Provided by the author(s) and University College Dublin ... E2 R… · (PPT), but not the ER...

Provided by the author(s) and University College Dublin Library in accordance with publisher

policies. Please cite the published version when available.

Title Estrogen increases expression of the human prostacyclin receptor within the vasculature

þÿ�t�h�r�o�u�g�h� �a�n� �E�R�±�-�d�e�p�e�n�d�e�n�t� �m�e�c�h�a�n�i�s�m

Authors(s) Turner, Elizebeth C.; Kinsella, B. Therese

Publication date 2010-02-26

Publication information Journal of Molecular Biology, 396 (3): 473-486

Publisher Elsevier

Link to online version http://dx.doi.org/10.1016/j.jmb.2010.01.010

Item record/more information http://hdl.handle.net/10197/3162

Publisher's statement þÿ�T�h�i�s� �i�s� �t�h�e� �a�u�t�h�o�r ��s� �v�e�r�s�i�o�n� �o�f� �a� �w�o�r�k� �t�h�a�t� �w�a�s� �a�c�c�e�p�t�e�d� �f�o�r� �p�u�b�l�i�c�a�t�i�o�n� �i�n� �J�o�u�r�n�a�l� �o�f�

Molecular Biology. Changes resulting from the publishing process, such as peer review,

editing, corrections, structural formatting, and other quality control mechanisms may not be

reflected in this document. Changes may have been made to this work since it was

submitted for publication. A definitive version was subsequently published in Journal of

Molecular Biology, 396 (3): 473-486 DOI 10.1016/j.jmb.2010.01.010.

Publisher's version (DOI) 10.1016/j.jmb.2010.01.010

Downloaded 2021-03-19T06:57:18Z

The UCD community has made this article openly available. Please share how this access

benefits you. Your story matters! (@ucd_oa)

© Some rights reserved. For more information, please see the item record link above.

https://twitter.com/intent/tweet?via=ucd_oa&text=DOI%3A10.1016%2Fj.jmb.2010.01.010&url=http%3A%2F%2Fhdl.handle.net%2F10197%2F3162

Turner EC & Kinsella BT. J Mol Biol. (2010), 396(3):473-86.

1

Estrogen increases expression of the human prostacyclin receptor within the vasculature

through an ERαααα-dependent mechanism.

Running Title: Prostacyclin Receptor Gene Regulation by Estrogen

Elizebeth C. Turner and B. Therese Kinsella*

UCD School of Biomolecular and Biomedical Sciences, UCD Conway Institute of Biomolecular

and Biomedical Research, University College Dublin, Belfield, Dublin 4, Ireland.

*Corresponding author: Tel: 353-1-7166727; Fax 353-1-2837211

Email: [email protected]


2

Abstract Prostacyclin and the prostacyclin receptor (IP) are implicated in mediating many of the

atheroprotective effects of estrogen in both humans and in animal models but through unknown

mechanisms. Hence, herein the influence of estrogen on IP gene expression in endothelial

EA.hy926, human erythroleukemia 92.1.7 and primary human (h) aortic smooth muscle (1o hAoSM)

cells was investigated. Estrogen increased hIP mRNA levels, promoter (PrmIP)-directed reporter

gene expression and cicaprost-dependent cAMP generation in all cell types, effects that were

abrogated by actinomycinD and the general estrogen receptor (ER)-α/ERβ antagonist ICI 182,780.

Furthermore, the ERα-selective agonist 4,4’,4”-(4-Propyl-[1H]-pyrazole-1,3,5-triyl)trisphenol

(PPT), but not the ERβ-agonist 2,3-bis(4-Hydroxyphenly)-propionitrile, significantly increased hIP

mRNA and PrmIP-directed gene expression. Deletional and mutational analysis of PrmIP

uncovered an evolutionary conserved estrogen-response element (ERE) while electrophoretic

mobility shift, antibody-supershift and chromatin immunoprecipitations assays confirmed the direct

binding of ERα, but not ERβ, to PrmIP both in vitro and in vivo. Moreover, immunofluorescence

microscopy corroborated that estrogen and PPT increased hIP expression in 1o hAoSMCs. In

conclusion, the hIP gene is directly regulated by estrogen that largely occurs through an ERα-

dependent transcriptional mechanism and thereby provides critical insights into the role of

prostacyclin/hIP in mediating the atheroprotective effects of estrogen within the human vasculature.

Key Words: Prostacyclin Receptor, gene expression, transcription, Estrogen-response element

(ERE), promoter.


3

Introduction

The prostanoid prostacyclin plays a central role in haemostasis, acting as a potent inhibitor

of platelet aggregation and as an endothelium-derived vasodilator 1; 2

. The prostacyclin receptor (IP)

is abundantly expressed throughout the vasculature, including in platelets/megakaryocytes,

macrophages, vascular endothelial and smooth muscle cells, various other tissues including the

heart, kidney, lung, thymus, spleen and in sensory neurons of the dorsal root ganglion 2; 3

. The IP is

primarily coupled to Gs/adenylyl cyclase activation, mediating prostacyclin inhibition of platelet

aggregation and vascular tone 2; 3

.

The cardioprotective effects of prostacyclin within the myocardium and vasculature are well

documented 4; 5

. Alterations in the levels of prostacyclin, its synthase or receptor, the IP, are

associated with a range of vascular dysfunctions including stroke and myocardial infarction 6; 7

.

Multiple and frequent single nucleotide polymorphisms occur within the coding sequence of the

human IP that correlate with predisposition to cardiovascular (CV) disease including enhanced

intimal hyperplasia and platelet activation in deep vein thrombosis 8. As a major product of

cyclooxygenase (COX)-2, prostacyclin acts as a potent pro-inflammatory mediator and is

abundantly produced during myocardial ischemia and hypoxia, offering cardioprotection 9; 10

.

Recognition of the importance of prostacyclin for haemostasis and CV integrity has been critically

highlighted by various clinical trials that established that certain COXIBs, the sub-class of non-

steroidal anti-inflammatory drugs that selectively inhibit COX2, depress prostacyclin generation

predisposing patients to increased risk of thrombotic stroke and myocardial infarction 11; 12

. While

IP-/-

null mice display normal vascular function, they exhibit enhanced thrombotic tendency in

response to vascular injury in addition to reduced acute inflammatory responses 3.

The protective role of estrogens in the heart and vasculature have also been established and

gender-specific differences in the incidence of CV disease occur both clinically and in animal

studies 5. For example, hormone/estrogen replacement therapy can prevent the primary onset of

coronary artery disease in post-menopausal women 5, although such effects are not without

controversy 13; 14

. The effects of estrogen are largely mediated through its binding to one of two

estrogen receptor (ER)α and β subtypes, members of the nuclear receptor superfamily 15; 16

. ERα

and ERβ display distinct patterns of expression and biological function largely acting as

transcription factors to modulate expression of target genes by either direct binding to the estrogen-

responsive element (ERE) with the consensus 5’-GGTCAnnnTGACC-3’ palindromic sequence 17

or by indirect interaction with other transcription factors, such as Sp1 and Ap1 15

. Ligand-activated

ERs may, in turn, recruit co-activators such as CBP/p300, SRC-1, TIF2 or co-repressors including

N-CoR and SMRT 18; 19

.


4

In addition to such classic genomic regulation by estrogen and analogues, more rapid non-

genomic effects also occur and it is thought that some of these CV protective actions may be

mediated by direct effects on the vessel wall 5; 16; 20

. Consistent with this, there is accumulating

evidence that many of the cardio-protective effects of estrogen are mediated due to its increased

synthesis & release of the endothelial-derived vasodilators nitric oxide and prostacyclin 21

. For

example, estrogen induces the synthesis and expression of COX1, COX2 and prostacyclin synthase,

resulting in up to 6-fold increases in systemic prostacyclin levels. Moreover, in the female low

density lipoprotein receptor null mice (LDLR-/-

), estrogen stimulated both COX2 expression and

prostacyclin formation resulting in a substantial atheroprotection 22

. In the same study, further

disruption of the IP gene abrogated the atheroprotective effects of estrogen and accelerated

atherogenesis in the double LDLR-/-

/IP-/-

null mouse 22

. However, despite this, the actual molecular

basis of the role of the IP in mediating such estrogen-induced atheroprotection remains to be

established. Moreover, it is currently unknown whether estrogen may directly, or indeed indirectly,

affect IP expression levels possibly accounting for such effects 22

and hence, critically, remains to

be investigated.

