Real-Time PCR with an Internal Control for Detection of All KnownHuman Adenovirus Serotypes�
Marjolein Damen,1,2,3 Rene Minnaar,1 Patricia Glasius,1 Alwin van der Ham,1 Gerrit Koen,1Pauline Wertheim,1 and Marcel Beld1*
Laboratory of Clinical Virology, Department of Medical Microbiology, Academic Medical Centre, University of Amsterdam,Amsterdam, The Netherlands1; Laboratory of Medical Microbiology, OLVG, Amsterdam, The Netherlands2; and
Laboratory of the Municipal Health Service, GGD Amsterdam, Amsterdam, The Netherlands3
Received 25 March 2008/Returned for modification 17 May 2008/Accepted 7 October 2008
The “gold standard” for the diagnosis of adenovirus (AV) infection is virus culture, which is rathertime-consuming. Especially for immunocompromised patients, in whom severe infections with AV have beendescribed, rapid diagnosis is important. Therefore, an internally controlled AV real-time PCR assay detectingall known human AV serotypes was developed. Primers were chosen from the hexon region, which is the mostconserved region, and in order to cover all known serotypes, degenerate primers were used. The internalcontrol (IC) DNA contained the same primer binding sites as the AV DNA control but had a shuffled proberegion compared to the conserved 24-nucleotide consensus AV hexon probe region (the target). The IC DNAwas added to the clinical sample in order to monitor extraction and PCR efficiency. The sensitivity and thelinearity of the AV PCR were determined. For testing the specificity of this PCR assay for human AVs, aselection of 51 AV prototype strains and 66 patient samples positive for other DNA viruses were tested.Moreover, a comparison of the AV PCR method described herein with culture and antigen (Ag) detection wasperformed with a selection of 151 clinical samples. All 51 AV serotypes were detected in the selection of AVprototype strains. Concordant results from culture or Ag detection and PCR were found for 139 (92.1%) of 151samples. In 12 cases (7.9%), PCR was positive while the culture was negative. In conclusion, a sensitive,internally controlled nonnested AV real-time PCR assay which is able to detect all known AV serotypes withhigher sensitivity than a culture or Ag detection method was developed.
Today, 52 subtypes of adenoviruses (AV; family Adenoviri-dae, genus Mastadenovirus) are known to infect humans. Theyare transmitted by the fecal-oral route and the respiratoryroute and are associated with acute respiratory disease (ac-counting for 10% of febrile respiratory diseases in children),conjunctivitis, genitourinary infections, and infant gastroenter-itis. AV have proved to be associated with the induction ofmalignant tumors in animals; however, this correlation has notbeen shown in humans. Human AV serotyping is based onresistance to neutralization by antisera to other AV serotypes.Of the 52 known serotypes, 51 have been sorted into six sero-groups, based on their ability to agglutinate red blood cellsfrom different species; serotype 52 has been found only re-cently. Most AV diseases are caused by a few serotypes (1 to 7)usually producing only mild infections in the immunocompe-tent host. The agent causing the infection can be isolated fromstool samples during periods of no illness. This phenomenonhinders the establishment of a causal association of AV withdisease and limits the significance of the diagnostic detectionof these viruses. Based on virus culture studies, it is known thatdifferent serotypes of AV can cause different clinical syn-dromes; however, we may have underestimated the incidenceof AV disease in some patient groups because some strains aredifficult to culture (2, 15). Disseminated AV infections in im-munocompromised individuals have been reported to yield
high morbidity and mortality rates, especially among children(9, 10, 13, 18, 23, 26, 27). However, the epidemiology of AVdisease is hampered by the facts that the sensitivity of AVculture is sometimes low and most AV PCR assays do notdetect all known human AV types. These conclusions are sup-ported by the findings in a recent publication of Casas et al.showing some new associations between specific clinical syn-dromes and various human AV serotypes (4). For instance, forthe first time, a measles-like syndrome in persons previouslyvaccinated against measles was associated with AV serotypes 4and 5.
Disseminating AV infections can be diagnosed by the cul-ture of AV from specimens obtained from multiple body sites,but this method is time-consuming and not very sensitive (2,12, 16). The detection of AV DNA in serum or plasma by PCRhas been shown to predict disseminated AV infection veryreliably (7, 19). In recent years, several sensitive AV PCRassays have been developed (1, 5, 11, 14, 19, 20, 24). However,these PCR assays do not detect all known human AV types,they are nested PCRs, or they are not all internally controlled.The aim of our study was to develop an internally controlledreal-time PCR assay detecting all known human AV types.
