L�Asparaginases (E.C. 3.5.1.1) from E. coli (EcA)and Erwinia chrysanthemi (ErA) are included intoschemes of standard induction therapy of acute lym�phoblast leukemia during three last decades [1]. EcA isalso used for treatment of lymphogranulomatosis,multiple myeloma, NK/T cell lymphoma, and skinT cell lymphoma [2–6]. Clinical application of EcArevealed side�effects that limit its use in medicine;some of them (e.g. hepatotoxicity, impairments inblood coagulation, and neurotoxicity) are attributedto L�glutaminase activity of this enzyme [7–10].L�Glutamine deamination occurring in blood plasmaresults in blockade of intracellular synthesis ofL�asparagine in normal cells and causes excessive for�mation of L�glutamate inducing some toxic effects[11, 12]. This hypothesis was confirmed by results ofclinical studies of Acinetobacter L�asparaginase exhib�iting high L�glutaminase activity and marked neuro�toxicity. On the other hand, preclinical study ofW. succinogenes L�asparaginase lacking L�glutami�nase activity demonstrated that in contrast to EcA thisenzyme did not cause hepatotoxicity or immunosup�pressive effect in vivo [11, 13, 14]. W. succinogenesL�asparaginase, L�glutaminase activity was basically
* To whom correspondence should be addressed.
absent only in Helicobacter pylori L. asparaginase [15,16]. The other group of side effects is determined byimmunogenicity of protein preparations and it isdirectly associated with length of amino acidsequences and quaternary structure of the enzyme.This emphasizes importance of the search for newsources of shorter L�asparaginases with low L�glutam�inase activity and study of their biochemical and bio�logical properties.
Among enzymes perspective for subsequent studiesthere is Rhodospirillum rubrum L�asparaginase (RrA),which is characterized by a 2�fold shorter amino acidsequence (172 residues) and low homology comparedwith EcA and ErA. Full�scale preclinical studies ofRrA require creation of a recombinant producer strainas natural R. rubrum strains are characterized by slowgrowth on specific media and low expression of RrA[17, 18]. Thus, L�asparaginases with short amino acidsequence and low L�glutaminase activity attract cer�tain interest as enzymes with higher specificity and,possibly, low immunogenicity.
The aim of this study was to isolate recombinantR. rubrum L�asparaginase and to investigate physic�chemical and catalytic characteristics and also anantiproliferative effect of this enzyme.
Recombinant Intracellular Rhodospirillum rubrum L�Asparaginase with Low L�Glutaminase Activity and Antiproliferative Effect
M. V. Pokrovskayaa, V. S. Pokrovskiya, b, *, S. S. Aleksandrovaa, N. Yu. Anisimovab, R. M. Andrianovc, E. M. Treschalinab, G. V. Ponomareva, and N. N. Sokolova
aInstitute of Biomedical Chemistry of Russian Academy of Medical Sciences, ul. Pogodinskaya 10, Moscow, 119121 Russia e�mail: [email protected]
bBlokhin Cancer Research Center of Russian Academy of Medical Sciences, Kashirskoye shosse 24, Moscow, 115478 RussiacBach Institute of Biochemistry of Russian Academy of Sciences, Leninsky prospekt 33, bld. 2, Moscow, 119071 Russia
Received June 1, 2011
Abstract—The recombinant producer strain expressing Rhodospirillum rubrum L�asparaginase (RrA) hasbeen obtained and a purification procedure of RrA has been developed. The purified enzyme, RrA, has thefollowing biochemical and catalytic characteristics: Km for L�Asn of 0.22 mM, pH optimum at 9.2; temper�ature optimum at 54°C, pI = 5.1. RrA exhibited a significant cytotoxic effect towards the following cell lines:K562 (IC50 = 1.80 U/mL), DU145 (IC50 = 9.19 U/mL), and MDA�MB�231 (IC50 = 34.62 U/mL). Com�parative analysis employing E. coli L�asparaginase II type (EcA) and Erwinia carotovora L�asparaginase(EwA) has shown that the enzyme cytotoxicity towards these cell lines decreased in the following order:EcA > RrA > EwA. Daily administration of RrA (4000 U/kg) to L5178y bearing mice for 10 days (total doseof 40000 U/kg) showed T/C = 172. Data obtained suggest that RrA may be referred to intracellular L�aspar�aginases with low L�glutaminase activity and marked antiproliferative effect.
