British ]ournu1 of Haernatology, 1995. 89. 152-156 Rapid genotype analysis in type 2B von Willebrand’s disease using a universal heteroduplex generator NIGEL WOOD,’ GRAHAM R. sTANDEN,2 ELIZABETH w. MURRAY,3 DAVID LILLICRAP,3 LARS HOLMBERC,4 IAN R. PEAKE~ AND JEFFREY BIDWELL’ ‘University of Bristol Department of Transplantation Sciences, Homeopathic Hospital Site, Cotham, Bristol, U.K., Department of Haematology, Bristol Royal Infirmary, Bristol, U.K., 3Department of Pathology, Richardson Laboratory, Queen’s University, Kingston, Ontario, Canada, ’Department of Medicine and Pharmacology, University of Sheffield, Shefleld, U.K. Department of Paediatrics, University of Lund, University Hospital, Lund, Sweden, and 4 Received 15 Iuly 1994; accepted for publication 22 September 1994 Summary. A new diagnostic technique based on DNA heteroduplex analysis has been used to identify specific point mutations in the von Willebrand’s factor (vWF) gene of patients with von Willebrand’s disease type 2B. Molecular analysis in these patients has shown previously that their mutations are clustered in a short region of sequence in exon 28 of the vWF gene. The principle of the method involves heteroduplex formation between amplified genomic sequence containing the defect and an exon 28 vWF gene universal heteroduplex generator (UHG). The LJHG is a synthetic vWF gene exon 28 homologue which contains a number of sequence mismatches designed to generate allele specific heteroduplexes for each type 2B mutation. Indivi- dual mutant genotypes are identified by characteristic banding patterns following polyacrylamide minigel electro- phoresis. The technique is rapid, simple, inexpensive, and is ideally suited for adoption by non-specialist haematology laboratories for screening purposes. Keywords: von Willebrand’s disease, type 2B. genotype, mutations, heteroduplex. Von Wdebrand’s disease (vWD) is the most common inherited bleeding disorder (Ruggeri & Zimmerman, 1987). In the majority of cases patients have a simple quantitative deficiency of von Wdebrand factor (vWF): so-called vWF type 1 (Sadler, 1994). In approximately 20% of patients, however, a functional defect of vWF is present and is referred to as vWD type 2. vWD type 2B constitutes 5% of the total and is characterized by increased a ity of the mutant vWF for a specific platelet receptor, glycoprotein Ib (GPIb) (De Marco et al, 1987, 1990). The larger vWF multimers have higher reactivity with this receptor and are selectively cleared from the circulation (Ruggeri et al, 1982). Thrombocytopenia may also be present and is exacerbated by conditions which increase the synthesis and release of vWF. These include DDAVP administration (Holmberg et al, 1983), pregnancy (Rick et al, 1987) and surgery (Hutlin & Sussman, 1990). The GPIb-binding domain of vWF has been localized to a peptide fragment encoded by exon 28 of the vWF gene Correspondence: Dr G. R. Standen, Department of Haernatology. Bristol Royal Infumary. Bristol Bs2 8HW. (Fujimura et al, 1986: Mancuso et al, 1989). Analysis of this region in patients with vWD type 2B has revealed that almost all cases have specific single amino acid mutations in a short sequence between codon 540 and codon 578 (Cooney et al, 1991; Randi et al, 1991: LiIlicrap et al, 1991; Donner et al, 1992; Pietu et al, 1992). This region is contained within a large disulphide loop defined by an intrachain Cys (509)-Cys (695) disulphide bond. Four mutations account for nearly 85% of the type 2B vWD patients studied to date (Ginsburg & Sadler, 1993). Therefore screening for a small panel of mutations should have a high sensitivity for the detection of this subtype and should enable accurate diagnosis and classification of the disorder at the DNA level. A number of polymerase chain reaction (PCR)-based techniques for mutation detection have been described in recent years. These include sequence-specificoligonucleotide (SSO) typing (Angelini et al, 1986), the amplification refractory mutation system (ARMS) (Newton et al, 1989). single-strand conformation polymorphism (SSCP) analysis (Orita et al. 1989) and chemical cleavage methods (Cotton et al, 1988). We (N.W.. J.B.) have previously described the 152
