrioside [MU-(GlcNAc)3] (Sigma) as substrate in 0.1M sodium phosphate buffer, pH 6. Fifty microliter of areaction mixture consisting of substrate (0.02–0.2 mM)and 0.1 µg of protein were incubated at 37 °C for 10min, and the reaction was stopped by adding 12.5 µl of2 N HCl. The mixture was diluted 320-fold with 0.15M glycine-NaOH buffer, pH 10.5. A 2-ml portion of themixture was used to determine the free methylumbelli-ferone released by enzymatic hydrolysis. A DyNA Quant200 fluorescence spectrophotometer (PharmaciaBiotech) was used to measure the product formed utiliz-ing an excitation wavelength of 365 nm and an emissionwavelength of 460 nm.

2.8.3. Colloidal chitin as the substrateColloidal chitin was prepared by the method of Shim-

ahara and Takiguchi (1988) using crabshell chitin(Sigma). One-tenth milliliter of a reaction mixture con-sisting of colloidal chitin (1–5 mg/ml) and 0.4 µg ofprotein in 50 mM Tris–HCl, pH 9, was incubated at37°C for 1 h. The reaction was stopped by adding 0.2ml of ferri-ferrocyanide reagent and then the mixturewas boiled for 15 min (Imoto and Yagishita, 1971). Aftercentrifugation at 12,000 rpm for 5 min, the supernatantwas collected and the reducing sugars were measured bythe absorbance at 405 nm.

2.9. Chitin-binding assay

The chitin-binding assay was done using colloidal chi-tin as the affinity matrix. Previously, we had utilizednative chitin instead of colloidal chitin as the ligand andpH 6.5 instead of pH 8 for the binding assay (Zhu et al.,2001; Zhang et al., 2002). However, because prep-arations of the latter were more reproducible than theformer, and the latter pH was intermediate to the pH ofthe locations where chitinase is physiologically func-tional, i.e. the molting fluid (pH ~7) and midgut lumen(pH ~l0), we have modified the assay as follows: first,0.5 mg of colloidal chitin was mixed with 1 µg of protein

in 50 µl of 10 mM sodium phosphate buffer, pH 8. Themixture was incubated at room temperature for 1 h andthen centrifuged for 3 min. The supernatant was col-lected as the fraction containing unbound protein. Thepellet was washed after suspension in 50 µl of 10 mMsodium phosphate buffer, pH 8, and centrifuged. Thissecond supernatant was denoted as wash fraction I. Thenthe pellet was washed after resuspension in 50 µl of 10mM sodium phosphate buffer containing 1 M NaCl, pH8, followed by another wash in 50 µl of 0.1 M aceticacid. Both of those supernatants were collected as washfractions II and III. Finally, the pellet was resuspendedin 50 µl of SDS-PAGE sample buffer and boiled for 10min. After centrifugation, the supernatant was collectedas the bound protein fraction. All fractions were ana-lyzed by SDS-PAGE followed by protein staining withCoomassie Brilliant Blue R-250. The protein bands werequantified using densitometric analysis.

2.10. Stability of chitinases in presence of gut extract

2.10.1. Preparation of gut extractMidguts were dissected from fifth instar larvae of M.

sexta that were actively feeding and immediately frozenon dry ice. The tissue was homogenized in five volumesof 50 mM Tris–HCl, pH 9, using a mortar and pestle onice. The homogenate was centrifuged at 12,000 rpm for20 min and the supernatant was collected.

2.10.2. Resistance of recombinant proteins to gutproteases

To investigate the stability of proteins, 20 µl of a reac-tion mixture containing 1 µg of chitinase protein and gutextract (1 µg of total protein) in 50 mM Tris–HCl, pH9, was incubated at 37°C for 0–60 min. The reactionwas stopped by adding 7 µl of 4× SDS-PAGE samplebuffer and immediately boiled for 5–15 mm. All sampleswere analyzed by SDS-PAGE followed by staining forproteins with Coomassie Brilliant Blue R-250. The pro-tein bands were quantified using densitometric analysis.

2.11. Circular dichroism

The gross structures of wild-type, truncated andextended forms of M. sexta chitinase as well as the linkerand CBDs were monitored by circular dichroism (CD).Proteins were diluted into 20 mM sodium phosphatebuffer, pH 8. The CD spectra were measured using aJasco J720 spectropolarimeter at 20 °C. After noisereduction and concentration adjustment, the ellipticitywas converted to the molar ellipticity and plotted againstthe wavelength.


3. Results

3.1. Expression, secretion and purification ofrecombinant proteins

To investigate the functions of various domainspresent in M. sexta chitinase, we generated cDNAexpression constructs encoding several recombinanttruncated and extended forms of the protein in additionto the one coding for the full-length protein, Chi535(Fig. 1). Five constructs containing the open readingframes for C-terminally truncated proteins with pro-gressively shorter deletions of amino acids on the C-ter-minal side of residue 376, including Chi376, Chi386,Chi396, Chi407 and Chi477 (see list of abbreviations

Fig. 1. Schematic diagram of recombinant full-length (Chi535), truncated (Chi386, Chi396, Chi407, Chi477, ChiLH, ChiCH and ChiLCH), andextended forms [(Chi386(MCBD), Chi386(MCBD)2 and Chi386(RCBD)] of insect chitinase. (A) The full-length glycoprotein Chi535 with predictedlocations of O- and N-linked residues (Hansen et al., 1997, 1998) denoted by the letters O and N. (B) The full-length, truncated and extendedforms with masses determined from amino acid sequence, SDS-PAGE and mass spectrometry.

and Fig. 1 for the regions included in these proteins),were expressed in Hi-5 insect cells using the Autographacalifornica nuclear polyhedrosis virus (AcMNPV) as theexpression vector (Gopalakrishnan et al., 1995; Zhu etal., 2001). Also, three extended forms of the protein, inwhich the C-terminus of the catalytic domain encodedby construct Chi386 was fused to one or two putativechitin binding domains, MCBD (amino acid residues478–535 of M. sexta chitinase (Kramer et al., 1993)) ora rice chitin binding domain, RCBD (amino acid resi-dues 19–68 of a rice class I chitinase (Huang et al.,1991)), were generated. Three deletion forms of M. sextachitinases devoid of the catalytic domain at the N-ter-minal end and with six histidines as a tag on the C-terminal end were produced as recombinant proteins.


These forms were the following: ChiLH (consisting ofamino acids 377–477 (the linker domain) followed by aC-terminal (His)6 tag); ChiCH (consisting of amino acids478–535 (the CBD) followed by a C-terminal (His)6tag); and ChiLCH (consisting of amino acids 377–535(linker domain and the CBD) followed by a C-terminal(His)6 tag). Finally, Chi80–535, a recombinant N-ter-minal truncated form missing the first 79 residues of thecatalytic domain, was also purified from the culturemedium but was found to be enzymatically inactive.

All of the recombinant proteins except for Chi376 andChiLH were secreted into the medium by the AcMNPV-infected insect cells. These results agreed with those ofZhu et al. (2001), who also reported that Chi376 wasnot secreted and remained inside the cells even thoughit contained the 19 amino acid-long signal peptide in thepreprocessed protein. When Chi376 was fused with theCBD from either M. sexta or rice chitinase, those con-structs also remained inside the cells and were notsecreted. However, addition of only 10 amino acids, con-sisting of residues 377–386 (SSYTVPPPHT), to the C-terminal of Chi376 did result in the secretion of recombi-nant proteins Chi386 and the domain-shuffled extendedproteins, Chi386MCBD, Chi386(MCBD)2 andChi386RCBD, into the media. Other longer proteinswith C-terminal CBDs, Chi407 and Chi477, which alsocontained residues 377–386, were likewise secreted fromthe cells into the media.

In terms of relative expression efficiency of the vari-ous proteins secreted by the insect cells, constructs enco-ding the full-length protein Chi535 and C-terminal trunc-ated protein Chi477 exhibited the highest yields ofapproximately 20 mg protein/l of culture media. Yieldsof three other truncated proteins, Chi386, Chi396 andChi407, were lower, ~10 mg/l, or only about 50% thatof Chi535 and Chi477. The extended forms,Chi386MCBD, Chi386(MCBD)2 and Chi386RCBD,were also secreted into the media but reached lower lev-els of �5 mg/l. The highest accumulations of secretedprotein occurred when the linker region of the recombi-nant proteins remained intact. Apparently, the presenceof CBDs (MCBD or RCBD) did not affect the secretoryefficiency of these proteins, although their level ofexpression was slightly lower relative to Chi535 andChi477. The yields of ChiLH, ChiCH and ChiLCH wererather low. The former protein was not secreted into themedium at all and had to be prepared from extracts oflysed cells. ChiCH and ChiLCH were secreted at con-centrations ranging from 0.5 to 2 mg/l.

