i
Recombinant Enzymes in PyrosequencingTechnology
Nader Nourizad
Royal Institute of TechnologyDepartment of Biotechnology
Stockholm 2004
ii
©Nader Nourizad
Nader NourizadDepartment of BiotechnologyRoyal Institute of TechnologyAlbaNovaSE-106 91 StockholmSweden
Printed at Universitetsservice US ABBox 700 14100 44Sweden
ISBN 91-7283-756-X
iii
Nader Nourizad (2004): Recombinant Enzymes in Pyrosequencing technology.Doctoral dissertation from the Department of Biotechnology, Royal Institute ofTechnology, Stockholm, Sweden.
ISBN 91-7283-756-X
AbstractPyrosequencing is a DNA sequencing method based on the detection of released
pyrophosphate (PPi) during DNA synthesis. In a cascade of enzymatic reactions,visible light is generated, which is proportional to the number of nucleotidesincorporated into the DNA template. When dNTP(s) are incorporated into the DNAtemplate, inorganic PPi is released. The released PPi is converted to ATP by ATPsulfurylase, which provides the energy to luciferase to oxidize luciferin and generatelight. The excess of dNTP(s) and the ATP produced are removed by the nucleotidedegrading enzyme apyrase.
The commercially available enzymes, isolated from native sources, show batch-to-batch variations in activity and quality, which decrease the efficiency of thePyrosequencing reaction. Therefore, the aim of the research presented in this thesiswas to develop methods to recombinantly produce the enzymes used in thePyrosequencing method. Production of the nucleotide degrading enzyme apyrase byPichia pastoris expression system, both in small-scale and in an optimized large-scalebioreactor, is described. ATP sulfurylase, the second enzyme in the Pyrosequencingreaction, was produced in Escherichia coli. The protein was purified and utilized inthe Pyrosequencing method. Problems associated with enzyme contamination (NDPkinase) and batch-to-batch variations were eliminated by the use of the recombinantATP sulfurylase.
As a first step towards sequencing on chip-format, SSB-(single-strand DNAbinding protein)-luciferase and Klenow DNA polymerase-luciferase fusion proteinswere generated in order to immobilize the luciferase onto the DNA template.
The application field for the Pyrosequencing technology was expanded byintroduction of a new method for clone checking and a new method for templatepreparation prior the Pyrosequencing reaction.
Keywords: apyrase, Pyrosequencing technology, Zbasic tag fusion, luciferase, ATPsulfurylase, dsDNA sequencing, clone checking, Klenow-luciferase, SSB-luciferase,Pichia pastoris, Echerichia coli.
©Nader Nourizad
iv
v
To my family Ann Britt, Sarah and Sam
vi
vii
Have a vision, future is yours
viii
ix
This thesis is based on the following publications, which in the text will be referred to
by their roman numerical:
List of publications
I. Nourizad, N., Ehn, M., Gharizadeh, B., Hober, S. and Nyrén, P. (2003)
Methylotrophic yeast Pichia pastoris as a host for production of ATP-diphosphohydrolase (apyrase) from potato tubers (Solanum tuberosum).
Protein Expr. Purif. 27(2): 229-37.
II. Nourizad, N., Salmalian, R., Jahic, M., Henriksson, H., Enfors, S.O., Veide,
A. and Nyrén, P. (2004) High Level Production of ATP-diphosphohydrolase(apyrase) from potato tubers (Solanum tuberosum) in Fed-batch mode in
Methylotrophic yeast Pichia pastoris. Manuscript.
III. Nordström, T., Nourizad, K., Ronaghi, M. and Nyrén, P. (2000) Method
enabling Pyrosequencing on double-stranded DNA. Anal. Biochem. 1: 282(2):186-93.
IV. Karamohamed, S., Nilsson, J., Nourizad, K., Ronaghi, M., Pettersson, B. and
Nyrén, P. (1999) Production, purification, and luminometric analysis of
recombinant Saccharomyces cerevisiae MET3 adenosine triphosphatesulfurylase expressed in Escherichia coli. Protein Expr. Purif. 15(3):381-8.
V. Gharizadeh, B., Eriksson, J., Nourizad, N. and Nyrén, P. (2004)
Improvements in Pyrosequencing technology by employing Sequenase
polymerase. Anal. Biochem. In press.
VI. Ehn, M., Nourizad, N., Bergström, K., Ahmadian, A., Nyrén, P., Lundeberg,
J. and Hober, S. (2004) Towards Pyrosequencing on surface-attached geneticmaterial by use of DNA binding luciferase fusion proteins. Anal. Biochem. In
press.
VII. Nourizad, N., Gharizadeh, B. and Nyrén, P. (2003) Method for clone
checking. Electrophoresis 24: 1712-5.
x
xi
Table of contents1. INTRODUCTION..................................................................................................................................... 1
2. DNA SEQUENCING TECHNOLOGIES.............................................................................................. 2
2.1. THE SANGER METHOD ......................................................................................................................... 22.2. THE MAXAM-GILBERT METHOD ......................................................................................................... 52.3. PYROSEQUENCING TECHNOLOGY........................................................................................................ 7
3. PROTEINS IN THE PYROSEQUENCING METHOD ..................................................................... 9
3.1. DNA POLYMERASE.............................................................................................................................. 93.2. ATP SULFURYLASE ........................................................................................................................... 113.3. LUCIFERASE....................................................................................................................................... 123.4. APYRASE............................................................................................................................................ 133.5. SINGLE-STRANDED DNA-BINDING PROTEIN (SSB).......................................................................... 14
4. RECOMBINANT PROTEIN EXPRESSION..................................................................................... 15
4.1. ESCHERICHIA COLI.............................................................................................................................. 154.2. YEAST ................................................................................................................................................ 184.3. FILAMENTOUS FUNGI......................................................................................................................... 204.4. INSECT CELLS..................................................................................................................................... 214.5. PLANT CELLS ..................................................................................................................................... 224.6. CHINESE HAMSTER OVARY CELLS (CHO) AND MAMMALIAN CELLS ............................................... 234.7. TRANSGENIC ANIMALS ...................................................................................................................... 23
5. PROTEIN PURIFICATION ................................................................................................................. 25
5.1. CHROMATOGRAPHIC METHODS......................................................................................................... 255.1.1. Gel filtration (Size Exclusion Chromatography) ..................................................................... 255.1.2. Ion exchange chromatography ................................................................................................. 265.1.3. Hydrophobic interaction chromatography (HIC).................................................................... 265.1.4. Reversed phase chromatography (RPC).................................................................................. 275.1.5. Affinity chromatography........................................................................................................... 27
5.1.5.1. IMAC (Immobilized metal affinity chromatography).......................................................................285.1.5.2. Staphylococcal protein A and its derivates (Z, Zbasic, ZZ).................................................................29
6. PRESENT INVESTIGATION .............................................................................................................. 30
6.1. RECOMBINANT APYRASE (PAPER I, II, III) ........................................................................................ 306.1.1. Small-scale production of apyrase (paper I) ........................................................................... 30
6.1.1.1. Characterization of recombinant apyrase...........................................................................................336.1.2. Large-scale production of apyrase (paper II) ......................................................................... 34
6.2. APPLICATION OF APYRASE IN THE PYROSEQUENCING TECHNOLOGY .............................................. 366.2.1. Recombinant apyrase in the Pyrosequencing reaction ........................................................... 366.2.2. Application of apyrase for template preparation prior the Pyrosequencing reaction........... 37
6.2.2.1. Single-strand method..........................................................................................................................376.2.2.2. Double-strand method (III).................................................................................................................38
6.3. RECOMBINANT ATP SULFURYLASE (IV).......................................................................................... 416.4. DNA POLYMERASES IN PYROSEQUENCING TECHNOLOGY (V) ........................................................ 426.5. FUSION PROTEINS (VI)....................................................................................................................... 446.6. CLONE CHECKING (VII)..................................................................................................................... 47
7. CONCLUDING REMARKS AND FUTURE TRENDS.................................................................... 50
ABBREVIATIONS ..................................................................................................................................... 51
ACKNOWLEDGEMENTS ....................................................................................................................... 53
REFERENCES ............................................................................................................................................ 56
ORIGINAL PAPERS
xii
Recombinant Enzymes in Pyrosequencing Technology
1
1. IntroductionThe discovery of more than 30 years ago, of restriction enzymes that restrict
genetic material, and ligases that joins restricted genetic material, led to a new
research field: recombinant DNA technology. This new technology allowed for
cloning of genes and also their expression in different host organisms (Linn andArber, 1968; Meselson and Yuan, 1968; Olivera and Lehman, 1967; Zimmerman et
al., 1967).During the past two decades techniques for production and purification of proteins
have enabled many of the advancements in biotechnology. Recombinant DNA
technologies have revolutionized the production of biomolecules (proteins) in largequantities. Together, these techniques have proven to be very powerful for production
and purification of different biological molecules.In the mid 1970´s methods for sequencing DNA were also introduced (Maxam
and Gilbert, 1977; Sanger et al., 1977b). In vitro mutagenesis was introduced by
Smith and co-workers at the university of British Columbia (Canada); syntheticoligonucleotides were used (Hutchison et al., 1978). The introduction of the
polymerase chain reaction (PCR) technique by Karry Mullis set a new epoch for the
field of recombinant DNA technology (Mullis and Faloona, 1987).The Pyrosequencing technology, which is based on real-time detection of DNA
synthesis by a bioluminometric strategy, was developed at the Royal Institute ofTechnology (KTH). This method has shown to be a versatile sequencing technology
suitable for many applications, such as SNP analysis, bacteria typing, virus typing,
fungi typing and tag sequencing. The Pyrosequencing technology is the firstalternative to the conventional Sanger method for de novo DNA sequencing.
This thesis briefly describes (i) different DNA sequencing methods, (ii) theproduction of proteins in different host organisms and (iii) purification methods for
proteins with or without fusion tags. The main aims of this thesis were to improve the
Pyrosequencing method by production of the enzymes involved in the methodrecombinantly and to expand the application field by introducing a new method for
clone checking and a new method for DNA template preparation prior thePyrosequencing reaction.
Nader Nourizad
2
2. DNA sequencing technologiesDNA sequencing techniques are used for determination of the precise order of
nucleotides in a DNA sample. These techniques are probably the most important
techniques available to the molecular biologist. DNA sequencing is used in many
different applications, such as forensic, diagnostic, evolutionary studies, and fordetermination of the entire genome sequence of organisms ranging from yeast to
humans. The DNA sequencing technologies that are available and currently usedinclude the Sanger method, which is based on electrophoretic separation and detection
of synthesized single-stranded DNA molecules that have been terminated with
dideoxynucleotides (Sanger et al., 1977a), the Maxam-Gilbert method, which utilizeschemical degradation of the ssDNA (Maxam and Gilbert, 1977), sequencing-by-
hybridization, which is based on hybridization of a labeled ssDNA of unknownsequence to a set of sequence specific oligomers immobilized onto a solid support
(Drmanac et al., 1989) and the Pyrosequencing technology, a recently developed
sequencing method based on a luminometric approach (Nyrén, 2001; Ronaghi et al.,1998).
The following section will focus on the Sanger method, the Maxam-Gilbert
method and the Pyrosequencing technology.
2.1. The Sanger methodThe Sanger method (Sanger et al., 1977b) enabled scientists to efficiently
sequence DNA. This sequencing method is simple and elegant and after more than a
quarter of a century after its development is still frequently used with moreadvancement in chemistry and automation. In this method, ssDNA serves as a
template for in vitro DNA synthesis using an oligonucleotide (primer) with asequence complementary to the 5’-end of the template. DNA polymerase extends the
DNA strand complementary to the template starting at the 3’-end of the primer. In the
sequencing reaction the natural dNTPs are mixed with dideoxy nucleotides (ddNTPs).ddNTPs lack the hydroxyl group on the 3’-end and thus, terminate elongation of the
DNA chain by DNA polymerase. In this method four parallel DNA elongationreactions are run with dNTPs/ddATP, dNTPs/ddCTP, dNTPs/ddGTP and
Recombinant Enzymes in Pyrosequencing Technology
3
dNTPs/ddTTP, respectively. As the dNTPs in the reaction are in excess compared to
the ddNTPs, different lengths of the DNA fragments can be obtained.The separation of the Sanger fragments is usually performed electrophoretically,
although mass spectrometry analysis has also been described (Jacobson et al., 1991;Murray, 1996). Previously, the detection of the fragments were performed by
radioactivity. The four samples were loaded onto a slab polyacrylamide gel and
separated by electrophoresis, and then the separation pattern was deduced from thedeveloped autoradiograms. These days, the radioactivity has been replaced by
fluorescent dyes and, the fragments are detected after excitation by a laser beam. Bylabeling the four ddNTPs with different fluorescent dyes, the four separate Sanger
reactions can be performed in one reaction and no modification of the primer is
required (Fig. 1). This technique has been fully automated after replacing the slab gelelectrophoresis step, which required manual gel casting and sample loading, with
capillary electrophoresis.
Nader Nourizad
4
Figure 1. A schematic drawing of the principle of the Sanger DNA sequencing method. A primed-template is used to synthesize a complementary DNA strand. The nucleotide concentration of eachddNTP and each of the four dNTPs is adjusted to produce DNA fragments terminated equal at everyddNTP position along the DNA. The labeled fragments are then separated by gel electrophoresis andthereby, allowing reconstruction of DNA sequence from the separation pattern.
3’
5’- 5’A T A G T C C G G T A C A C
Divided into four Sanger reactions
with polymerase extension and
fragment separation
dNTPsddATPDNA polymerase
dNTPsddGTPDNA polymerase
dNTPsddTTPDNA polymerase
dNTPsddCTPDNA polymerase
A C G T
Mig
ratio
n
Sequ
ence
rea
ding
ord
er
GTGTACCGGACTAT
Recombinant Enzymes in Pyrosequencing Technology
5
2.2. The Maxam-Gilbert methodThe Maxam-Gilbert DNA sequencing method is based on chemical degradation of
ssDNA (Maxam and Gilbert, 1977). In this method the DNA is amplified either by
PCR or bacteria. After DNA amplification, the double-stranded DNA-molecules are
labeled with radioactive phosphate (32P) at only one end (5'-end) of each strand withthe help of a special enzyme (polynucleotide kinase). The labeled DNA is divided into
four different reactions with different chemical reagents that cleave the DNAspecifically after A, C, G or T. The reaction conditions are such that each strand of
DNA in each sample is cut once at a random location along the bases—adenine (A),
guanine (G), cytosine (C) and thymine (T). The reactions result in mixtures of DNA-strands of different lengths (between one and several hundred nucleotides), with one
end representing one of the bases and the other end showing the 32P phosphate. Thesefragments are applied on parallel lanes on a sequencing gel and separated by gel
electrophoresis, according to their length. The result is detected by autoradiography
(Fig 2).
Nader Nourizad
6
Figure 2. A schematic illustration of the principle of the Maxam-Gilbert method.
3’- T A T C A G G C C A T G T G -32P 5’A T A G T C C G G T A C A C5’ 32P- -3’
5’- A T A G T C C G G T A C A C - 3’3’- T A T C A G G C C A T G T G - 5’
Enzymatic end-labeling ofeach strand with 32P
Single-strandpreparation
A T A G T C C G G T A C A C5’ 32P- -3’
Base specificcleavage
Reaction 1: Dimethylsulfate (alkaline) cuts G
Reaction 2: Dimethylsulfate (acidic) cuts G +A
Reaction 3: Hydrazine plus piperdine cuts C +T
Reaction 4: Hydrazine plus 2M NaCl cuts C
R1 R2 R3 R4
Mig
ratio
n
Sequ
ence
rea
ding
ord
er
CACATGGCCTGATA
Electroforesis andradioautography
3’- T A T C A G G C C A T G T G -32P 5’
Recombinant Enzymes in Pyrosequencing Technology
7
2.3. Pyrosequencing technologyIn the Pyrosequencing method four different enzymes are used and the DNA
sequencing is monitored in real-time (Nyrén, 2001; Ronaghi et al., 1998). The overall
reactions are described as follow:
In this method, the sequencing reaction contains template DNA, a primer thathybridizes to the single-stranded DNA template, DNA polymerase, ATP sulfurylase,
luciferase and apyrase, and the substrates APS and luciferin. The four dNTPs are
added to the reaction mixture sequentially. When the DNA polymerase incorporatesthe complementary nucleotide onto the 3’-end of the primed DNA template, PPi is
released in a quantity equimolar to nucleotide incorporation. ATP sulfurylasequantitively converts PPi to ATP in the presence of APS. The ATP that is produced
drives the luciferase-mediated conversion of luciferin to oxyluciferin, which generates
visible light in amounts that is proportional to the amount of ATP. The light producedin the luciferase-catalyzed reaction is detected by a photon multiplier tube or CCD
camera, and is recorded as a peak in a pyrogram. Each light signal is proportional tothe number of nucleotides incorporated. Apyrase continuously degrades ATP and
unincorporated excess dNTPs. When degradation is complete, another dNTP is added.