The overall aim and rationale of the current study is to address this deficit by characterizing

the hIP gene, focusing primarily on delineating the mechanism determining its aforementioned role

in mediating the response to estrogen within the vasculature. Herein, we have uncovered a

consensus cis-acting ERE in the hIP promoter critical for the transcriptional regulation of hIP

expression by estrogen in a host of cells of vascular origin, including in the human endothelial

EA.hy926 and megakaryocytic human erythroleukemia (HEL) 92.1.7 cell lines 23

and cultured

primary human aortic smooth muscle cells (1o

hAoSMCs). The data outlined provide compelling

evidence that the hIP gene is a direct target of estrogen that occurs through an ERα-dependent

mechanism and, accordingly, not only provides a molecular genetic basis for understanding the

modes of regulation of hIP expression in health and disease but also for the combined protective

roles of estrogen and prostacyclin within the CV system.


5

Results

Estrogen-regulation of hIP Expression in EA.hy926 and HEL 92.1.7 cells.

The incidence of CV disease is less pronounced in women than men and this difference

narrows post-menopause, consistent with the widely acknowledged atheroprotective actions of

estrogens in pre-menopausal females 20; 24; 25

. However the underlying mechanisms of cardio-

protection are largely unknown. In recent animal studies 22; 26

, the cardioprotective effects of

estrogen in LDLR-/-

mice were shown to be mediated in part by COX2-derived prostacyclin release.

Furthermore, the anti-atherogenic effects of estrogen were abrogated in IP-/-

null mice and

atherogenesis accelerated in double LDLR-/-

/IP-/-

null mice 22

. The rationale of the current study

was to establish whether estrogen may directly or indirectly regulate the human prostacyclin

receptor (hIP) expression, providing a possible molecular basis accounting for some or all of these

effects 22; 25

.

Initially, RT-PCR analysis was used to examine possible regulation of hIP mRNA

expression by 17β-estradiol (E2) in the human endothelial EA.hy926 and megakaryocytic HEL

92.1.7 cell lines, where the E2-responsive COX2 and -non-responsive GAP3’DH transcripts served

as controls. Quantitative real-time RT-PCR analysis established that E2-treatment increased hIP

mRNA in EA.hy926 (2.5-fold, P < 0.0001; Figure 1A) and HEL (1.3-fold, P = 0.008; Figure 1B)

cells, while pre-incubation with the transcriptional inhibitor actinomycin D (ActD), but not with the

translational inhibitor cycloheximide (CHX), completely abrogated the E2-induction of hIP mRNA

expression (Figure 1A & 1B, respectively). Moreover, E2 also resulted in significant increases in

COX2 mRNA in both cell types but did not affect GAP3’DH mRNA expression (Supplemental

Figure 1).

Previous studies have defined the human IP promoter (here-on-in referred to as PrmIP) as

nucleotides -2427 to -744, relative to the translational start codon (+1) 23

. Genetic firefly luciferase

reporter assays were used herein to examine PrmIP-directed gene expression. Stimulation with E2

resulted in concentration-dependent increases of PrmIP-directed luciferase expression in EA.hy926

and HEL cells (10 nM; 2-fold, P < 0.0001 and 1.7-fold, P = 0.0006, respectively; Figure 1C & 1D).

In addition to its classic ERα- and/or ERβ-dependent genomic regulation, E2 can mediate more

rapid non-genomic effects such as through activation of GPR30, a member of the G protein coupled

receptor superfamily 27

, and activation of the mitogen activated protein kinase (MAPK) and

phosphatidyl inositol 3’ kinase (PI3’K)-dependent signalling cascades 27; 28

. Hence, to establish

whether those pathways might contribute to the E2-induction of PrmIP-directed gene expression, the

effect of the p42/p44 extracellular signal-regulated kinase (ERK) and the PI3’K inhibitors PD98059

and Wortmanin, respectively, was examined. While E2 led to a time-dependent increase in PrmIP-


6

directed gene expression in both EA.hy926 and HEL cells, neither PD98059 nor Wortmanin

significantly affected that expression in either cell type (Figure 1E & 1F). Furthermore, treatment

with either PD98059 and Wortmannin alone had no effect whatsoever on basal PrmIP-directed

luciferase expression in either cell type (Figure 1E & 1F). Hence, these data establish that hIP

gene expression is indeed up-regulated by E2 and that this occurs at the transcriptional level through

a possible ERα/ERβ-dependent mechanism.

Determination of Estrogen Receptor Specificity.

E2-induced changes in transcription through ERα and/or ERβ regulate expression of distinct

as well as overlapping sets of target genes 29

. Herein, immunoblot analysis confirmed endogenous

expression of both ERα and ERβ in EA.hy926 and HEL cells and that expression is increased by

E2-stimulation (Figure 2B & 2D, respectively). The non-selective ERα/ERβ antagonist ICI

182,780 abrogated the E2-induced increases in hIP mRNA (Figure 2A & 2C) and PrmIP-directed

luciferase expression (Figure 2E & 2F). Moreover, the ERα-selective agonist 4,4’,4”-(4-Propyl-

[1H]-pyrazole-1,3,5-triyl)trisphenol (PPT), but not the ERβ agonist 2,3-bis(4-Hydroxyphenly)-

propionitrile (DPN), increased hIP mRNA in EA.hy926 and HEL cells (Figure 2A & 2C; P =

0.0003 and P = 0.0005, respectively). Furthermore PPT, but not DPN, also increased PrmIP-

luciferase expression in both cell types (Figure 2E & 2F; P < 0.0001 and P = 0.002, respectively).

Ectopic expression of ERα also resulted in concentration-dependent increases in PrmIP-

directed luciferase expression in EA.hy926 (Figure 2G) and, to a lesser extent, in HEL (Figure 2H)

cells in response to E2. This cellular difference may possibly be explained by the relatively high

levels of endogenous ERα protein expression in HEL cells compared with EA.hy926 cells (Figure

2B & 2D). Over-expression of ERβ did not significantly affect PrmIP-directed luciferase

expression in either cell line (Figure 2G & 2H). Western blot analysis confirmed that both ERα

and ERβ were over-expressed to equivalent levels in the transfected EA.hy 926 and HEL cells.

As stated, the hIP is primarily coupled to Gs-mediated adenylyl cyclase activation leading to

agonist-dependent increases in cAMP generation2; 3

. Hence, herein, the effect of E2 on cAMP

generation in HEL and EA.hy926 cells in response to the selective IP agonist cicaprost was

examined. E2 significantly increased cicaprost-induced cAMP generation in both HEL (P = 0.0002,

ANOVA; Figure 2I & 2J) and EA.hy926 (P = 0.0002, ANOVA) cells. The non-selective

ERα/ERβ antagonist ICI 182,780 30

abrogated the E2-induced increases in cicaprost-dependent

cAMP generation in both cells types while PPT, but not the ERβ agonist DPN, increased cicaprost-

dependent cAMP generation in HEL (P = 0.0004, ANOVA; Figure 2I & 2J) and EA.hy 926 (P =

0.0002, ANOVA) cells. Taken together, these data indicate that ERα, but not ERβ, selectively


7

mediates E2-inductions in PrmIP-directed gene expression in endothelial EA.hy926 and

megakaryocytic HEL cells leading to functional increases in hIP expression in both cell types.

Identification of a Functional ERE within the PrmIP

Thereafter, 5’ deletional- and genetic reporter-analyses localized the E2-responsive region(s)

within PrmIP. Initially, consistent with recently reported data in HEL cells23

, progressive 5’

deletion of PrmIP identified the core basal promoter (-1022 to -895) and an upstream repressor

region (-1761 to -1682) in EA.hy926 cells (Figure 3). E2-treatment resulted in approximately 2-

fold increases in luciferase expression-directed by the PrmIP-, PrmIP1- and PrmIP2- subfragments

(P < 0.0001 in all cases; Figure 3) but did not affect luciferase expression by the smaller PrmIP3-,

PrmIP4-, PrmIP5-, PrmIP6- or PrmIP7-subfragments. More specifically, deletion of nucleotides -

1682 to -1575 resulted in a complete loss of E2-induced expression in both EA.hy926 (Figure 3)

and HEL (Supplemental Figure 2) cells, thereby localizing the E2-responsive region.

Bioinformatic analyses of PrmIP predicted a putative ERE between -1682 to -1575 (5’

nucleotide at -1654, containing a single nucleotide variation from the consensus ERE; Figure 4).

Hence, the effect of E2 on luciferase expression directed by PrmIP2 containing either that putative

ERE or it’s mutated ERE* equivalent (Figure 4) was examined. While E2-stimulation yielded a 2-

fold increase in PrmIP2-directed luciferase expression (P < 0.0001) in EA.hy926 cells, it had no

effect on gene expression directed by the equivalent PrmIP2 subfragment containing the mutated

ERE* (Figure 4A). Similarly, disruption of the ERE* completely inhibited the E2-responsiveness

of PrmIP2 in HEL cells (Figure 4B).