MATERIALS AND METHODS
Viral strains. A selection of AV prototype strains of 51 AV serotypes waskindly provided by J. C. de Jong, Erasmus MC, Rotterdam, The Netherlands.
Clinical samples. One hundred fifty-one clinical samples from 96 patientssuspected of having AV infection were tested in the AV PCR. This selectioncomprised 86 fecal samples (10 AV culture negative and AV antigen positive, 36AV culture positive with an unknown AV antigen status, and 40 AV culture
negative and AV antigen negative), 62 respiratory samples (23 AV culturepositive and 39 AV culture negative), 2 skin swabs (1 AV culture positive and 1AV culture negative), and 1 cerebrospinal fluid (CSF) specimen (AV culturenegative).
For specificity testing, we used 41 EDTA plasma samples (2 PCR positive forBK virus, 6 PCR positive for cytomegalovirus [CMV], and 33 PCR positive forEpstein-Barr virus [EBV]), 4 urine samples PCR positive for BK virus, 13 fecalsamples (10 PCR positive for CMV and 3 PCR positive for EBV), and 8bronchoalveolar lavage (BAL) samples (5 PCR positive for CMV and 3 PCRpositive for EBV).
Viral culture. Clinical samples were cultured on human lung adenocarcinomaA549 cells, human diploid fibroblasts, tertiary monkey kidney cells, and Verocells. The viral cultures were examined twice weekly for the appearance of an(AV-specific) cytopathological effect. The identification of the isolates was per-formed according to the cytopathological effect in unstained cultures or thestaining seen after incubation with a specific monoclonal antibody (Dako,Glostrup, Denmark). In addition to virus culture, AV antigen detection (using anassay kit from Dako, Glostrup, Denmark) was performed with fecal samples inorder to detect AV types which are difficult to culture (e.g., AV types 40 and 41).Viral titers of serotypes were determined by 50% tissue culture infective dose(TCID50) analysis according to the Reed-Muench method (21).
Primers and probe. Primers from the hexon region of the AV were chosen.Forty-nine complete genomes representing all subgroups, as well as around 1,550hexon genes of different serotypes and isolates, were analyzed in the Vector NTIAdvance program (Invitrogen). The most conserved region of 103 bp was chosenas a target. In order to amplify all known types, the following degenerate primerswere constructed: a forward primer, 5�-CAGGACGCCTCGGRGTAYCTSAG-3�, and a reverse primer, 5�-GGAGCCACVGTGGGRTT-3� (where R is A or G,S is C or G, V is A, C, or G, and Y is C or T). The following 24-nucleotideconsensus probe sequence was chosen: 5�-CCGGGTCTGGTGCAGTTTGCCCGC-3�. Both the forward (n � 8) and reverse (n � 6) primers had maximumredundancy.
Alignments of sequences. All known complete genome sequences of AV werealigned using Vector NTI and ClustalW.
Construction of the AV-containing plasmid. AV DNA was purified from 200�l of AV type 2 (AV2) stock (1 in 1,000 dilution) in lysis buffer as described in“DNA purification” below. Amplification was performed with the followingnondegenerate target primers: forward, 5�-CAGGACGCCTCGGAGTACCTGAG-3�, and reverse, 5�-GGAGCCACCGTGGGGTT-3�. The 103-bp ampliconwas cloned into a PCRII-TOPO plasmid according to the instructions of themanufacturer (Invitrogen). Verification of the AV-containing plasmid was per-formed by sequencing. The concentration of AV DNA from the AV-containingplasmid was determined by evaluating the optical density at 260 nm, and serialdilutions of AV DNA were used to determine the sensitivity of the AV PCR.
Construction of the IC-containing plasmid. We designed two oligonucleotides(linkers) for the construction of internal control (IC) DNA, which weresynthesized by Applied Biosystems: adeno hexon linker 1 (5�-CAGGACGCCTCGGAGTACCTGAGCCGATGTGTCCGCCGTGGTCCCCTGGACCGAGACGTACTT-3�) and adeno hexon linker 2 (5�-GGAGCCACCGTGGGGTTTCTAAACTTGTTATTCAGGCTGAAGTACGTCTCGGTCCAGGGGACCACGG-3�). These two linkers, which together represent the same 103-bphexon region as that present in the in vitro AV DNA control, overlapped overa stretch of 28 nucleotides (underlined) and contained the same primerbinding sites as the in vitro AV DNA control (doubly underlined) but with ashuffled probe region (bold). The IC probe region allows discriminationbetween AV and IC DNA amplicons during amplification and detection. TheIC DNA control was constructed by the hybridization and elongation of 1 ngof linker 1 and 1 ng of linker 2 in a mixture of 2.5 U of AmpliTaq gold, 5 �gof bovine serum albumin, 1� PCR II buffer, deoxynucleoside triphosphates ata concentration of 200 �M each, and 3 mM MgCl2. The mixture was incu-bated for 10 min at 95°C, 5 min at 55°C, and 10 min at 72°C. The resultinghybrid was subsequently amplified with the nondegenerate target primers andcloned into a PCRII-TOPO plasmid according to the instructions of themanufacturer (Invitrogen). Verification of the IC-containing plasmid wasperformed by sequencing. The concentration of DNA was determined byevaluating the optical density at 260 nm.