Addition of dNTPs is performed one at a time. As the process continues, acomplementary DNA strand is formed and the nucleotide sequence is determined
from the signal peaks in the pyrogram (Fig. 3).
dNTP dNMP + 2 PPiApyrase
(DNA)n + dNTP DNA polymerase (DNA)n+1 + PPi
APS + PPiATP sulfurylase
ATP + SO42-
ATP + D-luciferin LightLuciferase
ATP AMP + 2 PPiApyrase
Nader Nourizad
8
Figure 3. The Pyrosequencing method is a non-electrophoretic real-time DNA sequencing method thatuses the luciferase-luciferin light release as the detection signal for nucleotide incorporation into targetDNA. The four different nucleotides are added iteratively to a four-enzyme mixture. Thepyrophosphate (PPi) released in the DNA polymerase-catalyzed reaction is quantitatively converted toATP by ATP sulfurylase, which provides the energy to firefly luciferase to oxidize luciferin andgenerate light (hu). The light is detected by a photon detection device and monitored in real time by acomputer program. Finally, apyrase catalyzes degradation of nucleotides that are not incorporated andthe system will be ready for the next nucleotide addition.
Recombinant Enzymes in Pyrosequencing Technology
9
3. Proteins in the Pyrosequencing methodThe Pyrosequencing method utilizes an enzyme system involving four enzymes
(DNA polymerase, ATP sulfurylase, firefly luciferse, apyrase) and an extra protein
the single-stranded DNA-binding protein. This section briefly describes each of theseproteins.
3.1. DNA polymeraseDNA polymerases (E.C 2.7.7.7) fulfill various replicative and repair functions
within living cells to ensure the survival of all organisms and accurate transfer ofgenetic information to subsequent generations (Kornberg, 1988). Escherichia coli
DNA polymerase I and a virus originated T7 DNA polymerase have been the mostwidely studied of all polymerases. DNA polymerase I possess, in addition to
polymerase activity, both 3’-5’ and 5’-3’ exonuclease activity. By proteolytic
(subtilisin) cleavage of DNA polymerase I (109 kDa), a smaller fragment harboring5’-3’ exonuclease activity and one larger fragment (Klenow fragment) harboring both
polymerase and 3’-5’ exonuclease activity are obtained (Klenow et al., 1971). During
the polymerization process, nucleotides are incorporated at the 3’-end of anelongating DNA strand. This reaction is described by the following reaction formula:
The polymerase first binds to the 3’- hydroxyl group of the primer, hybridized to
the template DNA, and then selects the correct nucleotide. This selectivity improvesthe overall replication fidelity. Following nucleotide binding, a conformational
change occurs and the enzyme moves the nucleotide from the binding site to the
active site (Ramanathan et al., 2001). Formation of the chemical bond then takes placeby nucleophilic attack on the alpha-phosphorus of the nucleotide by the 3’- hydroxyl
group on the primer strand. The polymerase then releases PPi and either translocatesto the next available template position or dissociates from the template DNA
(Kornberg and Lorch, 1992).
(DNA)n + dNTPDNA polymerase
(DNA)n+1 + PPi
Nader Nourizad
10
The 3’-5’ exonuclease activity of the enzyme is responsible for proofreading ofthe elongated primer chain, to ensure high-fidelity replication in accordance with the
Watson-Crick base-paring rules. This activity acts in the opposite direction to DNA
synthesis and corrects polymerization errors by removing the dNMP before the DNAis further elongated (Brutlag and Kornberg, 1972). Notably, Klenow and T7 DNA
polymerases lack 5’-3’ exonuclease activity. Proof-reading activity in DNApolymerase I is responsible for removing DNA lesions in dsDNA or RNA/DNA
hybrids during excision repair.
The Klenow polymerase that is used in the Pyrosequencing technology is 3’-5’exonuclease deficient. The 3’-5’ exonuclease activity is removed by two point
mutations at the N-terminus of the enzyme without affecting the polymerase activity(Derbyshire et al., 1988).
The processivity of a DNA polymerase is defined as the average number of bases
polymerized per encounter of the enzyme with a DNA primer/template. Theprocessivity of DNA polymerase I (Klenow polymerase) is 20-50 nucleotides before
the enzyme dissociates from the primer-template. In contrast, when the T7polymerase binds to E. coli thioredoxin, an accessory protein, hundreds of nucleotides
are added before the enzyme dissociates (Tabor and Richardson, 1987). In order to
study the effect of the thioredoxin-binding domain from T7 DNA polymerase onDNA polymerase I, a genetic fusion was constructed that inserts this domain into the
homologous site of DNA polymerase I from E. coli. This chimeric polymerase
showed an increased processivity when it was bound to thioredoxin (Bedford et al.,1997).
The Km value for various dNTPs are different for Klenow polymerase, but it is inthe micromolar range (McClure and Jovin, 1975). For an efficient polymerization, the
nucleotide concentration should be above the Km. However, the polymerization step
has a lower fidelity when the nucleotide concentration is too high above the Km (Clineet al., 1996).
The Klenow polymerase and the T7 DNA polymerase are the only polymerasesthat have been used in the Pyrosequencing technology so far.
Recombinant Enzymes in Pyrosequencing Technology
11
3.2. ATP sulfurylaseThe second reaction in the Pyrosequencing method is catalyzed by ATP
sulfurylase (E.C 2.7.7.4). In this reaction the PPi that is released upon DNA
polymerization is converted to ATP in the presence of APS (adenosinephosphosulfate). This reaction is described by the following formula:
The reduced form of sulfur (APS) is used in the biosynthesis of metabolites,
coenzymes and sulfolipids. ATP sulfurylase and APS kinase are responsible forcatalyzing the sequential steps that enable in the assimilation of sulfur. ATP
sulfurylase is involved in the first step and APS kinase in the second. In vivo, ATPsulfurylase catalyzes the production of APS and PPi from ATP and free sulfate. The
produced APS is further phosphorylated by APS kinase into adenosine 3’-phosphate
5’-phosphosulphate (PAPS), which is used to synthesize various sulphur- containingcompounds.
The equilibrium for APS production is unfavorable (Segel et al., 1987), whereas itis favorable for ATP synthesis (Robbins and Lipmann, 1958). However, the reaction
is pulled in the APS direction by the following removal of APS by APS kinase, and
the hydrolysis of PPi by inorganic pyrophosphatase. ATP sulphurylase activity has been found in many organisms, including baker’s
yeast, filamentous fungi (Segel et al., 1987), spinach leaf (Renosto et al., 1993) andrat (Brandan and Hirschberg, 1988). The genes encoding ATP sulfurylase have been
isolated from various species and the corresponding enzymes have been
characterized, e.g. E. coli (Leyh et al., 1988) and mouse (Li et al., 1995). The firstATP sulphurylase cloned was from the baker’s yeast, Saccharomyces cerevisiae,
namely the MET3 gene on chromosome X. This enzyme is the only commerciallyavailable ATP sulphurylase. The enzyme has a molecular weight of 315 kDa and
consists of six identical subunits (Segel et al., 1987). A recombinant form of the
enzyme has been successfully produced in E. coli (paper IV).
APS + PPiATP sulfurylase
ATP + SO42-
Nader Nourizad
12
3.3. LuciferaseThe progress of the Pyrosequencing reaction is continuously monitored by the
firefly luciferase reaction according to the following formula:
Since the dATP is a weak substrate for firefly luciferase, it has been replaced by amodified variant of this nucleotide (dATPaS) in the Pyrosequencing technology
(Ronaghi et al., 1998).
Light production in different organisms is catalyzed by luciferase (E.C. 1.13.12.7).
There are three major bioluminescent groups of beetles: Elateroidea (click beetles),Phengodidae (glow worms) and Lampyridae (firefly beetles) (Wood et al., 1989). The
light from the firefly beetles ranges from green to yellow (550-590nm). Since the lightproduced by luciferase can be monitored with great sensitivity, many applications
based on the luciferase reaction have been developed. These applications can be
divided into (i) reporter gene assays (Wibom et al., 1990), (ii) biomass assays (Thoreet al., 1975; Gallez et al., 2000; Niza-Riberio et al., 2000; Olsson et al., 1986), (iii)
monitoring of enzymes and molecular substances (Nyren and Lundin, 1985; Goswamiand Pande, 1984; Karamohamed and Guidotti, 2001) and (iv) immunoassays (Geiger
and Miska, 1987;Miska and Geiger, 1987; Kobatake et al., 1993).
The luciferase from the North American firefly, Photinus pyralis, was the first tobe cloned and sequenced (de Wet et al., 1986). This enzyme is a 61 kDa protein,
which produces light in the green-yellow region (550-590 nm) with an emission
maximum at 562 nm at the optimum pH between 7.5 - 8.5 (Sala-Newby et al., 1996).Several strategies including, site specific mutagenesis and using substrate analogs
have been used to identify and characterize the active site of firefly luciferase(Branchini et al., 1998; Branchini et al., 1999; Sala-Newby and Campbell, 1994;
Thompson et al., 1997). Different strategies have also been applied to increase the
thermostability of the enzyme, including addition of stabilizing compounds (Eriksson
ATP + D-luciferin LightLuciferase
Recombinant Enzymes in Pyrosequencing Technology
13
et al., 2003) and by site specific mutagenesis of the enzyme (Kajiyama and Nakano,
1993; White et al., 1996).
3.4. ApyraseIn the Pyrosequencing reaction the excess of unincorporated nucleotides and ATP
that is generated are degraded by apyrase. The reaction formula is as follows:
Apyrase (ATP-diphophohydrolase, E.C. 3.6.1.5) catalyzes the hydrolysis of
pyrophosphate bonds in tri- and diphosphates and liberates orthophosphate (Traverso-Cori et al., 1965). Apyrase differs from other ATPases in several ways, such as
requiring divalent cations (e.g., Ca2+, Mg2+ etc) (Plesner, 1995) and being insensitive
to specific inhibitors of other types of ATPases (P-, F- and V types) (Handa andGuidotti, 1996).
Apyrases have been identified in different organisms and animal tissues. In animaltissues the enzyme is an integral membrane protein and controls the extracellular
concentration of tri- and diphospho nucleotides (Plesner, 1995; Komoszynski, 1996;
Zimmermann et al., 1998; Guranowski et al., 2000; Gendron et al., 2000; Heine et al.,1999; Boeck et al., 2002). The transmembrane domain of ectoapyrase affects its
activity and quaternary structure (Wang et al., 1998; Grinthal and Guidotti, 2000). Inplant tissues apyrase is found in the cytosolic (Valenzuela et al., 1989), nuclear (Hsieh
et al., 2000) and membrane fractions (Tognoli and Marre, 1981; Vara and Serrano,
1981); Valenzuela et al., 1998; Day et al., 2000). Thus, plant apyrases have ubiquitouslocalization, and appear to be involved in many different reactions, such as
recognition of exogenous carbohydrates (Etzler et al., 1999), phosphate nutrition(Thomas et al., 1999), legume nodulation (Day et al., 2000) and xenobiotic resistance
(Roberts et al., 1999; Thomas et al., 2000).
Potato apyrase is the most extensively studied apyrase and has a molecular weightof 49 kDa. In potato tuber, this enzyme exists in more than one molecular form
dNTP dNMP + 2 PPiApyrase
ATP AMP + 2 PPiApyrase
Nader Nourizad
14
depending on the clonal variety (Traverso-Cori et al., 1970). Apyrases from different
clonal sources show differences both in isoelectric point and relative rate ofhydrolysis of ATP and ADP (Traverso-Cori et al., 1970). Apyrase purified from
Solanum tuberosum var. Pimpernel (Pimpernel apyrase) has an ATPase/ADPase ratioclose to 10 (Del Campo et al., 1977), whereas apyrase isolated from the Desiré variety
(Desiré apyrase) has an ATPase/ADPase ratio close to 1 (Del Campo et al., 1977).
3.5. Single-stranded DNA-binding protein (SSB)The single-stranded DNA-binding protein (SSB) binds with high affinity to single-
stranded (ss) DNA and plays an important role in DNA replication, recombination,
and repair (Timothy et al., 1994). SSB does not possess any enzymatic activity and
has been referred to by many different names since its discovery in 1970, includingDNA-unwinding protein, DNA-melting protein or helix-destabilizing protein
(Timothy et al., 1994). However, the terms single-stranded DNA-binding protein
(SSB) and helix-destabilizing protein are now commonly used (Timothy et al., 1994).SSB is important for DNA replication in phage T4 (Gold et al., 1976), phage T7 (Kim
and Richardson, 1993), E. coli (Meyer et al., 1979) and yeast (Brill and Stillman,1991), and it is assumed that SSBs are important for all organisms. SSB from E. coli
(Eco SSB) forms a homotetramer in vivo where each monomer has a molecular
weight of 18.9 kDa.Since SSB stabilizes and prevents formation of secondary structures in ssDNA, it
has been used in different biotechnical applications, such as the polymerase chainreaction (PCR) (Dabrowski and Kur, 1999), site-directed mutagenesis with junction to
recA (McEntee et al., 1980), Sanger DNA sequencing (Ball and Desselberger, 1992)
and in the Pyrosequencing technology (Ronaghi, 2000).In the Pyrosequencing technology SSB is added to the primed DNA template prior
to the Pyrosequencing reaction. The addition of SSB to a Pyrosequencing reaction hasbeen shown to improve the read length of the Pyrosequencing technology, especially
for sequencing of difficult templates (Ronaghi, 2000). The application of SSB in the
Pyrosequencing technology has also facilitated the optimization of differentparameters, such as enabling a more flexible primer design and eliminating
Recombinant Enzymes in Pyrosequencing Technology
15
intermediate washing steps that remove primers from the reaction mixture, which
could otherwise form primer-dimers or unspecifically bind the DNA template.
4. Recombinant protein expressionRecombinant DNA techniques are used for expression of genes from a variety of
sources in different host cells. Before the application of recombinant DNA techniques
for protein production, the target proteins were purified from native sources by manypurifications steps that usually resulted in low recovery. With the advent of modern
recombinant DNA techniques the pharmaceutical industry, and other protein-basedindustries, have been able to provide the market with proteins in quantities that were
previously impossible to obtain. The choice of host for the expression of heterologous
proteins depends mainly on the properties of the target protein and the final use of theexpressed protein. If the protein requires substantial post-translational modifications,
a eukaryotic host is the preferred choice.This section briefly describes some commonly used expression-hosts with respect
to their order of increasing complexity.
4.1. Escherichia coliThe most widely used host for heterologous protein production is the bacterium E.
coli. E. coli was used to produce the first recombinant protein of pharmaceutical
interest: recombinant human insulin (Johnson, 1983).
The E. coli system has several advantages compared to other systems: (i) it is wellcharacterized both genetically and physiologically, (ii) commercially available vectors
and strains are available, (iii) E. coli can be grow in inexpensive and simple media,(iv) E. coli has a short generation time (20 min) and (v) a number of cell manipulation
techniques are available.
A variety of promoters are available for recombinant protein production in the E.
coli system (Jonasson et al., 2002). Promoters can be either constitutive or inducible.
With a constitutive promoter, such as the promoter for Staphylococcal aureus protein
A (Lofdahl et al., 1983), a constant level of transcription of the target gene withsubsequent translation is obtained. Advantages of constitutive systems include
reduced formation of inclusion bodies and more efficient secretion of the target
Nader Nourizad
16
protein to the periplasmic space. With an inducible promoter system little or no
expression of the target protein is obtained before induction. An inducible promotersystem might be desirable if the recombinant protein is toxic to the host cell. A good
example of a commercially available inducible system is the pET system. In thissystem the tightly regulated T7 promoter is induced by addition of IPTG to the culture
medium (Studier and Moffatt, 1986). The T7 promoter is transcribed by the T7 phage
RNA polymerase, whose gene is integrated into the chromosome of the E. coli strainBL21 (DE3) and is regulated by the lac promoter. In E. coil strain BL21 (DE3)
transcription of the target gene is further repressed under non-induction conditions bythe activity of T7 lysozyme, an enzyme that degrades T7 RNA polymerase (Studier,
1991). Before induction the T7 lysozyme activity is sufficient for degradation of the
T7 RNA polymerase, but after induction of the cells with IPTG the amount of T7RNA polymerase increases tremendously and T7 RNA polymerase degradation is
negligible.
Other examples of inducible promoter systems are the arabinose promoter system,which is induced by addition of L-arabinose, the trp-promoter, which is induced by
either tryptophan starvation or addition of b-indoleacrylic acid (b-IAA) (Yansura and
Henner, 1990), and heat induced promoters, such as PL (l) (Bernard et al., 1979), PR
(l) (Nilsson and Abrahmsen, 1990) and lac (TS) (Hasan and Szybalski, 1995).
In the E. coli system recombinant proteins can be produced intracellularly, in the
periplasmic space or be secreted to the culture medium (Cornelis, 2000). Forsuccessful intracellular protein production it is important that the target proteins are
not susceptible to proteolysis (Maurizi, 1992; Gottesman and Maurizi, 1992), lackdisulphide bonds and are not toxic to the host cells. The level of protein production is
usually higher when expressed intracellularly than when secreted. However,
intracellularly produced products are often found in inclusion bodies. Proteins foundin inclusion bodies are easily isolated by centrifugation, but must generally be
refolded since they are found primarily in misfolded and denaturated states (Datar etal., 1993). In some cases, the denaturated protein can be solubilized and the enzyme
activity can be recovered after refolding (Rudolph and Lilie, 1996; Guise et al., 1996;
Mukhopadhyay, 1997; Lilie et al., 1998).