The following reagents have been used in this study:L�asparagine (Reanal, Hungary), glycine, KH2PO4,Na2HPO4, NaH2PO4, KCl (Serva, Germany),L�glutamine, Nessler’s reagent, TCA (trichloroaceticacid), bacto�tryptone, bacto�yeast extract (Fluka,Switzerland), NaOH, Na2B4O7 ⋅ 10 H2O (Merck,Germany), Tris (BioRad, USA), HCl, CH3COOH,CH3COONa (Reakhim, Russia).
RrA Cloning
The RrA gene was isolated from the Rhodospirillumrubrum strain (collection of the Microbiology Depart�ment, Lomonosov Moscow State University) usingthe pET23a vector (Novagen) and the following prim�ers: GCCCCTTCCCTTGCCACAGG, GGACAC�CCAAGCTTCCCTTTTCCG, CACAGGATCCT�CAAGGCAAATGGCCG. Manipulations with DNAwere performed using standard methods of molecularbiology [19]. The resultant E. coli clones B F dcmompT hsdS (rB� mB�) galλ (DE3) (Stratagene, USA)were analyzed for the presence of asparaginase activityby a complexonometric method on a solid mediumusing potassium hexacyanoferrate and copper sulfate[20].
The Bacterial Strain and Its Cultivation
The active producer was cultivated in Erlenmeyerflasks (the 1 L size) in 200 mL of LB medium withampicillin (100 μg/mL) using a a GFL 3033 shakingincubator (Germany) at 37°C. The cell culture densitywas determined using an Aquarius 7000 spectropho�tometer at 600 nm and expressed in optical units(OD600). The inducer (lactose, IPTG) was added tothe medium at OD600 of 0.9–1.9 up to the final con�centration of 0.2% and 0.001 M, respectively. After theinduction biomass was produced for 17–20 h.
Isolation and Purification of L�Asparaginase
At the end of the incubation cells were sedimentedby centrifugation (15 min, 2500g). The biomass wasresuspended in buffer A (10 mM NaH2PO4, 1 mM gly�cine, 1 mM EDTA, pH 7.5) and sonicated in aUZDN�2T disintegrator (Russia) for 10 min (1 minsonication with intervals for 1 min). The cell extractobtained by centrifugation of the sonicated suspension(60 min, 35000g) was applied onto a Q�Sepharose col�umn (2.0 × 30.0 cm) equilibrated with buffer A. Frac�tions containing RrA were diluted 10 times with bufferA pooled and applied onto a DEAE�Toyopearl 650mcolumn (1.5 × 20.0 cm). In both cases protein wereeluted using a linear gradient of NaCl concentration(0.0–1.0 M) at the elution rates of 78 and 30 mL/h,respectively. At the final stage of the enzyme solution
was desalinated and concentrated using an Amiconcell containing a Millipore filter (NMWL 18000). Allpurification procedures were performed at 4°C. Pro�tein concentration was determined by the Lowrymethod [21]. The isoelectric point was determined byisoelectrofocusing using a LKB column and the rangeof pH values from 4.0 to 10.0 [22].
Commercially available EcA (Medak) and alsorecombinant Erwinia carotovora L�asparaginase(EwA) [23] were used as control preparations.
Determination of Molecular Mass
Molecular mass of the purified protein was deter�mined by electrophoresis and mass�spectrometry.Electrophoresis was performed by the method ofLaemmli [22], using molecular weight protein mark�ers (Pharmacia, Amersham, #17�0446�01). Mass�spectrometry analysis was performed using a time�of�flight Bruker Ultraflex II mass�spectrometer (BrukerDaltonics, Germany) in the positive ion mode usingNd:YAG laser (355 nm) desorption and the acceler�ated voltage of 25 kV. Mass spectra were registered inthe reflectron mode for peptide mapping (proteinidentification) and in the linear mode for molecularmass determination of the target protein. Resultantmass spectra were treated using Bruker Flex Analysissoftware 2.4.
Determination of Enzymatic Activity of L�Asparaginase
L�Asparaginase activity was assayed by the directnesslerization method [24, 25]. One unit of L�aspara�ginase activity (1 IU) was defined as the amount ofenzyme that releases 1 μmol of ammonia per 1 min at37°C. Glutaminase activity was evaluated by the samemethod using L�glutamine as substrate. L�Asparagi�nase productivity of cultures was expressed asIU/OD600.
The pH dependence of the enzyme activity wasstudied at 37°C using standard buffer solutions:sodium acetate (the pH range from 3.0 to 6.0), sodiumphosphate (pH 6.0–8.0), Tris�HCl (7.0–9.0), borate(pH 9.0–11.0) [26]. The dependence of RrA activityon ionic strength was investigated by changing KClconcentration from 100 to 3000 mM. The effect oftemperature was studied at pH 7.0 in the temperaturerange 30–80°C.