DNA purification. The 51 prototypes were isolated alternately with negativecontrols by using the MagNA Pure (MP) system (Roche Diagnostics, Penzberg,Germany) as follows: 5 �l of each prototype together with 104 IC DNA copieswas mixed with 350 �l of MP lysis buffer. For isolation from the clinical samples,we used 200 �l of throat fluid, sputum, or plasma and 350 �l of MP lysis bufferor 50 �l of fecal material and 500 �l of MP lysis buffer. These mixtures were thensubjected to a vortex in an Eppendorf tube, left for 10 min at room temperature
(prelysis step), and subsequently centrifuged for 2 min at 13,000 rpm in anEppendorf centrifuge. Thereafter, 490 �l of supernatant was transferred into anMP sample cartridge together with 10,000 copies of IC DNA. Isolation was thenperformed with the MP system according to the protocol of the manufacturer(Roche Diagnostics, Penzberg, Germany) by using the total nucleic acid kit. TheDNA was finally eluted in 100 �l of MP elution buffer.
Competitive TaqMan PCR. Ten microliters of each eluate, containing 1,000copies of IC DNA, was used for the TaqMan PCR. The final PCR mixture (25�l) contained 12.5 �l of TaqMan Universal PCR master mix (ABI), 900 nMforward primer, 900 nM reverse primer, 200 nM target probe, 200 nM IC probe,and 400 ng of �-casein/�l (2). PCR was performed with an ABI Prism 7000sequence detection system as follows: 2 min at 50°C and 10 min at 95°C, followedby 45 cycles consisting of 15 s at 95°C and 1 min at 60°C. A signal was consideredto be relevant if a logarithmic curve was visible above the threshold for the targetand/or the IC.
Serial dilutions. Twelve (twofold) serial dilutions of plasmid containing AV2hexon DNA (AV2-plasmid DNA) and IC DNA in Tris-EDTA (pH 8.0) with 20ng/�l of calf thymus DNA (Sigma, The Netherlands) in a background of AV-negative throat fluid were made and tested by PCR after the extraction of DNAwith the MP system in order to test the lower limit of detection (LLOD) of theAV PCR. Furthermore, 12 (10-fold) serial dilutions of AV2-plasmid DNA in abackground of AV-negative plasma, with 104 copies of IC DNA in each dilution,were made in order to investigate whether there was an effect of competitionfrom the IC on the linearity and the LLOD of the assay.
RESULTS
Determination of the LLOD of the AV real-time PCR assay.To determine the LLOD of the AV real-time PCR assay, wespiked 200-�l aliquots of AV-negative throat fluid with de-creasing amounts of AV2-plasmid DNA, as well as IC DNA,before DNA purification by the MP system. DNA was eluted in100 �l, and 10 �l was used for real-time PCR. Twelve series oftwofold dilutions of AV DNA and IC DNA were tested. Asshown in Table 1, limiting dilutions of the AV DNA revealeda detection limit of 8 AV DNA copies in the PCR mixture, witha 50% hit rate (6 of 12 runs), resulting in an analytical detec-tion limit of 400 copies/ml. Limiting dilutions of the IC DNArevealed a detection limit of 16 IC DNA copies in the PCR
TABLE 1. LLODs for plasmids containing part of the AV2 hexongene DNA and IC DNAa
a The slope (resulting from a comparison between the number of copies in thePCR mixture and the hit rate) for AV2 hexon gene DNA was 3.68 � 0.13(mean � standard error of the mean), and that for IC DNA was 3.79 � 0.009.
mixture, with a 42% hit rate (5 of 12 runs), resulting in ananalytical detection limit of around 103 copies/ml (Table 1).