Transcript
British ]ournu1 of Haernatology, 1995. 89. 152-156
Rapid genotype analysis in type 2B von Willebrand’s disease using a universal heteroduplex generator
NIGEL W O O D , ’ GRAHAM R. s T A N D E N , 2 ELIZABETH w. M U R R A Y , 3 DAVID LILLICRAP,3 LARS HOLMBERC,4
IAN R . P E A K E ~ AND JEFFREY BIDWELL’ ‘University of Bristol Department of Transplantation Sciences, Homeopathic Hospital Site, Cotham, Bristol, U.K., Department of Haematology, Bristol Royal Infirmary, Bristol, U.K., 3Department of Pathology, Richardson Laboratory, Queen’s University, Kingston, Ontario, Canada,
’Department of Medicine and Pharmacology, University of Sheffield, Shefleld, U.K. Department of Paediatrics, University of Lund, University Hospital, Lund, Sweden, and 4
Received 15 Iuly 1994; accepted for publication 22 September 1994
Summary. A new diagnostic technique based on DNA heteroduplex analysis has been used to identify specific point mutations in the von Willebrand’s factor (vWF) gene of patients with von Willebrand’s disease type 2B. Molecular analysis in these patients has shown previously that their mutations are clustered in a short region of sequence in exon 28 of the vWF gene. The principle of the method involves heteroduplex formation between amplified genomic sequence containing the defect and an exon 28 vWF gene universal heteroduplex generator (UHG). The LJHG is a synthetic vWF gene exon 28 homologue which contains a
number of sequence mismatches designed to generate allele specific heteroduplexes for each type 2B mutation. Indivi- dual mutant genotypes are identified by characteristic banding patterns following polyacrylamide minigel electro- phoresis. The technique is rapid, simple, inexpensive, and is ideally suited for adoption by non-specialist haematology laboratories for screening purposes.
Keywords: von Willebrand’s disease, type 2B. genotype, mutations, heteroduplex.
Von Wdebrand’s disease (vWD) is the most common inherited bleeding disorder (Ruggeri & Zimmerman, 1987). In the majority of cases patients have a simple quantitative deficiency of von Wdebrand factor (vWF): so-called vWF type 1 (Sadler, 1994). In approximately 20% of patients, however, a functional defect of vWF is present and is referred to as vWD type 2. vWD type 2B constitutes 5% of the total and is characterized by increased a i t y of the mutant vWF for a specific platelet receptor, glycoprotein Ib (GPIb) (De Marco et al, 1987, 1990). The larger vWF multimers have higher reactivity with this receptor and are selectively cleared from the circulation (Ruggeri et al, 1982). Thrombocytopenia may also be present and is exacerbated by conditions which increase the synthesis and release of vWF. These include DDAVP administration (Holmberg et al, 1983), pregnancy (Rick et al, 1987) and surgery (Hutlin & Sussman, 1990).
The GPIb-binding domain of vWF has been localized to a peptide fragment encoded by exon 28 of the vWF gene
Correspondence: Dr G. R. Standen, Department of Haernatology. Bristol Royal Infumary. Bristol Bs2 8HW.
(Fujimura et al, 1986: Mancuso et al, 1989). Analysis of this region in patients with vWD type 2B has revealed that almost all cases have specific single amino acid mutations in a short sequence between codon 540 and codon 578 (Cooney et al, 1991; Randi et al, 1991: LiIlicrap et al, 1991; Donner et al, 1992; Pietu et al, 1992). This region is contained within a large disulphide loop defined by an intrachain Cys (509)-Cys (695) disulphide bond. Four mutations account for nearly 85% of the type 2B vWD patients studied to date (Ginsburg & Sadler, 1993). Therefore screening for a small panel of mutations should have a high sensitivity for the detection of this subtype and should enable accurate diagnosis and classification of the disorder at the DNA level.