All of the secreted proteins were purified from culturemedia by chromatographic methods as described in Sec-tion 2. The purity of each protein was examined by SDS-PAGE. As shown in Fig. 2A, preparations of Chi535,Chi477, Chi407, Chi396, Chi386, Chi386MCBD,Chi386(MCBD)2 and Chi386RCBD exhibited singleprotein bands and their apparent molecular masses were

Fig. 2. SDS-PAGE analysis and immunoblotting of recombinant full-length, truncated and extended forms of insect chitinase. Proteins (2µg) obtained by hydroxylapatite chromatography were subjected toelectrophoresis on a 12% SDS-PAGE and stained with CoomassieBrilliant Blue R-250 (A). Immunoblotting was done using anti-Chi535(B) and anti-Chi386 (C) antibodies. Lane 1, protein standard markers;lane 2, Chi535; lane 3, Chi477; lane 4, Chi407; lane 5, Chi396; lane6, Chi386; lane 7, Chi386(MCBD); lane 8, Chi386(MCBD)2; lane 9,Chi386(RCBD); lane 10, ChiLCH; lane 11, ChiCH; lane 12, ChiLHand lane 13, protein standard markers.

estimated to be 81, 67, 53, 49, 48, 54, 60 and 53 kDa,respectively (Fig. 1B). However, since the theoreticalsizes of the truncated proteins based on their amino acidcompositions were smaller in each case, 60.4, 53.5, 46.1,45.1 and 43.9 kDa, respectively, and the masses determ-ined by mass spectrometry were smaller than the appar-ent masses estimated from mobilities during SDS-PAGE, all of those proteins were probably post trans-lationally glycosylated but to varying extents (Zhu et al.,2001; see Section 3.2). The apparent masses of theextended forms (lacking the linker region) were alsolarger than the predicted masses of 50.9, 57.9 and 48.9kDa, respectively, for Chi386MCBD, Chi386(MCBD)2and Chi386RCB. Thus, those extended forms wereapparently glycosylated as well but probably to a lowerextent than the forms with the intact linker region. Thus,the relative differences between the observed and pre-dicted masses ranged from about 2 to 30%. The degreeof glycosylation apparently increased with the length ofthe truncated proteins. Mass spectrometry confirmed thatthe masses of all proteins were larger than those pre-dicted from their amino acid sequences, indicating post-translational glycosylation.


The mobilities of ChiLH, ChiLCH and ChiCH asdetermined by SDS-PAGE were also greater than thosepredicted from their masses derived from the amino acidsequences. Laser desorption mass spectrometry was usedto determine their molecular masses more accurately.Whereas the SDS-PAGE results indicated that the mol-ecular weights of ChiCH and ChiLH are 13 and 20 kDa,respectively (Fig. 1 and Table 2), mass spectrometryindicated that these proteins had molecular weights ofonly 9.1 and 12.7 kDa, respectively. The masses pre-dicted for ChiCH and ChiLH from their amino acidsequences (8.1 and 12.0 kDa, respectively) were closeto the values determined by mass spectrometry. Unex-pectedly, ChiLCH was quite heterogeneous (21–46 kDa)when examined by SDS-PAGE, and mass spectrometryrevealed the presence in the preparation of a major pro-tein with a size of 19 kDa. Its theoretical molecularweight based on amino acid sequence data was 18.8 kDa.Fig. 1 and Table 2 summarize the properties of allrecombinant forms of these proteins.

The N-terminal sequence of both ChiLCH, a hetero-geneous preparation consisting of a mixture of proteinsranging in size from 19 to 46 kDa, and ChiLH, whichwas a homogeneous preparation, was DKLSS. Thesedata were in agreement with the predicated amino acidsequences of the mature forms of these proteins encodedby their constructs after cleavage of the leader peptide.There was no evidence of N-terminal sequence hetero-geneity in the sequence of ChiLCH, even though it con-sisted of a mixture of proteins that apparently were het-erogeneously glycosylated. The N-terminal sequence ofChiCH was DKLI, which was also exactly as predicted.Thus, the N-terminal sequencing results demonstratedthat cleavage of the leader peptide of the precursors ofthese truncated forms had occurred in the insect cells asexpected. Since these proteins were purified by affinitychromatography on Ni-NTA column, they all have an

Table 2Carbohydrate compositions and masses of recombinant full-length and truncated forms of insect chitinasea

Carbohydrate Chi535 Chi477 Chi407 Chi396 Chi386 ChiLH ChiCH ChiLCH

GalNAc 20 ± 14 16 ± 12 4 ± 3 1 ± 1 0 1 ND 8Mannose 8 ± 4 8 ± 3 38 ± 36 14 ± 7 9 ± 3 1 5 4GlcNAc 4 ± 2 3 ± 1 4 ± 3 3 ± 2 4 ± 1 0 2 1Glucose 2 ± 0 3 ± 1 13 ± 10 4 ± 1 2 ± 1 1 1 0Galactose 4 ± 3 4 ± 1 3 ± 2 2 ± 0 1 ± 0 0 ND 2Total 38 34 62 24 16 3 8 15

Mass (kDa)aa 60 54 46 45 44 12 8 19aa + carbohydrate 68 61 58 49 47 13 10 22SDS 81 67 53 49 48 20 13 21–46Mass spectrometry ND 62.0 49.4 47.9 46.1 12.7 9.1 19–46

a Moles of sugar per mole of protein. Mean value ±SD (n = 3) for Chi535, Chi477 and Chi407. Mean value ±0.5 range (n = 2) for Chi396 andChi386. ND=Not detected.

intact His6 tag at the C-terminus. Therefore, it is prob-able that the heterogeneity observed in the ChiLCHpreparation was due to a heterogeneous post-trans-lational glycosylation.

3.2. Carbohydrate analysis

M. sexta chitinase is a glycoprotein, but the specificamino acid residues that are glycosylated are unknown(Gopalakrishnan et al., 1995; Zhu et al., 2001). When theamino acid sequence of insect chitinase was subjectedto analysis by O-glycosylation site prediction software(Hansen et al., 1997, 1998), many residues in the linkerregion were predicted to be O-glycosylated, including 19threonine residues: no. 380, 386, 390, 392, 401, 413–416, 422, 423, 426, 429–434 and 469, and five serineresidues: no. 378, 400, 403, 406 and 421 (Fig. 1A). Onlytwo of the threonines and three of the serines in thelinker region, and all of the other threonines and serinesoutside of the linker region were not predicted to be gly-cosylated. On the other hand, when the chitinasesequence was subjected to analysis by N-glycosylationsite prediction software (Gupta et al., 2003), out of thefour asparagine-X-Ser/Thr residues present in this pro-tein, only two (asparagines 66 and 285) were predictedto be N-glycosylated and those residues are outside ofthe linker region. Thus, most of the glycosylation ininsect chitinase is predicted to occur in the linker regionas O-glycosylated threonines and serines.

Chemical analysis of carbohydrates present in the full-length enzyme and the truncated proteins confirmed theprediction that all of these recombinant proteins wereindeed glycosylated with mannose and/or GalNAc beingthe most abundant sugars. These analyses also revealedthat the degree of glycosylation varied as longerstretches of amino acids were deleted from the C-ter-minal region (Table 2).The catalytic domain with the


minimal length of linker (Chi386) contained GlcNAc,mannose and trace amounts of glucose and galactose.The proteins with an increasingly longer linker have pro-gressive increases in GalNAc, while retaining nearly thesame amount of GlcNAc, galactose and mannose asChi386. Some preparations of Chi407 had unusuallyhigh amounts of mannose and glucose, which resultedin a large standard error in the carbohydrate compositionfor that protein. The reason for this large variation isunknown, but it may be related to improper or variablefolding of the truncated protein in the absence of a full-length linker region. The data for the other truncatedforms of chitinase are consistent with the notion that thecatalytic domain has only one or two N-linked oligo-saccharides rich in mannose and that the linker regionis O-glycosylated (containing Gal and GalNAc) overmuch of its length. The difference in the sizes determ-ined by mass spectrometry from those predicted onlyfrom amino acid sequences also increased as larger por-tions of the linker were added to the catalytic domain,which suggested that glycosylation occurred over theentire linker region. However, there was little or nocarbohydrate in the linker or CBD when these recombi-nant proteins were expressed individually. Nonetheless,both of these domains migrated non-ideally during SDS-PAGE, especially ChiLH, which behaved like a proteintwice as large as predicted (Table 2). Apparently, thelinker does not associate with SDS in a complex with acharge:mass ratio comparable to those of the standardmarker proteins.