Km values were determined by the rate of ammoniaformation during enzymatic hydrolysis of L�aspar�agine and L�glutamine. Asparaginase activity wasassayed at 37°C and pH 8.0 using a thermostated cell.An aliquot (1 mL) of asparagine solutions (0.01—0.04 M)were mixed with 0.2 mL of 12.5 mM borate buffer; thereaction was initiated by adding 0.1 mL of RrA solu�tion (0.5–10 mg/mL). Ammonia assay was performedusing Nessler’s reagent. The reaction was stopped byadding 0.6 mL of 10% TCA. Absorbance was deter�mined at 480 nm. Graphic treatment of results and
RECOMBINANT INTRACELLULAR R. Rubrum L�ASPARAGINASE 125
calculation of Km and Vmax values were performedusing the Lineweaver�Burk double�reciprocal plotsand the Microsoft Excel software.
The Study of Thermal and Chemical Denaturation
RrA stability was investigated in phosphate bufferby incubating the enzyme solution at various temper�atures (up to 80°C) for 3 min or at 37°C for 1 h in thepresence of 0–8.0 M urea concentrations and thenenzymatic activity was assayed by the standard assayprocedure. Enzyme activity determined at 37°C in theabsence of urea was defined as 100%.
Cytotoxicity Studies
RrA activity was compared with that of EcA andEwA using human chronic myelogeneous leukemiacell line K562 (the collection of tumor strains ofBlokhin Cancer Research Center), human prostatecancer cell line DU145 (ATCC, USA), and two celllines of human breast cancer MDA�MB�231andMCF�7 (ATCC). Cells were cultivated at 37°C in 5%CO2 in RPMI 1640 medium (Paneko, Russia) con�taining 10% fetal calf serum (HyClone LaboratoriesLogan, Great Britain) inactivated at 56°C for 30 min,2 mM L�glutamine, 100 μg/mL penicillin and100 μg/mL streptomycin (Paneko). Cells reached thelogarithmic growth phase were seeded in flat�bottom96 well plates (Costar) (5–6 × 104 cells per well) andincubated for 24 h before addition of the enzymesunder the above mentioned conditions. Light micros�copy of cells was performed using the AxioVision 4system (Zeiss Germany). Cell viability was deter�mined by the Trypan blue exclusion test (Paneko).Cells were counted in a Goryaev chamber. L�Aspara�ginase preparations in Hanks solution (in the range ofdecreasing concentrations 50–0.000062 IU/mL) wereadded to the wells containing cell cultures and incuba�tion continued for 72 h. The same volume of Hankssolution was added to control wells. After the incuba�tion the number of viable cells was determined usingthe MTT test based on ability of dehydrogenases of liv�ing cells to reduce 3�(4,5�dimethyl�2�thiazolyl)�2,5�diphenyl�2H�tetrazolium bromide (MTT) to violetformazan crystals soluble in dimethyl sulfoxide [27].Optical absorbance of colored solutions was measured
at λ = 540 nm using a Multiscan MS plate reader(Labsystems, Finland). Cytotoxicity of testedenzymes was evaluated by the formula (1–Ne/Nc) ×100%, where Ne and Nc are absorbance of experi�mental and control samples, respectively. Using themethod of nonlinear regression the IC50 value(enzyme concentration required for 50% reduction inthe number of living cells) and minimal effective con�centration (Cmin) inducing statistically inhibition ofcell proliferation compared with control were calcu�lated for each enzyme preparation.
The Study of Antitumor Activity
The antitumor activity was investigated in femaleDBA2 mice (18–24 g) with intraperitoneally (i/p)transplanted Fischer L5178y leukemic cells (fifth pas�sage) from the collection of tumor strains of BlokhinCancer Research Center [28, 29]. Before treatmentanimals were randomly subdivided into experimentaland control groups each of which contained 7 animals.During next 10 days after tumor cell transplantationmice of the experimental group were treated with RrAsolution (100 IU/mL) at the daily dose of 4000 IU/kg,i.p. in 0.9% NaCl. Control mice received i/p injec�tions of 0.3 mL of the vehicle.
Effectiveness of treatment was evaluated byincreased lifespan of treated animals compared con�trol group (T/C); this was calculated as the ratio of themean lifespan (MLS) in both groups and expressed inpercent. In control group T/C = 100%. Mice survivedfor more than 60 days without visible signs of tumor onautopsy (ascite, nodular growth, enlargement ofmesenteric lymph nodes) were considered to be cured[29]. During MLS calculation cured mice were nottaken into consideration. Tolerability of treatment wasevaluated by changes in molecular mass of mice, loco�motor activity and by changes of internal organs dur�ing autopsy.