A number of polymerase chain reaction (PCR)-based techniques for mutation detection have been described in recent years. These include sequence-specific oligonucleotide (SSO) typing (Angelini et al, 1986), the amplification refractory mutation system (ARMS) (Newton et al, 1989). single-strand conformation polymorphism (SSCP) analysis (Orita et al. 1989) and chemical cleavage methods (Cotton et al, 1988). We (N.W.. J.B.) have previously described the
152
Rapid Genotype Analysis in vWD Type 2 B 153 appliGation of a new and technically simple mutation detection system based on DNA heteroduplex analysis (reviewed by Bidwell et al, 1994). The basis of allelic identification is heteroduplex formation between polymerase chain reaction products and a universal heteroduplex generator (UHG), an artificially constructed DNA molecule which mimics the genomic DNA sequence but which differs by a controlled number of nucleotide deletions or substi- tutions next to or including sites of defined mutation. Applications have included rapid matching of human HLA- DR-DW allotypes (Bidwell et al. 1993), classification of phenylketonuria genotypes (Wood et al, 1993b) and screening for specific b-globin chain mutations in sickle cell anaemia (Wood et al. 1993a). In this report we describe the application of UHG screening to the detection of four common point mutations in vWD type 2B.
MATERIALS AND METHODS
Construction of UHG. A specific UHG was designed to identify common vWD type 2B mutations within exon 28 of
w i I d type pseudogene UHG
w i I d type pseudogene 540insM *R543W *R545C UHG
wi ld type pseudogene W550C *V551L *V553M UHG
w i I d type pseiidogene P574L R578Q UHG
Table I. Mutations analysed by UHG technique.
Amino acid Nucleotide DNA source substitution substitution (reference)
R543W C3916T Lillicrap et al( l991) R545C C3922T Ran& et al( l991) V551L G3940C Donner et al(1991) V553M G3946A Lillicrap et al( l991)
the vWF gene (Fig 1). Two overlapping ‘longmers’ (1 1 7 and 120 bp in size), partially homologous to the vWF exon 28 sequence but containing two three-base deletions and two two-base substitutions (Fig l), were synthesized on an ABI 391A synthesizer using polystyrene support columns. The longmers were fused and amplified in a standard PCR reaction (see below) to obtain the expected 223 bp product. The product was electrophoresed on a 12% polyacrylamide gel (see below) and visualized by ethidium bromide staining.
531 533 535 537 539 541 543 545 547 549 530 532 534 536 538 540 542 544 546 548 F E V L K A F V V D M M E R L R I S Q K
GACCGGAAGCGACCGTCAGAGCTGCGGCGCATTGCCAGCCAGGTGAAGT D R K R P S E L R R
Fig 1. vWF gene exon 28 showing wild-type, pseudogene and UHG nucleotide sequence, sites of common type 2B mutations (*), oligoprimer annealing sites (=) and longmer overlap (===). The ’identifiers’ in the UHG consist of two three-base deletions (* * * in codons 544 and 551/ 552) and two two-base substitutions (GT -+ CA in codons 574/575 and GC + CG in codons 577/578). These were determined empirically but using guidelines reported previously (Bidwell et al. 1994).
154 Nigel Wood et a1 M.bp 1114 900
692 501
404
320
242
489
I - I
Heteroduplexes
iomoduplexes
Pig 2. Identification of vWD type 2B mutations using a universal heteroduplex generator. M = molecular weight markers VIII. Boehrimger Mannheim.
Following excision of the UHG fragment from the gel, the DNA was isolated by electroelution (ATTO Max Yield Electroelutor) and ethanol precipitation. The precipitate was dried, redissolved in 75p1 of sterile water and serial dilutions of the stock solution (40ng/pl) were made. A final dilution of the stock solution was found to give the most intense and specific product on re-amplification.
