+ All Categories
Home > Documents > Recombinant DNA Technology. Further Historical Perspective Geneticists have known for a long time...

Recombinant DNA Technology. Further Historical Perspective Geneticists have known for a long time...

Date post: 25-Dec-2015
Category:
Upload: georgina-willis
View: 215 times
Download: 0 times
Share this document with a friend
Popular Tags:
38
Recombinant DNA Technology
Transcript
Page 1: Recombinant DNA Technology. Further Historical Perspective Geneticists have known for a long time how to isolate DNA from cells. Geneticists have known.

Recombinant DNA Technology

Page 2: Recombinant DNA Technology. Further Historical Perspective Geneticists have known for a long time how to isolate DNA from cells. Geneticists have known.

Further Historical Perspective

Geneticists have known for a long time how to isolate DNA from cells.

Geneticists have known for a long time how to chop DNA into small pieces.

What geneticists did not know how to do until the early 1970s was to replicate small fragments of DNA.

Page 3: Recombinant DNA Technology. Further Historical Perspective Geneticists have known for a long time how to isolate DNA from cells. Geneticists have known.

1970s Breakthrough

• The discovery of the restriction enzyme

(or restriction endonuclease).

Page 4: Recombinant DNA Technology. Further Historical Perspective Geneticists have known for a long time how to isolate DNA from cells. Geneticists have known.

Properties of RE

• Cut double-stranded DNA at specific target sites.

• Allow fragments of DNA that have been cut with the same RE to be rejoined.

Page 5: Recombinant DNA Technology. Further Historical Perspective Geneticists have known for a long time how to isolate DNA from cells. Geneticists have known.
Page 6: Recombinant DNA Technology. Further Historical Perspective Geneticists have known for a long time how to isolate DNA from cells. Geneticists have known.

AnimationAnimation

• Recombinant DNA_Animation_1

• Recombinant DNA_Animation_2

Page 7: Recombinant DNA Technology. Further Historical Perspective Geneticists have known for a long time how to isolate DNA from cells. Geneticists have known.

The joining of two DNA fragments by DNA ligase produces a recombinant DNA molecule

Page 8: Recombinant DNA Technology. Further Historical Perspective Geneticists have known for a long time how to isolate DNA from cells. Geneticists have known.
Page 9: Recombinant DNA Technology. Further Historical Perspective Geneticists have known for a long time how to isolate DNA from cells. Geneticists have known.
Page 10: Recombinant DNA Technology. Further Historical Perspective Geneticists have known for a long time how to isolate DNA from cells. Geneticists have known.
Page 11: Recombinant DNA Technology. Further Historical Perspective Geneticists have known for a long time how to isolate DNA from cells. Geneticists have known.
Page 12: Recombinant DNA Technology. Further Historical Perspective Geneticists have known for a long time how to isolate DNA from cells. Geneticists have known.

Therefore, eukaryotic DNA could be propagated in prokaryotic cells.

A great breakthrough!!!!!

Page 13: Recombinant DNA Technology. Further Historical Perspective Geneticists have known for a long time how to isolate DNA from cells. Geneticists have known.

Carriers of foreign DNA are Vectors:

• Most carriers are

• 1. Plasmids

• 2. Bacteriophages (viruses)

Page 14: Recombinant DNA Technology. Further Historical Perspective Geneticists have known for a long time how to isolate DNA from cells. Geneticists have known.

• A bacteriophage is a virus that

infects a bacteria.

Page 15: Recombinant DNA Technology. Further Historical Perspective Geneticists have known for a long time how to isolate DNA from cells. Geneticists have known.
Page 16: Recombinant DNA Technology. Further Historical Perspective Geneticists have known for a long time how to isolate DNA from cells. Geneticists have known.

Introduction to PCR• PCR (polymerase chain reaction)

• PCR is a means to enhance/replicate the amount of DNA collected (in vitro)

* p r c

Page 17: Recombinant DNA Technology. Further Historical Perspective Geneticists have known for a long time how to isolate DNA from cells. Geneticists have known.

PCR Creates more DNA for Study

• PCR Animation

Page 18: Recombinant DNA Technology. Further Historical Perspective Geneticists have known for a long time how to isolate DNA from cells. Geneticists have known.

DNA Replication Review:

• Add DNA polymerase, all 4 DNA building blocks ???