We also examined the susceptibility of the recombi-nant proteins to various glycosidases as monitored by acomparison of their mobilities upon SDS-PAGE beforeand after enzyme treatment. Treatment of Chi535 withPNGase F overnight to remove N-linked glycosidesresulted in a mobility shift corresponding to a sizereduction of about 3 kDa (data not shown). If theremoval of N-linked sugars was assumed to be complete,this result suggested that there was approximately 3 kDaof N-linked carbohydrates in this protein. Treatment withan O-glycosidase mixture (exo-O-glycosidases+endo-O-glycosidases) removed about 4 kDa of sugar fromChi535, a result suggesting that there was about 4 kDaof O-linked sugars in insect chitinase. A mixture of bothN- and O-glycosidases removed approximately 6 kDa ofcarbohydrate. Overall, these data indicate that there wasapproximately 6 kDa of N- and O-linked oligosaccha-rides in the full-length protein Chi535.

Treatment of Chi386 with N-glycosidase, but not O-glycosidase, resulted in a mobility shift consistent witha reduction in size of about 2 kDa (data not shown). Incontrast, O-glycosidase treatment, but not N-glycosidasetreatment, resulted in a mobility shift equivalent to 3 kDaof the slowest moving band in the ChiLCH preparation.Several other bands in this preparation showed no alter-ation in mobility (size) after treatment with a mixture

of N- and O-glycosidases (data not shown). ChiCH andChiLH preparations showed no changes in mobility(size) after treatment with the mixture of N- and O-gly-cosidases. From all of the data described above includingthe carbohydrate content and glycosidase treatments, weconclude that the catalytic domain of M. sexta chitinasehas one or two sites of N-glycosylation and that thelinker domains in Chi535, Chi477, Chi407, Chi396,Chi386 and ChiLCH, but not ChiLH, have multiple sitesof O-glycosylation (Fig. 1).

3.3. Immunoblot analysis

In immunological studies, we found that the anti-Chi535 antibody, our first polyclonal antibody that wasraised against the full-length glycoprotein prepared fromthe molting fluid (Koga et al., 1983b), did not react wellwith the C-terminal-truncated proteins, Chi386 andChi376, or ChiCH (Fig. 2B; Zhu et al., 2001). We attri-buted this observation to an inability of that polyclonalantibody, which was raised against the full-length native81 kDa M. sexta chitinase, to bind to the catalyticdomain (residues 1–376) or CBD (residues 478–535).Therefore, we raised a second polyclonal antibody to thesmallest secreted enzymatic protein, Chi386, which con-tained the entire catalytic domain and lacked most of theC-terminal linker (except for the first 10 amino acids)and the entire CBD.

To investigate further the specificities of these twoantibodies, immunoblot analysis was done using theantibodies elicited against either Chi535 or Chi386. Asshown in Fig. 2B, anti-Chi535 antibody recognizedChi535 and Chi477 well, but the recognition of Chi407and Chi396 was much weaker. Chi386, Chi386MCBD,Chi386(MCBD)2 and Chi386RCBD were unrecognizedor hardly at all, suggesting that the linker region(positions 386–477) and/or its associated glycosyl resi-dues are important for recognition by the anti-Chi535antibody. However, this antibody recognized ChiLH,which contains the entire linker domain and a C-terminalHis-tag, only very weakly and did not recognize theCBD fragment. Interestingly, the Chi535-antibody cross-reacted strongly with ChiLCH, which contains both thelinker region and the CBD and also is glycosylated. Itappears that the anti-Chi535 antibody strongly recog-nizes epitopes that are composed of elements from boththe linker and the CBDs, especially the O-glycosylatedsites.

The linker region is a S/T-rich region with a highpotential for O-glycosylation. The possibility that theanti-Chi535 antibody recognizes epitopes consisting ofthese sugars was tested by treating Chi535 and ChiLCHwith a mixture of N- and O-glycosidases. We found noevidence of any reduction in immunological activity ofthese proteins even though we could demonstrateremoval of most of the carbohydrate residues because


of changes in the mobility of the protein band(s) afterglycosidase treatment, suggesting that the epitopesrecognized by the antibody involve primarily aminoacids and not sugars. However, we could not be certainthat all of the sugars had been removed from the linkerregion by the glycosidase treatment. ChiLCH expressedfrom E. coli may help to clarify the immunologicalspecificity or antibody recognition properties. Thus, thenature of the residues that interact with the anti-Chi535antibody remains unresolved.

To detect protein forms that lacked this linker region,another antibody, anti-Chi386, had to be generated andutilized. This antibody recognized all of the deleted andextended forms of insect chitinase that contained thecatalytic domain quite well (Fig. 2C). Anti-Chi386detected Chi535 and Chi386 about equally well. Eventhough the Chi386 antigen did not contain the CBDregion and only the first 10 amino acids of the linkerregion, western blotting analysis showed that anti-Chi386 recognized ChiCH well. Chi386 and ChiCHapparently share a common epitope that is perhapslocalized in their carbohydrate binding sites. Anti-Chi386 also cross reacted with a set of larger molecularweight proteins present in the ChiLCH preparation butnot with the lower molecular weight proteins that crossreacted with the Chi535 antibody.

3.4. Chitin binding

To compare the ability of the truncated and extendedforms of insect chitinase to bind to the insoluble sub-strate chitin, a binding assay was conducted at pH 8using colloidal chitin as the affinity matrix. The boundand unbound fractions were resolved by SDS-PAGE andstained for proteins. Chi535 was bound to colloidal chi-tin and the percentage bound was approximately 80%under our experimental conditions (Fig. 3). Non-specificadsorption of proteins to colloidal chitin was tested usingbovine serum albumin as the test protein, which wasbound to only about 5% with chitin. The binding abilitiesof the four C-terminal truncated forms were substantiallylower than that of Chi535, with the binding of Chi477,Chi407, Chi396 and Chi386 occurring at only 15, 50, 33and 37%, respectively. The reduced adsorption of thesetruncated forms (compared to the full-length enzyme)was not unexpected because the putative CBD (residues478–535) was absent from those proteins. However, thehigher percentage of binding observed with Chi407 com-pared to Chi477 suggested that the full-length linkerregion, perhaps as a result of the unusually high contentof mannose and glucose, did influence ligand bindingbut in an unknown manner. The presence of amino acidresidues 408–477 was detrimental to binding, perhapsbecause of steric interference. When the CBDs frominsect and rice chitinases were fused with Chi386 (witha binding ability of 37%), the resulting products,

Fig. 3. Chitin-binding assay of recombinant full-length, truncated andextended forms of insect chitinase. Chitin binding assays were doneas described in Section 2. The assay mixtures contained 1 µg of chitin-ase and 0.5 mg of colloidal chitin. All fractions were subjected to SDS-PAGE and proteins were stained with Coomassie Brilliant Blue R-250.Lane 1, starting fraction; lane 2, unbound fraction; lane 3, wash frac-tion I (10 mM sodium phosphate, pH 8); lane 4, wash fraction II (10mM sodium phosphate containing 1 M NaCl, pH 8); lane 5, washfraction III (0.1 M acetic acid; and lane 6, bound fraction. Boundpercentage = bound protein (lane 6) /starting protein (lane1). BSA =bovine serum albumin.

Chi386MCBD and Chi386RCBD, exhibited a bindingability of 86 and 74%, respectively, which were compa-rable in strength to that of the full-length chitinase,Chi535. The absence of the linker region in those con-structs did not negatively affect the extent of binding tochitin. Furthermore, when a second insect CBD domainwas added, the resulting protein, Chi386(MCBD)2,showed the highest binding capacity of all at 99%. Thus,addition of either an insect or a plant CBD to Chi386resulted in increased adsorption to the insoluble sub-strate, colloidal chitin.

Regarding the ability of the linker (ChiLH) and CBDs(ChiCH) to bind to insoluble chitin, ChiCH had an affin-ity for insoluble chitin similar to Chi535. About 65% ofChiCH was bound to colloidal chitin (Fig. 3). The linkerdomain ChiLH did not bind to colloidal chitin. Whenthe linker region was fused with the CBD (ChiLCH),that recombinant protein exhibited only about half of thebinding ability of Chi535 and ChiCH. The linker regioninterfered with the chitin binding of ChiCH when thecatalytic domain was not attached to the N-terminal ofthe linker region.