Recombinant Enzymes in Pyrosequencing Technology
17
There are several strategies available to increase the overall solubility of
intracellularly expressed recombinant proteins. One strategy is to geneticallyincorporate a highly soluble fusion tag into the recombinant protein (Hammarstrom et
al., 2002). Examples of useful fusion tags are thioredoxin (LaVallie et al., 1993),Staphylococcal protein A and its derivatives (Z, Zbasic and ZZ) (Fig. 4) (Nilsson and
Abrahmsen, 1990; Nilsson et al., 1987), and Streptococcus protein G (Nygren et al.,
1988). In other strategies bacterial chaperones and foldases have been used to increasethe amount of soluble protein (Hockney, 1994; Buchner and Rudolph, 1991; Georgiou
and Valax, 1996; Samuelsson et al., 1996).In order to avoid inclusion body formation, it is sometimes preferable to direct the
recombinant protein to the periplasmic space using a signal peptide at the N-terminus
of the protein (Wulfing and Pluckthun, 1994). The signal peptides PhoA, MalE,OmpA and LamB, originate from E. coli (Blight et al., 1994). The secretory
machinery for targeting recombinant proteins to the periplasmic space has been
described by Muller (Muller et al., 2001). The periplasmic space of E. coli has anoxidizing environment, which enables formation of disulphide bonds that are
necessary for the correct folding of some proteins (Fabianek et al., 2000; Raina andMissiakas, 1997). A few signal peptides have been reported to secret the protein into
the culture media (Moks et al., 1986).
The choice of strategy for production of recombinant proteins is highly dependenton the nature of the target protein. It should be noted that the cytosol of E. coli
contains approximately 4000 proteins, whereas the periplasmic space contains onlyabout 100 (Blattner et al., 1997). Therefore, the choice of protein localization strongly
influences the down-stream process.
Nader Nourizad
18
Figure 4. Schematic illustration of Staphylococcal protein A and its derivatives.
4.2. YeastS. cerevisiae (baker’s yeast), a unicellular eukaryotic microorganism, is well
known for its use in baking and brewing processes. S. cerevisiae is a model system for
studying genetics and expression of recombinant proteins in eukaryote systems. The
lack of endotoxins gives a GRAS (Generally Regarded As Safe) status to thismicroorganism, according to the US Food and Drug Administration (FDA).
There are several expression plasmids available for production of heterologous
proteins in S. cerevisiae, including yeast episomal and centromere plasmids. The yeastcentromere plasmid is stable and contains a chromosomal centromere, and is therefore
only present in one or two copies per cell. The episomal plasmid is based on theendogenous plasmid (2µ circle) and is present in 10 to 40 copies per cell (Pichuantes
et al. 1996). Plamids can also be integrated into the chromosome of S. cerevisiae by
homologues recombination.Advantages with the yeast system are optimized fermentation conditions, less
complex culture medium and ability to perform post-translational modifications.However, there are some draw-backs, including comparatively low expression levels,
different in post-translational modifications and possible hyperglycosylation
compared to animal cells (Pichuantes et al., 1996). Other yeast species have emerged as alternatives to S. cerevisiae including
Hansenula polymorpha, Kluyveromyces lactis, Schizosaccharomyces pombe,
Yarrowia lipolytica and Pichia pastoris. The methylotropic yeast P. pastoris has
gained much popularity in recent years for expression of heterologous proteins at high
levels, either intracellularly or secreted (Cereghino and Cregg, 2000). Methylotrophic
S E D A B XC M
Zbasic
Z ZZ
IgG binding Cell anchoring
Signal peptideA1 - V, G29 - A
11 aa - R
Recombinant Enzymes in Pyrosequencing Technology
19
yeasts produce less hyperglycosylated and higher amounts of recombinant proteins
(Hollenberg and Gellissen, 1997; Gellissen and Hollenberg, 1997). Since P. pastoris
secretes low levels of endogenous proteins and the growth medium is often devoided
of added proteins, secreted recombinant proteins can be the main protein in the culturemedia (Cregg et al., 2000). The availability of commercial expression systems and the
simplicity of the techniques required for genetic manipulation makes this organism an
attractive host for recombinant protein expression (Gellissen, 2000; Cereghino et al.,2002).
The constitutive promoter GAP (glyceraldehyde-3-phosphate dehydrogenase) andthe inducible AOX1 (alcohol oxidase) promoter are frequently used for heterologous
expression in P. pastoris. The constitutive GAP promoter is strong and can be
regulated slightly by growth on different carbon sources, with the highest expressionlevels reached on glucose as a carbon source (Waterham et al., 1997). The AOX1
promoter is also strong and more widely used, and appears to be tightly regulated by a
repression/derepression and an induction mechanism (Cereghino and Cregg, 2000).The promoter is repressed by growth on glucose or unlimited growth on glycerol,
derepression of the AOX1 promoter occurs on limited growth on glycerol. Theabsence of a repressing carbon source does not result in substantial transcription of
AOX1. The induction is started with the addition of methanol to the culture media.
Methanol is also the carbon source for the cells (Tschopp et al., 1987). In theperoxisomes methanol is converted to formaldehyde and hydrogen peroxide by
alcohol oxidase using molecular oxygen. Since alcohol oxidase has a very low affinityfor oxygen, the cell compensates by producing a large amount of alcohol oxidase. All
vectors that are available for P. pastoris are shuttle vectors and are designed to
integrate into the chromosome of P. pastoris upon transformation. Integration can bedirected to the his4 locus (mutated non-functional HIS4) and a functional HIS4 will be
formed upon plasmid integration, enabling the cells to grow on histidine deficientmedium (Fig. 5) (Higgins and Cregg, 1998). In order to secret the target protein to the
culture media, a secretion signal from the S. cerevisiae a-mating factor or the acid
phosphatase signal peptide is generally used (Cereghino and Cregg, 2000).
Nader Nourizad
20
Figure 5. Schematic illustration of plasmid integration by a single cross-over event in the genome ofPichia pastoris at the his4 locus. Cells containing the integrated plasmid can be isolated by selectivegrowth on histidine deficient medium.
Multiple insertion of the target gene into the P. pastoris genome might increaserecombinant protein production (Clare et al., 1991). Several strategies to obtain clones
with multiple gene insertions have been established (Clare et al., 1991).Since the bioreactor conditions are well established for P. pastoris, high cell
density cultures can be obtained (Stratton et al., 1998; Bretthauer and Castellino,
1999).
4.3. Filamentous fungiIn many industrial processes filmanetous fungi are used to produce enzymes,
polysaccharides, pigments, lipids, vitamins, polyhydric alcohols and glycolipids.
Filamentous fungi are capable of producing large amounts of specific proteins fromfungal sources (Punt et al., 2002). Improvements in protein yield have been obtained
by traditional strain improvement-strategies using mutagenesis approaches (Punt et
al., 2002).
Recombinant Enzymes in Pyrosequencing Technology
21
For production of non-fungal proteins protease deficient strains have been
developed (van den Hombergh et al., 1997) and fungal proteins have been used asfusion-carriers to improve the secretion of heterologous proteins (Ward et al., 1990).
Aspergillus and Trichoderma are widely used in the industry for large-scaleproduction of proteins. Fungi cells are able to secrete proteins to the culture medium
at high concentrations, up to 30 g/L (Punt et al., 2002). Many strains have GRAS
status and are able to perform post-translational modifications.
4.4. Insect cellsThe use of insect cells for heterologous protein production is a more cost-effective
alternative to mammalian cell cultures (Altmann et al., 1999; McCarroll and King,
1997). The maintenance of cell lines is relatively easy and the yield of correctlyfolded and processed target proteins is generally high, whereas all post-translational
modifications of proteins from higher mammals are not always correct.
Expression systems that use recombinant baculovirus, such as Spodoptera
frugiperda, to introduce target genes into different cells are commonly used (Altmann
et al., 1999). The sf/9 baculovirus vector system has been used to produce a specificHIV envelope protein, which is used for vaccine production. The system has also
been used to express the human prostate-specific antigen (PSA) in a pilot scale
experiment with production levels of 2-4 mg/L (Kurkela et al., 1995). The cell culturemedium is complex and can be up to 15 times more expensive than that used for yeast
or E. coli. Post-translationally modificated proteins expressed in insect cells can besecreted and properly folded. However, post-translational modifications performed in
insect cells are not identical to those occuring in mammalian systems, and there is risk
for incorrect glycosylation. Advantages of this system, compared to mammaliansystems, include low back-ground expression, lower growth temperature and less
expensive culture media (Pfeifer, 1998).
Nader Nourizad
22
Whole insect larvae have also been use to manufacture humanized antibodies. The
level of production of heterologous proteins in this system is higher than when usingmammalian cells, with a potential for protein yields higher than 100 mg/L (Simonsen
and McGrogan, 1994).
4.5. Plant cellsPlant cells also provide an inexpensive and convenient system for large-scale
production of recombinant proteins. Several efficient plant-based expression systems
have been developed. Plant-derived biopharmaceutical proteins, such as antibodies,vaccines, human blood products, hormones and growth regulators, are reaching the
late stages of commercial development (Fischer and Emans, 2000). Industrial
enzymes, such as phytase and glucanase, are other examples of proteins that areproduced in plants (Twyman et al., 2003).
In vegetative plants the recombinant proteins are secreted into their exudates (e.g.
leaves or roots), enabling proteins to be collected continuously (Borisjuk et al., 1999;Komarnytsky et al., 2000). Some plant-based transient expression systems allow rapid
screening of recombinant protein production (Fischer et al., 1999).Plants are considered to be much safer than both microbes and animals as they
generally lack human pathogens, oncogenic DNA sequences and endotoxins
(Twyman et al., 2003). The ability of plants to post-translationally modifyrecombinant proteins was demonstrated by production of functional antibodies
(Twyman et al., 2003). However, there are some differences in post-translationalmodifications compared to mammalian cells, particularly with respect to glycan-chain
structures (Twyman et al., 2003).
The strong and constitutive cauliflower mosaic virus 35S (CaMV 35S) promoter isoften chosen to drive transgene expression in dicotyledonous species. Since the
CaMV 35S promoter has a lower activity in cereals, the maize ubiquitin-1 (ubi-1)promoter is preferred (Twyman et al., 2003).
The compartment in which the recombinant protein accumulates strongly
influences the interrelated processes of protein folding, assembly and post-translational modification (Schillberg et al., 2003). As a result, sub-cellular targeting
can also be used as a general method to increase the yield of recombinant proteins.
Recombinant Enzymes in Pyrosequencing Technology
23
Targeting recombinant proteins to oil bodies or to the plasma membrane can also
facilitate protein purification (Twyman et al., 2003).Maize has been used to commercially produce recombinant avidin and
glucuronidase (Hood et al., 2002; Lamphear et al., 2002), recombinant antibodies,laccase, trypsin and aprotinin (Hood et al., 2002). Potato is the major host for vaccine
production and transgenic potato tubers have been administered to humans in at least
three different clinical trials (Twyman et al., 2003).
4.6. Chinese hamster ovary cells (CHO) and mammalian cellsIn general, proteins that require complex post-translational modifications are
poorly produced in bacteria and yeast. Therefore, more complex expression systems,
such as mammalian cells lines, African Green Monkey kidney cell lines (COS)(Gluzman, 1981) and Chinese Hamster Ovary cell lines (CHO) (Urlaub and Chasin,
1980) are preferred. Expression vectors for transfection of mammalian cell lines have
viral origin and they can be introduced to the host cells either as a non-integrating andnon-replicating DNA vector or as an integrating vector for stable integration of the
target gene into the host cell genome (Makrides, 1999; Colosimo et al., 2000). In thecase of stable integration, all daughter cells will express the recombinant protein for a
considerable period of time (Shoji et al., 1997).
Chinese hamster ovary (CHO) cells are used to produce several commerciallyavailable products, including tissue plasminogen activator (tPA), erythropoetin (EPO)
and recombinant human DNase. Compared to bioreactor conditions for E. coli andyeast, the culture media required for mammalian cell lines is complex and expensive,
but post-translation modifications of recombinant protein, such as glycosylation can
be properly made. Production levels are typically in the range of tens of milligramsper liter per day and the growth rate is slow. Growth supplements, such as mammalian
serum components, can reduce the biosafety of this production system.
4.7. Transgenic animalsThe potential of transgenic animals to produce biologically active recombinant
proteins in an effective and economic manner has stimulated a great interest in this
system. Since milk is a product that can be easily collected in large volumes, the
Nader Nourizad
24
mammary gland tissue has generally been considered the preferred choice of
production of recombinant proteins. Traditional dairy species, such as sheep, goatsand cows have been used to produce recombinant proteins (Eyestone, 1999; Dyck et
al., 2003). Other forms of collectable body fluids, such as blood, urine and seminal-fluid could also be used for production of target proteins (Dyck et al., 2003). The use
of transgenic eggs for large-scale production of recombinant proteins is another
option (Dyck et al., 2003).Techniques that have been successful at introducing a foreign gene into animals
include micro-injection of DNA into the pronuclei of fertilized eggs (Gordon et al.,1980), retrovirus systems in which the viral gene sequences are removed and replaced
with a transgene, and the use of motile sperms as vectors to introduce the target DNA
into oocytes (Dyck et al., 2003).Although the future for production of therapeutic proteins in transgenic animals
looks promising and the transgenic animal bioreactor represent a powerful tool for
producing recombinant proteins, development of transgenic domestic animals iscomplicated (Dyck et al., 2003). Present methods to generate transgenic animals are
relatively ineffective and time-consuming, and efforts to improve transgenesis byvarious methods have had limited achievement (Dyck et al., 2003).
Recombinant Enzymes in Pyrosequencing Technology
25
5. Protein purificationThe demand for recombinant and biologically active proteins, such as enzymes,
hormones, antibodies, and biopharmaceuticals for industrial applications, diagnosis
and medical therapy is constantly increasing. A product is usually isolated andpurified from a complex mixture containing solids, other proteins, carbohydrates,
lipids and other chemicals. Examples of complex mixtures are fermentation broths ofwhole or disrupted recombinant microorganisms, tissue cultures and body fluids, e.g.
blood. Protocols to separate the recombinant protein from contaminating material
usually require a series of different unit operations, such as solid-liquid separation,cell disruption, liquid-liquid extraction, ultra-filtration, salt or alcohol fractionation.
For some products, especially injectable biotherapeutic agents, further purification byone or more polishing steps is necessary. Various fractionation methods are available
to separate proteins, such as ultracentrifugation, chromatography, isoelectric focusing,
gel electrophoresis and aqueous two-phase systems (Issaq et al., 2002; Kepka et al.,2003). This section briefly describes chromatographic methods used for protein
purification.
5.1. Chromatographic methodsThe principle of most chromatographic purification methods is based on
interaction of proteins or peptides with a solid-support (stationary phase) and a
mobile-phase.
5.1.1. Gel filtration (Size Exclusion Chromatography)Gel filtration chromatography is based on partitioning proteins between two liquid
phases, one stationary inside the gel particles and one mobile making up the void
volume between the particles. As a result, molecules are separated relative to
differences in the size and shapes of the proteins and the pore size distribution of thethree-dimensional network of the matrix (Bollag, 1994a). Since only a small volume
of the sample can be loaded onto the column, gel filtration chromatography is suitableas a last polishing step.
Nader Nourizad
26
5.1.2. Ion exchange chromatographyIon exchange chromatography is one of the most important and general separation
methods for purifying proteins. In ion exchange chromatography proteins are
separated according to differences in surface charges. Charges on the proteins bind toopposite charges in the chromatography medium. An ion exchanger consists of an
inert gel matrix that carries the charged groups, which participate in the ion exchangeprocess. Most ion exchangers are either anion exchangers, which carry positively
charged groups and bind anions, e.g., diethylaminoethyl (DEAE) and quaternary
amino (Q), or cation exchangers, which carry negatively charged groups and bindcations, e.g., carboxymethyl (CM) and sulfonate (S). The bound proteins are eluted
from the ion exchanger either by increasing the concentration of salt, which competesfor the same binding site on the ion exchanger, or by changing the pH of the eluent
and as a consequence the proteins lose their charges by titration.
Ion exchange chromatography is easy to use, widely applicable, can give goodresolution and high yield of active material, and can be used to concentrate the sample
(Bollag, 1994b). However, this method usually requires optimization for each targetprotein. In some cases, in order to improve the binding of the target protein onto the
ion exchanger, gene fusion strategies have been used, for example a positively
charged tag (hexa-arginine) was fused to a target protein, which increased its bindingto a cation exchanger (Smith et al., 1984).
5.1.3. Hydrophobic interaction chromatography (HIC)In HIC, proteins are separated based on differences in their content of surface
hydrophobic amino acids and presence of clefts and crevices at or near the proteinsurface (Queiroz et al., 2001). The strength of protein binding depends on the density
of hydrophobic groups at the surface or near the surface of the protein, and on the
type and degree of hydrophobic ligands coupled to the polymer matrix. The mostwidely used ligands for HIC are straight chain alkanes (-Cn) or simple aromatic
compounds (phenyl). The strength of interaction increases with increasing alkyl chainlength (methyl < ethyl <……..< octyl). Proteins are usually eluted by decreasing the
salt concentration in the elution buffer. As HIC requires that the proteins should be in
Recombinant Enzymes in Pyrosequencing Technology
27
high salt concentration, this separation method is of practical use after salt
precipitation or after ion exchange chromatography.