PCR ampl$cation. The two vWF oligoprimers used to prepare the UHG and amplify the patient’s genomic DNA were designed to specifically amplify exon 28 sequence rather than the vWF pseudogene on chromosome 22 (Fig 1). Amplifications (100 p1 total volume) were performed in an (NH4)2S04 based PCR buffer ( 1 6 m ~ (NH4)2SO4, 6 7 m ~ Tris-HC1 pH 8.8 (at 25”C), 0.01% (w/v) Tween, 1 . 5 m ~ MgC12) containing 0 . 5 ~ ~ of each primer and d ” s at a combined concentration of 200 p ~ . The PCR conditions
were initial denaturation at 94°C for 5 min followed by 32 cycles of 94°C for 1 min, 55°C for 1 min, 72°C for 1 min, and a final extension step of 72°C for 9min. Two units of thermostable DNA polymerase (Advanced Biotechnologies) were used to hot start the reactions. The products were electrophoresed on 2% agarose gels in 0.5 x Tris/borate/ EDTA (TBE) buffer and visualized using ethidium bromide. UHG heteroduplex analysis. Genomic DNA was obtained
from vWD type 2B patients with specific exon 28 mutations identified by direct nucleotide sequencing (Table I). A 229 bp fragment of the true gene was amplified and an aliquot of the PCR mix was combined with an aliquot of diluted UHG to give a final volume of 30 pl. The exact ratio in each case was defined by the intensity of the DNA bands on the agarose gel and the final ratio was adjusted to 1:l. The mixture was denatured at 94°C for 3 min before cooling to 3 7°C at a
1114 ”.””-
I I Fig 3. Schematic representation of heteroduplex banding patterns observed for
Control R543W V553M R545C V551L each type 2B mutation.
Rapid Genotype Analysis in vWD Type 2 B 155 contmlled rate over 30min. DNA heteroduplexes were resolved by electrophoresis for 90min at 200V on 12% non-denaturing polyacryamide gels (2.6% cross-linking) and specific banding patterns were visualized by ethidium bromide staining.
RESULTS
Heteroduplex banding patterns for the wild-type gene sequence and four common vWD type 2B point mutations are shown in Fig 2. The results are shown in schematic form in Fig 3. Genomic DNA from each patient genotyped by direct nucleotide sequencing gave two variable bands specific for the heterozygous mutant alleles and two common bands corresponding to the normal allele. Identical results for the R543W and R545C mutations were obtained for DNA derived from different patients. Rapidly migrating homoduplex bands are shown at the bottom of the gel.
DISCUSSION
In this report we describe a rapid technique for vWD type 2B genotyping which identifies four common point mutations within exon 28 of the human vWF gene. The method involves PCR amplification of the target exon and hybridiz- ation with a PCR-amplifiable synthetic DNA (UHG). The UHG contains ‘identiiers’ consisting of nucleotide deletions and substitutions contiguous with known mutation sites within the target exon. DNA heteroduplexes between the UHG and genomic sequence containing different type 2B mutations have altered electrophoretic mobilities due to changes in molecular conformation and charge properties. Individual mutant genotypes can therefore be clearly distinguished by characteristic banding patterns following electrophoresis on non-denaturing polyacrylarnide gels.
The UHG employed has been designed to identify several additional vWD type 2B mutations reported in the literature (see Fig 1) and further studies are underway to determine whether allele specific heteroduplexes are detected in these instances. It would also be of interest to determine whether previously undescribed type 2B mutations within the sequence covered by the UHG generate abnormal banding patterns in the absence of a contiguous ‘identifier’. Preliminary studies suggest that ‘identifiers’ may exert a significant conformation/charge effect at some distance from the mutation (Wood et al, 1994). However, the range of influence may depend upon a number of factors, including the nature of the UHG sequence mismatch and its position in relation to the primer sequences.
The UHG screening technique is ideally suited for genotyping inherited disorders in which recurring muta- tions are clustered within a reasonably short region of sequence. We have reported previously that the method provides a valuable tool for rapid genotype analysis in sickle- cell anaemias (Wood et al. 1993a). Preliminary studies suggest an additional role for screening selected p- thalassaemia mutations in well-defined population groups. The technique might also be expected to have practical
applications for rapid molecular diagnosis in vWD type 2A where virtually all reported mutations are localized in exon 28 of the vWF gene between codon 742 and codon 875 (Ginsburg & Sadler, 1993).