Statistical Treatment
Statistical treatment of results obtained in experi�ments with cell cultures was performed by calculatingmedians and 25 and 75 quartiles in groups (Med, 25–75%). Statistical treatment of results on mice survivalwas performed using the log�rank test and generation
Table 1. Results of RrA purification
Purification stage Total protein, mg Total activity, IU Specific activity, IU/mg Yield, %
Cell suspension 60000 100
Cell free extract 10040 52200 5.2 87
Chromatography on Q�Sepharose 2610 45000 17.2 75
Chromatography on DEAE�Toyopearl 650m 1123 43800 39 73
of Kaplan�Meier survival curves. Differences wereconsidered as statistically significant at p ≤ 0.05.
RESULTS
Characteristics of Recombinant Producer Strain of RrA
The RrA gene cloned in the pET23a vector by HindIIIand BamHI restriction sites was expressed in theE. coli BL21 (DE3) strain. Stability of the resultantproducer was confirmed by restriction analysis andhigh RrA expression in the cell culture(20⎯30 IU/mL), which was not decreased during12 reseedings. Sequencing of plasmids isolated from4 clones followed by subsequent computer�aided anal�ysis (SIB BLAST network service) revealed identity ofthe insert with known sequence of the geneRru_A3730 from R. rubrum (ATCC 11170/NCIB8255) that consists of 519 nucleotides; only two nucle�otide substitutions have been found (Fig. 1). One sub�stitution (C261T) did not change amino acidsequence, while the mutation A445G resulted in thesubstitution K149E. According to mass spectrometrydata, molecular mass of RrA monomer was 19.1 kDa,this is similar to the molecular mass value determined
by electrophoresis (20 kDa). The resultant enzymeconsisted of 172 amino acid residues.
RrA Expression
During 10 h of cell culture growth after inductionthe enzyme activity was observed only after sonicationof cells; this is obviously explained by intracellularlocalization of RrA in the recombinant producer strain.The activity of culture reached 25.3–27.3 IU/mL within8.5–11.5 h after lactose addition and 21.8–24.2 IU/mLwithin 10–13 h after IPTG induction. Cultivation for11.5 h was accompanied by lysis of cells as indirectlyevidenced by a decrease of the optical density frommaximal values of 5.4–6.8 (for lactose) and 5.7–6.0(for IPTG) to 4.2–5.1 and 4.0–4.6 by the end of culti�vation, respectively. Lysis of cells was accompanied byrelease of the enzyme into the periplasmic space andcultivation medium. For both inducers the enzymeactivity in the cell culture without sonication was13 IU/mL and productivity = 3.0. Biomass produc�tion after IPTG induction occurred slower. After addi�tion of lactose or IPTG the strain productivity was 5.4(8.5 h after induction) and 4.9 (13 h after induction),respectively.
Fig. 1. Gene and amino acid sequence of RrA. Substitutions in the nucleotide sequence compared with the gene of native RrAare marked.
RECOMBINANT INTRACELLULAR R. Rubrum L�ASPARAGINASE 127
RrA Purification
The method of enzyme isolation from the producerstrain cells and its subsequent purification described inthe Material and Method section included ultrasonictreatment of cell suspension, cell debris removal bycentrifugation and two steps of ion exchange chroma�tography on Q�Sepharose and DEAE�Toyopearl650m. Table 1 summarizes results of enzyme purifica�tion. One can see that the major proportion of ballastproteins was removed during the first step of chro�matographic separation; although this was accompa�nied by loss of about 10% of the target enzyme its spe�cific activity demonstrated a 3�fold increase. Duringsubsequent purification steps loss of the enzyme activ�ity was not observed and its specific activity demon�strated further 2.5�fold increase.
Electrophoresis of purified RrA in 12% SDS�PAAG revealed a single band in the region 19–21 kDa(Fig. 2). The electrophoretic data were processed bythe Gel�Pro analyzer 3.1.00.00 software (MediaCybernetics, USA) and according to calculations thedegree of purification of the resultant enzyme prepara�tion was 92%.
Isoelectric Point
The isoelectric point is at pH 5.1 ± 0.3; this corre�sponds to theoretically calculated values and is some�
what lower than pI of asparaginase purified from thenatural strain; the latter is well explained by substitu�tion of positively charged Lys for negatively chargedGlu.