3.5. Circular dichroism

The gross structures of wild-type and several of thetruncated and extended forms of M. sexta chitinase wereanalyzed using circular dichroism (CD). As shown inFig. 4, the CD spectra are consistent with the full-lengthenzyme and the C-terminally truncated forms, Chi477,Chi407, Chi396 and Chi386, having both α-helices andβ-sheets in agreement with the prediction that the cata-lytic domain of family 18 chitinases consists of a (βα)8barrel structure (Terwisscha van Scheltinga et al., 1996).As the length of the truncated proteins decreased, theabsorbance at approximately 220 nm slightly decreased,while that at about 207 nm increased, indicating a mod-erate change in the relative proportion of α-helix to β-

Fig. 4. (A) Circular dichroism spectra of recombinant full-length,truncated and extended forms of insect chitinase. CD spectra weremeasured in 20 mM phosphate buffer, pH 6.5 at room temperature ina 0.1 cm cuvette. (A) Chi535, Chi477 and Chi407. (B) Chi535, Chi396and Chi386. (C) Chi535, ChiLCH, ChiCH and ChiLH. The concen-trations of Chi535, Chi477, Chi407, Chi396, Chi386, ChiLCH, ChiCHand ChiLH were 18, 17, 16, 16, 16, 410, 112 and 140 µM, respectively.

sheet. On the other hand, ChiLH exhibited a CD spec-trum indicative of little, if any, secondary structure. Thespectrum of ChiCH showed predominance of β-strands.These results are consistent with the catalytic domainand CBD retaining most of their characteristic secondarystructures both individually and when present in the full-length enzyme. The linker region, however, appeared tobe devoid of any ordered structure, which did not sig-nificantly affect the structure of the other domains.

3.6. Resistance to gut extract proteases

To investigate the influence of the domains on chitin-ase stability in its natural gut environment, each of therecombinant proteins was incubated with proteinasespresent in an extract prepared from midguts of feedingfifth instar M. sexta larvae. As shown in Fig. 5, Chi535and Chi477 were more stable than the other truncatedforms, with half-lives of �60 min. Chi407 had a half-life of approximately 50 min, whereas those of Chi386and Chi396 were only about 15 min. These results sug-gested that the S/T-rich linker region and/or glycosyl-ation might increase the stability of insect chitinase.With regard to extended forms, addition of either MCBDor RCBD increased stability only slightly. However,addition of a second MCBD increased the half-life of

Fig. 5. Stability of recombinant full-length, truncated and extendedforms of insect chitinase in the presence of gut extract. Enzyme stab-ility assay was done by the method described in Section 2. Chitinases(1 µg) were incubated at 37 °C for 0–60 min in the presence of gutextract (1 µg of total protein). All fractions were subjected to SDS-PAGE and proteins were stained with Coomassie Brilliant Blue R-250.


the protein from 15 to 40 min. These results suggestedthat the S/T-rich linker region and/or glycosylation con-tributed to the stability of insect chitinase. It is possiblethat the CBDs improved stability by shielding some ofthe target sites from the gut proteinases, which helpedto diminish protein degradation.

ChiCH was as stable in the presence of gut proteasesas the full-length enzyme, but ChiLCH, in which thelinker domain was attached to CBD, was degraded rap-idly (t1 /2 = 5 min) from a protein of about 45 kDa to amixture of products with sizes ranging from ~20 to 25kDa. Those products were stable over the duration of theexperiment. ChiLH also was unstable in the presence ofgut proteases and was completely degraded by 10 min.

3.7. Kinetic analyses

To compare the enzymatic behavior of these modifiedforms of insect chitinase, kinetic analyses were done atpH 9 using several substrates, including colloidal chitinas an insoluble polymeric substrate, CM-Chitin-RBV asa soluble polymeric substrate, and MU-(GlcNAc)3 as asoluble oligomeric substrate. All of the recombinant pro-teins with the intact catalytic domain were activetowards each of the substrates. With colloidal chitin asthe substrate, it should be noted that the Km values of allof the truncated forms were larger than that of Chi535,indicating that those enzymes had a diminished affinityfor the insoluble large substrate presumably because theylacked the CBD (Table 3). The kinetic behavior ofChi407, however, was non-ideal such that the kineticparameters could not be calculated because apparentlythe enzyme was highly susceptible to substrate and/orproduct inhibition (data not shown). The Km values ofthe three extended forms were smaller than that ofChi386 and similar to that of Chi535, suggesting that allhad a high substrate affinity. As expected, addition ofCBDs increased the affinity of the catalytic domain of

Table 3Kinetic parameters of truncated and extended forms of insect chitinaseusing colloidal chitin as the substratea

Enzyme Vmax (�A405/h/µM) Km (mg/ml) Vmax/Km

Chi535 8.70 4.29 2.05Chi477 8.40 9.96 0.89Chi407b – – –Chi396 11.8 20.0 0.59Chi386 13.5 29.0 0.47Chi386(MCBD) 3.49 4.98 0.70Chi386(MCBD)2 4.88 4.67 1.04Chi386(RCBD) 3.11 3.18 0.99

a Substrate concentration ranged from 1 to 5 mg/ml and enzymeconcentration from 49 to 83 nM.

b No parameters were determined because of strongsubstrate/product inhibition.

the insect chitinase for the insoluble substrate. Theseresults were in good agreement with those obtained fromchitin-binding analysis. It is likely that the binding ofthe insoluble substrate to the CBD increased the localconcentration of the substrate in the neighborhood of thecatalytic site. With respect to the oligosaccharide sub-strate, MU-(GlcNAc)3, all of the enzymes were suscep-tible to substrate inhibition. Interestingly, Chi407 wasparticularly susceptible to inhibition by the small sub-strate (Table 4). On the other hand, with regard to thesoluble polymeric substrate, CM-Chitin-RBV, there wasno substrate inhibition behavior and it was possible toderive Vmax and Km values for all of the recombinantproteins (Table 5). The Km values of the extended formswere the smallest for all of the substrates. However, theturnover numbers did not vary substantially and the mostactive protein was the full-length enzyme.

4. Discussion

A multi-domain structural organization is oftenobserved in polysaccharide-degrading enzymes, whereone or more domains are responsible for hydrolysis andone or more domains are responsible for associating withthe solid polysaccharide substrate. In addition, there areusually linker regions between the two types of domains,which also may be responsible, at least in part, for somefunctional properties of the enzymes. For example, a chi-tinase from the parasitic nematode, Brugia malayi, con-tains catalytic, linker and CBDs (Venegas et al., 1996).Insect chitinases possess such a structural organizationas do other nematode, microbial, and plant chitinases andfungal cellulases. The most novel multidomain structureexhibited by an insect chitinase, which we are aware of,is that of the enzyme from the beetle, Tenebrio molitor(Royer et al., 2002). This protein is very large, with acalculated molecular mass of the deduced protein being320 kDa. It contains five catalytic domains, five Ser/Thr-rich linker domains, four CBDs, and two mucin-likedomains. The chitinases from the bacterium, Serratiamarcescens, fall into three classes (with sizes rangingfrom 36 to 52 kDa), which are composed of differentcombinations of catalytic domains, fibronectin type-III-like domains, and N- or C-terminal CBDs (Suzuki et al.,1999). The M. sexta chitinase, however, is much smallerthan the Tenebrio enzyme and less complex in domainstructure with only a single N-terminal catalytic domain,a linker domain, and a C-terminal CBD. Classes I andIV plant chitinases contain an N-terminal CBD and aG/P-rich linker preceding the catalytic domain (Raikhelet al., 1993; Neuhaus, 1999), whereas the fungal cellul-ases possess a threonine/serine/proline-rich linkerbetween the N-terminal catalytic domain and the C-ter-minal cellulose-binding domain (Srisodsuk et al., 1993).The Manduca chitinase linker region that is rich in T


Table 4Kinetic parameters of truncated and extended forms of insect chitinase using MU-(GlcNAc)3 as the substratea

Enzyme Substrate inhibition (mM) kcat (1/s) Km (mM) kcat/Km (1/s/mM)

Chi535 �0.10 0.76 1.13 0.67Chi477 �0.20 0.31 0.51 0.62Chi407b �0.03 – – –Chi396 �0.10 0.27 0.64 0.42Chi386 �0.10 0.37 0.93 0.40Chi386(MCBD) �0.10 0.14 0.29 0.50Chi386(MCBD)2 �0.05 0.17 0.31 0.54Chi386(RCBD) �0.05 0.22 0.48 0.46

a Substrate concentration ranged from 0.02 to 0.2 mM and enzyme concentration from 25 to 43 nM.b No parameter were determined because of strong substrate inhibition.