Determination of the linearity of the AV real-time PCRassay with a constant amount of IC. To determine the linearityof the AV real-time PCR assay, we spiked 200-�l samples ofAV-negative plasma with decreasing amounts of AV2-plasmidDNA. Before DNA purification by the MP system, every sam-ple was spiked with 104 copies of IC DNA. DNA was eluted in100 �l, and 10 �l of extracted DNA was used for real-timePCR, resulting in 103 copies of IC DNA per sample. Twelveseries of 10-fold dilutions of AV DNA were tested. The limit ofdetection of AV DNA in this setting was 100 AV DNA copiesin the PCR mixture, with a 100% hit rate (12 of 12 runs),resulting in a 100% quantitative limit of detection of 5 � 103
copies of AV DNA per ml (Table 2). The quantitative AVPCR has a linear dynamic range between 5 � 103 and 5 � 108
copies/ml, with a regression coefficient of 0.991 (Fig. 1).Determination of the efficiency of the AV real-time PCR
assay in comparison to the TCID50 method for representativeserotypes belonging to the six subgroups. In order to investi-gate if the redundancy of the primers influenced the efficiencyof amplification of prototypes representing all six subgroups,limiting dilutions of prototype 2 (subgroup C), prototype 4(subgroup E), prototype 7 (subgroup B), prototype 8 (sub-
group D), prototype 31 (subgroup A), and prototype 41 (sub-group F) strains were performed. No differences in amplifica-tion efficiency among the six subgroups were found, and overallthe PCR was more sensitive than the TCID50 titer determina-tion method (Table 3). In addition, an alignment of the de-duced amplicons of all known complete AV genomes is shownin Fig. 2. As the assay was intended to amplify all knownserotypes, the most conserved (hexon) region was chosen. De-generate primers were used, without the resulting amplicons’being significant enough to serve as a template for genotypingdifferences, because the overall level of homology of the am-plicons among the serotypes within each of the six subgroups ishigh.
Testing of the specificity of the AV real-time PCR assay. Thespecificity of the real-time AV PCR assay was examined bytesting 51 AV serotypes. The extraction of every single AVprototype was done alternately with negative extraction con-trols, and all samples contained IC DNA. Furthermore, 6EDTA plasma samples PCR positive for CMV, 33 plasmasamples PCR positive for EBV, 2 plasma samples PCR positivefor BK virus, 4 urine samples PCR positive for BK virus, 3 fecalsamples PCR positive for EBV, 10 fecal samples PCR positivefor CMV, 3 BAL samples PCR positive for EBV, and 5 BALsamples PCR positive for CMV were tested by the AV real-time PCR. All 51 AV prototype strain samples were found tobe positive for AV (Table 4) (the recently found serotype 52[17] was checked in silico, and a 100% match with the AV-specific primer and probe sequences described herein wasfound); 57 of the 61 clinical samples tested negative for AV,whereas 4 of 61 samples tested positive for AV. These sampleswere all obtained from hematology patients, and AV positivitywas confirmed by sequencing (results not shown). Negativeresults were not due to the presence of inhibitory substancessince the signals for the coextracted IC DNA were positive inall cases (Table 5).
Comparison of virus culture with AV real-time PCR forclinical specimens. A panel of 151 clinical samples was col-lected for the evaluation of the AV real time PCR. Cultureresults for these samples were already available. The panelcomprised 62 respiratory specimens (throat fluid, sputum, orBAL specimens), of which 23 were AV culture positive (1 ofthe 23 was also herpes simplex virus positive) and 39 were AV
TABLE 2. Linearity of extraction results for plasmid containingpart of the AV2 hexon gene DNA with 104 copies of IC DNA
No. of AVDNA
copies inPCR
mixture
No. of samplespositive for
AV DNA/totalno. of samples
(%)
Mean CTa
for AVDNA
No. of samplespositive for ICDNA/total no.of samples (%)
a The mean cycle threshold (CT) is the average CT value of 12 independentmeasurements.
b ND, not detectable.
FIG. 1. Standard curve for plasmid DNA containing part of theAV2 hexon gene. Twelve series of 10-fold dilutions of extracted plas-mid DNA containing part of the AV2 hexon gene, each with a constantlevel of 104 copies of IC DNA per dilution, were tested by PCR,resulting in a dynamic range of 5 � 103 to 5 � 108 copies/ml, with aregression coefficient of 0.991.
TABLE 3. Comparison of results from PCR and TCID50 methods
a The sensitivity of PCR for different serotypes was determined by using limitingdilutions and comparing the results to TCID50 titers expressed as log values. Oneserotype from each subgroup was used in both PCR and TCID50 analyses.
culture negative. Twenty-one of these 39 specimens were com-pletely culture negative, and the other samples were culturepositive for other viruses (enterovirus [EV], CMV, respiratorysyncytial virus [RSV], or influenza virus A). Twenty-two of 39AV culture-negative respiratory samples were from patientswho had an AV-positive sample obtained from another bodysite and/or on another sampling date.