Electrophoretic mobility shift assays (EMSAs) and antibody shift assays further investigated

the presence and specificity of nuclear/transcription factors capable of binding the putative ERE

within PrmIP in vitro. Incubation of the biotinylated ERE probe, spanning nucleotides -1671 to -

1637, with nuclear extract from HEL cells resulted in the formation of a major DNA-protein

complex, designated C1, and a second more diffuse, slower migrating DNA-protein complex

designated C2 (Figure 5A, lane 2). Both C1 and C2 complexes were efficiently competed by an

excess of the corresponding non-labelled ERE probe (Figure 5A, lane 3). The specificity of

nuclear factor binding to the ERE probe was verified whereby a competitor based on a consensus

ERE sequence, but not on a randomised IP sequence, specifically competed both C1 and C2 DNA-

protein complexes (Figure 5A, lanes 4 and 5). Moreover, supershift assays employing anti-ERα

and anti-ERβ antibodies demonstrated specific and direct binding of ERα to the ERE probe of

PrmIP in HEL cells as evidenced by the presence of an additional intense supershifted complex,

whereas only a very weak ERβ-containing supershifted complex was evident (Figure 5A, lanes 6 &

7, respectively). As additional controls, it was determined that neither complex C1 nor C2 nor the


8

anti-ERα and anti-ERβ antibody- supershifted complex were generated by incubation of the ERE

probe with the nuclear extract dialysis buffer (NEDB; Supplemental Figure 3).

To investigate whether endogenous ERα and/or ERβ actually binds to PrmIP in vivo, ChIP

analysis was performed using anti-ERα and anti-ERβ specific antibodies. In vehicle-treated

EA.hy926 and HEL cells, PCR amplification yielded products from input chromatin and chromatin

recovered from the anti-ERα immunoprecipitates, but not from anti-ERβ or control normal rabbit

IgG immunoprecipitates (Figure 5B; upper panels). Moreover, E2-stimulation resulted in

significant increases in amplicons generated in the anti-ERα derived immunoprecipitations in both

EA.hy926 and HEL cells, while no amplicons were generated from anti-ERβ or control IgG

immunoprecipitates in either cell line (Figure 5B; lower panels). Additionally, PCR analysis using

primers for a non-specific region of PrmIP did not generate amplicons from ERα or ERβ

immunoprecipitates in either cell type (Figure 5C). Collectively, these data confirm that ERα, and

not ERβ, specifically binds to a functional ERE within PrmIP to mediate E2-induced upregulation of

hIP expression in both EA.hy926 and HEL cells.

E2-regulation of IP Expression in Primary Human Aortic Smooth Muscle Cells

To determine whether the critical E2-ERα-ERE-mediated regulation of PrmIP identified

herein in human vascular endothelial EA.hy926 and megakaryocytic HEL cell lines may occur

more widely within cells derived from the vasculature, the effect of E2 on hIP expression was also

investigated in primary human aortic smooth muscle cells (1o hAoSMCs).

Semi-quantitative RT-PCR confirmed E2 up-regulation of both hIP and COX2 mRNA

expression in 1o hAoSMCs (Figure 6A) while real-time RT-PCR revealed a 2.2-fold increase in E2-

induced hIP mRNA (P < 0.0001), an effect abolished by both ActD and ICI 182,780 (Figure 6C).

Immunoblot analysis confirmed that ERα, and to a lesser extent, ERβ are expressed in 1o hAoSMC

and both are increased in response to E2 (Figure 6B). Treatment with the selective ERα and ERβ

agonists PPT and DPN, respectively, confirmed that ERα mediates E2-upregulation of hIP mRNA

in 1o hAoSMCs (P < 0.0001; Figure 6C). Furthermore, E2 led to a 2.2-fold (P < 0.0001) increase

in PrmIP-directed luciferase expression in 1o hAoSMCs (Figure 6D), an affect completely

abrogated by ICI 182,780, while PPT, and not DPN, also significantly increased PrmIP-directed

luciferase expression (P = 0.0002; Figure 6D). The antagonist ICI 182,780 also abrogated the E2-

induced increases in cicaprost-dependent cAMP generation, while PPT, but not DPN, significantly

increased cicaprost-dependent cAMP generation in 1o hAoSMCs (P = 0.0002 and P = 0.0003,

respectively; Figure 6E). Moreover, ChIP analysis demonstrated that ERα, not ERβ, is capable of

direct binding to PrmIP in 1o hAoSMCs in vivo, and that binding is enhanced by E2, consistent with

findings in EA.hy926 and HEL cells (Figure 6F & 6G).


9

Thereinafter, indirect immunofluorescent staining of 1o hAoSMCs with an affinity purified

anti-IP antisera directed to it’s intracellular (IC)2 domain confirmed expression of endogenous hIP

on the plasma membrane and intracellular membranes and established that exposure to E2 for 24h

resulted in substantial increases in hIP levels (Figure 7A). The antigenic IC2 peptide completely

blocked specific immunodetection of the hIP, thereby further validating specificity of the anti-IP

antisera (Figure 7A). Expression of COX2 was also confirmed to be significantly increased by E2

and showed distinct perinuclear staining (Figure 7A), consistent with previous reports 31

.

Treatment with ICI 182,780 completely abrogated the E2-induced increase in both hIP and COX2

expression (Figure 7B) while the ERα and ERβ selective-agonists PPT and DPN, respectively,

demonstrated that the E2-induced expression of both hIP and COX2 mainly occurs through an ERα-

dependent mechanism (Figure 7B).

Collectively, data presented herein establish that E2-upregulates expression of the hIP in

several cell lineages derived from the human vasculature that occurs through direct binding of ERα

to a functional ERE within PrmIP. Such regulation of the hIP expression adds to the growing

appreciation of the importance of E2-mediated regulation of the COX-derived prostacyclin

metabolite and of its signalling & function within the vasculature.


10

Discussion

CV disease is the leading cause of morbidity and premature mortality, particularly in western

societies, but coronary heart disease develops on average 10 years later in women than in men.

This time delay has been partly attributed to the protective effects of female sex hormones, in

particular the estrogens 16; 20

. Mechanistic studies carried out in in vitro cell/tissue preparations and

in animal studies have demonstrated that both natural and synthetic estrogens exhibit anti-

inflammatory and vasoprotective effects 24; 32; 33; 34; 35

. Moreover, 17β-estradiol (E2) has been shown

to lead to rapid endothelium-dependent and -independent dilation of coronary arteries in both

women and men and to augment endothelium-dependent relaxation of coronary arteries ex vivo and

to improve endothelial function 36

. The endothelium-derived prostacyclin not only plays a critical

dynamic role in haemostasis and in the regulation of vascular tone but also, similar to E2, acts as a

critical cytoprotectant within the wider CV system 21; 37

. Expression of COX1, COX2 and

prostacyclin synthase and, consequently, synthesis of prostacyclin are significantly elevated in

response to E2 21

and compelling data generated in experimental animal models suggest that the

anti-atherogenic effects of E2 are mediated, at least in part, through the prostacyclin receptor/IP 22

.

Herein, the aim of the current study was to carry out a detailed mechanistic study with the specific

objective of seeking clarity vis a vis the possible regulation of IP expression by E2 as suggested, but

never actually demonstrated, from the numerous observations generated from such studies in both

humans and animals.

Stimulation with E2 resulted in the up-regulation of COX2 and hIP mRNA levels and

increased PrmIP-derived gene expression and cicaprost-dependent cAMP generation in both model

vascular endothelial (EA.hy926) and megakaryocytic (HEL 92.1.7) cells and 1o hAoSMCs. The

transcriptional inhibitor ActD and the non-selective ER antagonist ICI 182,780 completely

abrogated any E2-stimulatory effects on hIP expression in all cell lines. Moreover, the translational

inhibitor CHX and the MAPK and PI3’K inhibitors PD98059 and Wortmannin did not abrogate E2-

stimulatory effects on hIP expression in both EA.hy 926 and HEL cells. Collectively, these data

establish that E2-regulation of the hIP occurs through a transcriptional mechanism and not through

secondary events such as regulation of GPR30 and/or downstream activation of the MAPK or

PI3’K signalling.

These findings identify the hIP, as well as confirming COX2, as a bona fide target of E2 and

may help, at least partly, to explain the observations in IP-/-

null mice whereby the atheroprotective

effects of E2 are abrogated, highlighting a critical role for the hIP in mediating the cardioprotective

effects of E2 22

. To our knowledge, data presented herein is the first demonstration of (h)IP

regulation by estrogen within the vasculature.


11

The transcriptional effects of E2 are largely mediated through two distinct nuclear receptors,

ERα and ERβ, each encoded by unique genes but displaying distinct patterns of expression and

function in various tissues 17

. ERα is the predominant subtype expressed in the breast, uterus,

cervix, vagina and additional target organs whereas ERβ exhibits a more limited expression pattern

and is primarily detected in the ovary, prostate, testis, spleen, lung, hypothalamus and thymus 38; 39

.