5.1.4. Reversed phase chromatography (RPC)In reversed phase chromatography, separation is based on the hydrophobic
interaction between proteins and immobilized organic molecules (el Rassi et al.,
1990). This separation method differs from HIC by the degree of substitution, as wellas aliphatic content of the groups on the matrix, which is higher for RPC than HIC. In
RPC, the purification is often performed at low pH in order to increase the exposureof hydrophobic patches of the protein. Since the interaction between adsorbent and
protein is much stronger in RPC than HIC, an organic solvent is required for efficient
elution. Purification at low pH and elution by an organic solvent often destroy thethree-dimensional structure of the target protein, and in many cases, leads to protein
denaturation and irreversible inactivation of biological activity. However, in cases
when these treatments are tolerated, RPC can be use as a final polishing step since theresolution of this technology is very high.
5.1.5. Affinity chromatographyAffinity chromatography is a type of adsorption chromatography in which the
molecule to be purified is specifically and reversibly adsorbed by a complementarybinding substance (ligands) immobilized to an insoluble support (matrix). Examples
of useful ligand molecules are antibodies, metals, lectins and biotin (Issaq et al.,2002). Purification is often of a high order and recoveries of active proteins are
generally very high compared to other chromatographic methods. Affinity
chromatography can also concentrate samples, which enables large volumes to beconveniently processed. In this purification method the sample is loaded onto the
column and the proteins of interest are captured by the functional group (immobilizedligand). The bound protein is often recovered by washing the column with a
competitive substrate or a solution that disrupts the interaction between protein and
immobilized ligand (Issaq et al., 2002).By genetic design a fusion tag of different size can be incorporated at the N or C
terminus of a target protein to facilitate its purification, and increase the overall
Nader Nourizad
28
efficiency in the down-stream process. Examples of fusion tag strategies are outlined
in table 1. Immobilized metal affinity chromatography and Staphylococcal protein Aand its derivates (Z, Zbasic, ZZ) are described in more detail in the next section.
References: I (Stahl et al., 1997), II (Stahl and Nygren, 1997), III (Porath et al., 1975), IV (Smith andJohnson, 1988), V (Einhauer and Jungbauer, 2001), VI (Brizzard et al., 1994), VII (di Guan et al.,1988) VIII (Schmidt and Skerra, 1993), IX (Schmidt et al., 1996).
5.1.5.1. IMAC (Immobilized metal affinity chromatography)In the IMAC method, chelating compounds that are covalently bound to a solid
phase are used to catch transition-metal ions (Cu2+, Ni2+, Zn2+, Co2+, Fe3+, Al3+), which
serve as affinity ligands for various proteins. The metal ligand can bind amino acidresidues, such as poly-histidine, tryptophan, or multiple copies of the peptide Ala-His-
Gly-His-Arg-Pro, which can be genetically fused to either the N or the C terminus of
a recombinant protein (Chaga, 2001). Since the interaction between immobilizedmetal ions and the side chains (e.g. poly histidine) has reversible character, it can be
used to capture of the target protein and then be disrupted using mild (non-denaturing)conditions. A major benefit of the His (6) affinity tag is that a recombinant protein can
also be purified under denaturing conditions, which is very suitable for proteins that
are found in inclusion bodies (Nilsson et al., 1997).
Table 1. Examples of affinity fusion tags which are used for protein purification. SPA, StaphylococcalProtein A; SPG, Streptococcal protein G; GSA, Glutatione S transferase; MBP, Maltose Binding protein.
Ligand ReferencesSPA and derivatives Human IgG ISPG and derivatives Human serum alumin IIPoly His Me2+-chelator IIIGST Glutatione IVMonoclonal antibody-peptide
Monoclonal antibodies V
FLAG peptide (mAb M1, mAb M2) VIMBPStreptavidin-peptidase Iand II
AmyloseStreptavidin
VIIVIII & IX
Recombinant Enzymes in Pyrosequencing Technology
29
5.1.5.2. Staphylococcal protein A and its derivates (Z, Zbasic, ZZ)Staphylococcal protein A (SPA) is an immunoglobulin-binding receptor present
on the surface of the gram-positive bacteria Staphylococcus aureus. SpA interacts
with (Ig) of various origins, such as human IgG subclasses (1, 2, 4) via the constantdomain (Langone, 1982; Eliasson et al., 1988). Different variants of SPA (Z, Zbasic,
ZZ) (Fig. 4) (Graslund et al., 2002) have been widely used as fusion partners, becauseof their high IgG binding capacity, high solubility, and stability against proteolysis
(Nilsson et al., 1997). Since SPA has no disulphide bonds, which can otherwise
interfere with disulphide formation in the target protein, the protein and its variantshave been successfully expressed in the cytoplasm, in the periplasm and to the
cultivation media of E. coli. SPA and variant have also been successfully produced inother expression systems, such as yeast, plant, insect and mammalian cells (Nilsson et
al., 1997).
Nader Nourizad
30
6. Present investigationCommercially available enzymes, isolated from native sources, show batch-to-
batch variation in activity and quality and contain contaminants that interfer with the
Pyrosequencing reaction. Thus, the aim of the research presented in this thesis was toproduce the enzymes involved in the Pyrosequencing method by recombinant DNA
technology.Paper I describes small-scale production of the nucleotide degrading enzyme
apyrase and paper II describes optimization of large-scale production of the same
enzyme in a bioreactor. The application of apyrase for template preparation prior tothe Pyrosequencing reaction is discussed in paper III. The production of ATP
sulfurylase, the second enzyme in the Pyrosequencing reaction, is discussed in paperIV. A comparison of the two most widely used exo (-) DNA polymerases, Klenow
polymerase and Sequenase, is discussed in paper V.
A strategy for immobilization of luciferase onto the DNA template, which enablesthe Pyrosequencing reaction to be performed on a chip format, is discussed in paper
VI.
In paper VII a new method for clone checking by the Pyrosequencing method isdescribed. The N-terminus of the His (6)-apyrase construct (discussed in paper II) was
(re)sequenced by this new method.
6.1. Recombinant apyrase (paper I, II, III)Apyrase was produced both in small-scale (shaking-flask culture) and in large-
scale (bioreactor). These production experiments together with application of the
recombinant apyrase in the Pyrosequencing reaction and in a new templatepreparation method are described in the following section.
6.1.1. Small-scale production of apyrase (paper I)Apyrase catalyzes the hydrolysis of phosphoanhydride bonds of nucleoside tri-
and diphosphates in the presence of divalent cations (Plesner, 1995). In thePyrosequencing reaction, apyrase is responsible for degradation of unincorporated
nucleotides and ATP. Since the only commercially available apyrase, isolated from
Recombinant Enzymes in Pyrosequencing Technology
31
potato tubers, showed batch-to-batch variations in activity and quality, we decided to
produce this enzyme recombinantly. The plasmid carrying the cDNA of S. tubersum
apyrase, provided by Harvard University (Handa and Guidotti, 1996), was sequenced
and showed one base deletion (nucleotide G in position 375) in comparison with thepublished sequence (Handa and Guidotti, 1996). A PCR-based method for site
directed mutagenesis of this apyrase clone was applied (Fig. 6).
Figure 6. A schematic representation of the procedure for site directed mutagenesis of the potato tubersapyrase cDNA clone. (A) Two separate PCR reactions were performed on the plasmid carrying theapyrase gene, using primer pair a/b (Ap-EcoRI-up/Biotin-Ap-mut-reverse) and c/d (Biotin-Ap-mut-forward/Ap-XbaI-down), respectively. Primer b and c harbors an extra base represented by a grey box.(B) In order to get a full length template, the non-biotinylated strand from both PCR products wereannealed to each other and a primer extension reaction was performed. (C) The product was used astemplate in a second PCR reaction using primer pair a/d. The full length product harbored the extrabase.
Attempts to produce recombinant apyrase in E. coli resulted in insoluble
aggregates that showed to be difficult to refold. As an alternative expression host themethyltrophic yeast P. pastoris was chosen. The coding sequence of potato apyrase,
without the signal peptide, was cloned into the YpDC541 vector to create a fusion
with the a-mating secretion signal of S. cerevisiae. Thereby, the apyrase gene was
placed under the control of the methanol inducible alcohol oxidase promoter (Fig. 7).
a
b d
c
a
d
A
B
C
Nader Nourizad
32
Figure 7. Schematic picture of the constructed plasmid YpDC541-apyrase. Abbreviations used: 5’-AOX1 promoter, methanol-inducible promoter; 3’-AOX1 terminator, transcription terminatorregion; alfa factor, secretion signal from S. cerevisiae; His4, selection marker in P. pastoris; Kan res,kanamycin resistance gene; COLE1 ori, origin of replication in E. coli; Amp res, ampicillin resistancegene (functional in E. coli only). The constructed plasmid was linearized with StuI beforeelectroporation into P. pastoris.
The YpDC541-apyrase construct was integrated into a protease deficient strain of
P. pastoris (SMD1168). A five hundred ml culture, in a shaking flask, was set up, inwhich the amount of added yeast extract, peptone, and methanol were optimized. A
methanol induction (2% v/v) resulted in secretion of apyrase to a level of 1 mg/L. The
biologically active recombinant apyrase was concentrated and purified. The purifiedenzyme was estimated to be at least 90 percent pure with an overall purification yield
of about 27 percent. The SDS-PAGE and Western blot analyses, showed that thepurified enzyme was hyperglycosylated. N-glycans was removed by endoglycosidase
H, without affecting the enzymatic activity of the apyrase. After deglycosylation a
single band corresponding to a molecular mass of 48 kDa was detected by SDS-PAGE and Coomassie brilliant blue staining (Fig. 8). Although the amount of apyrase
produced in this study was rather low, it was the first reported method for productionof recombinant apyrase.
YpDC541
alpha factor
His4
Kan res
ColE1 ori
Amp res
5'AOX1 promoter3'AOX1 terminator
Stu I
apyrase
NotIXhoI
YpDC541-apyrase
Recombinant Enzymes in Pyrosequencing Technology
33
Figure 8. SDS-PAGE analysis of recombinant apyrase produced in P. pastoris. The SDS-PAGE wasperformed under reducing conditions on a gradient (10-20%) gel. Protein bands were stained byCoomassie brilliant blue. Lanes 1 and 5, standard low weight molecular marker with weights given inthe right margin; lane 2, 15 units commercial apyrase (Sigma Chemical Co.); lane 3, 15 units purifiedrecombinant apyrase; lane 4, 15 units purified recombinant apyrase after endoglycosidase H treatment.
6.1.1.1. Characterization of recombinant apyraseIn potato tuber, apyrase exists in more than one molecular form depending on the
clonal variety (Traverso-Cori et al., 1970). Apyrases from different clonal sources
show differences both in isoelectric point and relative rate of hydrolysis of ATP and
ADP (Traverso-Cori et al., 1970). Apyrase purified from S. tuberosum var. Pimpernel(Pimpernel apyrase, apyrase A) has an ATPase/ADPase ratio close to 10 (Del Campo
et al., 1977) and apyrase isolated from the Desiré variety (Desiré apyrase, apyrase B)has an ATPase/ADPase ratio close to 1 (Del Campo et al., 1977).
The recombinant apyrase produced in both paper I and II was found to be an
apyrase B variant. This was determined by a nucleotide analog inhibition experiment(data not shown). In Fig. 9 the principle for the experimental set up for determination
of apyrase type is schematically illustrated.
1 2 3 4 5 kDa
94.0
43.067.0
30.0
14.4
20.1
Nader Nourizad
34
Figure 9. Schematic illustration of characterization of apyrase types. Traces from real-time monitoring(luminometric assay) of nucleotide degradation by: (a) apyrase A, (b) apyrase B, and (c) recombinantapyrase in the absence or presence of an inhibitor. All reactions were started by addition of 10 pmolATP.
6.1.2. Large-scale production of apyrase (paper II)In a bioreactor, the growth conditions can be better controlled than in a shaking-
flask culture, and high cell densities, which might result in high yields of recombinantprotein, can be obtained (Cereghino et al., 2002).
In paper II, we show that recombinant apyrase can be produced in high amountsby fermentation of P. pastoris in a bioreactor. The fermentation of P. pastoris can be
Apyrase A Apyrase A with inhibitor
Apyrase B
Recombinant apyrase
Apyrase B with inhibitor
Recombinant apyrase with inhibitor
a
c
b
Recombinant Enzymes in Pyrosequencing Technology
35
divided into three different phases. The aim of the first phase is to obtain a high cell
density by growing the cells on glycerol. In the second step, the cells are still fed withglycerol, but at a growth-limiting rate. This will prepare the cells for the transition to
methanol feeding. The third phase is the methanol phase, where the cells are startingto produce the recombinant enzyme.
In order to simplify the down-stream process, a His (6) tag was genetically
incorporated at the N-terminus of the protein by sub-cloning of the apyrase gene intothe pFastBacHTa vector, and thereafter, cloning into the YpDC541 vector (see paper
I). An optimization of the pH and media composition, including fermentation atdifferent pH (5, 6 and 7) and addition of yeast extract and peptone into the cultivation
medium, was performed. At the optimal conditions (pH 7 and addition of yeast extract
and peptone to the medium), 40 mg/L of apyrase was obtained. The production levelwas 40 times higher than earlier obtained for the apyrase in shaking-flask culture. The
recombinant His (6)-apyrase was purified by cation exchange chromatography
(Trisacryl gel) and metal-chelate affinity chromatography (Co2+). The recombinantHis (6)-apyrase was found to be hyperglycosylated and the N-glycan on the protein
was removed by means of a-mannosidase and endoglycosidase H. The metal-chelate
affinity chromatography step removed both remaining contaminants from the cationexchange step and the endoglycosidases used for deglycosylation (Fig. 10).
Figure 10. SDS-PAGE analysis of recombinant His (6)- apyrase produced in P. pastoris. The SDS-PAGE was performed under reducing conditions on a gradient (10-20%) gel. Protein bands werestained by Coomassie brilliant blue. Lane 1, standard low weight molecular marker with weights givenin the left margin; lane 2, 30 units SP-Trisacryl cation exchange purified recombinant His (6)-apyrase;lane 3, 20 units purified recombinant apyrase after endoglycosidase H and a-mannosidase treatment,and metal-chelate chromatography purification.
94.067.043.030.020.114.4
kDa 1 2 3
Nader Nourizad
36
6.2. Application of apyrase in the Pyrosequencing technologyThe activity of (recombinant) apyrase in the Pyrosequencing reaction and in an
enzymatic template preparation method are described in this section.
6.2.1. Recombinant apyrase in the Pyrosequencing reactionThe activity of recombinant native apyrase (paper I) (Fig. 11) and His (6)-apyrase
(paper II) (Fig. 12) were tested in combination with the Pyrosequencing technology.
Both recombinant enzymes showed good activity in comparison to the commercial
apyrase (Fig. 11, 12).
Figure 11. Raw pyrogram sequence data. The Pyrosequencing reaction was performed on a 300 bplong PCR product in the presence of 40 mU commercial apyrase (A) or in the presence of 40 mUpurified recombinant apyrase (B). About 1 pmol of template-primer was used in the assay. The cyclicnucleotide dispensation order was A,C,G,T. The correct DNA sequence is indicated above the traces.
T C5 T G2 A2 G C T C3 T C G T G C G C T C T C2 T G T2 C2 G A C3 T
T C5 T G2 A2 G C T C3 T C G T G C G C T C T C2 T G T2 C2 G A C3 T
A
B
ACGT nucleotide addition order
Recombinant Enzymes in Pyrosequencing Technology
37
Figure 12. Raw pyrogram sequence data. The Pyrosequencing reaction was performed on a 150 bplong PCR product in the presence of 40 mU purified recombinant His (6)-apyrase. About 1 pmol oftemplate-primer was used in the assay. The cyclic nucleotide dispensation order was A,C,G,T. Thecorrect DNA sequence is indicated above the trace.
6.2.2. Application of apyrase for template preparation prior the Pyrosequencingreaction
PCR products that are to be sequenced contain excess amounts of PCR primers,
nucleotides and PPi, which have to be removed or degraded prior to sequencing by
the Pyrosequencing method. These by-products can interfere in the course of DNAsequencing since the amplification primers can re-anneal to the amplified DNA,
causing unspecific sequence signals, and the remaining nucleotides and PPi can causeasynchronous extension and depletion of APS. The salt in the PCR buffer slightly
inhibits the enzyme system and should be removed or diluted.
There are two approaches currently used for template preparation: single-strandtemplate preparation methods (Fig. 13) and double-strand template preparation
methods (Fig. 14).