Table 5Kinetic parameters of truncated and extended forms of insect chitinaseusing CM-Chitin-RBV as the substratea

Enzyme Vmax (�A550/h/µM) Km (mg/ml) Vmax/Km

Chi535 18.2 1.84 9.89Chi477 13.5 1.58 8.54Chi407 3.39 0.63 5.41Chi396 9.52 1.49 6.39Chi386 6.54 1.05 6.23Chi386(MCBD) 2.30 0.28 8.19Chi386(MCBD)2 2.54 0.35 7.28Chi386(RCBD) 2.99 0.52 5.81

a Substrate concentration ranged from 0.1 to 1.0 mg/ml and enzymeconcentration from 62 to 107 nM.

and S residues is also rich in P, D and E residues, whichqualifies it as a PEST sequence according to Rogers etal. (1986). This composition suggests that the insect chi-tinase might be a rapidly degraded protein. Intracellularubiquitin-conjugating enzymes recognize such asequence so that proteasomes can digest the conjugatedprotein when it is localized intracellularly. However,insect chitinase is a secreted protein and, therefore,would be expected to be exposed to intracellular pro-teases or the ubiquitin-conjugating system for only ashort period of time. Conversely, because Chi477 andChi535, which contain the linker region, were morestable in the presence of midgut proteases than the otherC-terminal truncated forms, the linker region apparentlyhelps to stabilize the enzyme and protects protease-sus-ceptible bonds in the catalytic domain from hydrolysisin the gut.

Recombinant enzymes lacking amino acid residuesfrom position 377 to 386 accumulated intracellularly(e.g. Chi376 with or without CBDs, data not shown),whereas all of the forms that had these 10 amino acidswere secreted into the media. We conclude, therefore,that the N-terminal portion of the linker region (residues377–386) must be present, in addition to the 19 amino

acid-long N-terminal leader peptide, for secretion tooccur outside of the cells. That region may also need tobe O-glycosylated because ChiLH, which contains resi-dues 377–386, accumulates intracellularly and, basedupon its size determined by mass spectrometry, ChiLHdoes not appear to be glycosylated. ChiCH, which doesnot contain residues 377–386, is secreted into themedium and has approximately the same size predictedfrom its amino acid sequence. Thus, ChiCH does notappear to be glycosylated (Table 2). On the other hand,during SDS-PAGE, ChiLCH behaved like a proteinlarger than predicted because it is glycosylated (15 molof sugar). It has very little GlcNAc. Thus, the M. sextachitinase linker region is probably O-glycosylated. How-ever, both secretion from the cell and glycosylation ofChiLCH appear to be dependent upon the presence ofthe CBD because ChiLH is localized intracellularly andnot glycosylated. The glycosylating enzyme system inthe ER and/or Golgi may recognize sites for glycosyl-ation, which are present only in molecules with both ofthose domains. This idea is further supported by thereaction of these domains to anti-Chi535, which recog-nizes ChiLCH but not ChiCH and recognizes ChiLHonly very weakly. The critical residues for glycosylation,therefore, may involve residues between amino acids376 and 386 (which includes two threonines) becauseChi376 accumulated intracellularly, whereas Chi386 wassecreted. Site-directed mutagenesis of these residuesmight help to answer the question about whether theseresidues are required for secretion.

The primary epitope recognized by the antibody elic-ited by the wild-type glycoprotein is the highly glycosyl-ated Ser/Thr-rich linker region of M. sexta chitinase.Other highly immunogenic insect proteins that appar-ently are extensively O-glycosylated in threonine-richdomains similar to the linker region of Manduca chitin-ase are peritrophins-55 and -95 from the sheep blowfly,Lucilia cuprina (Tellam et al., 2000, 2003). The sera ofsheep vaccinated with these peritrophins exhibited astrong immune response that inhibited the growth ofblowfly larvae (Casu et al., 1997; Tellam et al., 2003).


M. sexta chitinase is probably N-glycosylated in thecatalytic domain and O-glycosylated in the linker region.The insect cell line used here, TN-5B1-4 (Hi-5), whichis used routinely for foreign glycoprotein production,synthesizes proteins with both N- and O-linked oligo-saccharides (Davidson et al., 1990; Davis and Wood,1995; Jarvis and Finn, 1995; Hsu et al., 1997). Variousstudies of the glycosylation patterns of endogenous andrecombinant glycoproteins produced by insect cells haverevealed a large variety of glycan structures (Marchal etal., 2001). When human fucosyltransferase III was pro-duced as a recombinant protein in both insect and mam-malian cells, N-glycosylation was required for its properfolding in vivo (Morais et al., 2002). Whether the sameeffect of N-glycosylation is true for insect chitinaseremains to be determined. Previously, results of experi-ments investigating the effects of the N-glycosylationinhibitor, tunicamycin, on recombinant expression ofinsect chitinases in these cells indicated that the proteinswere glycosylated prior to being secreted by the cells(Gopalakrishnan et al., 1995; Zheng et al., 2002). Directchemical and enzymatic analyses have confirmed that M.sexta chitinase is both N- and O-glycosylated. Prolonged(overnight) deglycosylation of Chi535 with a mixture ofN- and O-glycosidases resulted in a protein that appearsto be smaller by about 6 kDa accounting for about 30sugar residues per mole of protein. Because N-linkedoligosaccharides in insects typically have 6–7 residues,two of which are GlcNAc (Paulson, 1989; Kubelka etal., 1995), our best estimate of the distribution of N-glycosylation involves a single or possibly two sites ofN-glycosylation in the catalytic domain and O-glycosyl-ation of between 10 and 20 serine or threonine residuesin the linker region. O-Glycosylation may involvemainly addition of galactose and N-acetylgalactosamine.The structures of the N- and O-linked glycans may becomparable to those identified in other invertebrates(Marchal et al., 2001; Wilson, 2002).

Glycosylation of the linker region may help to preventproteolytic cleavage(s) at sites between the catalytic andCBDs. Such a functional role of glycosylated regions hasbeen observed in some bacterial cellulases (Langsford etal., 1987). The full-length and near full-length O-glycos-ylated forms, Chi535 and Chi477, were the most stableproteins when incubated with the hornworm’s midgutproteinases. The linker region connects the catalyticdomain and the cysteine-rich CBD, both of which arepredicted to have compact structures. Protein modelingstudies using the crystal structures of other family 18glycosylhydrolases as templates suggested that the cata-lytic domain of M. sexta chitinase has an eight-fold(βα)8-TIM barrel structure (Kramer and Muthukrishnan,1997; Nagano et al., 2002). The CBD probably exhibitsa multi-stranded β-sheet structure based on similarity totachycitin (Suetake et al., 2000). We know of no struc-tures computed or proposed for linker domains which

may be rather flexible and potentially susceptible to pro-teolytic degradation unless they are protected by glycos-ylation. The CD spectrum of the linker domain is con-sistent with the lack of any secondary structure in thisdomain. It is conceivable that during the period ofmaximum chitinase activity, the enzyme is fully glycos-ylated. When required, a glycosidase(s) could be pro-duced that would remove sugar residues, thus exposingthose amino acid residues for proteolytic cleavage. Alter-natively, proteolytic cleavage may be reduced becauseof glycosylation. Consistent with this notion is the find-ing that analysis of molting fluid from M. sexta and Bom-byx mori revealed the presence of truncated forms ofcatalytically active chitinaes with sizes ranging from 50to 60 kDa (Kramer and Koga, 1986; Koga et al., 1997;Abdel-Banat et al., 1999). We have detected similartruncated forms in our insect cell expression system,especially several days subsequent to infection with therecombinant baculovirus (Gopalakrishnan et al., 1995).

Peptides linking protein domains are very common innature and many are believed to join domains ratherpassively without disturbing their function or affectingtheir susceptibility to cleavage by host proteases (Argos,1990; Gilkes et al., 1991). Linker peptides with G, Tor S residues are most common, perhaps because thoseresidues are relatively small with G providing flexibilityand T and S being uncharged but polar enough to inter-act with solvent or by their ability to hydrogen bond towater or the protein backbone to achieve conformationaland energetic stability. The interdomain linker peptideof a fungal cellobiohydrolase apparently has a dual rolein providing the necessary distance between the twofunctional domains and facilitating the dynamic adsorp-tion process led by the cellulose-binding domain(Srisodsuk et al., 1993). Solution conformation studiesof a fungal two-domain cellulase revelaed that its linkerexhibited an extended conformation leading tomaximum extension between the two domains and thatheterogeneous glycosylation of the linker was likely akey factor defining its extended conformation (Receveuret al., 2002). Since the domain structure of M. sexta chi-tinase is similar to that of this fungal cellulase, theseenzymes may have similar global structural character-istics. CD spectra of the proteins generated here wereconsistent with the hypothesis that the catalytic andCBDs possess substantial secondary structure, whereasthe linker region does not.