Furthermore, 86 fecal samples were included in the analysis;36 were AV culture positive, 10 were AV culture negative butAV antigen positive by an enzyme-linked immunosorbent as-say (ELISA), and 40 were AV culture and AV antigen nega-tive. Twenty-eight of 40 specimens were completely culturenegative, 10 of 40 were EV culture positive, 1 of 40 was rota-virus positive by an ELISA, and 1 of 40 was positive for Clos-tridium toxin. Two skin swabs were included in the selection, ofwhich one was AV culture positive and one was EV culturepositive; one CSF specimen, which was completely culturenegative, was also included.
As depicted in Table 6, agreement between the results ofvirus culture (and antigen detection) and AV real-time PCRwas found for 139 of 151 clinical samples (92.1%). Concordantnegative results for 31 respiratory samples, 36 fecal samples, 1skin swab, and 1 CSF specimen (45.7%) were found. Concor-dant positive results for 23 respiratory samples, 36 fecal sam-ples, and 1 skin swab (39.7%) were found. Discordant resultsfor 12 clinical samples (7.9%) were found. Eight respiratoryspecimens and four fecal samples (7.9%) were negative by AVculture and positive by the AV real-time PCR. Four of the 12discrepancies were for samples from AV-infected patients(who had previous samples or other types of specimens thatwere culture positive); 7 of 12 were for samples that wereculture or ELISA positive for another viral pathogen (CMV,rotavirus, or RSV), and 1 of 12 was for a sample positive forClostridium toxin. In only one case (that of a sputum sample),the patient was not known to have an AV infection detected inother samples or on other test dates and no other pathogenwas cultured (Table 6).
DISCUSSION
The isolation of AV in cell culture, especially from respira-tory materials and feces, is still regarded as the diagnostic“gold standard.” The disadvantages of culture are, however,obvious—for example, labor-intensiveness, delays of days tosometimes weeks to obtain a positive result, and false negativ-ity. The latter can occur since some AV types (e.g., AV types40 and 41) are difficult to culture (8, 15). The recognition ofinvasive AV disease has been facilitated by the development ofAV PCR assays (14, 22, 24, 25). Only recently, we have learnedthat invasive AV disease can be an important complication instem cell recipients, especially children. However, the studieshave been performed with PCR assays which detect only asubset of AV types. The importance of other, less commonlyisolated AV types is not known. Furthermore, other groups ofpatients need to be tested for all known AV serotypes, forexample, solid-organ transplant recipients and other immuno-compromised patients, including adults as well as children.
Various AV PCR assays have been developed up to now;however, none could detect all known AV serotypes in oneassay together with an IC in a real-time setting. Various assayswere developed which were able to detect a subset of AVtypes, with or without an IC and either in a real-time setting ornot (1, 5, 11, 19, 24). Lion et al. (19) published a description ofan AV PCR approach which is able to detect all 51 serotypes;however, six separate assays (six primer-probe combinations)are needed for the detection of all serotypes. Heim et al. (14)and Sarantis et al. (22) describe a TaqMan PCR method whichis able to detect all 51 serotypes; however, in this assay, no ICis used. ICs are essential in diagnostic assays, because false-negative results or invalid results can be ruled out (3). More-over, the diagnosis of AV infections with one set of primers
FIG. 2. Alignments of deduced amplicon sequences from serogroups A to F. Alignments were made using Vector NTI. Primer binding sitesare indicated in yellow. The probe binding site is indicated in blue. Redundancies in the primer and probe binding sites are marked in red, whereasdashes represent identical nucleotides. Forward primer sequence, CAGGACGCCTCGGRGTAYCTSAG; probe sequence, CCGGTCTGGTGCAATTCGCCCGC; and reverse primer sequence, TTRGGGTGVCACCGAGG (where R is A or G, S is G or C, V is A, C, or G, Y is C or T,and B is T, G, or C.)
TABLE 4. Sensitivity of AV PCR for prototype strains of AVa
Subgroup (serotype�s) Source Result Target CTrange
and two probes for the detection of all known AV types andwith an IC in a real-time PCR is preferable to the otherapproaches and to our knowledge not previously documented.