Diagnosis of vWD in the neonatal period is often difEcult. because plasma levels of factor VIII and vWF are elevated soon after birth. Rapid genotype diagnosis may be achieved by vWF gene tracking using intragenic variable number tandem repeat (VNTR) analysis, but prior family studies are required (Bignell et al, 1990). The UHG screening technique can be performed on small quantities of blood, including dried blood spots (Wood et al, 1993b), and can provide a direct approach to rapid neonatal diagnosis of vWD type 2B in the absence of pedigree studies.
The present study further illustrates the wide diagnostic potexitial of UHG-based heteroduplex technology (Bidwell et al, 1994). We have shown that the technique provides clear identification of at least four vWD type 2B genotypes which together constitute nearly 70% of cases so far reported (Ginsburg & Sadler, 1993). The method is inexpensive, simple to perform, and may be completed within one working day. It is therefore ideally suited for adoption by non-specialist coagulation laboratories as an initial screen- ing procedure for the diagnosis of this vWD variant.
ACKNOWLEDGMENT
We are grateful to Professor J. Evan Sadler for providing DNA for use in this study.
REFERENCES
Angelini. G., Du Preval. C., Gorski, J. & Mach, B. (1986) High- resolution analysis of the human HLA-DR polymorphism by hybridization with sequence-specac oligonucleotide probes. Proceedings of the National Academy of Sciences of the United States of America, 83, 4489-4493.
Bidwell, J.L., Clay. T.M.. Wood. N.A.P., Pursd, M.P., Martin, A.F.. Bradley, B.A. & Hui, K.M.. (1993) Handbook of HLA Typing Techniques (ed. by K. M. Hui and J. L. Bidwell), pp. 99-116. CRC Press, Boca Raton. Florida.
Bidwell. J., Wood. N.. Clay, T.. Pursall. M.. Culpan, D.. Evans, J . , Bradley, B., Tyfield, L.. Standen. G. & Hui. K. (1994) DNA heteroduplex technology. Advances in Electrophoresis, 7, 3 1 1-349.
Bignell. P., Standen. G.R., Bowen, D.J.. Peake. LR. & Bloom, A.L. (1990) Rapid neonatal diagnosis of von Wdebrands disease by use of the polymerase chain reaction. Lancet. 336, 638-639.
Cooney. K.A.. Nichols, W.C.. Bruck, M.E., Bahou, W.F., Shapiro. A.D., WalterBowie.E.J..Grainick,H.R.&Ginsburg.D.(1991)The molecular defect in type IIB von Willebrand disease. Journal of Clinical Investigation. 87, 1227-1233.
Cotton, R.G.H.. Rodrigues, N.R. &Campbell. R.D. (1988) Reactivity of cytosine and thymine in single-base-pair mismatches with hydroxylamine and osmium tetroxide and its application to the study of mutations. Proceedings of the National Academy of Sciences of the United States of America, 85, 4397-4401.
De Marco. L.. Mazzucato, M., Del Ben, M., Budde. U.. Frederici. A., Girolami. A. & Rugerri. Z.M. (1987) Type IIB von Willebrand factor with normal sialic acid content induces platelet aggregation in the absence of ristocetin. Journal of Clinical Investigation. 80,
De Marco. L.. Mazzucata. M.. DeRola, D., Casonata. A.. Federici. 475-482.
156 Nigel Wood et a1 A.B.. Grolami. A. & Ruggeri. Z.M. (1990) Distinct abnormalities in the interaction of p d e d type IIA and IIB von Willebrand factor with the two platelet binding sites, glycoprotein complexes Ib-IX and IIB-IIL4. Journal of Clinical Investigation, 86, 785-792.
Dormer, M.. Kristoffersson, C., Lenk, H.. Scheibel. E.. Dahlback. B.. Nilsson. I.M. & Holmberg, L. (1992) Type IIB von Willebrands disease: gene mutations and clinical presentation in nine famiIies from Denmark, Germany and Sweden. British Journal of Haematology. 82. 58-65.