The basic function of CBDs is thought to help localizethe enzyme on the insoluble substrate to enhance theefficiency of degradation (Linder and Terri, 1997). Ingeneral, for many glycosyl hydrolases, the binding speci-ficity of the carbohydrate binding module mirrors thatof the catalytic module and these two domains are usu-ally in relatively close association. The CBD of insectchitinase belongs to carbohydrate-binding module family14, which consists of approximately 70 residues


(Coutinho and Henrissat, 1999). Of the chitin-bindingmodules, there are only three subfamilies identified sofar and the M. sexta chitinase CBD is a member ofSubfamily 1 (Henrissat, 1999). Such a carbohydrate-binding function has been demonstrated in several car-bohydrolases and other carbohydrate-binding proteins.These modules are attached to catalytic domains of sev-eral chitinases and also to chitinase-like proteins devoidof enzyme activity. These CBDs can be either N- or C-terminal and may be present as a single copy or as mul-tiple repeats. These domains are cysteine-rich and haveseveral highly conserved aromatic residues (Shen andJacobs-Lorena, 1999). The cysteine residues help tomaintain protein folding by forming disulfide bridgesand the aromatic residues probably interact with sacchar-ides in the ligand-binding pocket. There are peritrophicmatrix proteins, mucins, with affinity for chitin, whichcontain a similar six-cysteine peritrophin-A/mucin con-sensus sequence (Tellam et al., 1999; Morlais and Sever-son, 2001).

Insoluble substrate-binding domains apparentlyincrease the enzyme concentration at the substrate sur-face and help to juxtaposition the catalytic domain sothat hydrolysis occurs more readily on the insoluble sub-strates (Linder and Terri, 1997; Black et al., 1997).When fused with the catalytic domain of M. sexta chitin-ase, both insect and rice CBDs were similar in theirability to promote binding to and hydrolysis of chitin.The influence of extra substrate-binding domains hasbeen examined previously using a fungal chitinase thatwas constructed to include plant and fungal carbo-hydrate-binding domains (Limón et al., 2001). Theaddition of those domains increased the substrate-bind-ing capacity and specific activity of the enzyme towardhigh molecular mass insoluble substrates, such as groundchitin or chitin-rich fungal cell walls. Removal oraddition of cellulose-binding domains can reduce orenhance, respectively, the ability of cellulases to degradecrystalline cellulose (Chhabra and Kelly, 2002). When asecond cellulose-binding domain was fused to Trichod-erma reesei cellulase, the resulting protein had a muchhigher affinity for cellulose than the protein with only asingle binding domain (Linder et al., 1996). Likewise,the M. sexta chitinase catalytic domain fused with twoCBDs associated with chitin more strongly than any ofthe single CBD-containing proteins described in thisstudy. This domain apparently targets the secretedenzyme to its substrate.

Rye seed contains two chitinases, one with and theother lacking a CBD (Taira et al., 2002). In terms offungicidal activity, the former class I enzyme inhibitedfungal growth more effectively than the latter class IIenzyme. Apparently, the CBD of the class I chitinasefacilitates binding to the fungal hyphae, whereas theother enzyme cannot associate with this insoluble sub-strate as well. Similarly, removal of the N-terminal CBD

from a tobacco class I chitinase resulted in increases inKm and Vmax of the enzyme (Iseli et al., 1993). The CBDof insect chitinase probably has the function of associat-ing with insoluble chitin and helping to direct the chitinchain into the active site of the catalytic domain in amanner similar to the processive hydrolysis mechanismof S. marcescens chitinase A (ChiA, Uchiyama et al.,2001). The only difference is that in the case of insectchitinase, hydrolysis proceeds toward the reducing endinstead of the non-reducing end (Kramer and Koga,1986).

Catalytically, none of the modified forms of insectchitinase reported in this study was more efficient at sub-strate hydrolysis than the full-length enzyme. Chi535was from 2- to 4-fold more active in hydrolyzing insol-uble colloidal chitin than any of the other enzymes, butall of the recombinant forms were nearly comparable inturnover rate when the two soluble substrates, CM-chi-tin-RBV, which is a chitin derivative that is O-carboxy-methylated, and MU-(GlcNAc)3, an oligosaccharide sub-strate, were tested. Thus, a moderate increase in catalyticefficiency was observed when the catalytic domain fusedwith the CBD hydrolyzed the insoluble substrate. Whenthe C-terminal CBD was deleted from a bacterial chitin-ase from A. caviae, this truncated chitinase was alsoactive, but it liberated longer oligosaccharide productsthan did the full-length enzyme (Zhou et al., 2002).Thus, as was observed with other carbohydrolases suchas xylanases (Gill et al., 1999), the CBD of insect chitin-ase facilitates hydrolysis of insoluble but not solublesubstrates, and also influences the size of the oligosacch-aride products generated. The linker region can alsoinfluence the functionality of the carbohydrate-bindingdomain. When a fungal cellulose-binding domain wasfused with a fungal threonine/serine-rich linker peptide,the fusion protein adsorbed to both crystalline andamorphous cellulose. However, deletion of the linkerpeptide caused a decrease in cellulose adsorption and ahigher sensitivity to protease digestion (Quentin et al.,2002).

The results of this study are consistent with thehypothesis that M. sexta chitinase consists of twodomains connected by a linker region with the N-ter-minal domain harboring the catalytic activity and the C-terminal one being a CBD capable of specific recog-nition of the insoluble chitin polymer. These activitiesare independent of each other because each domain wasfunctional separately when they were expressed asrecombinant proteins. The linker region between thesedomains, which is highly glycosylated, not only connectsthem but also facilitates protein secretion from the celland helps to stabilize the enzyme in the presence of pro-teolytic enzymes. Proteolysis of cuticle protein is prob-ably necessary to expose chitin in the exoskeleton andPM so that chitinases can digest the polysaccharide.Insect chitinase may have evolved resistance to those


proteases by utilizing a linker region that is highly glyco-sylated. Also, the linker region is probably exposed suf-ficiently to the aqueous environment such that it isstrongly immunogenic. The data generated here alsosupport the hypothesis that the domain structure of insectchitinase was evolved for efficient degradation of theinsoluble substrate to soluble β(1→4)-linked oligo-saccharides of GlcNac during the molting process. Theunique properties of the two domains and the linkerregion suggest that each could be used to manipulateinteractions of proteins with chitin in chitin-containingorganisms, such as pest insects and pathogenic fungi,which could lead to adverse effects on their life cycles.

Acknowledgements

The authors are grateful to Dr. Daizo Koga, Dr. TamoFukamizo, Dr. Charles Specht and Dr. Arthur Retnaka-ran for critical comments. Supported in part by USDA-NRI grant no. 9802493 and the Department of Energy-funded (DE-FG02-93ER-20097) Center for Plant andMicrobial Complex Carbohydrates, University of Geor-gia. Mention of a proprietary product does not constitutea recommendation or endorsement by the USDA. TheUSDA is an equal opportunity/affirmative actionemployer and all agency services are available withoutdiscrimination. This is contribution no. 03-261-J of theKansas Agricultural Experiment Station.

References

Abdel-Banat, M.A.B., Koga, D., 2001. A genomic clone for a chitinasegene from the silkworm, Bombyx mori: structural organizationidentifies functional motifs. Insect Biochem. Mol. Biol. 31, 497–508.

Abdel-Banat, M.A.B., Kameyama, Y., Yoshioka, T., Koga, D., 1999.Purification and characterization of a 54 kDa chitinase from Bom-byx mori. Insect Biochem. Mol. Biol. 29, 537–547.

Argos, P., 1990. An investigation of oligopeptides linking domains inprotein tertiary structures and possible candidates for general genefusion. J. Mol. Biol. 211, 943–958.

Black, G.W., Rixon, J.E., Clarke, J.H., Hazlewood, G.P., Ferreira,L.M.A., Bolam, D.N., Gilbert, H.J., 1997. Cellulose-bindingdomains and linker sequences potentiate the activity of hemicellul-ases against complex substrates. J. Biotechnol. 57, 59–69.

Casu, R., Eisemann, C., Pearson, R., Riding, G., East, I., Donaldson,A., Cadogan, L., Tellam, R., 1997. Antibody-mediated inhibitionof the growth of larvae from an insect causing cutaneous myiasisin a mammalian host. Proc. Natl. Acad. Sci. USA 94, 8939–8944.

Chhabra, S.R., Kelly, R.M., 2002. Biochemical characterization ofThermotoga maritime endoglucanase Cel74 with and without acarbohydrate-binding module (CBM). FEBS Lett. 531, 375–380.

Choi, H.K., Choi, K.H., Kramer, K.J., Muthukrishnan, S., 1997. Iso-lation and characterization of a genomic clone for the gene of aninsect molting enzyme, chitinase. Insect Biochem. Mol. Biol. 27,37–47.