The real-time AV PCR assay described in the present paperis sensitive, has a broad linear range, and is specific. Thesensitivity of the PCR assay was evaluated with limiting dilu-tions of both AV2-plasmid DNA and IC DNA. AV2-plasmidDNA and IC DNA in a background of AV-negative throatfluid were separately extracted by the MP system. Poissonstatistics predict that 63% of the reactions will be positive witha single copy of DNA in the PCR mixture (6). The differencesobserved in the detection rate between AV2-plasmid DNA andIC DNA are therefore probably within the normal test vari-ation.
The AV IC DNA was constructed from an AV2 stock. Weevaluated the sensitivity of the PCR for AV serotypes belong-ing to the six subgroups in serial dilutions in comparison to thatof the TCID50 method of determining titers, and no significantdifferences were found. Table 3 shows results for representa-tive serotypes from the six subgroups in comparison to TCID50
results. In all cases, the PCR was more sensitive. Moreover, thetitration of other serotypes showed similar trends, with com-parable R2 values. This finding suggests comparable sensitivi-ties of the PCR for the various subgroups and serotypes.
The PCR was tested against a selection of all known 51prototype strains with alternating negative controls: 6 EDTAplasma samples PCR positive for CMV, 33 plasma samplesPCR positive for EBV, 2 plasma samples PCR positive for BKvirus, 4 urine samples PCR positive for BK virus, 3 fecal sam-ples PCR positive for EBV, 10 fecal samples PCR positive forCMV, 3 BAL samples PCR positive for EBV, 5 BAL samplesPCR positive for CMV, and 151 clinical samples with knownculture results. The results for the panel of samples with the 51prototype strains showed that our PCR detected them all,whereas serotype 52 (17) showed 100% homology to ourprimer and probe sequences, making it likely to be detected bythe AV PCR assay described herein. The specificity of our AVreal-time PCR assay was tested with 66 samples positive forother DNA viruses, and 62 of 66 (94%) were AV PCR nega-tive. The four exceptions came from patients with a hemato-logical disease, and other materials from these patients werealso positive in the viral culture. Moreover, AV infection inthese particular samples was confirmed by sequencing.
Comparisons with virus culture showed good concordance,
and in 12 of 151 cases (7.9%), the PCR was positive while virusculture was negative. In 4 of these 12 cases, AV was culturedfrom another type of specimen from the same patient, earlieror later in the course of the disease. In these cases, it isconceivable that, due to better sensitivity, the PCR detectedAV while the virus culture was negative. In 6 of 12 cases,another viral pathogen (CMV or RSV) was cultured; in 1 of 12,the sample was positive for rotavirus antigen; and in 1 of 12,the cells were destroyed by Clostridium toxin. For these eightsamples, it is possible that the culture for AV was less sensitivethan the AV PCR assay due to the presence of other pathogens(resulting in overgrowth by another pathogen and/or low AVloads in patient samples because of interference).
In this paper, we present a newly developed internally con-trolled AV real-time PCR assay which is sensitive when testedon serial dilutions as well as when tested on clinical samples. Itis specific and able to detect all known AV serotypes with oneprimer pair-probe set. The assay is easy to use in diagnostic aswell as in research settings, because only one test run persample is required. Since the spectrum of AV disease is notfully known, our AV real-time PCR may be an important toolin further research and diagnostic protocols.
ACKNOWLEDGMENTS
We thank J. C. de Jong, Erasmus MC, Rotterdam, The Netherlands,for kindly providing the AV prototype strains and peer reviewing andNicholas Griffin for critically reviewing and reading the manuscript.
REFERENCES
1. Avalon, A., P. Perez, J. C. Aguilar, R. O. De Lejarazu, and J. E. Echevarría.2001. Rapid and sensitive diagnosis of human adenovirus infections by ageneric polymerase chain reaction. J. Virol. Methods 92:113–120.
2. Baldwin, A., H. Kingman, M. Darville, A. B. M. Foot, D. Grier, J. M.Cornish, N. Goulden, A. Oakhill, D. H. Pamphilon, C. G. Steward, and D. I.Marks. 2000. Outcome and clinical course of 100 patients with adenovirusinfection following bone marrow transplantation. Bone Marrow Transplant.26:1333–1338.
3. Beld, M., R. Minnaar, J. Weel, C. Sol, M. Damen, H. van der Avoort, P.Wertheim-van Dillen, A. van Breda, and R. Boom. 2004. Highly sensitiveassay for detection of enterovirus in clinical specimens by reverse transcrip-tion-PCR with an armored RNA internal control. J. Clin. Microbiol. 42:3059–3064.