6.2.2.1. Single-strand methodIn the single-strand method one of the PCR primers is biotin-labeled at the 5’-
terminus. The biotinylated PCR product binds to a streptavidin coated solid support,
allowing the immobilization of the DNA fragment. This permits the immobilized
DNA to be single-stranded by alkali treatment (high pH), and simultaneously, theinterfering components to be removed. The eluted non-biotin-labeled strand can also
be collected and used for sequencing. After the separation step, a sequencing primer isannealed to the single-stranded DNA. There are two methods available for single-
strand DNA preparation: (i) streptavidin coated magnetic beads, using a magnet for
A C G C A G T A C 3A T A T G A C A C T A T G T
Nader Nourizad
38
purification, denaturation and elution, and (ii) streptavidin coated Sepharose beads,
based on filter separation by a vacuum system.
Figure 13. A schematic illustration of the single-strand template preparation method utilized for thePyrosequencing technology.
6.2.2.2. Double-strand method (III)There are two different methods available for preparation of double-stranded
template. In the first method (III), nucleotides, PPi and amplification primers are
removed enzymatically. Nucleotides and PPi are degraded by addition of apyrase andpyrophosphatase, and the amplification primers are removed by exonuclease I, which
specifically degrades single-stranded DNA. The double-stranded DNA is thendenaturated by heat and the sequencing primer is annealed.
The left over nucleotides in the PCR can be degraded either by alkaline
phosphatase (in this study: calf intestine alkaline or shrimp alkaline phosphatase) orapyrase treatment. Among these enzymes apyrase showed to be the most effective for
PCR product withbiotin at the 5´- end
Immobilization andNaOH treatment
Annealing of sequencing primer
3´ 5´
5´5´3´
3´
5´5´3´
3´
3´
3´
5´3´ 5´
5´
Recombinant Enzymes in Pyrosequencing Technology
39
nucleotide degradation. The alkaline phosphatases showed a lower efficiency for
degradation of nucleotides because of the strong inhibition (competitive) byphosphate, which is produced as a by-product. Although apyrase is a very efficient
nucleotide degrading enzyme it can not degrade the PPi produced in the PCR. This isin contrast to alkaline phosphatase, which degrades not only nucleoside tri- and
diphosphates, but also nucleoside monophosphates and PPi. However, when apyrase
is used in combination with enzymes such as inorganic pyrophosphatase or ATPsulfurylase, PPi can be efficiently removed. ATP sulfurylase converts PPi to ATP,
which is subsequently hydrolyzed by apyrase.The remaining PCR primers can be removed by the enzyme exonuclease I.
Exonuclease I specifically degrade ssDNA with 3’ to 5’ polarity. One drawback with
using exonuclease I is the low catalytic rate and termination in presence of primer-dimers and loop structures. Nevertheless, these problem were efficiently solved by
using SSB (and DMSO) together with exonuclease I.
After enzymatic treatment the sample is heated to 96°C to inactivate the enzymes,especially exonuclease I, which otherwise could degrade the sequencing primer. After
the enzymatic inactivation step, a sequence primer is hybridized to the dsDNAtemplate. To allow the primer to hybridize to the DNA, DNA should be first
denaturated. DNA can be denaturated with alkali treatment or by high temperature.
The alkali denaturation has been preferred in the ssDNA template preparation method,but high temperature denaturation is preferred for dsDNA preparation. The critical
moment for efficient primer hybridization, after dsDNA denaturation, is to avoid re-annealing of the two complementary strands (Chen et al., 1997). To delay the re-
association of DNA strands and favor hybridization of shorter oligonucleotides, rapid
cooling, is efficient (Smith, 1979). In most applications dry ice is used for rapidcooling while others recommend even faster cooling at lower temperatures (Brody et
al., 1986; Wetmur, 1991; Jung et al., 1992). In this work, more moderate temperatureshave been applied of practical reasons. Rapid cooling was performed at 0°C when one
of the PCR primers was used as sequencing primer, and at –20°C, when an inner
sequence primer was used. In addition, different types of additives can be used for themaintenance of single strands after denaturation, such as DMSO, SSB and different
detergents (Casanova et al., 1990).
Nader Nourizad
40
High quality sequence data was obtained on DNA of variable lengths (50 to 2000
bp) and GC content. The method was applied on templates from different sources,such as bacterial 16SRNA, Bacillus antrach, human p53 gene, a cDNA library and
plasmids.
Figure 14. A schematic illustration of the double-strand template preparation method utilized for thePyrosequencing technology.
The second double-strand method is based on using blocking primers (Nordstromet al., 2002). The principle behind this approach is to prevent the re-annealing of the
PCR primers to the amplified DNA. This could be carried out either by utilizingcomplementary blocking primers hybridizing to the PCR primers or using non-
extendable primers, with the same sequence as the PCR primers.
PCR reaction
Heating and annealing ofsequencing primer
Enzymatic degradation ofdNTP, PPi and PCR primers
5´5´3´
3´
PiPi Pi
Pi
Pi
Pi
dNMP
dNMP
dNMPdNMPdNMP
PPiPPi
PPi
PPiPPi
PPi
dNTP
dNTP dNTPdNTP
dNTP5´
5´3´
3´
5´5´3´
3´
5´3´5´
3´
Recombinant Enzymes in Pyrosequencing Technology
41
6.3. Recombinant ATP sulfurylase (IV)In this part a method for production and purification of a recombinant ATP
sulfurylase from S. cerevisiae is presented. The gene for ATP sulfurylase (MET 3)
was cloned into a plasmid carrying the lux regulatory system, which directs thesynthesis of ATP sulfurylase to the cytosol of E. coli. The highest production level of
soluble and biologically active ATP sulfurylase was obtained at 18°C and in the XL1-blue strain of E. coli. The ATP sulfurylase activity during production and purification
was followed using a real time assay for ATP sulfurylase.
ATP sulfurylase was purified to electrophoretic homogeneity by ion exchange andgel filtration chromatography (Fig. 15). A recovery of approximately 80% was
obtained. The specific activity was shown to be high (140 U/mg) in comparison withthe commercial preparation (9 U/mg). Furthermore, the purified enzyme was free
from contaminating NTP kinase (Karamohamed et al., 1999) (Fig. 16).
Figure 15. SDS-PAGE analysis of different steps in the purification of recombinant ATP sulfurylasefrom E. coli. The protein bands were stained by Coomassie blue. Lane 1, standard low molecularweight markers; Lane 2, 300 mU ATP sulfurylase from E. coli cell lysate; Lane 3, 300 mU from thepellet after ammonium sulfate fractionation; Lane 4, 420 mU from the pooled fractions after High-QSepharose fractionation; Lane 5, 300 mU from pooled fractions after Superdex 200 fractionation; Lane6, 30 mU of commercial ATP sulfurylase.
6 5 4 3 2 1
Nader Nourizad
42
Figure 16. A typical trace obtained from real-time monitoring of NDP kinase activity of commercial(Co.Sulf.) and recombinant ATP sulfurylase (R.Sulf.). The trace shows that the recombinant ATPsulfurylase is kinase-free, while the commercial enzyme is not.
6.4. DNA polymerases in Pyrosequencing technology (V)A DNA polymerase used in the Pyrosequencing reaction should fulfill a number
of characteristics if high quality data should be obtained. The DNA polymerase mustbe 3'-5' exonuclease-deficient in order to avoid degradation of the sequencing primer
annealed to the template. The processivity must be reasonable high to achieve full
incorporation of nucleotides in each step. Moreover, the DNA polymerase must beable to use modified nucleotides (such as dATPaS and c7dATP) and to incorporate
such nucleotides with high efficiency, especially across homopolymeric T-regions.
Furthermore, it is a clear advantage if primer-dimers and loop-structures cannot beused as substrates. It is also desirable that the polymerase has an efficient strand-
displacement activity.
Since the exonuclease-deficient form of DNA polymerase I large fragment, alsoknown as Klenow fragment and related here as Klenow polymerase, displays many of
the above described features, we decided to produce a 3'-5' exonuclease deficient
Klenow polymerase. The Klenow DNA polymerase exo (+) was muted at two points(Asp355-Ala) and (Glu357-Ala) in order to remove the 3'-5' exonuclease activity. The 3'-
5' exonuclease deficient variant was produced by the T7 promoter system in E. coli
Recombinant Enzymes in Pyrosequencing Technology
43
(data not shown). This enzyme has worked well for most Pyrosequencing applications
so far.Although the 3'-5' exonuclease deficient Klenow polymerase has traditionally
been used in the Pyrosequencing method, sequencing problems due to inefficientincorporation of nucleotide dATPaS in homopolymeric T-regions and extension of
mispairs formed by unspecific hybridization events have occasionally been
encountered. For example, sequencing of templates containing regions with 4 to 5 T
with Klenow polymerase resulted in unsynchronized sequence signals. Further,primer-dimers and 3’-end loops gave increased background signals. Therefore, in
order to improve the performance of the Pyrosequencing technology a modified T7
polymerase (exonuclease deficient T7 DNA polymerase), Sequenase (Tabor andRichardson, 1989), was tested.
The effect of Sequenase on sequencing performance on poly (T)-rich templateswas evaluated in parallel with Klenow DNA polymerase. Sequenase demonstrated far
better catalytic efficiency for all homopolymeric T-regions tested. Synchronized
extension was observed on homopolymeric templates containing regions with up to 8T (Fig. 17(b)). It was also found that both Klenow and Sequenase incorporated all the
other nucleotides (G, T, C) with good efficiency.
Nader Nourizad
44
Figure 17. Sequencing performance by two different DNA polymerases. The Pyrosequencing reactionwas performed on a PCR fragment, containing a poly-T track of seven T, in the presence of (a)Klenow, and (b) Sequenase. Note the low T and high A signal peaks obtained (filled and dotted arrows,respectively) when Klenow was applied. When Sequenase was used the sequence could be easily readand the T and A signal peaks were close to the expected levels. The order of nucleotide addition isindicated on the bottom of the traces. The sequence obtained is indicated above trace b.
6.5. Fusion proteins (VI)In this paper, we designed constructs in which the firefly-luciferase was
genetically fused to a DNA binding protein (Klenow DNA polymerase or SSB) and to
a purification handle (Zbasic) that could be removed by enzymatic cleavage (Fig. 18).The fusion proteins were produced intracellularly in E. coli under control of the
T7 promoter in 500 ml shake flask cultivation. The proteins were released by
sonication, and the soluble fractions were purified. The first purification step for both
a
b
Klenow
Sequenase
A
7A
ACC AT
2T
GT2T
C
Recombinant Enzymes in Pyrosequencing Technology
45
constructs were cation exchange chromatography in which the pH of the buffer was
adjusted to 7.5. The elution of the Zbasic-Klenow-luciferase was performed with alinear gradient and the Zbasic-SSB-luciferase with a step-wise protocol. The cation
exchange chromatography purifications step was efficient and resulted in high yieldof pure protein (with exception for the Zbasic-Klenow-luciferase preparation for which
a minor degradation product was observed). From 500 ml shake flask cultivations, 15
mg Zbasic-SSB-luciferase and 22 mg Zbasic-Klenow-luciferase of high purity wereobtained. The Zbasic tag was removed by enzymatic cleavage using 3C protease
(recombinant coxsackievirus 3C protease) and the target proteins were further purifiedby anion exchange chromatography. The purification yields for both target proteins
were showen to be high and of high purity.
In order to study the binding of the fusion proteins to DNA and the functionalityof the luciferase within the fusion proteins, they were analyzed by complete extension
of immobilized DNA templates, which was monitored by the Pyrosequencing
chemistry. Paramagnetic beads, with immobilized ssDNA and an annealed primer,were incubated in separate reactions with the fusion proteins, Zbasic-SSB-luciferase,
SSB-luciferase, Zbasic-Klenow-luciferase and Klenow-luciferase, respectively. Theproteins were incubated with the immobilized DNA for 30 min and thereafter, all free
unbound protein was washed out. A Pyrosequencing mixture without luciferase and
apyrase, and in the case of Klenow fusions without Klenow, was added to the washedbeads. Run-off reactions were performed in the presence of DNA polymerase and all
four nucleotides. The obtained light intensities were plotted over time and the resultsfrom these experiments are shown in (Fig. 19). All tested proteins were found to
bound selectively to the immobilized DNA and their enzymatic domains were active.
At the plateau point (steady state for light signal production) for Klenow-luciferaseand Zbasic- Klenow-luciferase, soluble Klenow polymerase were added to the reaction
mixtures, but no increase in the signals were observed, indicating that the DNA wassaturated with polymerase.
The Zbasic purification tag did not affect the reaction during these analyses,
therefore, the only necessary down-stream processing step could be a cation exchangechromatography step, which is very selective, efficient, mild, cost-effective and easy
to scale up. This shows that an easy cultivation and a single step purification
Nader Nourizad
46
procedure can be applied to obtain proteins of high purity that are functional in DNA
binding, as well as, polymerase and luciferase activity.
Figure 18. A schematic illustration of the fusion constructs: (A) Zbasic-Klenow-luciferse and (B) Zbasic-SSB-luciferse. The cleavage site for protease 3C is indicated above each construct.
Figure 19. Complete primer extension assay performed on DNA immobilized on magnetic beads byuse of the fusion proteins. The y axis denotes measured light signal in arbitrary units and the x axistime in seconds. (-) DNA curves parallel to the x axis are reactions where all four fusion proteins havebeen incubated with DNA-free beads. The vertical arrow marks time point for addition of 5 unitssoluble Klenow.
Klenow
pT7ZbasicII-Klenow-Luciferase
Zbasic
3c cleavage site
Luciferase
SSB
pT7ZbasicII-SSB-Luciferase
Zbasic
3c cleavage site
Luciferase
A
B
Recombinant Enzymes in Pyrosequencing Technology
47
6.6. Clone checking (VII)As most DNA manipulation techniques can result in artifacts, methods that
facilitate quality control are important. For example, after cloning and/or mutagenesis
of a gene or specific DNA fragment, the new construct should be carefully checkedfor proper function. Clone checking is crucial to confirm that a DNA fragment has
been cloned in the correct frame and orientation within a vector. Moreover, it isrequired to check for undesired mutations that could have occurred during initial PCR
steps. In addition, the quality of oligonucleotides used during different procedures
(e.g., primers for PCR cloning) should also be considered.In this work, we combined the Pyrosequencing technology with a preprogrammed
nucleotide dispensation strategy to allow fast analysis of new DNA constructs. In thepreprogrammed nucleotide dispensation strategy, the nucleotide dispensation order is
predetermined according to the correct type consensus sequence of the clone. This is
in contrast to the general used cyclic nucleotide dispensation strategy where thenucleotides are repeatedly added in a cyclic order, e.g., A, C, G, T.
The new approach was applied to study plasmids constructed for the production ofrecombinant apyrase with a His (6) tag at the N-terminus. The strategy for
construction of the plasmid YpDC541-His (6)-apyrase, which was used for evaluation
of the new clone checking method, is schematically illustrated in (Fig. 20). We usedthe preprogrammed dispensation ability of the Pyrosequencing technique for clone
quality control with successful result. Mutations and deletions were easily observed in
the pyrogram sequence pattern as missing signal peaks. It is worth mentioning thatsingle-base mutations, insertions or deletions that occur in a context of similar bases,
are observed as alterations in signal peak heights within a homopolymeric region.Figure 21 shows three analyzed His (6)-apyrase clones: (i) one with no mutation in
the N-terminus region (Fig. 21a), (ii) one with one base deletion (Fig. 21b), and (iii)
one with a large deletion of 195 nucleotides (Fig. 21c). It is worth noting thatalthough a preprogrammed nucleotide dispensation strategy was used, the sequence
after the large deletion in figure 21c, could be identified. Thus, after the large deletionthe following sequence was obtained CCTATTGGCAACAATATTGAGTATTT-
TAT. This sequence is located 123 bases into the apyrase gene.
Nader Nourizad
48
The preprogrammed dispensation strategy introduce a new sequencing strategy for
clone checking, in which longer and faster reads can be obtained.
Figure 20. Schematic representation of the procedure for sub-cloning and cloning of the apyrase intothe plamids pFastBacHTa and YpDC541, respectively. Abbreviations used: Sig.P, alfa factor secretionsignal from S. cerevisiae; MCS, Multi Cloning Site.
SnaBI NotI
MCSSig. P
NotI
ApyraseHis(6)
EheI XbaI
pFastBacHTa
YpDC541
pUC19-Apyrase
EheI
XbaI
His(6)
ApyraseSig. P His(6)
pFastBacHTa-Apyrase
YpDC541-His (6)-Apyrase
MCS
Recombinant Enzymes in Pyrosequencing Technology
49
Figure 21. Pyrogram, preprogrammed sequence information, from three of the apyrase clonesanalyzed. (a) one of the correct clones, (b) one of the clones with a one base deletion (the deletion isindicated with an arrow), and (c) a clone with a large deletion (the start position for the sequence afterthe deletion is indicated with an arrow). The correct sequence of a part of the region analyzed is shownabove trace (a). The nucleotides were added according to the correct sequence of the target DNA.