To determine any possible ER subtype specificity in the E2-mediated up-regulation of the hIP, the

effect of the specific ERα and ERβ agonists was investigated. PPT, and not DPN, resulted in

significant increases in hIP mRNA, PrmIP-directed gene expression and cicaprost-dependent cAMP

generation in EA.hy926, HEL and 1o hAoSM cells suggesting an ERα-dependent mechanism.

Furthermore, immunofluorscence microscopy using selective anti-hIP antibodies corroborated these

findings showing E2-ERα-mediated increased expression of the hIP in 1o hAoSMCs and provides

evidence for similar modes of regulation of COX2 22

and hIP in response to E2 in the vasculature.

Notably, while the ERβ agonist DPN did show modest inductions in immunoreactive expression of

both COX2 and the hIP, ectopic expression of ERα, but not ERβ, significantly increased PrmIP-

directed gene expression in all cell types understudy strongly suggesting an ERα-specific

mechanism. Whether ERβ may regulate hIP gene expression in a cell-type specific manner or,

indeed, whether it may act as a competitor of ERα-regulated expression of the hIP, as occurs in the

case of the BRCA2 gene 40

, requires further investigation.

Stimulation of target gene expression in response to E2, or other ER agonists, largely occurs

through one of two mechanisms 17; 38

. One such mechanism, exemplified by E2-regulation of the

progesterone receptor 41

, occurs through ‘direct binding’ whereby the E2-liganded ER binds directly

to a specific ERE and interacts directly with co-activator proteins and components of the RNA

polymerase transcription initiation complex resulting in enhanced transcription. The second

mechanism is referred to as ‘tethering’ whereby ER interacts with other DNA-bound transcription

factor(s), and not DNA, stabilising DNA/protein interactions and increasing transcription. An

example of tethering is the interaction of ERα with Sp1, conferring E2-responsiveness to the LDL

receptor gene 42

.

The consensus cis-acting ERE was originally identified by aligning homologous sequences in

the 5’ flanking regions of the estrogen-regulated vitellogenin A1, A2, B1, B2 and apo-VLDLII

genes 43

. The minimal ERE sequence is a 13 bp palindromic inverted repeat (IR) with the

consensus 5’-GGTCAnnnTGACC-3’ 17; 44

, which can act in an orientation- and distance-

independent manner and, therefore, is defined as an enhancer element 44

. In the case of the ERα

subtype, extension of the length of the ERE palindrome with an A/T rich sequence, of

approximately 15 nucleotides, immediately flanking the 5’ ERE is particularly important in


12

determining its binding affinity17

. Herein, the site of action of E2 was localised to -1682 to -1575

within the PrmIP and bioinformatic analysis revealed a near perfect ERE at -1654 with 12 bp of the

13 bp palindromic sequence identical to the consensus ERE and, notably, also containing a 5’

flanking “A/T rich sequence”, optimal for ERα binding 17

. Moreover, the ERE and flanking 5’A/T

enriched-region were found to be highly conserved in a host of other species including within the

dog, bovine and horse IP promoters (Figure 4C).

Hence, herein we investigated whether the evolutionary conserved ERE at -1654 mediates the

E2-induction of PrmIP-directed gene expression. Stimulation with E2 led to significant increases in

PrmIP2-directed luciferase expression in EA.hy926 and HEL cells, but did not have an effect on

expression by those subfragments containing the mutated ERE*. Moreover, EMSA and antibody

supershifts confirmed the specific binding of ERα, and to a much lesser extent ERβ, in vitro.

Superseding these findings, ChIP analysis with fragmented chromatin from EA.hy926, HEL and 1o

hAoSM cells confirmed specific binding of ERα, and not ERβ, within the E2-responsive region of

PrmIP in vivo. Furthermore, E2-stimulation led to a significant increase in specific ERα-DNA

interaction in all cell types. Collectively, these data demonstrate that ERα serves as a trans-acting

factor critical for regulation of the hIP in response to E2 through a direct E2-ERα-ERE mechanism.

In conclusion, we have identified an evolutionary conserved cis-acting ERE critical for the

transcriptional regulation of the hIP in model and primary cells derived from the human vasculature

and confirm that the hIP gene is regulated by E2 through a direct ERα-ERE-dependent mechanism.

These data provide an important molecular genetic platform for understanding the critical role of

the hIP as a mediator of the atheroprotective effects of E2 and its wider contribution to mechanisms

of cardio-protection in humans. While it is appreciated that our studies are performed in cellular

based systems, these molecular genetic studies are indeed likely to reflect the more

physiological/clinical setting. Clinical trials involving E2, such as Women in Health Initiative

(WHI), have led to conflicting data regarding the clinical safety of HRT as a cardio-protectant, or

not, post-menopause 14

. In light of the fact that the data herein pertaining to the hIP adds to a

growing list of other proteins including COX1-, COX2- and prostacyclin synthase-associated with

the important vasodilator prostacyclin and which are also upregulated by E2, it is tempting to

propose that data from the E2 clinical trials might perhaps be re-evaluated or, indeed, any further

trials involving E2 may take a more detailed consideration of the prostanoid/prostacyclin-regulatory

pathways/systems, such as within the vasculature.


13

Materials & Methods

Materials

pGL3Basic, pRL-Thymidine Kinase (pRL-TK), and Dual Luciferase Reporter Assay System

were obtained from Promega Corporation and pCRE-Luc from Strategene. DMRIE-C was from

Invitrogen Life Technologies and Effectene from Qiagen. Anti-ERα (sc-7207x), anti-ERβ (sc-

8974x), normal rabbit IgG (sc-2027) and goat anti-rabbit horseradish peroxidise (sc-2204) were

obtained from Santa Cruz Biotechnology. Anti-HDJ-2 antibody was from Neomarkers. 4,4’,4”-(4-

Propyl-[1H]-pyrazole-1,3,5-triyl)trisphenol (PPT), 2,3-bis(4-Hydroxyphenly)-propionitrile (DPN)

and ICI 182,780 were all obtained from TOCRIS. ActinomycinD (ActD), 17β-estradiol,

cyclohexamide (CHX) and Wortmannin were from Sigma and PD98059 was obtained from

Calbiochem.

Cell Culture

Human erythroleukemic (HEL) 92.1.7 cells 45

, obtained from the American Type Culture Collection,

were cultured in RPMI 1640, 10 % fetal bovine serum (FBS). Human endothelial EA.hy926 cells 46

,

obtained from the Tissue Culture Facility at UNC Lineberger Comprehensive Cancer Centre,

Chapel Hill, NC, were cultured in DMEM, 10 % FBS. Primary human aortic smooth muscle cells

(1° h.AoSMCs) were purchased from Cascade Biologics (C-007-5C) and routinely grown in either

Smooth Muscle Cell Growth Medium 2 (Promocell GMBH, C-22062) supplemented with 0.5 ng/ml

epidermal growth factor, 2 ng/ml basic fibroblast growth factor, 5 µg/ml insulin, 5% FBS or in

M199, 10% FBS. All mammalian cells were grown at 37 oC in a humid environment with 5 % CO2

and were confirmed to be free of mycoplasma contamination.

Luciferase-based Genetic Reporter Plasmids

The plasmid pGL3B:PrmIP, encoding PrmIP (-2427 to -774, relative to the translation start codon

at +1) from the human prostacyclin receptor (IP) in the pGL3Basic reporter vector, in addition to

pGL3B:PrmIP1, pGL3B:PrmIP2, pGL3B:PrmIP3, pGL3B:PrmIP4, pGL3B:PrmIP5,

pGL3B:PrmIP6 and pGL3B:PrmIP7 were previously described 23

. Site-directed mutagenesis of the

ERE (-1654) from gGTCAagGTCAc to gTGCTagTGCTc was carried by Quik-ChangeTM

method

(Stratagene) using pGL3B:PrmIP2 as template and primers Kin724 (5'-

dCAAAATATGATTCCTGAAGTGCTAGTGCTCCAGAGCTTGGCCTGGGGC -3') and

complementary Kin725 to generate pGL3B:PrmIP2ERE

*. The fidelity of all plasmids was

confirmed by DNA sequence analysis.