4. Casas, I., A. Avellon, M. Mosquera, O. Jabado, J. E. Echevarria, R. H.Campos, M. Rewers, P. Perez-Brena, W. I. Lipkin, and G. Palacios. 2005.Molecular identification of adenoviruses in clinical samples by analyzing apartial hexon genomic region. J. Clin. Microbiol. 43:6176–6182.
5. Claas, E. C., M. W. Schilham, C. S. de Brouwer, P. Hubacek, M. Echavarria,A. C. Lankester, M. J. van Tol, and A. C. Kroes. 2005. Internally controlledreal-time PCR monitoring of adenovirus DNA load in serum or plasma oftransplant recipients. J. Clin. Microbiol. 43:1738–1744.
TABLE 6. Comparison of results of AV PCR and virus culture or antigen detection for different clinical specimens
a PCR-positive, culture-negative, ELISA-positive samples were fecal samples with AV types which are probably not culturable on routine cells. All had high AV DNAloads.
b Of the 12 PCR-positive, culture-negative samples, 4 were from AV-infected patients (with an earlier sample or different type of specimen culture positive), 7 wereculture or ELISA positive for another viral pathogen (CMV, rotavirus, or RSV), and 1 was positive for Clostridium toxin.
6. Diaco, R. 1995. Practical considerations for the design of quantitative PCRassays, p. 84–108. In M. A. Innis, D. H. Gelfland, and J. J. Sninsky (ed.), PCRstrategies. Academic Press, Inc., New York, NY.
7. Echavarria, M., M. Forman, M. J. van Tol, J. M. Vossen, P. Charache, andA. C. Kroes. 2001. Prediction of severe disseminated adenovirus infection byserum PCR. Lancet 358:384–385.
8. Echavarria, M., S. C. Ray, R. Ambinder, J. S. Dumler, and P. Charache.1999. PCR detection of adenovirus in a bone marrow transplant recipient:hemorrhagic cystitis as a presenting manifestation of disseminated disease.J. Clin. Microbiol. 37:686–689.
9. Echavarria, M., S. A. Kolavic, S. Cersovsky, F. Mitchell, J. L. Sanchez, C.Polyak, B. L. Innis, and L. N. Binn. 2000. Detection of adenoviruses (AdV)in culture-negative environmental samples by PCR during an AdV-associ-ated respiratory disease outbreak. J. Clin. Microbiol. 38:2982–2984.
10. Flomenberg, P., J. Babbitt, W. R. Drobyski, R. C. Ash, D. R. Carrigan, G. V.Sedmak, T. McAuliffe, B. Camitta, M. M. Horowitz, N. Bunin, and J. T.Casper. 1994. Increasing incidence of adenovirus disease in bone marrowtransplant recipients. J. Infect. Dis. 169:775–781.
11. Gu, Z., S. W. Belzer, C. S. Gibson, M. J. Bankowski, and R. T. Hayden. 2003.Multiplexed, real-time PCR for quantitative detection of human adenovirus.J. Clin. Microbiol. 41:4636–4641.
12. Hale, G. A., H. E. Heslop, R. A. Krance, M. A. Brenner, D. Jayawardene,D. K. Srivastava, and C. C. Patrick. 1999. Adenovirus infection after pedi-atric bone marrow transplantation. Bone Marrow Transplant. 23:277–282.
13. Heemskerk, B., A. C. Lankester, T. van Vreeswijk, M. F. C. Beersma, E. C. J.Claas, L. A. Veltrop-Duits, A. C. M. Kroes, J. M. J. J. Vossen, M. W.Schilham, and M. J. D. van Tol. 2005. Immune reconstitution and clearanceof human adenovirus viremia in pediatric stem-cell recipients. J. Infect. Dis.191:520–530.
14. Heim, A., C. Ebnet, G. Harste, and P. Pring-Akerblom. 2003. Rapid andquantitative detection of human adenovirus DNA by real-time PCR. J. Med.Virol. 70:228–239.
15. Horwitz, M. S. 2001. Adenoviruses, p. 2301–2326. In D. M. Knipe and P. M.Howley (ed.), Fields virology, 4th ed. Lippincott Williams and Wilkins,Philadelphia, PA.
16. Howard, D. S., G. L. Phillips II, D. E. Reece, R. K. Munn, J. Henslee-Downey, M. Pittard, M. Barker, and C. Pomeroy. 1999. Adenovirus infec-tions in hematopoietic stem cell transplant recipients. Clin. Infect. Dis.29:1494–1501.
17. Jones, M. S., II, B. Harrach, R. D. Ganac, M. M. A. Gozum, W. P. dela Cruz,B. Riedel, C. Pan, E. L. Delwart, and D. P. Schnurr. 2007. New adenovirusspecies found in a patient presenting with gastroenteritis. J. Virol. 81:5978–5984.