Coutinho, P.M., Henrissat, B., 1999. Carbohydrate-active enzymes: anintegrated database approach. In: Gilbert, H.H., Davies, G.J., Hen-

rissat, H., Svensson, B. (Eds.), Recent Advances in CarbohydrateBioengineering. Royal Society of Chemistry, Cambridge, UK, pp.3–12. Carbohydrate-active enzymes family server URL:http://afmb.cnrsmrs.fr/~pedro/CAZY/db.html.

Davidson, D.J., Fraser, M.J., Castellino, F.J., 1990. Oligosaccharideprocessing in the expression of human plasminogen cDNA by lepi-dopteran insect (Spodoptera frugiperda) cells. Biochemistry 19,5584–5590.

Davis, T.R., Wood, H.A., 1995. Intrinsic glycosylation potentials ofinsect cell lines and insect larvae. In Vitro Cell. Dev. Bio. Anim.31, 659–663.

Ding, X., Gopalakrishnan, B., Johnson, L.B., White, F.F., Wang, X.,Morgan, T.D., Kramer, K.J., Muthukrishnan, S., 1998. Insect resist-ance of transgenic tobacco expressing an insect chitinase gene.Transgenic Res. 7, 77–84.

Fukamizo, T., 2000. Chitinolytic enzymes: catalysis, substrate binding,and their application. Curr. Protein Peptide Sci. 1, 105–124.

Gilkes, N.R., Henrissat, B., Kilburn, D.G., Miller, R.C., Warren,R.A.J., 1991. Domains in microbial β-1, 4-glycanases: sequenceconservation, function, and enzyme families. Microbiol. Rev. 55,303–315.

Gill, J., Rixon, J.E., Bolam, D.N., McQueen-Mason, S., Simpson, P.J.,Williamson, M.P., Hazlewood, G.P., Gilbert, H.J., 1999. The typeII and X cellulose-binding domains of Pseudomonas xylanase Apotentiate catalytic activity against complex substrates by a com-mon mechanism. Biochem. J. 342, 473–480.

Gooday, G.W., 1999. Aggressive and defensive roles for chitinases.In: Jollés, P., Muzzarelli, R.A.A. (Eds.), Chitin and Chitinases. Bir-khäuser Verlag, Basel, Switzerland, pp. 157–169.

Gopalakrishnan, B., Muthukrishnan, S., Kramer, K.J., 1995. Baculo-virus-mediated expression of a Manduca sexta chitinase gene:properties of the recombinant protein. Insect Biochem. Mol. Biol.25, 255–265.

Gupta, R., Jung, E., Brunak, S., 2003. Prediction of N-glycosylationsites in human proteins. In preparation. Seehttp://www.cbs.dtu.dk/services/NetNGlyc/.

Hansen, J.E., Lund, O., Rapacki, K., Brunak, S., 1997. O-glycbaseversion 2.0—a revised database of O-glycosylated proteins.Nucleic Acids Res. 25, 278–282. See http://www.cbs.dtu.dk/services/NetOGlyc/.

Hansen, J.E., Lund, O., Tolstrup, N., Gooley, A.A., Williams, K.L.,Brunak, S., 1998. NetOglyc: prediction of mucin type O-glycosyl-ation sites based on sequence context and surface accessibility.Glycoconjugate J. 15, 115–130.

Henrissat, B., 1999. Classification of chitinases modules. In: Jollés, P.,Muzzarelli, R.A.A. (Eds.), Chitin and Chitinases. Birkhäuser Ver-lag, Basel, Switzerland, pp. 137–156.

Huang, J.-K., Wen, L., Swegle, M., Tran, H.-C., Thin, T.H., Naylor,H.M., Muthukrishnan, S., Reeck, G.R., 1991. Nucleotide sequenceof a rice genomic clone that encodes a class I endochitinase. PlantMol. Biol. 16, 479–480.

Huang, X., Zhang, H., Zen, K.C., Muthukrishnan, S., Kramer, K.J.,2000. Homology modeling of the insect chitinase catalytic domain–oligosaccharide complex and the role of a putative active site tryp-tophan in catalysis. Insect Biochem. Mol. Biol. 30, 107–117.

Hsu, T.A., Takahashi, N., Tsukamoto, Y., Kato, K., Shimada, I.,Masuda, K., Whitely, E.M., Fan, J.Q., Lee, Y.C., Betenbaugh, M.J.,1997. Differential N-glycan patterns of secreted and intracellularIgG produced in Trichoplusia ni cells. J. Biol. Chem. 272, 9062–9070.

Imoto, T., Yagishita, K., 1971. A simple activity measurement of lyso-zyme. Agric. Biol. Chem. 35, 1154–1156.

Iseli, B., Boller, T., Neuhas, J.-M., 1993. N-terminal cysteine-richdomain of tobacco class I chitinase is essential for binding but notfor catalytic or antifungal activity. Plant Physiol. 103, 221–226.

Jarvis, D.L., Finn, E.E., 1995. Biochemical analysis of the N-glycosy-

http://afmb.cnrsmrs.fr/~pedro/CAZY/db.htmlhttp://www.cbs.dtu.dk/services/NetNGlyc/http://www.cbs.dtu.dk/services/NetOGlyc/http://www.cbs.dtu.dk/services/NetOGlyc/


ation pathway in baculovirus-infected lepidopteran insect cells.Virology 212, 500–511.

Kim, M.G., Shin, S.W., Bae, K.S., Kim, S.C., Park, H.Y., 1998. Mol-ecular cloning of chitinase cDNAs from the silkworm, Bombyxmori, and the fall webworm, Hyphantria cunea. Insect Biochem.Mol. Biol. 28, 163–171.

Koga, D., Jilka, J., Kramer, K.J., 1983a. Insect endochitinases: glyco-proteins from moulting fluid, integument and pupal haemolymph.Insect Biochem. 13, 295–305.

Koga, D., Jilka, J., Speirs, R.D., Kramer, K.J., 1983b. Immunologicalrelationships between β-N-acetylglucosaminidases from the tob-acco hornworm, Manduca sexta (L.). Insect Biochem. 13, 407–410.

Koga, D., Funakoshi, T., Mizuki, K., Ide, A., Kramer, K.J., Zen, K.-C., Choi, H., Muthukrishnan, S., 1992. Immunoblot analysis of chi-tinolytic enzyme in integument and molting fluid of the silkworm,Bombyx mori, and the tobacco hornworm, Manduca sexta. InsectBiochem. Mol. Biol. 22, 305–311.

Koga, D., Sasaki, Y., Uchiumi, Y., Hirai, N., Arakane, Y., Nagamatsu,Y., 1997. Purification and characterization of Bombyx mori chitin-ase. Insect Biochem. Mol. Biol. 27, 757–767.

Kramer, K.J., Koga, D., 1986. Insect chitin: physical state, synthesis,degradation and metabolic regulation. Insect Biochem. 16, 851–877.

Kramer, K.J., Muthukrishnan, S., 1997. Insect chitinases: molecularbiology and potential use as biopesticides. Insect Biochem. Mol.Biol. 27, 887–900.

Kramer, K.J., Dziadik-Turner, C., Koga, D., 1985. Chitin metabolismin insects. In: Kerkut, G.A., Gilbert, L.I. (Eds.), ComprehensiveInsect Physiology, Biochemistry and Pharmacology. Integument,Respiration and Circulation, 3. Pergamon Press, Oxford, pp. 75–115.

Kramer, K.J., Corpuz, L., Choi, H., Muthukrishnan, S., 1993. Sequenceof a cDNA and expression of the genes encoding epidermal andgut chitinases of Manduca sexta. Insect Biochem. Mol. Biol. 23,691–701.

Kramer, K.J., Muthukrishnan, S., Johnson, L., White, F., 1997. Chitin-ases for insect control. In: Carozzi, N., Koziel, M. (Eds.), Advancesin Insect Control: The Role of Transgenic Plants. Taylor andFrancis Publ, Bristol, PA, pp. 185–193.

Kubelka, V., Altmann, F., Marz, L., 1995. The asparagine-linkedcarbohydrate of honeybee venom hyaluronidase. Glycoconjugate J.12, 77–83.

Langsford, M.L., Gilkes, N.R., Singh, B., Moser, B., Miller, R.C.,Warren, R.A.J., Kilburn, D.G., 1987. Glycosylation of bacterial cel-lulases prevents proteolytic cleavage between functional domains.FEBS Lett. 25, 163–167.

Limón, M.C., Margolles-Clark, E., Benı́tez, T., Penttilä, M., 2001.Addition of substrate-binding domains increases substrate-bindingcapacity and specific activity of a chitinase from Trichoderma harz-ianum. FEMS Microbiol. Lett. 198, 57–63.