14

Reverse transcriptase-polymerase chain reaction (RT-PCR)

Total RNA was isolated from 1o hAoSMCs, HEL 92.1.7 and EA.hy926 cells using TRIzol reagent

(Invitrogen Life Technologies). DNase 1-treated total RNA was converted to first strand (1o)

cDNA with MMLV RT (Promega). PCR primers were designed to specifically amplify hIP mRNA

sequences (5’-dGAAGGCACAGACGCACGGGA -3’, Nu -57 to -37; Kin264) and (5’-

dGGCGAAGGCGAAGGCATCGC -3’; Nu 294 to 275; Kin266) to generate a 348 bp amplicons

and hCOX2 mRNA sequences (5’- dATCTCAGTCTTGAAGCCAATT-3’, Nu 3119 to 3139;

DT121) and (5’-dGAGCTAAATAGCAGTCCTGAG3’, Nu 3339 to 3360; DT122) or, as an

internal control, to amplify glyceraldehyde-3-phosphate dehydrogenase (GA3’PDH) mRNA (467

bp) (5’-dTGAAGGTCGGAGTCAACG-3’; Nu 527-545; Kin291) and (5’-

dCATGTGGGCCATGAGGTC-3’; Nu 993-976; DT92). All primers were designed to span across

an intron such that only PCR products from 1o cDNA would be amplified, thereby eliminating

genomic artifacts. The levels of hIP mRNA expression were determined by measurement of PCR

product band intensities on densitometirc scans; in each case, expression levels are represented as a

ratio relative to GA3’PDH expression (i.e. hIP/GA3’PDH ± SEM, arbitrary units). Real-time

quantitative PCR was performed using the human prostaglandin I2 receptor (hIP) gene expression

assay (Hs00168765_m1) from Applied Biosystems as per the manufacturer’s instructions using a

7900HT Fast Real-time PCR system (Applied Biosystems).

Assay of Luciferase Activity

HEL 92.1.7 and EA.hy926 cells were co-transfected with various pGL3Basic-recombinant plasmids,

encoding firefly luciferase, along with pRL-TK, encoding renilla luciferase, using DMRIE-C

transfection reagent as previously described 23

. In the case of the 1o hAoSMCs, in brief, 24h prior

to transfection cells were plated in 6-well format to achieve 60-80 % confluency at time of

transfection and were co-transfected with recombinant pGL3Basic (2 µg) and pRL-TK (200 ng)

using 5 µl Effectene® reagent as per the manufacturer’s instructions (Qiagen). Medium was

supplemented 24h post-transfection with either 17β-estradiol (E2; 10 nM), 4,4’,4”-(4-Propyl-[1H]-

pyrazole-1,3,5-triyl)trisphenol (PPT; 100 nM), 2,3-bis(4-Hydroxyphenly)-propionitrile (DPN; 100

nM) and/or ICI 182,780 (ICI; 100 nM) or, as a control, with vehicle [PBS, 0.1% EtOH] for 24 h.

Alternatively, to examine the effect of MAPK and PI3’K inhibitors on E2-induced PrmIP-directed

gene expression the medium was supplemented with either PD98059 (PD; 10µM), wortmannin

(Wort; 400 nM) or, as a control, with vehicle [Veh, 0.01% DMSO] for 30 mins prior to stimulation

with 17β-estradiol (E2; 10 nM) for 0 to 24 h. Firefly and renilla luciferase activity was assayed 16h

later using the Dual Luciferase Assay System. To investigate the effect of over-expression of


15

ERα and ERβ on PrmIP2-directed luciferase expression, pcDNA3.1-ERα and pcDNA3.1-ERβ (0-

2.0 µg), or, as a negative control, pcDNA3.1, were transiently transfected into HEL, EA.hy926 or 1o

hAoSMCs, as described above, along with recombinant pGL3B:PrmIP2. Firefly and renilla

luciferase activity was assayed after 48h using the Dual Luciferase Assay System. Relative firefly

to renilla luciferase activities (arbitrary units) were calculated as a ratio and were expressed in

relative luciferase units (RLU).

A reporter gene assay was performed to investigate changes in the intracellular levels of

cAMP using the method described by Fitzgerald et al. 47

with minor modifications. In brief,

luciferase reporter pCRE-Luc (1 µg; Stratagene) was co-transfected with 50 ng pRL-TK into HEL,

EA.hy 926 and 1o AoSM cells. Cells were incubated 24h post-transfection with either vehicle (V;

PBS, 0.01% EtOH), E2 (10 nM ), E2 (10 nM) plus ICI 182,780 (100 nM), ICI 182,780 (100 nM),

PPT (100 nM) or DPN (100 nM) for 24h. Cells were treated 48h post-transfection with IBMX (100

µM) at 37 oC for 30 min and then stimulated with either vehicle (V; DMSO) or 1 µM cicaprost at

37 oC for 3h. Firefly and renilla luciferase activity was assayed 52 hr post-transfection using the

Dual Luciferase Assay System and expressed as a ratio (relative luciferase units; RLU).

Western Blot Analysis

Both endogenous and ectopic expression of ERα and ERβ proteins in HEL, EA.hy926 and 1o

hAoSM cells was confirmed by western blot analysis. Briefly, whole cell protein was resolved by

SDS-PAGE (10 % acrylamide gels) and transferred to polyvinylidene difluoride (PVDF) membrane

according to standard methodology. Membranes were screened using anti- ERα and anti- ERβ sera

in 5 % non fat dried milk in 1 x TBS (0.01 M Tris-HCl, 0.1 M NaCl, pH 7.4) for 2h at room

temperature followed by washing and screening using goat anti-rabbit horseradish peroxidise

followed by chemiluminescence detection. To confirm uniform protein loading, the blots were

stripped and rescreened with anti-HDJ-2 antibody (Neomarkers) to detect endogenous HDJ-2

protein expression. In all cases the relative levels of ERα/ERβ expression in vehicle- or E2-

incubated cells were normalized against HDJ-2 expression.

Electrophoretic Mobility Shift and Supershift Assays

Nuclear extract was prepared from HEL, EA.hy926 and 1o hAoSM cells essentially as previously

described 48

. The identity and sequence of the forward biotin-labelled oligonucleotide probe is as

follows: ERE probe; 5’-[Btn]d GATTCCTGAAGGTCAAGGTCACCAGAGCTTGGCCTG -3’;

Nu -1671 to -1637 of PrmIP. The sequence of the corresponding non-labelled complementary

oligonucleotide is inferred. The identities and sequences of the forward non-labelled competitor/non


16

competitors include (1). PrmIP ERE competitor; 5’-d

GATTCCTGAAGGTCAAGGTCACCAGAGCTTGGCCTG -3’; Nu -1671 to -1637 of PrmIP.

(2). Consensus ERE competitor; 5’-dGGATCTAGGTCACTGTGACCCCGGATC -3’. (3) Non-

specific competitor; 5’-dTGCGCCCGGCCTTCCATGCTCTTTGAC-3’. For electrophoretic

mobility supershift assays, nuclear extract (2 µg total protein) was pre-incubated with 3 µg of anti-

ERα or anti-ERβ sera for 1h at room temperature prior to the addition of the biotinylated ERE

probe. As additional controls, nuclear extract or nuclear extract dialysis buffer (NEDB; 20 mM

Hepes, pH 7.9, 20% glycerol, 100 mM KCl, 0.4 mM PMSF, 0.5 mM EDTA, 0.2 mM EGTA and

0.2 mM EGTA;48

) was pre-incubated either with the vehicle (-) or with anti-ERα and anti-ERβ sera

prior to incubation with the biotinylated ERE probe, as indicated.

ChIP analysis

Chromatin immunoprecipitation (ChIP) assays were performed as previously described 23

. PCR

analysis was carried out using 2-3 µl of ChIP sample as template or, as a positive control, with an

equivalent volume of a 1:20 dilution of the input chromatin DNA. Sequences of the primers used

for the ChIP PCR reactions and corresponding nucleotides within PrmIP include.

1. 5′-dGAGAGGTACCCAGCGGTGGTGGCTTGGCTGTG-3′ , Nu -1761 to -1729

2. 5′-dCTCTAAGCTTGGAGACTTCCATGGC-3′ , Nu -1555 to -1540

3. 5′-dGAGAGACGCGTAGCTACTCGGGAGGCTGAGGCAC-3′, Nu -774 to -740

4. 5′-dGAGAGGTACCACCCTGAGACAGCCCAGG-3′, Nu -1271 to -1243

Immunofluorescence Microscopy

A polyclonal anti-IP antibody directed to intracellular (IC)2 domain of the hIP (amino acid residues

CLSHPYLYAQLDGPR; IP peptide) was raised in rabbits following conjugation to the carrier

protein keyhole limpet haemacyanin according to standard procedures. Following affinity

purification on SulfoLink-conjugated IP peptide resin (Pierce), indirect immunofluorescent

detection of hIP and COX2 (anti-COX2; sc-1745) expression was determined in permeabilised

(3.7 % paraformaldehyde, 0.2 % triton-X) or, as controls, in non-permeabilised cells. As additional

controls, the anti-hIP antibody was pre-incubated with its cognate IP peptide (10 µg/ml) prior to

exposure to cells. In parallel, nuclei was counter-stained with 4,6-diamidino-2-phenyl-indole

(DAPI; 0.5 µg/ml, 1 min). All slides were imaged, at x 63 magnification, using Zeiss Imager.M1

AX10 microscope using AxioVision software (Version 4.4) for acquiring multichannel images with

filters appropriate for AlexaFluor488 and DAPI fluorescence.