Plasmid seq ApyraseTGAAGCTTAC AGAGGATCGCATCACCATCACCATCACGATTACGATATCCCAACGACCGAAAACCTGTATTTTCAGGGCGCC CAAATTCCATTGAGAAG5´
3´
a
b
c
T G G C A C A G A A T C G C A T C A A T C A A T C A C G A A C G A T A T C G A G T G T A C A C G
A2 T2 G2
A G A G G A C A A G T C A T
C2 C2 T2A2 C2
C3A4
C2
T4
G3 C3 A3
T2 C2 T2 A2
T3T2 A2
T G G C A T A C C T A G A G T A A T
A2
C3
T2 G2 A2 A2 T2
T4
Nader Nourizad
50
7. Concluding remarks and future trendsThe Pyrosequencing technology is based on real-time detection of DNA synthesis
monitored by bioluminescence. This technology is a versatile DNA sequencing
technology suitable for many applications, such as SNP genotying, bacteriagenotying, virus genotying, fungi genotying and tag sequencing. In this thesis we
have extended the application field of this technology by adding a method for dsDNAsequencing and a method for clone checking. In addition, to increase the efficiency of
the Pyrosequencing system, strategies for production and isolation of several of the
proteins involved in this system were developed. Production of the nucleotide-degrading enzyme (apyrase) in a bioreactor was optimized and a protocol for
production and purification of ATP sulfurylase was developed.In one study, a gene fusion strategy was used to enable immobilization of
luciferase (light producing enzyme) on the DNA template. Importantly, the ability to
attach luciferase to the DNA template enables future development of thePyrosequencing technology in a chip format.
Further improvements of the Pyrosequencing technology, especially in read-
lenght, can be made by investigating proteins involved in the reaction. This thesis haspresented some strategies to improve the Pyrosequencing technology by improving
the quality of necessary protein components and diversifying its application. In thefuture, the enzymes involved in this method can be genetically improved to be able to
perform specific tasks, for example the DNA polymerase might be modified to be
able to perform the polymerization step with higher processivity and velocity,whereas ATP sulfurylase, luciferase and apyrase can be modified to increase their
thermostability, which will allow the Pyrosequencing reaction to be performed at hightemperature. The possibility to replace the present enzymes with a new and better set
from different native sources should also be explored.
Recombinant Enzymes in Pyrosequencing Technology
51
Abbreviations
ADP adenosine diphosphate
AMP adenosine monophosphate
APS adenosine phosphosulfateATP adenosine triphosphate
bp base pairCCD charge-coupled device
cDNA complementary DNA
dATP deoxyadenosine triphosphatedATPaS deoxyadenosine alfa-thiotriphosphate
ddATP dideoxyadenosine triphosphate
ddCTP dideoxycytidine triphosphate
ddGTP dideoxyguanine triphosphateddNTP dideoxynucleoside triphosphate
ddTTP dideoxythymidine triphosphatedGTP deoxyguanine triphosphate
dNDP deoxynucleoside diphosphate
dNMP deoxynucleoside monophosphatedNTP deoxynucleoside triphosphate
ds double-strandeddTTP deoxythymidine triphosphate
DNA deoxyribonucleic acid
EDTA ethylenediamine tetraacetic acidkb kilobase
KF Klenow fragmentPCR polymerase chain reaction
PPi inorganic pyrophosphate
DEAE diethylaminoethylCM carboxymethyl
S sulfonate
Nader Nourizad
52
Q quaternary amino
SPA Staphylococcal protein ASPG Streptococcal protein G
GSA glutathione S transferaseMBP maltose binding protein
IMAC immobilized metal affinity chromatography
PAPS adenosine 3’-phosphoate 5’-phosphosulphateSSB single-strand DNA-binding protein
CAMW cauliflower mosaic virusb-IAA b-indoleacrylic acid
km Michaelis-Menten constantcDNA complementary DNA
SNP single nucleotide polymorphismTA Tris-acetate
DMSO dimethyl sulfoxide
Recombinant Enzymes in Pyrosequencing Technology
53
AcknowledgementsBy experience from many years in KTH, I know that the acknowledgement is the first
part (sometimes the only part) to be explored by colleagues. So lets start. Do not worry; it is avery nice and positive acknowledgement.
First of all I take this opportunity to express my warm heart feeling (hjärtliga) to allpeople I know that have some positive input in my entire life. These pages are thanks givingpart and I start with the entire staff at the biotechnology department (three floors) forproductive collaborations. I would like to thank in particular:
Professor Pål Nyrén, my supervisor who accept me as diploma worker first and later as aPh.D student. I would like to thank him for his scientific guidance, for his respect to studentsand their integrity, for his great sense of humor, positive attitude and for his patience andhaving time to hear my crazy ideas här och där. His family, Maja, Aaron and Emma(vildbasarna) are also acknowledged for nice conversations during our Pyro-group parties.
I would like to thank Pål again for critical reading of this thesis.
Dr Mostafa Ronaghi, for great and supportive friendship, for his endless vision, andmost of all for his general generosity (My life in Stockholm started with 4 months living inhis apartment, thanks again for your generosity) and for your positive attitude.
Dr Baback Gharizadeh, a great friend with a lot of energy, colleague who made our laba hyperactive place for experiment and collaborations, for his good taste in music, for hisgood advises how I can bring up my children??, for all walking moment to Karlberg duringall these years and of course for his enormous knowledge about computer (my Mac guru).Thank you for all assistance, collaboration and interesting conversations. TommyNordström, a nice friend and colleague with a good sense of humor Jonas Eriksson, for allthe nice conversations and collaborations. Carlos Garcia and Samer Kara, the old membersof the group, for your friendship and collaboration, all diploma workers in the Pyromanklubben (Mattias, Marie, Sophia, Flora, Aman, Andres, Simon, Anders A).
Assoc. professor Sophia Hober and Assoc. professor Andres Veide for your expertguidance through the protein production and purification meeting and always taking yourtime with patience to have fruitful dialogues and scientific conversations.
Assoc. professor Sophia Hober again for your collaboration over three articles.
Professor Per Åke Nygren for all on line discussion about purification.
Assoc. professor Per Ljungdahl at Ludwig institute (Karolinska) for his hugeknowledge and interest for molecular biology, especially Baker’s yeast. Thanks for yourexpertis help during my time in the Karolinska.
Dr Emma Master (she is a Canadian-Persian girl) for her valuable comments on thisthesis and all other papers.
Dr Tor Björn Gräslund for his all expertise help in protein science.
Maria Ehn for her positive and nice collaborations over three papers.
Nader Nourizad
54
Reza Salmalian our fermentation expert for friendship during the last year and for allhelp, which have assisted me in my work.
Aman and Anders A (halv-Pyromaner) for their sense of humor.
Bahram Amini, fruitful collaborations and all sequencings work during years. Alwaysbeing ready to help.
Alphonsa Lourdudoss, Lotta Rosenfeldt (fick den här äran att ha dig som toast master)Anne Jifält, Marita Johnsson, Monica Ruck and Pia Ahnlén, for all excellent professionalassistance during the years Gunnila Applegren for your positive energy, and TommyÖstlund, our best technical person, for his technical assistance during all years.
Alphonsa Lourdudoss and Lotta Rosenfeldt, thanks again for all nice lunchconversations and all tårta–fika during years.
All the new and old members of the family floor 2: I start with room nr 1: ProfessorKarl Hult for your energy and knowledge in metabolism, Professor Tulla Terri for yourvision and hard working and of course some interest for different soup, Anna and Totte myfavorite forskar par (harmonic and positive researcher, for our conversation about plant celltransformation and many other things) (filmjölk specialister), Linda for your kindness ineverything, even for föreldrarlösa cats, Dr Harry for critical reading of my two papers (I,VII) and your sense of humor, the Belgian and Canadian room, Dr Kathleen thanks for allhelp for XET and your positive carma and I take this opportunity för att tacka Wald påSvenska for our music discussions, Assoc. Professor Mats Martinell for your interest inprotein production, especially lab course (you choose always me as a lab course ansvarig,thanks a lot), Anders for your relax attitude in the case of lab course and all scientificdiscussions (insulin), Cecilia M, a nice girl with bio-cathalic dance ambition (jätte bugg),Maria nice lady med humor, Eva another nice lady in that room, she is ranked nr 60 as atennis player in the Sweden (WOOOW!), I forgot almost Dr Fredrik for his discussion abouteverything (and nothing), computer questions (squash guru), Now we are nära to Bloody hellroom, Åsa vollybollstjärna (förlåt mig, beachvollystjärna) who always provide me with tipsand notes about patent and starts-up company, you are a positive and energetic girl. Ulla apositive girl who likes adrenalin-full adventures, she helped me to find a new talent in myself(Nader-Brandman), our Lab needs you for new adventures, Dr (soon) Henrik my Elvis (theonly copy in the world, who is better than the original), Soraya my venture cup partner andfor your positive attitude to the life. Assoc. Professor Per Berglund, a real scientist with apedantisk skött room, Dr Park, my south Korean brother, thanks for all help during writingthis thesis, I am still waiting for the final fight (you can choose place), Cecilia B, super girlwith super ambitions, Marianne, a good doktorand and a good mother who loves roller blade,diving etc, Dr Malin, my assisterande toast master, a generous, positive and happy girl (somälskar godis). Dr Joke-Hollendare with H2O ambition, a nice girl, happy, positive, etc(Nader ska jobba på Astra?? Eller hur Joke) and her kind man Dr DJ, Magnus (Matrix),utmanaren som byte sida, happy guy with a lot of energy (American football), a crazy guy in(min smak), Drs Martin and Christina for all discussion about crystallography, DrHongbin for all help for Äkta purification (you always have time for my questions, thanks alot). The UFO(R) room, Martin for your sense of humor and computer help (PC guru), Dr Qifor our lunch discussion about food-boxes, Anders en envis protein-dykare, Alex my brotherfrom India, who invite me and my family to his wedding (in India), thanks, we will come, DrLionel De Capprio for your sense of humor. And all dipolma worker, Anders, Mattias,Veronika, Maria, Peter for all nice lunch discussion. Old member at floor 2, Dr KristinaBlomqvist for all nice discussion and help about yeast transformation, Dr Stewart (mad cow)for your sense of humor and all antibody tips, and Dr Mats Holmquist for teaching me the
Recombinant Enzymes in Pyrosequencing Technology
55
Pichia pastoris expression system. Kalle och Mike mina favorit studenter på protein reningkursen.
From first floor: Dr Mehmedalija (Bato) (fermentaion expert) for all nice discussions,Maria B (an active and + girl), Maga (DNA chip expert), Ella (Bradford expert) for all helpand scientific discussions during years.
The microbiology group; Professor Gunnel Dalhamar for your interest to be member inthe blowing club, Pelle a real scout leader, Kaj my Finish brother for all scanning work andyour interest for allt annat utom jorden. Peter Komlos and his wife Marita for nicediscussions, Jaky-Foo a nice arbetskamrat with vision outside the Sweden (oooh you arecoming to my party!!), Lydia and Seyoum, for nice discussion, Karin för att du alltidkommer ihåg din disk-vecka, Anna som kommer alltid och endast på tårt-möte.
The staff at Pyrosequencing AB for technical assistance and expertise, particularlyBjörn Ekström, Dr Maria Murby, Dr Björn Ingemarsson, Dr Anders Alderborn, D rNigel Tooke, Peter Hagerlid, Peter Lindqvist, Christina Johansson, Jenny Dunker,Kristin Hellman, Dr Annika Tallsjö and Per-Johan Ulfendahl.
All teachers at the university of Kalmar who make this university to be the bestHögskolan in the Sweden after KTH. Special thanks to Anki Koch-Schmidt for your visionand energy.
All teachers and kitchen personal at the Folkhögskolan in Nässjö, Special thanks toMathematic and physic teacher Mats Johansson for your pedagogic teaching.
All members in our football team (Tehran-united), Abbas, Davood, Daryosh, Shervin.
All members in the GTM (Jalal, Davood, Abbas, Saeed) for the future collaboration.
I would also like to express my deepest appreciation and gratitude to all my friends fortheir friendship: Jalal and his family (Åsa, Daniel, David) Reza Khiabani, FredrickLekarp, Nader Pourmand and his family (Soheila, Arvin, Ayda), Bahram Amini and hisfamily (Parisa, Anahita), Afshin Ahmadian and his family (Mojgan, Jasmine), Mehran,Virginija and her family, Farshid and his family (Lena, Daniel and Farideh), Morteza andFarideh (Azadeh, Mehdi)
Kim Nouria for your vision and energy and future collaboration.
My nice and crazy friends in the family; Shahnavaz+Lundberg (Shervin, Anna, andmy nice God-son Viggo and God-daughter Lo) for nice hospitality, help, discussions andall parties over years.
Ramin, Abbas, Davood, Jalal, Daryoosh, Shervin, Afshin S, Baback, Reza, Hadi,Amene my best friends. You have been nice and true friends through all years.
My parent(s), my sisters and their families, Zoya, Soheila (Armin), Nahid and Hossein(Ali, Arash, Shahrzad, Aria) for their constant love and support. Dear Shahrzad, my sisterdoughter with a lot of good ambitions and her nice husband, Shab.
My Swedish relatives; familjen Karlsson 1 (Kjell, Gittan, Emma), familjen Karlsson 2(Roger, Carina, Erica, Robin), familjen Karlsson 3 (Fredrik, Maria) for their hospitalityduring all these years.
My family; Ann Britt my love and my source of joy, happiness and energy (bakom varjeframgångsrik man står en kvinna), my beloved daughter (Sarah) and my beloved son (Sam),vildbasarna som väcker mina barnliga sidor varje dag.I am sure that I have forgot some friends in this acknowledgement. By this I say: Tack allesammans!
Nader Nourizad
56
ReferencesAltmann, F., Staudacher, E., Wilson, I.B. and Marz, L.: Insect cells as hosts for the expression ofrecombinant glycoproteins. Glycoconj J 16 (1999) 109-23.
Ball, J.K. and Desselberger, U.: Incorporation of single-stranded DNA binding protein early inpolymerase chain reaction product sequencing reactions prevents enzyme pausing. Anal Biochem 207(1992) 349-51.
Bedford, E., Tabor, S. and Richardson, C.C.: The thioredoxin binding domain of bacteriophage T7DNA polymerase confers processivity on Escherichia coli DNA polymerase I. Proc Natl Acad Sci U SA 94 (1997) 479-84.
Bernard, H.U., Remaut, E., Hershfield, M.V., Das, H.K., Helinski, D.R., Yanofsky, C. and Franklin,N.: Construction of plasmid cloning vehicles that promote gene expression from the bacteriophagelambda pL promoter. Gene 5 (1979) 59-76.
Blattner, F.R., Plunkett, G., 3rd, Bloch, C.A., Perna, N.T., Burland, V., Riley, M., Collado-Vides, J.,Glasner, J.D., Rode, C.K., Mayhew, G.F., et al.: The complete genome sequence of Escherichia coli K-12. Science 277 (1997) 1453-74.
Blight, M.A., Chervaux, C. and Holland, I.B.: Protein secretion pathway in Escherichia coli. Curr OpinBiotechnol 5 (1994) 468-74.
Boeck, C.R., Sarkis, J.J. and Vendite, D.: Kinetic characterization and immunodetection of ecto-ATPdiphosphohydrolase (EC 3.6.1.5) in cultured hippocampal neurons. Neurochem Int 40 (2002) 449-53.
Bollag, D.M.: Gel-filtration chromatography. Methods Mol Biol 36 (1994a) 1-9.
Bollag, D.M.: Ion-exchange chromatography. Methods Mol Biol 36 (1994b) 11-22.
Borisjuk, N.V., Borisjuk, L.G., Logendra, S., Petersen, F., Gleba, Y. and Raskin, I.: Production ofrecombinant proteins in plant root exudates. Nat Biotechnol 17 (1999) 466-9.
Branchini, B.R., Magyar, R.A., Murtiashaw, M.H., Anderson, S.M., Helgerson, L.C. and Zimmer, M.:Site-directed mutagenesis of firefly luciferase active site amino acids: a proposed model forbioluminescence color. Biochemistry 38 (1999) 13223-30.
Branchini, B.R., Magyar, R.A., Murtiashaw, M.H., Anderson, S.M. and Zimmer, M.: Site-directedmutagenesis of histidine 245 in firefly luciferase: a proposed model of the active site. Biochemistry 37(1998) 15311-9.
Brandan, E. and Hirschberg, C.B.: Purification of rat liver N-heparan-sulfate sulfotransferase. J BiolChem 263 (1988) 2417-22.
Bretthauer, R.K. and Castellino, F.J.: Glycosylation of Pichia pastoris-derived proteins. BiotechnolAppl Biochem 30 ( Pt 3) (1999) 193-200.
Brill, S.J. and Stillman, B.: Replication factor-A from Saccharomyces cerevisiae is encoded by threeessential genes coordinately expressed at S phase. Genes Dev 5 (1991) 1589-600.
Brizzard, B.L., Chubet, R.G. and Vizard, D.L.: Immunoaffinity purification of FLAG epitope-taggedbacterial alkaline phosphatase using a novel monoclonal antibody and peptide elution. Biotechniques16 (1994) 730-5.
Brody, R.S., Doherty, K.G. and Zimmerman, P.D.: Processivity and kinetics of the reaction ofexonuclease I from Escherichia coli with polydeoxyribonucleotides. J Biol Chem 261 (1986) 7136-43.
Recombinant Enzymes in Pyrosequencing Technology
57
Brutlag, D. and Kornberg, A.: Enzymatic synthesis of deoxyribonucleic acid. 36. A proofreadingfunction for the 3' leads to 5' exonuclease activity in deoxyribonucleic acid polymerases. J Biol Chem247 (1972) 241-8.