Linder, M., Terri, T.T., 1997. The roles and function of cellulose-bind-ing domains. J. Biotechnol. 57, 15–28.

Linder, M., Salovuori, I., Ruohonen, L., Teeri, T.T., 1996. Characteriz-ation of a double cellulose-binding domain. Synergistic high affin-ity binding to crystalline cellulose. J. Biol. Chem. 271, 21268–21272.

Lu, Y., Zen, K.C., Muthukrishnan, S., Kramer, K.J., 2002. Site-directed mutagenesis and functional analysis of active site acidicamino acid residues D142, Dl44 and El46 in Manduca sexta(tobacco hornworm) chitinase. Insect Biochem. Mol. Biol. 32,1369–1382.

Marchal, I., Jarvis, D.L., Cacan, R., Verbert, A., 2001. Glycoproteinsfrom insect cells: sialylated or not? Biol. Chem. 382, 151–159.

Mikitani, K., Sugasaki, T., Shimada, T., Kobayashi, M., Gustafsson,J.A., 2000. The chitinase gene of the silkworm, Bombyx mori, con-tains a novel Tc-like transposable element. J. Biol. Chem. 225,37725–37732.

Morais, V.A., Costa, M.T., Costa, J., 2002. N-glycosylation of recom-binant human fucosyltransferase III is required for its in vivo fold-ing in mammalian and insect cells. Biochim. Biophys. Acta 1619,133–138.

Morlais, I., Severson, D.W., 2001. Identification of a polymorphicmucin-like gene expressed in the midgut of the mosquito, Aedesaegypti, using an integrated bulked segregant and differential dis-play analysis. Genetics 158, 1125–1136.

Nagano, H., Orengo, C.A., Thornton, J.M., 2002. One fold with manyfunctions: the evolutionary relationships between TIM barrel famil-ies based on their sequences, structures and functions. J. Mol. Biol.321, 741–765.

Neuhaus, J.M., 1999. Plant chitinases (PR-3, PR-4, PR-4, PR-8, PR-11). In: Datta, S.K., Muthukrishnan, S. (Eds.), Pathogenesis-Related Proteins in Plants. CRC Press, New York, pp. 77–106.

Patil, R.S., Ghormade, V., Deshpande, M.V., 2000. Chitinolyticenzymes: an exploration. Enzyme Microbial Tech. 26, 473–483.

Paulson, J.C., 1989. Glycoproteins: what are the sugar chains for?Trends Biochem. Sci. 14, 272–276.

Quentin, M., Ebbelaar, M., Derksen, J., Mariani, C., Van der Valk,H., 2002. Description of a cellulose-binding domain and a linkersequence from Aspergillus fungi. Appl. Microbiol. Biotechnol. 58,658–662.

Raikhel, N.V., Lee, H.-I., Broekaert, W.F., 1993. Structure and func-tion of chitin-binding proteins. Annu. Rev. Plant Physiol. PlantMol. Biol. 44, 591–615.

Receveur, V., Czjzek, M., Schülein, M., Panine, P., Henrissat, B.,2002. Dimension, shape, and conformational flexibility of a twodomain fungal cellulase in solution probed by small angle X-rayscattering. J. Biol. Chem. 277, 40887–40892.

Rogers, S., Wells, R., Rechsteiner, M., 1986. Amino acid sequencescommon to rapidly degraded proteins: the PEST hypothesis.Science 234, 364–368.

Royer, V., Fraichard, S., Bouhin, H., 2002. A novel putative insectchitinase with multiple catalytic domains: hormonal regulation dur-ing metamorphosis. Biochem. J. 366, 921–928.

Shen, Z., Jacobs-Lorena, M., 1999. Evolution of chitin-binding pro-teins in invertebrates. J. Mol. Evol. 48, 341–347.

Shimahara, K., Takiguchi, Y., 1988. Preparation of crustacean chitin.In: Wood, W.A., Kellogg, S.T. (Eds.), Methods in Enzymology,vol. 161, Academic Press, California, pp. 417–423.

Shinoda, T., Kobayashi, J., Matsui, M., Chinzei, Y., 2001. Cloningand functional expression of a chitinase cDNA from the commoncutworm, Spodoptera litura, using a recombinant baculovirus lack-ing the virus-encoded chitinase gene. Insect Biochem. Mol. Biol.31, 521–532.

Srisodsuk, M., Reinikainen, T., Pentilä, M., Teeri, T., 1993. Role ofthe interdomain linker peptide of Trichoderma reesei cellobiohyd-rolase I in its interaction with crystalline cellulose. J. Biol. Chem.268, 20756–20761.

Suetake, T., Tsuda, S., Kawabata, S., Miura, K., Iwanaga, S., Hikichi,K., Nitta, K., Kawano, K., 2000. Chitin-binding proteins in invert-ebrates and plants comprise a common chitin-binding motif. J. Biol.Chem. 275, 17929–17932.

Suzuki, K., Taiyoji, M., Sugawara, N., Nikaidou, N., Hernissat, B.,Watanabe, T., 1999. The third chitinase gene (ChiC) of Serratiamarcescens 2170 and the relationship of its product to other bac-terial chitinases. Biochem. J. 343, 587–596.

Suzuki, M., Fujimoto, W., Goto, M., Morimatsu, M., Syuto, B., Iwan-aga, T., 2002. Cellular expression of gut chitinase mRNA in thegastrointestinal tract of mice and chickens. J. Histochem. Cyto-chem. 50, 1081–1089.

Taira, T., Ohnuma, T., Yamaguchi, T., Aso, Y., Ishiguro, M., Ishihara,M., 2002. Antifungal activity of rye (Secale cereale) seed chitin-ases: the different binding manner of class I and class II chitinasesto fungal cell walls. Biosci. Biotechnol. Biochem. 66, 970–977.

Tarentino, A.L., Plummer, T.H., 1994. Enzymatic deglycosylation of


asparagine-linked glycans: purification, properties, and specificityof oligosaccharide-cleaving enzymes from Flavobacterium menin-gosepticum. Methods Enzymol. 230, 44–57.

Tellam, R.L., 1996. Protein motifs in filarial chitinases: an alternativeview. Parasitol. Today 12, 291–292.

Tellam, R.L., Wijffels, G., Willadsen, P., 1999. Peritrophic matrix pro-teins. Insect Biochem. Mol. Biol. 29, 87–101.

Tellam, R.L., Eisemann, C., Casu, R., Pearson, R., 2000. The intrinsicperitrophic matrix protein peritrophin-95, is also secreted from lar-vae of Lucilia cuprina as a highly immunogenic soluble protein.Insect Biochem. Mol. Biol. 30, 9–17.

Tellam, R.L., Vuocolo, T., Eisemann, C., Briscoe, S., Riding, G.,Elvin, C., Pearson, R., 2003. Identification of an immuno-protectivemucin-like protein, peritrophin-55, from the peritrophic matrix ofLucilia cuprina larvae. Insect Biochem. Mol. Biol. 33, 239–252.

Terwisscha van Scheltinga, A.C., Hennig, M., Dijkstra, B.W., 1996.The 1.8 Å resolution structure of hevamine, a plantchitinase/lysozyme and analysis of the conserved sequence andstructure motifs of glycosyl hydrolase family 18. J. Mol. Biol. 2621 (8), 243–257.

Uchiyama, T., Katouno, F., Nikaidou, N., Nonaka, T., Sugiyama, J.,Watanabe, T., 2001. Roles of the exposed aromatic residues incrystalline chitin hydrolysis by chitinase A from Serratia marces-cens 2170. J. Biol. Chem. 44, 41343–41349.

Venegas, A., Goldstein, J.C., Beauregard, K., Oles, A., Abdulhayoglu,N., Fuhrman, J.A., 1996. Expression of recombinant microfilarialchitinase and analysis of domain function. Mol. Biochem. Parasitol.78, 149–159.

Wilson, B.H., 2002. Glycosylation of proteins in plants and invert-ebrates. Curr. Opin. Struct. Biol. 12, 569–577.

York, W.S., Darvill, A.G., McNeil, M., Stevenson, T.T., Albersheim,P., 1985. Isolation and characterization of cell walls and cell wallcomponents. Meth. Enzymol. 118, 3–40.

Zhang, H., Huang, X., Fukamizo, T., Muthukrishnan, S., Kramer, K.J.,2002. Site-directed mutagenesis and functional analysis of an activesite tryptophan of insect chitinase. Insect B

Date post:	01-Feb-2021
Category:	Documents
Upload:	others
View:	1 times
Download:	0 times

Properties of catalytic, linker and chitin-binding domains of insect … · 2005. 10. 28. ·...

Documents