17

Statistical Analysis

Statistical analysis of differences were analysed using the two-tailed Students’ unpaired t-test or, as

specifically indicated in the text, using two-way analysis of variance (ANOVA). All values are

expressed as mean ± standard error of the mean (SEM). P-values ≤ 0.05 were considered to

indicate statistically significant differences and *, **, ***, **** indicate P ≤. 0.05, 0.01, 0.001,

0.0001 for two-tailed Students’ unpaired t-test analysis and ### indicates P ≤ 0.001 for ANOVA

analysis, respectively.

Acknowledgements: The plasmids pcDNA3.1-ERα and pcDNA3.1-ERβ were kindly provided by

Dr Leigh Murphy, University of Manitoba, Canada. This work was supported by The Health

Research Board (RP2006/14) and Science Foundation Ireland (Grant No. SFI: 05/IN.1/B19).


18

References

1. Gryglewski, R. J. (2008). Prostacyclin among prostanoids. Pharmacol Rep 60, 3-11.

2. Narumiya, S., Sugimoto, Y. & Ushikubi, F. (1999). Prostanoid receptors: structures,

properties, and functions. Physiol Rev 79, 1193-226.

3. Sugimoto, Y., Narumiya, S. & Ichikawa, A. (2000). Distribution and function of prostanoid

receptors: studies from knockout mice. Prog Lipid Res 39, 289-314.

4. Ribeiro, L. G., Brandon, T. A., Hopkins, D. G., Reduto, L. A., Taylor, A. A. & Miller, R. R.

(1981). Prostacyclin in experimental myocardial ischemia: effects on hemodynamics,

regional myocardial blood flow, infarct size and mortality. Am J Cardiol 47, 835-40.

5. Tostes, R. C., Nigro, D., Fortes, Z. B. & Carvalho, M. H. (2003). Effects of estrogen on the

vascular system. Braz J Med Biol Res 36, 1143-58.

6. Bing, R. J. (2001). Myocardial ischemia and infarction: growth of ideas. Cardiovasc Res 51,

13-20.

7. Flavahan, N. A. (2007). Balancing prostanoid activity in the human vascular system. Trends

Pharmacol Sci 28, 106-10.

8. Patrignani, P., Di Febbo, C., Tacconelli, S., Douville, K., Guglielmi, M. D., Horvath, R. J.,

Ding, M., Sierra, K., Stitham, J., Gleim, S., Baccante, G., Moretta, V., Di Francesco, L.,

Capone, M. L., Porreca, E. & Hwa, J. (2008). Differential association between human

prostacyclin receptor polymorphisms and the development of venous thrombosis and intimal

hyperplasia: a clinical biomarker study. Pharmacogenet Genomics 18, 611-20.

9. McAdam, B. F., Catella-Lawson, F., Mardini, I. A., Kapoor, S., Lawson, J. A. & FitzGerald,

G. A. (1999). Systemic biosynthesis of prostacyclin by cyclooxygenase (COX)-2: the

human pharmacology of a selective inhibitor of COX-2. Proc Natl Acad Sci U S A 96, 272-7.

10. Sakai, A., Yajima, M. & Nishio, S. (1990). Cytoprotective effect of TRK-100, a

prostacyclin analogue, against chemical injuries in cultured human vascular endothelial cells.

Life Sci 47, 711-9.

11. Fitzgerald, G. A. (2004). Coxibs and cardiovascular disease. N Engl J Med 351, 1709-11.

12. Catella-Lawson, F. & Crofford, L. J. (2001). Cyclooxygenase inhibition and

thrombogenicity. Am J Med 110 Suppl 3A, 28S-32S.

13. Barrett-Connor, E., Mosca, L., Collins, P., Geiger, M. J., Grady, D., Kornitzer, M., McNabb,

M. A. & Wenger, N. K. (2006). Effects of raloxifene on cardiovascular events and breast

cancer in postmenopausal women. N Engl J Med 355, 125-37.

14. Smith, N. L., Heckbert, S. R., Lemaitre, R. N., Reiner, A. P., Lumley, T., Weiss, N. S.,

Larson, E. B., Rosendaal, F. R. & Psaty, B. M. (2004). Esterified estrogens and conjugated

equine estrogens and the risk of venous thrombosis. Jama 292, 1581-7.

15. Shang, Y. & Brown, M. (2002). Molecular determinants for the tissue specificity of SERMs.

Science 295, 2465-8.

16. Xing, D., Nozell, S., Chen, Y. F., Hage, F. & Oparil, S. (2009). Estrogen and mechanisms of

vascular protection. Arterioscler Thromb Vasc Biol 29, 289-95.

17. Klinge, C. M., Jernigan, S. C., Smith, S. L., Tyulmenkov, V. V. & Kulakosky, P. C. (2001).

Estrogen response element sequence impacts the conformation and transcriptional activity of

estrogen receptor alpha. Mol Cell Endocrinol 174, 151-66.

18. Dahlman-Wright, K., Cavailles, V., Fuqua, S. A., Jordan, V. C., Katzenellenbogen, J. A.,

Korach, K. S., Maggi, A., Muramatsu, M., Parker, M. G. & Gustafsson, J. A. (2006).

International Union of Pharmacology. LXIV. Estrogen receptors. Pharmacol Rev 58, 773-81.

19. Geserick, C., Meyer, H. A. & Haendler, B. (2005). The role of DNA response elements as

allosteric modulators of steroid receptor function. Mol Cell Endocrinol 236, 1-7.

20. Mackman, N. & Smyth, S. (2009). Cardiovascular disease in women. Arterioscler Thromb

Vasc Biol 29, 277-8.

21. Ospina, J. A., Krause, D. N. & Duckles, S. P. (2002). 17beta-estradiol increases rat

cerebrovascular prostacyclin synthesis by elevating cyclooxygenase-1 and prostacyclin

synthase. Stroke 33, 600-5.


19

22. Egan, K. M., Lawson, J. A., Fries, S., Koller, B., Rader, D. J., Smyth, E. M. & Fitzgerald, G.

A. (2004). COX-2-derived prostacyclin confers atheroprotection on female mice. Science

306, 1954-7.

23. Turner, E. C. & Kinsella, B. T. (2009). Transcriptional regulation of the human prostacyclin

receptor gene is dependent on Sp1, PU.1 and Oct-1 in megakaryocytes and endothelial cells.

J Mol Biol 386, 579-97.

24. Mendelsohn, M. E. (2002). Protective effects of estrogen on the cardiovascular system. Am J

Cardiol 89, 12E-17E; discussion 17E-18E.

25. Garcia Rodriguez, L. A., Egan, K. & FitzGerald, G. A. (2007). Traditional nonsteroidal anti-

inflammatory drugs and postmenopausal hormone therapy: a drug-drug interaction? PLoS

Med 4, e157.

26. Li, M., Kuo, L. & Stallone, J. N. (2008). Estrogen potentiates constrictor prostanoid

function in female rat aorta by upregulation of cyclooxygenase-2 and thromboxane pathway

expression. Am J Physiol Heart Circ Physiol 294, H2444-55.

27. Revankar, C. M., Cimino, D. F., Sklar, L. A., Arterburn, J. B. & Prossnitz, E. R. (2005). A

transmembrane intracellular estrogen receptor mediates rapid cell signaling. Science 307,

1625-30.

28. Kazi, A. A. & Koos, R. D. (2007). Estrogen-induced activation of hypoxia-inducible factor-

1alpha, vascular endothelial growth factor expression, and edema in the uterus are mediated

by the phosphatidylinositol 3-kinase/Akt pathway. Endocrinology 148, 2363-74.

29. Kian Tee, M., Rogatsky, I., Tzagarakis-Foster, C., Cvoro, A., An, J., Christy, R. J.,

Yamamoto, K. R. & Leitman, D. C. (2004). Estradiol and selective estrogen receptor

modulators differentially regulate target genes with estrogen receptors alpha and beta. Mol

Biol Cell 15, 1262-72.

30. Wijayaratne, A. L. & McDonnell, D. P. (2001). The human estrogen receptor-alpha is a

ubiquitinated protein whose stability is affected differentially by agonists, antagonists, and

selective estrogen receptor modulators. J Biol Chem 276, 35684-92.

31. Kaltschmidt, B., Linker, R. A., Deng, J. & Kaltschmidt, C. (2002). Cyclooxygenase-2 is a

neuronal target gene of NF-kappaB. BMC Mol Biol 3, 16.

32. Bakir, S., Mori, T., Durand, J., Chen, Y. F., Thompson, J. A. & Oparil, S. (2000). Estrogen-

induced vasoprotection is estrogen receptor dependent: evidence from the balloon-injured

rat carotid artery model. Circulation 101, 2342-4.