18. Leruez-Ville, M., V. Minard, F. Lacaille, A. Buzyn, E. Abachin, S. Blanche,F. Freymuth, and C. Rouzioux. 2004. Real-time blood plasma polymerasechain reaction for management of disseminated adenovirus infection. Clin.Infect. Dis. 38:45–52.
19. Lion, T., R. Baumgartinger, F. Watzinger, S. Matthes-Martin, M. Suda, S.Preuner, B. Futterknecht, A. Lawitschka, C. Peters, U. Potschger, and H.Gadner. 2003. Molecular monitoring of adenovirus in peripheral blood afterallogeneic bone marrow transplantation permits early diagnosis of dissemi-nated disease. Blood 102:1114–1120.
20. Pehler-Harrington, K., M. Khanna, C. R. Waters, and K. J. Henrickson.2004. Rapid detection and identification of human adenovirus species byAdenoplex, a multiplex PCR-enzyme hybridization assay. J. Clin. Microbiol.42:4072–4076.
21. Reed, L. J., and H. Muench. 1938. A simple method of estimating fiftypercent endpoints. Am. J. Hyg. 27:493–497.
22. Sarantis, H., G. Johnson, M. Brown, M. Petric, and R. Tellier. 2004. Com-prehensive detection and serotyping of human adenoviruses by PCR andsequencing. J. Clin. Microbiol. 42:3963–3969.
23. Schilham, M. W., E. C. Claas, W. van Zaane, B. Heemskerk, J. M. Vossen,A. C. Lankester, R. E. Toes, M. Echavarria, A. C. Kroes, and M. J. van Tol.2002. High levels of adenovirus DNA in serum correlate with fatal outcomeof adenovirus infection in children after allogeneic stem-cell transplantation.Clin. Infect. Dis. 35:526–532.
24. Seidemann, K., A. Heim, E. D. Pfister, H. Koditz, A. Beilken, A. Sander, M.Melter, K. Sykora, M. Sasse, and A. Wessel. 2004. Monitoring of adenovirusinfection in pediatric transplant recipients by quantitative PCR: report of sixcases and review of the literature. Am. J. Transplant. 4:2102–2108.
25. Vabret, A., S. Gouarin, M. Joannes, C. Barranger, J. Petitjean, S. Corbet, J.Brouard, F. Lafay, J. F. Duhamel, B. Guillois, and F. Freymuth. 2004.Development of a PCR- and hybridization-based assay (PCR AdenovirusConsensus) for the detection and the species identification of adenovirusesin respiratory specimens. J. Clin. Virol. 31:116–122.
26. van Tol, M. J. D., E. C. J. Claas, B. Heemskerk, L. A. Veltrop-Duits, C. S. deBrouwer, T. van Vreeswijk, C. C. Sombroek, A. C. M. Kroes, M. F. C.Beersma, E. P. A. de Klerk, R. M. Egeler, A. C. Lankester, and M. W.Schilham. 2005. Adenovirus infection in children after allogeneic stem celltransplantation: diagnosis, treatment and immunity. Bone Marrow Trans-plant. 35:S73–S76.
27. Walls, T., A. G. Shankar, and D. Shingadia. 2003. Adenovirus: an increas-ingly important pathogen in paediatric bone marrow transplant patients.Lancet Infect. Dis. 3:79–86.
JOURNAL OF CLINICAL MICROBIOLOGY, Mar. 2009, p. 875 Vol. 47, No. 30095-1137/09/$08.00�0 doi:10.1128/JCM.00016-09
AUTHOR’S CORRECTION
Real-Time PCR with an Internal Control for Detection of All Known HumanAdenovirus Serotypes
Marjolein Damen, Rene Minnaar, Patricia Glasius, Alwin van der Ham, Gerrit Koen,Pauline Wertheim, and Marcel Beld
Laboratory of Clinical Virology, Department of Medical Microbiology, Academic Medical Centre, University of Amsterdam, Amsterdam,The Netherlands; Laboratory of Medical Microbiology, OLVG, Amsterdam, The Netherlands; and Laboratory of the
Municipal Health Service, GGD Amsterdam, Amsterdam, The Netherlands
Volume 46, no. 12, p. 3997–4003, 2008. Page 4001, legend of Fig. 2, lines 3 and 4: “probe sequence, CCGGTCTGGTGCAATTCGCCCGC” should read “probe sequence, CCGGGTCTGGTGCAGTTTGCCCGC.”