5’ CTGACGCTGCTGCATGCTAGCT 3’

3’ GACTACGACGACGTACGATCGA 5’

Page 19: Recombinant DNA Technology. Further Historical Perspective Geneticists have known for a long time how to isolate DNA from cells. Geneticists have known.

DNA Replication Review:

• Primers are required:

5’ CTGACGCTGCTGCATGCTAGCT 3’

CGA 5’

5’ CTG

3’ GACTACGACGACGTACGATCGA 5’

Page 20: Recombinant DNA Technology. Further Historical Perspective Geneticists have known for a long time how to isolate DNA from cells. Geneticists have known.

DNA Replication Review:

• Primers are required:

5’ CTGACGCTGCTGCATGCTAGCT 3’

. . . t a c g a t CGA 5’

5’ CTG a t g c t g . . . .

3’ GACTACGACGACGTACGATCGA 5’

Page 21: Recombinant DNA Technology. Further Historical Perspective Geneticists have known for a long time how to isolate DNA from cells. Geneticists have known.
Page 22: Recombinant DNA Technology. Further Historical Perspective Geneticists have known for a long time how to isolate DNA from cells. Geneticists have known.
Page 23: Recombinant DNA Technology. Further Historical Perspective Geneticists have known for a long time how to isolate DNA from cells. Geneticists have known.
Page 24: Recombinant DNA Technology. Further Historical Perspective Geneticists have known for a long time how to isolate DNA from cells. Geneticists have known.
Page 25: Recombinant DNA Technology. Further Historical Perspective Geneticists have known for a long time how to isolate DNA from cells. Geneticists have known.

Introduction to Agarose Gel Electrophoresis

Page 26: Recombinant DNA Technology. Further Historical Perspective Geneticists have known for a long time how to isolate DNA from cells. Geneticists have known.

Weigh out ~ a gram of agarose.

Page 27: Recombinant DNA Technology. Further Historical Perspective Geneticists have known for a long time how to isolate DNA from cells. Geneticists have known.

• Mix the agarose with 50- 100 ml of buffer.

Page 28: Recombinant DNA Technology. Further Historical Perspective Geneticists have known for a long time how to isolate DNA from cells. Geneticists have known.

• Heat to dissolve the agarose.

Page 29: Recombinant DNA Technology. Further Historical Perspective Geneticists have known for a long time how to isolate DNA from cells. Geneticists have known.

• Assemble the gel tray and comb.

Page 30: Recombinant DNA Technology. Further Historical Perspective Geneticists have known for a long time how to isolate DNA from cells. Geneticists have known.

Pour the gel.

Page 31: Recombinant DNA Technology. Further Historical Perspective Geneticists have known for a long time how to isolate DNA from cells. Geneticists have known.

• Pick up the DNA sample with a micro-pipettor.

Page 32: Recombinant DNA Technology. Further Historical Perspective Geneticists have known for a long time how to isolate DNA from cells. Geneticists have known.

• Load one DNA sample into each well on the gel.

Page 33: Recombinant DNA Technology. Further Historical Perspective Geneticists have known for a long time how to isolate DNA from cells. Geneticists have known.

Connect the gel to a low voltage power supply.

Page 34: Recombinant DNA Technology. Further Historical Perspective Geneticists have known for a long time how to isolate DNA from cells. Geneticists have known.

After completion of the run, add a DNA staining material and visualize the DNA

under UV light.

Page 35: Recombinant DNA Technology. Further Historical Perspective Geneticists have known for a long time how to isolate DNA from cells. Geneticists have known.

• Analyze the results.

Page 36: Recombinant DNA Technology. Further Historical Perspective Geneticists have known for a long time how to isolate DNA from cells. Geneticists have known.
Page 37: Recombinant DNA Technology. Further Historical Perspective Geneticists have known for a long time how to isolate DNA from cells. Geneticists have known.

• Gel Electrophoresis – demonstration

• Ensure you’re plugged into the web ;)

Page 38: Recombinant DNA Technology. Further Historical Perspective Geneticists have known for a long time how to isolate DNA from cells. Geneticists have known.

• Electrophoresis Demo 1 – flash simulation

• Electrophoresis Demo 2 – java applet

• You need to be hooked to the web for these to work ;)


Recommended