Fujimura. Y.. Titani. K., Holland, L.Z.. Russell, S.R., Roberts, J.R., Elder, J.H., Ruggeri. Z.M. & Zimmerman. T.S. (1986) von Wdlebrand factor: a reduced and alkylated 52/48-kDa fragment beginning at amino acid residue 449 contains the domain interacting with platelet glycoprotein Ib. Journal of Biological Chemistry. 261, 381-385.
Ginsburg. D. & Sadler, J.E. (1993) Von Willebrand disease: a database of point mutations, insertions and deletions. Thrombosis and Haemostasis. 69, 177-184.
Holmberg. L.. Nilsson. LM., Borge. L., Gunnarsson. M. & Sjorin, E. (1983) Platelet aggregation induced by ldesamino-8+arginine vasopressin (DDAVP) in type IIB von Willebrand’s disease. New EnglandJournal of Medicine, 309, 816-821.
Hultin. M.B. & Sussman, 1.1. (1990) Postoperative thrombocyto- penia in type IIB von Willbrand disease. American Journal of Hematology. 33, 64-68.
Wcrap. D., Murray, E.W.. Benford. K.. Blanchette, V.S., Rivard, G.E.. Wensley. R. & Giles. A.R. (1991) Recurring mutations at CpG dinucleotides in the region of the von Willebrand factor gene encoding the glycoprotein Ib binding domain in patients with type W von Willebrand’s disease. British Journal of Haematology. 79.
Mancuso, D.J.. Tuley. E.A., Westtield, I.A.. Worrall, N.K., Shelton- InIoes. B.B.. Sorace. J.M.. Alevy. Y.G. & Evan Sadler. J. (1989) Structure of the gene for human von Willebrand factor. Journal of Biological Chemistry. 264, 19514-19527.
any point mutation in DNA. The amplification refractory mutation system (ARMS). Nucleic Acids Research, 17. 2503- 2516.
Orita M.. Iwahana. H.. Kanazawa. H.. Hayashi. K. & Sekiya. T. (1989) Detection of polymorphisms of human DNA by gel electrophoresis as single-stranded conformation polymorphisms. Proceedings of the National Academy of Sciences ofthe United States of America, 86, 2766-2770.
Pietu, G.. Ribba. A.S., de Paillette. L.. Cherel. G.. Lavergne. J.M.. Bahnak. B.R. & Meyer. D. (1992) Molecular study of von WiUebrand disease: identification of potential mutations in patients with type IIA and type IIB. Blood Coagulation and Fibrinolysis, 3, 415-421.
Randi. A.M., Rabinowitz, I., Mancuso. D.J.. Mannucci. P.M. & Evan Sadler, J. (1991) Molecular basis of von Wdlebrand disease type W. Journal of Clinical Investigation. 87, 1220-1226.
Rick, M.E.. Williams, S.B., Sacher, R.A. & McKeown, L.P. (1987) Thrombocytopenia associated with pregnancy in a patient with type IIB von Willebrand’s disease. Blood, 69, 786-789.
Ruggeri, Z.M.. Lombardi, L., Gatti. R., Bader, C., Vakecchi. C. & Zimmerman. R.S. (1982) Type W von Willebrands disease: differential clearance of endogenous versus transfused large multimer von Willebrand factor. Blood. 60, 1453-1456.
Ruggeri. Z.M. & Zimmerman, T.S. (1987) Willebrand factor and von Willebrand disease. Blood. 70,985-904.
Sadler. J.E. (1994) A revised classilkation of von Willebrand disease. Thrombosis and Haemostasis, 71, 520-525.
Wood, N., Standen. G.. Hows, J., Bradley, B. & Bidwell. J. (1993a) Diagnosis of sickle-cell disease with a universal heteroduplex generator. Lancet. 342, 1519-1520.
Wood. N.. Standen. G.. Old. J. & Bidwell, J. (1994) Optimization and properties of a UHG for genotyping of haemoglobins S and C. Human Mutation. in press.
Wood, N.. TyEeld. L. & Bidwell. J. (1993b) Rapid classification of phenylketonuria genotypes by analysis of heteroduplexes generated by PCR-amplifiable synthetic DNA. Human Mutation. 2,131-137.