33. Chen, S. J., Li, H., Durand, J., Oparil, S. & Chen, Y. F. (1996). Estrogen reduces

myointimal proliferation after balloon injury of rat carotid artery. Circulation 93, 577-84.

34. Levine, R. L., Chen, S. J., Durand, J., Chen, Y. F. & Oparil, S. (1996).

Medroxyprogesterone attenuates estrogen-mediated inhibition of neointima formation after

balloon injury of the rat carotid artery. Circulation 94, 2221-7.

35. Mendelsohn, M. E. & Karas, R. H. (2007). HRT and the young at heart. N Engl J Med 356,

2639-41.

36. Sherwood, A., Bower, J. K., McFetridge-Durdle, J., Blumenthal, J. A., Newby, L. K. &

Hinderliter, A. L. (2007). Age moderates the short-term effects of transdermal 17beta-

estradiol on endothelium-dependent vascular function in postmenopausal women.

Arterioscler Thromb Vasc Biol 27, 1782-7.

37. Norel, X. (2007). Prostanoid receptors in the human vascular wall. ScientificWorldJournal 7,

1359-74.

38. Hall, J. M., Couse, J. F. & Korach, K. S. (2001). The multifaceted mechanisms of estradiol

and estrogen receptor signaling. J Biol Chem 276, 36869-72.

39. Couse, J. F., Lindzey, J., Grandien, K., Gustafsson, J. A. & Korach, K. S. (1997). Tissue

distribution and quantitative analysis of estrogen receptor-alpha (ERalpha) and estrogen

receptor-beta (ERbeta) messenger ribonucleic acid in the wild-type and ERalpha-knockout

mouse. Endocrinology 138, 4613-21.


20

40. Jin, W., Chen, Y., Di, G. H., Miron, P., Hou, Y. F., Gao, H. & Shao, Z. M. (2008). Estrogen

receptor (ER) beta or p53 attenuates ERalpha-mediated transcriptional activation on the

BRCA2 promoter. J Biol Chem 283, 29671-80.

41. Kraus, W. L., Montano, M. M. & Katzenellenbogen, B. S. (1994). Identification of multiple,

widely spaced estrogen-responsive regions in the rat progesterone receptor gene. Mol

Endocrinol 8, 952-69.

42. Li, C., Briggs, M. R., Ahlborn, T. E., Kraemer, F. B. & Liu, J. (2001). Requirement of Sp1

and estrogen receptor alpha interaction in 17beta-estradiol-mediated transcriptional

activation of the low density lipoprotein receptor gene expression. Endocrinology 142,

1546-53.

43. Walker, P., Germond, J. E., Brown-Luedi, M., Givel, F. & Wahli, W. (1984). Sequence

homologies in the region preceding the transcription initiation site of the liver estrogen-

responsive vitellogenin and apo-VLDLII genes. Nucleic Acids Res 12, 8611-26.

44. Klein-Hitpass, L., Ryffel, G. U., Heitlinger, E. & Cato, A. C. (1988). A 13 bp palindrome is

a functional estrogen responsive element and interacts specifically with estrogen receptor.

Nucleic Acids Res 16, 647-63.

45. Long, M. W., Heffner, C. H., Williams, J. L., Peters, C. & Prochownik, E. V. (1990).

Regulation of megakaryocyte phenotype in human erythroleukemia cells. J Clin Invest 85,

1072-84.

46. Suggs, J. E., Madden, M. C., Friedman, M. & Edgell, C. J. (1986). Prostacyclin expression

by a continuous human cell line derived from vascular endothelium. Blood 68, 825-9.

47. Fitzgerald, L. R., Mannan, I. J., Dytko, G. M., Wu, H. L. & Nambi, P. (1999). Measurement

of responses from Gi-, Gs-, or Gq-coupled receptors by a multiple response element/cAMP

response element-directed reporter assay. Anal Biochem 275, 54-61.

48. Coyle, A. T. & Kinsella, B. T. (2005). Characterization of promoter 3 of the human

thromboxane A receptor gene. A functional AP-1 and octamer motif are required for basal

promoter activity. FEBS J 272, 1036-53.


21

FIGURES

Figure 1: Effect of E2 on PrmIP-directed Gene Expression and Cicaprost-dependent cAMP

Generation in EA.hy926 and HEL cells.

Panels A & B: Quantitative real-time RT-PCR analysis of hIP relative to GA3’PDH mRNA

expression in EA.hy926 (Panel A) and HEL (Panel B) cells pre-incubated for 24h with either

vehicle (V), E2 (10 nM) and/or ActD (10 µg/ml) and CHX (20 µg/ml). Panel C & D: Effect of E2

(0 – 100 nM; 24h) on PrmIP-directed luciferase gene expression in EA.hy926 (Panel C) and HEL

(Panel D) cells (RLU ± SEM; n = 6). Panels E & F: Effect of MAPK and PI3K inhibitors,

PD98059 (PD; 10 µM; 0-24 h) and Wortmannin (Wort; 400 nM; 0-24 h) respectively, on E2 (10 nM;

0-24 h)-induced PrmIP-directed luciferase gene expression in EA.hy926 (Panel E) and HEL (Panel

F) cells (RLU ± SEM; n = 6). P-values ≤ 0.05 were considered to indicate statistically significant

differences and *, **, ***, **** indicate P ≤. 0.05, 0.01, 0.001, 0.0001 for two-tailed Students’

unpaired t-test analysis.


22


23

Figure 2: Effect of ER Ligand Specificity on hIP Expression in EA.hy926 and HEL cells

Panels A and C: Quantitative RT-PCR analysis of hIP relative to GA3’PDH mRNA expression in

EA.hy926 (Panel A) or HEL (Panel C) cells pre-incubated for 24h with vehicle (V; PBS, 0.01%

EtOH), E2 (10 nM), E2 (10 nM) plus ICI 182,780 (100 nM), ICI 182,780 (100 nM), PPT (100 nM)

or DPN (100 nM). Panels B & D: Immunoblot analysis of ERα, ERβ and HDJ-2 expression in

EA.hy926 (Panel B) and HEL (Panel D) cells pre-incubated for 24h with vehicle (V) or E2 (10 nM).

Relative levels of ERα/ERβ expression in vehicle- or E2-incubated cells normalized against HDJ-2

expression are indicated below panels. Panels E & F: Effect of ER ligands on PrmIP-directed

luciferase expression in EA.hy926 (Panel E) and HEL (Panel F) cells (RLU ± SEM; n = 6) where

cells were pre-incubated for 24h with drugs or vehicle as in Panels A/C. Panels G & H: Effect of

ectopic expression of ERα (0-2.0 µg) and ERβ (0-2.0 µg) on PrmIP-directed luciferase expression

in EA.hy926 (Panel G) and HEL (Panel H) cells (RLU ± SEM; n = 6). Lower Panels: Western

blot analysis of whole cell protein in G & H transfected with either the empty vector (C) or with

vectors encoding ERα or ERβ and screened with the respective anti-ERα and anti-ERβ antisera and,

as a protein loading control, anti-HDJ-2. Panels I & J: HEL cells were pre-incubated with vehicle

(V; PBS, 0.01% EtOH), E2 (10 nM), E2 (10 nM) plus ICI 182,780 (100 nM), ICI 182,780 (100 nM),

PPT (100 nM) or DPN (100 nM) for 24h and hIP-induced cAMP accumulation in response to

vehicle (V; PBS, 0.01 % DMSO) or cicaprost (1 µM) determined (RLU ± SEM; n = 3), where data

are represented as fold inductions in cAMP accumulation in Panel J. P-values ≤ 0.05 were

considered to indicate statistically significant differences and *, **, ***, **** indicate P ≤. 0.05,

0.01, 0.001, 0.0001 for two-tailed Students’ unpaired t-test analysis and ### indicates P ≤ 0.001 for

ANOVA analysis, respectively.


24

Figure 3: Localisation of an E2-Responsive Region within PrmIP by 5’ Deletion Analysis.

A schematic of the hIP genomic region, spanning nucleotides -2427 to +767, encoding PrmIP, exon

(E)1, intron (I)1 and E2, where +1 corresponds to the translational start site. Effect of E2 on PrmIP-,

PrmIP1-, PrmIP2-, PrmIP3-, PrmIP4-, PrmIP5-, PrmIP6- and PrmIP7-directed luciferase gene

expression in EA.hy926 cells pre-incubated for 24h with vehicle (V; PBS, 0.01 % EtOH) or E2 (10

nM; RLU ± SEM; n = 6). P-values ≤ 0.05 were considered to indicate statistically significant

differences and *, **, ***, **** indicate P ≤. 0.05, 0.01, 0.001, 0.0001 for two-tailed Students’

unpaired t-test analysis.


25

Figure 4: Identification of Putative ERE within PrmIP.