Buchner, J. and Rudolph, R.: Renaturation, purification and characterization of recombinant Fab-fragments produced in Escherichia coli. Biotechnology (N Y) 9 (1991) 157-62.
Casanova, J.L., Pannetier, C., Jaulin, C. and Kourilsky, P.: Optimal conditions for directly sequencingdouble-stranded PCR products with sequenase. Nucleic Acids Res 18 (1990) 4028.
Cereghino, G.P., Cereghino, J.L., Ilgen, C. and Cregg, J.M.: Production of recombinant proteins infermenter cultures of the yeast Pichia pastoris. Curr Opin Biotechnol 13 (2002) 329-32.
Cereghino, J.L. and Cregg, J.M.: Heterologous protein expression in the methylotrophic yeast Pichiapastoris. FEMS Microbiol Rev 24 (2000) 45-66.
Chaga, G.S.: Twenty-five years of immobilized metal ion affinity chromatography: past, present andfuture. J Biochem Biophys Methods 49 (2001) 313-34.
Chen, X., Zehnbauer, B., Gnirke, A. and Kwok, P.Y.: Fluorescence energy transfer detection as ahomogeneous DNA diagnostic method. Proc Natl Acad Sci U S A 94 (1997) 10756-61.
Clare, J.J., Romanos, M.A., Rayment, F.B., Rowedder, J.E., Smith, M.A., Payne, M.M., Sreekrishna,K. and Henwood, C.A.: Production of mouse epidermal growth factor in yeast: high-level secretionusing Pichia pastoris strains containing multiple gene copies. Gene 105 (1991) 205-12.
Cline, J., Braman, J.C. and Hogrefe, H.H.: PCR fidelity of pfu DNA polymerase and otherthermostable DNA polymerases. Nucleic Acids Res 24 (1996) 3546-51.
Colosimo, A., Goncz, K.K., Holmes, A.R., Kunzelmann, K., Novelli, G., Malone, R.W., Bennett, M.J.and Gruenert, D.C.: Transfer and expression of foreign genes in mammalian cells. Biotechniques 29(2000) 314-8, 320-2, 324 passim.
Cornelis, P.: Expressing genes in different Escherichia coli compartments. Curr Opin Biotechnol 11(2000) 450-4.
Cregg, J.M., Cereghino, J.L., Shi, J. and Higgins, D.R.: Recombinant protein expression in Pichiapastoris. Mol Biotechnol 16 (2000) 23-52.
Dabrowski, S. and Kur, J.: Cloning, overexpression, and purification of the recombinant His-taggedSSB protein of Escherichia coli and use in polymerase chain reaction amplification. Protein Expr Purif16 (1999) 96-102.
Datar, R.V., Cartwright, T. and Rosen, C.G.: Process economics of animal cell and bacterialfermentations: a case study analysis of tissue plasminogen activator. Biotechnology (N Y) 11 (1993)349-57.
Day, R.B., McAlvin, C.B., Loh, J.T., Denny, R.L., Wood, T.C., Young, N.D. and Stacey, G.:Differential expression of two soybean apyrases, one of which is an early nodulin. Mol Plant MicrobeInteract 13 (2000) 1053-70.
de Wet, J.R., Wood, K.V., Helinski, D.R. and DeLuca, M.: Cloning firefly luciferase. MethodsEnzymol 133 (1986) 3-14.
Del Campo, G., Puente, J., Valenzuela, M.A., Traverso-Cori, A. and Cori, O.: Hydrolysis of syntheticpyrophosphoric esters by an isoenzyme of apyrase from Solanum tuberosum. Biochem J 167 (1977)525-9.
Nader Nourizad
58
Derbyshire, V., Freemont, P.S., Sanderson, M.R., Beese, L., Friedman, J.M., Joyce, C.M. and Steitz,T.A.: Genetic and crystallographic studies of the 3',5'-exonucleolytic site of DNA polymerase I.Science 240 (1988) 199-201.
di Guan, C., Li, P., Riggs, P.D. and Inouye, H.: Vectors that facilitate the expression and purification offoreign peptides in Escherichia coli by fusion to maltose-binding protein. Gene 67 (1988) 21-30.
Drmanac, R., Labat, I., Brukner, I. and Crkvenjakov, R.: Sequencing of megabase plus DNA byhybridization: theory of the method. Genomics 4 (1989) 114-28.
Dyck, M.K., Lacroix, D., Pothier, F. and Sirard, M.A.: Making recombinant proteins in animals--different systems, different applications. Trends Biotechnol 21 (2003) 394-9.
Einhauer, A. and Jungbauer, A.: The FLAG peptide, a versatile fusion tag for the purification ofrecombinant proteins. J Biochem Biophys Methods 49 (2001) 455-65.
el Rassi, Z., Lee, A.L. and Horvath, C.: Reversed-phase and hydrophobic interaction chromatographyof peptides and proteins. Bioprocess Technol 9 (1990) 447-94.
Eliasson, M., Olsson, A., Palmcrantz, E., Wiberg, K., Inganas, M., Guss, B., Lindberg, M. and Uhlen,M.: Chimeric IgG-binding receptors engineered from staphylococcal protein A and streptococcalprotein G. J Biol Chem 263 (1988) 4323-7.
Eriksson, J., Nordstrom, T. and Nyren, P.: Method enabling firefly luciferase-based bioluminometricassays at elevated temperatures. Anal Biochem 314 (2003) 158-61.
Etzler, M.E., Kalsi, G., Ewing, N.N., Roberts, N.J., Day, R.B. and Murphy, J.B.: A nod factor bindinglectin with apyrase activity from legume roots. Proc Natl Acad Sci U S A 96 (1999) 5856-61.
Eyestone, W.H.: Production and breeding of transgenic cattle using in vitro embryo productiontechnology. Theriogenology 51 (1999) 509-17.
Fabianek, R.A., Hennecke, H. and Thony-Meyer, L.: Periplasmic protein thiol:disulfideoxidoreductases of Escherichia coli. FEMS Microbiol Rev 24 (2000) 303-16.
Fischer, R. and Emans, N.: Molecular farming of pharmaceutical proteins. Transgenic Res 9 (2000)279-99; discussion 277.
Fischer, R., Vaquero-Martin, C., Sack, M., Drossard, J., Emans, N. and Commandeur, U.: Towardsmolecular farming in the future: transient protein expression in plants. Biotechnol Appl Biochem 30 ( Pt2) (1999) 113-6.
Gallez, F., Fadel, M., Scruel, O., Cantraine, F. and Courtois, P.: Salivary biomass assessed bybioluminescence ATP assay related to (bacterial and somatic) cell counts. Cell Biochem Funct 18(2000) 103-8.
Geiger, R. and Miska, W.: Bioluminescence enhanced enzyme immunoassay. New ultrasensitivedetection systems for enzyme immunoassays, II. J Clin Chem Clin Biochem 25 (1987) 31-8.
Gellissen, G.: Heterologous protein production in methylotrophic yeasts. Appl Microbiol Biotechnol 54(2000) 741-50.
Gellissen, G. and Hollenberg, C.P.: Application of yeasts in gene expression studies: a comparison ofSaccharomyces cerevisiae, Hansenula polymorpha and Kluyveromyces lactis -- a review. Gene 190(1997) 87-97.
Recombinant Enzymes in Pyrosequencing Technology
59
Gendron, F.P., Halbfinger, E., Fischer, B. and Beaudoin, A.R.: Inhibitors of NTPDase: key players inthe metabolism of extracellular purines. Adv Exp Med Biol 486 (2000) 119-23.
Georgiou, G. and Valax, P.: Expression of correctly folded proteins in Escherichia coli. Curr OpinBiotechnol 7 (1996) 190-7.
Gold, L., O'Farrell, P.Z. and Russel, M.: Regulation of gene 32 expression during bacteriophage T4infection of Escherichia coli. J Biol Chem 251 (1976) 7251-62.
Gordon, J.W., Scangos, G.A., Plotkin, D.J., Barbosa, J.A. and Ruddle, F.H.: Genetic transformation ofmouse embryos by microinjection of purified DNA. Proc Natl Acad Sci U S A 77 (1980) 7380-4.
Goswami, T. and Pande, S.V.: Radioisotopic assay of femtomole quantities of total adeninenucleotides, ATP plus ADP, and AMP. J Biochem Biophys Methods 9 (1984) 143-51.
Gottesman, S. and Maurizi, M.R.: Regulation by proteolysis: energy-dependent proteases and theirtargets. Microbiol Rev 56 (1992) 592-621.
Graslund, T., Ehn, M., Lundin, G., Hedhammar, M., Uhlen, M., Nygren, P.A. and Hober, S.: Strategyfor highly selective ion-exchange capture using a charge-polarizing fusion partner. J Chromatogr A942 (2002) 157-66.
Grinthal, A. and Guidotti, G.: Substitution of His59 converts CD39 apyrase into an ADPase in aquaternary structure dependent manner. Biochemistry 39 (2000) 9-16.
Guise, A.D., West, S.M. and Chaudhuri, J.B.: Protein folding in vivo and renaturation of recombinantproteins from inclusion bodies. Mol Biotechnol 6 (1996) 53-64.
Guranowski, A., Galbas, M., Hartmann, R. and Justesen, J.: Selective degradation of 2'-adenylateddiadenosine tri- and tetraphosphates, Ap(3)A and Ap(4)A, by two specific human dinucleosidepolyphosphate hydrolases. Arch Biochem Biophys 373 (2000) 218-24.
Hammarstrom, M., Hellgren, N., van Den Berg, S., Berglund, H. and Hard, T.: Rapid screening forimproved solubility of small human proteins produced as fusion proteins in Escherichia coli. ProteinSci 11 (2002) 313-21.
Handa, M. and Guidotti, G.: Purification and cloning of a soluble ATP-diphosphohydrolase (apyrase)from potato tubers (Solanum tuberosum). Biochem Biophys Res Commun 218 (1996) 916-23.
Hasan, N. and Szybalski, W.: Construction of lacIts and lacIqts expression plasmids and evaluation ofthe thermosensitive lac repressor. Gene 163 (1995) 35-40.
Heine, P., Braun, N., Heilbronn, A. and Zimmermann, H.: Functional characterization of rat ecto-ATPase and ecto-ATP diphosphohydrolase after heterologous expression in CHO cells. Eur J Biochem262 (1999) 102-7.
Higgins, D.R. and Cregg, J.M.: Introduction to Pichia pastoris. Methods Mol Biol 103 (1998) 1-15.
Hockney, R.C.: Recent developments in heterologous protein production in Escherichia coli. TrendsBiotechnol 12 (1994) 456-63.
Hollenberg, C.P. and Gellissen, G.: Production of recombinant proteins by methylotrophic yeasts. CurrOpin Biotechnol 8 (1997) 554-60.
Hood, E.E., Woodard, S.L. and Horn, M.E.: Monoclonal antibody manufacturing in transgenic plants--myths and realities. Curr Opin Biotechnol 13 (2002) 630-5.
Nader Nourizad
60
Hsieh, H.L., Song, C.J. and Roux, S.J.: Regulation of a recombinant pea nuclear apyrase by calmodulinand casein kinase II. Biochim Biophys Acta 1494 (2000) 248-55.
Hutchison, C.A., 3rd, Phillips, S., Edgell, M.H., Gillam, S., Jahnke, P. and Smith, M.: Mutagenesis at aspecific position in a DNA sequence. J Biol Chem 253 (1978) 6551-60.
Issaq, H.J., Conrads, T.P., Janini, G.M. and Veenstra, T.D.: Methods for fractionation, separation andprofiling of proteins and peptides. Electrophoresis 23 (2002) 3048-61.
Jacobson, K.B., Arlinghaus, H.F., Buchanan, M.V., Chen, C.H., Glish, G.L., Hettich, R.L. andMcLuckey, S.A.: Applications of mass spectrometry to DNA sequencing. Genet Anal Tech Appl 8(1991) 223-9.
Johnson, I.S.: Human insulin from recombinant DNA technology. Science 219 (1983) 632-7.
Jonasson, P., Liljeqvist, S., Nygren, P.A. and Stahl, S.: Genetic design for facilitated production andrecovery of recombinant proteins in Escherichia coli. Biotechnol Appl Biochem 35 (2002) 91-105.
Jung, M., Dritschilo, A. and Kasid, U.: Reliable and efficient direct sequencing of PCR-amplifieddouble-stranded genomic DNA template. PCR Methods Appl 1 (1992) 171-4.
Kajiyama, N. and Nakano, E.: Thermostabilization of firefly luciferase by a single amino acidsubstitution at position 217. Biochemistry 32 (1993) 13795-9.
Karamohamed, S. and Guidotti, G.: Bioluminometric method for real-time detection of ATPaseactivity. Biotechniques 31 (2001) 420-5.
Karamohamed, S., Nordstrom, T. and Nyren, P.: Real-time bioluminometric method for detection ofnucleoside diphosphate kinase activity. Biotechniques 26 (1999) 728-34.
Kepka, C., Collet, E., Persson, J., Stahl, A., Lagerstedt, T., Tjerneld, F. and Veide, A.: Pilot-scaleextraction of an intracellular recombinant cutinase from E. coli cell homogenate using athermoseparating aqueous two-phase system. J Biotechnol 103 (2003) 165-81.
Kim, Y.T. and Richardson, C.C.: Bacteriophage T7 gene 2.5 protein: an essential protein for DNAreplication. Proc Natl Acad Sci U S A 90 (1993) 10173-7.
Klenow, H., Overgaard-Hansen, K. and Patkar, S.A.: Proteolytic cleavage fo native DNA polymeraseinto two different catalytic fragments. Influence of assay condtions on the change of exonucleaseactivity and polymerase activity accompanying cleavage. Eur J Biochem 22 (1971) 371-81.
Kobatake, E., Iwai, T., Ikariyama, Y. and Aizawa, M.: Bioluminescent immunoassay with a protein A-luciferase fusion protein. Anal Biochem 208 (1993) 300-5.
Komarnytsky, S., Borisjuk, N.V., Borisjuk, L.G., Alam, M.Z. and Raskin, I.: Production ofrecombinant proteins in tobacco guttation fluid. Plant Physiol 124 (2000) 927-34.
Komoszynski, M.A.: Comparative studies on animal and plant apyrases (ATP diphosphohydrolase EC3.6.1.5) with application of immunological techniques and various ATPase inhibitors. Comp BiochemPhysiol B Biochem Mol Biol 113 (1996) 581-91.
Kornberg, A.: DNA replication. J Biol Chem 263 (1988) 1-4.
Kornberg, R.D. and Lorch, Y.: Chromatin structure and transcription. Annu Rev Cell Biol 8 (1992) 563-87.
Recombinant Enzymes in Pyrosequencing Technology
61
Kurkela, R., Herrala, A., Henttu, P., Nai, H. and Vihko, P.: Expression of active, secreted humanprostate-specific antigen by recombinant baculovirus-infected insect cells on a pilot-scale.Biotechnology (N Y) 13 (1995) 1230-4.
Lamphear, B.J., Streatfield, S.J., Jilka, J.M., Brooks, C.A., Barker, D.K., Turner, D.D., Delaney, D.E.,Garcia, M., Wiggins, B., Woodard, S.L., et al.: Delivery of subunit vaccines in maize seed. J ControlRelease 85 (2002) 169-80.
Langone, J.J.: Applications of immobilized protein A in immunochemical techniques. J ImmunolMethods 55 (1982) 277-96.
LaVallie, E.R., DiBlasio, E.A., Kovacic, S., Grant, K.L., Schendel, P.F. and McCoy, J.M.: Athioredoxin gene fusion expression system that circumvents inclusion body formation in the E. colicytoplasm. Biotechnology (N Y) 11 (1993) 187-93.
Leyh, T.S., Taylor, J.C. and Markham, G.D.: The sulfate activation locus of Escherichia coli K12:cloning, genetic, and enzymatic characterization. J Biol Chem 263 (1988) 2409-16.
Li, H., Deyrup, A., Mensch, J.R., Jr., Domowicz, M., Konstantinidis, A.K. and Schwartz, N.B.: Theisolation and characterization of cDNA encoding the mouse bifunctional ATP sulfurylase-adenosine 5'-phosphosulfate kinase. J Biol Chem 270 (1995) 29453-9.
Lilie, H., Schwarz, E. and Rudolph, R.: Advances in refolding of proteins produced in E. coli. CurrOpin Biotechnol 9 (1998) 497-501.
Linn, S. and Arber, W.: Host specificity of DNA produced by Escherichia coli, X. In vitro restriction ofphage fd replicative form. Proc Natl Acad Sci U S A 59 (1968) 1300-6.
Lofdahl, S., Guss, B., Uhlen, M., Philipson, L. and Lindberg, M.: Gene for staphylococcal protein A.Proc Natl Acad Sci U S A 80 (1983) 697-701.
Makrides, S.C.: Components of vectors for gene transfer and expression in mammalian cells. ProteinExpr Purif 17 (1999) 183-202.
Maurizi, M.R.: Proteases and protein degradation in Escherichia coli. Experientia 48 (1992) 178-201.