Panels A and B: A schematic of PrmIP2 in addition to the putative ERE, where the 5’ nucleotide is

indicated in brackets (-1654) and the actual sequence of the ERE and its mutated ERE* variant are

given. Effect of E2 on PrmIP2, PrmIP2ERE*

and PrmIP3-directed luciferase expression in EA.hy926

(Panel A) and HEL (Panel B) cells pre-incubated for 24h with either vehicle (V; PBS, 0.01% EtOH)

or E2 (10 nM; RLU ± SEM; n = 6). Panel C: Alignment of the putative estrogen-responsive region

of human PrmIP with horse, dog, bovine IP promoter orthologue sequences. The consensus ERE is

underlined in the human PrmIP sequence and highlighted by a grey box in the orthologues. P-values

≤ 0.05 were considered to indicate statistically significant differences and *, **, ***, **** indicate

P ≤. 0.05, 0.01, 0.001, 0.0001 for two-tailed Students’ unpaired t-test analysis.


26

Figure 5: EMSA and ChIP of ERαααα Binding to PrmIP.

Panel A: A schematic of PrmIP (-2427 to -774) in addition to the putative ERE, where the 5’

nucleotide (-1654) is indicated. EMSA and supershift assays were carried out using nuclear extract

from HEL cells and a biotin-labelled ERE probe, as indicated by the horizontal bar. Nuclear extract

was pre-incubated either with the vehicle (-) or with (+) non-labelled ERE probe, consensus ERE

competitor, non-specific competitor or with anti-ERα and anti-ERβ sera prior to incubation with

the biotinylated ERE probe, as indicated. Arrows to the left indicate DNA:protein complexes (C1 /

C2) and the star to the right indicates supershifted transcription factor:DNA complexes. Panels B

& C: ChIP analysis: a schematic showing the forward and reverse primers used to amplify either

the estrogen-responsive (-1761 to -1746; solid arrows; Panel B) or, as controls, downstream (-1271

to -1005; dashed arrows; Panel C) sub-fragments of the PrmIP genomic region from

immunoprecipitates of cross-linked chromatin from either EA.hy926 (Panel B) and HEL (Panel C)

cells pre-incubated for 24h with vehicle (V; PBS, 0.01 % EtOH) or E2 (10 nM). Images are

representative of three independent experiments.


27

Figure 6:

Regulation of hIP/PrmIP Expression in 1o hAoSMCs.

Panel A: Quantitative real-time RT-PCR analysis of COX2 and hIP relative to GA3’PDH mRNA

expression in 1o hAoSMCs pre-incubated for 24h with vehicle (V; PBS, 0.01 % EtOH) or E2 (10

nM). Panel B: Immunoblot analysis of ERα and ERβ expression in 1o hAoSMCs pre-incubated for

24h with vehicle (V) or E2 (10 nM). Relative levels of ERα/ERβ expression in vehicle- or E2-

incubated cells normalized against HDJ-2 expression are indicated. Panels C: Quantitative RT-

PCR analysis of hIP relative to GA3’PDH mRNA expression in 1o hAoSMCs pre-incubated for 24h

with vehicle (V), E2 (10 nM), E2 (10 nM) plus ActD (10 µg/ml), ActD (10 µg/ml), E2 (10 nM) plus

ICI 182,780 (100 nM), ICI 182,780 (100 nM), PPT (100 nM) or DPN (100 nM) for 24h (Relative

Expression ± SEM, n = 3). Panels D: Effect of ER ligands on PrmIP-directed luciferase expression

in 1o hAoSMCs pre-incubated for 24h with either vehicle (V), E2 (10 nM), E2 (10 nM) plus ICI

182,780 (100 nM), ICI 182,780 (100 nM), PPT (100 nM) or DPN (100 nM; RLU ± SEM; n = 6).

Panel E: 1o hAoSMCs were pre-incubated with vehicle (V; PBS, 0.01% EtOH), E2 (10 nM), E2 (10

nM) plus ICI 182,780 (100 nM), ICI 182,780 (100 nM), PPT (100 nM) or DPN (100 nM) for 24h

and hIP-induced cAMP accumulation in response to vehicle (V; PBS, 0.01 % DMSO)- or cicaprost

(1 µM) determined. Data are represented as fold inductions in cAMP accumulation. Symbols ###

represent P ≤ 0.001 for ANOVA analysis. Panel F & G: ChIP analysis: a schematic showing the

forward and reverse primers used to amplify either the estrogen-responsive (-1761 to -1746; solid

arrows; Panel F) or, as controls, downstream (-1271 to -1005; dashed arrows; Panel G) sub-

fragments of the PrmIP genomic region from immunoprecipitates of cross-linked chromatin from 1o

hAoSMCs pre-incubated for 24h with vehicle (V; PBS, 0.01 % EtOH; upper panels) or E2 (10 nM;

lower panels). Images are representative of three independent experiments. P-values ≤ 0.05 were

considered to indicate statistically significant differences and *, **, ***, **** indicate P ≤. 0.05,


28

0.01, 0.001, 0.0001 for two-tailed Students’ unpaired t-test analysis and ### indicates P ≤ 0.001 for

ANOVA analysis, respectively.

Figure 7: Immunofluorescence microscopy of human IP and COX2 expression in 1o

hAoSMCs.

Panel A & B: Immunofluorescence microscopy of 1o hAoSMCs pre-incubated for 24h with either

vehicle (V; PBS, 0.01 % EtOH), E2 (5 nM or 10 nM; Panel A) or with vehicle (V), E2 (10 nM), E2

(10 nM ) plus ICI 182,780 (100 nM), PPT (100 nM) or DPN (100 nM; Panel B) and

immunolabelled with either anti-hIP (upper panels) or anti-COX2 (lower panels) sera and

AlexaFluor488 conjugated anti-rabbit IgG (green), followed by counterstaining with DAPI (blue).

Upper and lower right images in Panel A: Immunoscreening of 1o hAoSMCs with anti-hIP pre-

blocked with the antigenic peptide (upper panel) or with the AlexaFluor488 conjugated anti-rabbit

IgG alone (lower panel). Images are representative of three independent experiments.


29


30

Supplementary Figures:

Supplementary Figure 1: Effect of E2 on hIP mRNA Expression in EA.hy926 and HEL cells.

Panel A & B: RT-PCR analysis of COX2, hIP or GA3’PDH mRNA expression in EA.hy926

(Panel A) and HEL (Panel B) cells pre-incubated for 24h with vehicle (V; PBS, 0.01 % EtOH) or

E2 (10 nM), where the bar charts represent mean fold inductions ± SEM (n = 3). P-values ≤ 0.05

were considered to indicate statistically significant differences and *, **, ***, **** indicate P ≤.

0.05, 0.01, 0.001, 0.0001 for two-tailed Students’ unpaired t-test analysis


31

Supplementary Figure 2: Localisation of an E2-Responsive Region within PrmIP by 5’

Deletion Analysis. A schematic of the hIP genomic region, spanning nucleotides -2427 to +767,

encoding PrmIP, exon (E)1, intron (I)1 and E2, where +1 corresponds to the translational start site.

Effect of E2 on PrmIP-, PrmIP1-, PrmIP2-, PrmIP3-, PrmIP4-, PrmIP5-, PrmIP6- and PrmIP7–

directed luciferase gene expression in EA.hy926 (Panel A) and HEL (Panel B) cells pre-incubated

for 24h with vehicle (V; PBS, 0.01 % EtOH) or E2 (10 nM; RLU ± SEM; n = 6). Results are

expressed as mean fold-induction of luciferase expression in E2- relative to vehicle-treated

EA.hy926 (Panel A) and HEL (Panel B) cells.


32

Supplementary Figure 3: EMSA and Supershift Assay of ERαααα Binding to PrmIP.

Panel A: A schematic of PrmIP (-2427 to -774) in addition to the putative ERE, where the 5’

nucleotide (-1654) is indicated. EMSA and supershift assays were carried out using nuclear extract

from HEL cells or, as controls, with the nuclear extract dialysis buffer (NEDB; 20 mM Hepes, pH

7.9, 20% glycerol, 100 mM KCl, 0.4 mM PMSF, 0.5 mM EDTA, 0.2 mM EGTA and 0.2 mM

EGTA;48

) and a biotin-labelled ERE probe, as indicated by the horizontal bar. For antibody

supershift assays, nuclear extract or NEDB was pre-incubated either with the vehicle (-) or with

anti-ERα and anti-ERβ sera prior to incubation with the biotinylated ERE probe, as indicated.

Arrows to the left indicate DNA:protein complexes (C1 / C2) and the star to the right indicates

supershifted transcription factor:DNA complexes. Images are representative of three independent

experiments.

Date post:	16-Oct-2020
Category:	Documents
Upload:	others
View:	0 times
Download:	0 times

Provided by the author(s) and University College Dublin ... E2 R… · (PPT), but not the ER...

Documents