Maxam, A.M. and Gilbert, W.: A new method for sequencing DNA. Proc Natl Acad Sci U S A 74(1977) 560-4.
McCarroll, L. and King, L.A.: Stable insect cell cultures for recombinant protein production. CurrOpin Biotechnol 8 (1997) 590-4.
McClure, W.R. and Jovin, T.M.: The steady state kinetic parameters and non-processivity ofEscherichia coli deoxyribonucleic acid polymerase I. J Biol Chem 250 (1975) 4073-80.
McEntee, K., Weinstock, G.M. and Lehman, I.R.: recA protein-catalyzed strand assimilation:stimulation by Escherichia coli single-stranded DNA-binding protein. Proc Natl Acad Sci U S A 77(1980) 857-61.
Meselson, M. and Yuan, R.: DNA restriction enzyme from E. coli. Nature 217 (1968) 1110-4.
Meyer, R.R., Glassberg, J. and Kornberg, A.: An Escherichia coli mutant defective in single-strandbinding protein is defective in DNA replication. Proc Natl Acad Sci U S A 76 (1979) 1702-5.
Miska, W. and Geiger, R.: Synthesis and characterization of luciferin derivatives for use inbioluminescence enhanced enzyme immunoassays. New ultrasensitive detection systems for enzymeimmunoassays, I. J Clin Chem Clin Biochem 25 (1987) 23-30.
Nader Nourizad
62
Moks, T., Abrahmsen, L., Nilsson, B., Hellman, U., Sjoquist, J. and Uhlen, M.: Staphylococcal proteinA consists of five IgG-binding domains. Eur J Biochem 156 (1986) 637-43.
Mukhopadhyay, A.: Inclusion bodies and purification of proteins in biologically active forms. AdvBiochem Eng Biotechnol 56 (1997) 61-109.
Muller, M., Koch, H.G., Beck, K. and Schafer, U.: Protein traffic in bacteria: multiple routes from theribosome to and across the membrane. Prog Nucleic Acid Res Mol Biol 66 (2001) 107-57.
Mullis, K.B. and Faloona, F.A.: Specific synthesis of DNA in vitro via a polymerase-catalyzed chainreaction. Methods Enzymol 155 (1987) 335-50.
Murray, K.K.: DNA sequencing by mass spectrometry. J Mass Spectrom 31 (1996) 1203-15.
Nilsson, B. and Abrahmsen, L.: Fusions to staphylococcal protein A. Methods Enzymol 185 (1990)144-61.
Nilsson, B., Moks, T., Jansson, B., Abrahmsen, L., Elmblad, A., Holmgren, E., Henrichson, C., Jones,T.A. and Uhlen, M.: A synthetic IgG-binding domain based on staphylococcal protein A. Protein Eng1 (1987) 107-13.
Nilsson, J., Stahl, S., Lundeberg, J., Uhlen, M. and Nygren, P.A.: Affinity fusion strategies fordetection, purification, and immobilization of recombinant proteins. Protein Expr Purif 11 (1997) 1-16.
Niza-Riberio, J., Louzã, A.C., Santos, P. and Lima, M.: Monitoring the microbiological quality of rawmilk through the use of an ATP bioluminescence method. Food Control 11 (2000) 209-216.
Nordstrom, T., Alderborn, A. and Nyren, P.: Method for one-step preparation of double-stranded DNAtemplate applicable for use with Pyrosequencing technology. J Biochem Biophys Methods 52 (2002)71-82.
Nordstrom, T., Nourizad, K., Ronaghi, M. and Nyren, P.: Method enabling pyrosequencing on double-stranded DNA. Anal Biochem 282 (2000) 186-93.
Nygren, P.A., Eliasson, M., Abrahmsen, L., Uhlen, M. and Palmcrantz, E.: Analysis and use of theserum albumin binding domains of streptococcal protein G. J Mol Recognit 1 (1988) 69-74.
Nyrén, P.: Method for sequencing DNA based on the detection of the relese of pyrophosphate andenzymatic nucleotide degradation, US 6 258 568BI, WO98/28440, 2001.Nyren, P. and Lundin, A.: Enzymatic method for continuous monitoring of inorganic pyrophosphatesynthesis. Anal Biochem 151 (1985) 504-9.
Olivera, B.M. and Lehman, I.R.: Linkage of polynucleotides through phosphodiester bonds by anenzyme from Escherichia coli. Proc Natl Acad Sci U S A 57 (1967) 1426-33.
Olsson, T., Sandstedt, K., Holmberg, O. and Thore, A.: Extraction and determination of adenosine 5'-triphosphate in bovine milk by the firefly luciferase assay. Biotechnol Appl Biochem 8 (1986) 361-9.
Pfeifer, T.A.: Expression of heterologous proteins in stable insect cell culture. Curr Opin Biotechnol 9(1998) 518-21.
Pichuantes, S., Tien, . and Franzusoff, A.: Isolation of the human PC6 gene encoding the putative hostprotease for HIV-1 gp160 processing in CD4+ T lymphocytes. Proc Natl Acad Sci U S A 93 (1996)7695-700.
Plesner, L.: Ecto-ATPases: identities and functions. Int Rev Cytol 158 (1995) 141-214.
Recombinant Enzymes in Pyrosequencing Technology
63
Porath, J., Carlsson, J., Olsson, I. and Belfrage, G.: Metal chelate affinity chromatography, a newapproach to protein fractionation. Nature 258 (1975) 598-9.
Punt, P.J., van Biezen, N., Conesa, A., Albers, A., Mangnus, J. and van den Hondel, C.: Filamentousfungi as cell factories for heterologous protein production. Trends Biotechnol 20 (2002) 200-6.
Queiroz, J.A., Tomaz, C.T. and Cabral, J.M.: Hydrophobic interaction chromatography of proteins. JBiotechnol 87 (2001) 143-59.
Raina, S. and Missiakas, D.: Making and breaking disulfide bonds. Annu Rev Microbiol 51 (1997) 179-202.
Ramanathan, S., Chary, K.V. and Rao, B.J.: Incoming nucleotide binds to Klenow ternary complexleading to stable physical sequestration of preceding dNTP on DNA. Nucleic Acids Res 29 (2001)2097-105.
Renosto, F., Patel, H.C., Martin, R.L., Thomassian, C., Zimmerman, G. and Segel, I.H.: ATPsulfurylase from higher plants: kinetic and structural characterization of the chloroplast and cytosolenzymes from spinach leaf. Arch Biochem Biophys 307 (1993) 272-85.
Robbins, P.W. and Lipmann, F.: Enzymatic synthesis of adenosine-5'-phosphosulfate. J Biol Chem 233(1958) 686-90.
Roberts, N.J., Brigham, J., Wu, B., Murphy, J.B., Volpin, H., Phillips, D.A. and Etzler, M.E.: A Nodfactor-binding lectin is a member of a distinct class of apyrases that may be unique to the legumes. MolGen Genet 262 (1999) 261-7.
Ronaghi, M.: Improved performance of pyrosequencing using single-stranded DNA-binding protein.Anal Biochem 286 (2000) 282-8.
Ronaghi, M., Uhlen, M. and Nyren, P.: A sequencing method based on real-time pyrophosphate.Science 281 (1998) 363, 365.
Rudolph, R. and Lilie, H.: In vitro folding of inclusion body proteins. Faseb J 10 (1996) 49-56.
Sala-Newby, G.B. and Campbell, A.K.: Stepwise removal of the C-terminal 12 amino acids of fireflyluciferase results in graded loss of activity. Biochim Biophys Acta 1206 (1994) 155-60.
Sala-Newby, G.B., Thomson, C.M. and Campbell, A.K.: Sequence and biochemical similaritiesbetween the luciferases of the glow-worm Lampyris noctiluca and the firefly Photinus pyralis. BiochemJ 313 ( Pt 3) (1996) 761-7.
Samuelsson, E., Jonasson, P., Viklund, F., Nilsson, B. and Uhlen, M.: Affinity-assisted in vivo foldingof a secreted human peptide hormone in Escherichia coli. Nat Biotechnol 14 (1996) 751-5.
Sanger, F., Air, G.M., Barrell, B.G., Brown, N.L., Coulson, A.R., Fiddes, C.A., Hutchison, C.A.,Slocombe, P.M. and Smith, M.: Nucliotide sequence of bacteriophage phi X174 DNA. Nature 265(1977a) 687-95.
Sanger, F., Nicklen, S. and Coulson, A.R.: DNA sequencing with chain-terminating inhibitors. ProcNatl Acad Sci U S A 74 (1977b) 5463-7.
Schillberg, S., Fischer, R. and Emans, N.: Molecular farming of recombinant antibodies in plants. CellMol Life Sci 60 (2003) 433-45.
Schmidt, T.G., Koepke, J., Frank, R. and Skerra, A.: Molecular interaction between the Strep-tagaffinity peptide and its cognate target, streptavidin. J Mol Biol 255 (1996) 753-66.
Nader Nourizad
64
Schmidt, T.G. and Skerra, A.: The random peptide library-assisted engineering of a C-terminal affinitypeptide, useful for the detection and purification of a functional Ig Fv fragment. Protein Eng 6 (1993)109-22.
Segel, I.H., Renosto, F. and Seubert, P.A.: Sulfate-activating enzymes. Methods Enzymol 143 (1987)334-49.
Shoji, I., Aizaki, H., Tani, H., Ishii, K., Chiba, T., Saito, I., Miyamura, T. and Matsuura, Y.: Efficientgene transfer into various mammalian cells, including non-hepatic cells, by baculovirus vectors. J GenVirol 78 ( Pt 10) (1997) 2657-64.
Simonsen, C.C. and McGrogan, M.: The molecular biology of production cell lines. Biologicals 22(1994) 85-94.
Smith, A.J.: The use of exonuclease III for preparing single stranded DNA for use as a template in thechain terminator sequencing method. Nucleic Acids Res 6 (1979) 831-48.
Smith, D.B. and Johnson, K.S.: Single-step purification of polypeptides expressed in Escherichia colias fusions with glutathione S-transferase. Gene 67 (1988) 31-40.
Smith, J.C., Derbyshire, R.B., Cook, E., Dunthorne, L., Viney, J., Brewer, S.J., Sassenfeld, H.M. andBell, L.D.: Chemical synthesis and cloning of a poly(arginine)-coding gene fragment designed to aidpolypeptide purification. Gene 32 (1984) 321-7.
Stahl, S. and Nygren, P.A.: The use of gene fusions to protein A and protein G in immunology andbiotechnology. Pathol Biol (Paris) 45 (1997) 66-76.
Stahl, S., Nygren, P.A. and Uhlen, M.: Strategies for gene fusions. Methods Mol Biol 62 (1997) 37-54.
Stratton, J., Chiruvolu, V. and Meagher, M.: High cell-density fermentation. Methods Mol Biol 103(1998) 107-20.
Studier, F.W.: Use of bacteriophage T7 lysozyme to improve an inducible T7 expression system. J MolBiol 219 (1991) 37-44.
Studier, F.W. and Moffatt, B.A.: Use of bacteriophage T7 RNA polymerase to direct selective high-level expression of cloned genes. J Mol Biol 189 (1986) 113-30.
Tabor, S. and Richardson, C.C.: Selective oxidation of the exonuclease domain of bacteriophage T7DNA polymerase. J Biol Chem 262 (1987) 15330-3.
Tabor, S. and Richardson, C.C.: Selective inactivation of the exonuclease activity of bacteriophage T7DNA polymerase by in vitro mutagenesis. J Biol Chem 264 (1989) 6447-58.
Thomas, C., Rajagopal, A., Windsor, B., Dudler, R., Lloyd, A. and Roux, S.J.: A role forectophosphatase in xenobiotic resistance. Plant Cell 12 (2000) 519-33.
Thomas, C., Sun, Y., Naus, K., Lloyd, A. and Roux, S.: Apyrase functions in plant phosphate nutritionand mobilizes phosphate from extracellular ATP. Plant Physiol 119 (1999) 543-52.
Thompson, J.F., Geoghegan, K.F., Lloyd, D.B., Lanzetti, A.J., Magyar, R.A., Anderson, S.M. andBranchini, B.R.: Mutation of a protease-sensitive region in firefly luciferase alters light emissionproperties. J Biol Chem 272 (1997) 18766-71.
Thore, A., Ansehn, S., Lundin, A. and Bergman, S.: Detection of bacteriuria by luciferase assay ofadenosine triphosphate. J Clin Microbiol 1 (1975) 1-8.
Recombinant Enzymes in Pyrosequencing Technology
65
Timothy, J., Sofat, A., Sharr, M. and Doshi, B.: Unusual presentation of a germ cell neoplasm. JNeurol Neurosurg Psychiatry 57 (1994) 1278-9.
Tognoli, L. and Marre, E.: Purification and characterization of a divalent cation-activated ATP-ADPasefrom pea stem microsomes. Biochim Biophys Acta 642 (1981) 1-14.
Traverso-Cori, A., Chaimovich, H. and Cori, O.: Kinetic Studies and Properties of Potato Apyrase.Arch Biochem Biophys 109 (1965) 173-84.
Traverso-Cori, A., Traverso, S. and Reyes, H.: Different molecular forms of potato apyrase. ArchBiochem Biophys 137 (1970) 133-42.
Tschopp, J.F., Brust, P.F., Cregg, J.M., Stillman, C.A. and Gingeras, T.R.: Expression of the lacZ genefrom two methanol-regulated promoters in Pichia pastoris. Nucleic Acids Res 15 (1987) 3859-76.
Twyman, R.M., Stoger, E., Schillberg, S., Christou, P. and Fischer, R.: Molecular farming in plants:host systems and expression technology. Trends Biotechnol 21 (2003) 570-8.
Urlaub, G. and Chasin, L.A.: Isolation of Chinese hamster cell mutants deficient in dihydrofolatereductase activity. Proc Natl Acad Sci U S A 77 (1980) 4216-20.
Valenzuela, J.G., Charlab, R., Galperin, M.Y. and Ribeiro, J.M.: Purification, cloning, and expressionof an apyrase from the bed bug Cimex lectularius. A new type of nucleotide-binding enzyme. J BiolChem 273 (1998) 30583-90.
Valenzuela, M.A., Lopez, J., Depix, M., Mancilla, M., Kettlun, A.M., Catalan, L., Chiong, M., Garrido,J. and Traverso-Cori, A.: Comparative subcellular distribution of apyrase from animal and plantsources. Characterization of microsomal apyrase. Comp Biochem Physiol B 93 (1989) 911-9.
van den Hombergh, J.P., Sollewijn Gelpke, M.D., van de Vondervoort, P.J., Buxton, F.P. and Visser,J.: Disruption of three acid proteases in Aspergillus niger--effects on protease spectrum, intracellularproteolysis, and degradation of target proteins. Eur J Biochem 247 (1997) 605-13.
Vara, F. and Serrano, R.: Purification and characterization of a membrane-bound ATPdiphosphohydrolase from Cicer arietinum (chick-pea)roots. Biochem J 197 (1981) 637-43.
Wang, T.F., Ou, Y. and Guidotti, G.: The transmembrane domains of ectoapyrase (CD39) affect itsenzymatic activity and quaternary structure. J Biol Chem 273 (1998) 24814-21.
Ward, M., Wilson, L.J., Kodama, K.H., Rey, M.W. and Berka, R.M.: Improved production ofchymosin in Aspergillus by expression as a glucoamylase-chymosin fusion. Biotechnology (N Y) 8(1990) 435-40.
Waterham, H.R., Digan, M.E., Koutz, P.J., Lair, S.V. and Cregg, J.M.: Isolation of the Pichia pastorisglyceraldehyde-3-phosphate dehydrogenase gene and regulation and use of its promoter. Gene 186(1997) 37-44.
Wetmur, J.G.: DNA probes: applications of the principles of nucleic acid hybridization. Crit RevBiochem Mol Biol 26 (1991) 227-59.
White, P.J., Squirrell, D.J., Arnaud, P., Lowe, C.R. and Murray, J.A.: Improved thermostability of theNorth American firefly luciferase: saturation mutagenesis at position 354. Biochem J 319 ( Pt 2) (1996)343-50.
Wibom, R., Lundin, A. and Hultman, E.: A sensitive method for measuring ATP-formation in ratmuscle mitochondria. Scand J Clin Lab Invest 50 (1990) 143-52.
Nader Nourizad
66
Wood, K.V., Lam, Y.A., Seliger, H.H. and McElroy, W.D.: Complementary DNA coding click beetleluciferases can elicit bioluminescence of different colors. Science 244 (1989) 700-2.
Wulfing, C. and Pluckthun, A.: Protein folding in the periplasm of Escherichia coli. Mol Microbiol 12(1994) 685-92.
Yansura, D.G. and Henner, D.J.: Use of Escherichia coli trp promoter for direct expression of proteins.Methods Enzymol 185 (1990) 54-60.
Zimmerman, S.B., Little, J.W., Oshinsky, C.K. and Gellert, M.: Enzymatic joining of DNA strands: anovel reaction of diphosphopyridine nucleotide. Proc Natl Acad Sci U S A 57 (1967) 1841-8.
Zimmermann, H., Braun, N., Kegel, B. and Heine, P.: New insights into molecular structure andfunction of ectonucleotidases in the nervous system. Neurochem Int 32 (1998) 421-5.