The Dependence of the Enzyme Activity on pH, Temperature and Ionic Strength
The pH optimum of the enzyme was 9.2. At physi�ological pH values of about 7.4 RrA activity represents30–40% of maximal and it is basically negligible atpH 5.0 (Fig. 3). In contrast to EcA and ErA the RrAactivity depends on composition of buffer. For exam�ple, in 0.1 M sodium phosphate buffer RrA activitywas 2 times lower than in 0.1 M sodium acetate(pH 6.0) and 0.05 M Tris�HCl (pH 7.0–8.0) buffers;in 0.0125 M borate buffer it was 30% lower than in0.05 M Tris�HCl (pH 9.0).
1 2 3 4 5 6 7 8 9
Fig. 2. Electrophoresis of purified rRa preparation in 12%SDS�PAAG. Tracks 1–3—RrA after ultrasonic treatment (30 IU/mL,24.5 µg of protein per 1 µL), 1, 3, 5 µL, respectively; 4—molecular weight protein markers (Amersham #17�0446�01). 5–7—RrA after purification (608 IU/mL, 10.96 µg ofprotein per 1 µL), 2, 5, 10 µL, respectively. 8, 9—EcA, 0.5,1 µL.
120
100
80
60
40
20
08765432 11109 12
pH
Activity, %
Fig. 3. The dependence of RrA activity on pH.
120
100
80
60
40
20
3.02.52.01.51.00.50 3.5Concentration KCl, M
Activity, %
Fig. 4. The dependence of RrA activity on ionic strength.
RrA is characterized by a temperature optimum at54–55°C. At 36–37°C the enzyme activity representsnot less than 72% of maximal. The temperaturedependence of the enzyme activity is similar to that ofenzyme preparations used in clinical practice [30].
RrA activity was maximal at the ionic strength in therange of KCl concentrations from 750 to 1250 mM. Thedecrease of ionic strength to 0.001 mM resulted in thedecrease of the enzyme activity by 30%, while itsincrease to 3000 mM caused a 2�fold decrease in RrAactivity (Fig. 4).
Stability
L�Asparaginase activity remained at the level ofmore than 95% of initial activity during enzymeincubation for 3 days in the range of temperatures
from 4 to 37°C. During enzyme storage at the tem�peratures –70 –20°C (in the buffer containing 10 mMK2HPO4, 10 mM KH2PO4, 1 M glycine, 1 mM EDTA,0.28 M KCl, and 0.5% glucose) RrA activity remainedunchanged for 4 months. The study of RrA thermosta�bility has shown that a sharp decrease in the enzymeactivity begins after incubation for 3 min at tempera�tures exceeding 57°C. After incubation at 60°C for3 min only 27% of the initial enzymatic activity pre�served (Fig. 5). Incubation at 80°C for 10 min causeda decrease in enzyme activity up to 1% of the initiallevel. Thus, insignificant increase (by 2–3°C) of incu�bation temperature of the temperature optimum ofthis enzyme resulted in its inactivation.
Incubation of RrA for 1 h with 0–3 M urea revealedinsignificant decrease in enzyme activity (at least 70%of initial activity remained), while subsequent increase
120
100
80
60
40
20
0443424 6454 t, °C
Activity, %
Fig. 5. Thermostability of RrA.
120
100
80
60
40
20
210 73Urea, M
Activity, %
4 5 6 8
Fig. 6. Stability of RrA in urea.
Table 2. Physico�chemical and kinetic parameters of RrA and EcA
Parameter RrA EcA
Molecular mass of monomer, kDa 18.07 36.85
Number of amino acid residues 172 348
pH optimum 9.2 7.0–7.5
pI 5.1 ± 0.3 5.0 ± 0.2
Km for L�asparagine, mM 0.22 ± 0.01 0.017 ± 0.001
L�Glutaminase activity, % of L�asparaginase activity <0.1 ~5
Table 3. IC50 values characterizing the cytotoxic effect of RrA, EcA, and EwA on various cell lines
RECOMBINANT INTRACELLULAR R. Rubrum L�ASPARAGINASE 129
in urea concentration caused total inactivation of thisenzyme (Fig. 6).
Catalytic Properties
The Km value of RrA for L�asparagine was 0.22 mM,Vmax was 5.32 mM/min, kcat = 2.53 s–1. In accordancewith literature data [31], the Km value of EcA forL�asparagine assayed in the same way was 0.017 mM.Under our experimental conditions Km value forL�glutamine was not detected. It should be noted thatL�glutaminase activity assayed by the direct nessler�ization method (see Materials and Methods Section)represented not more than 0.1% of L�asparaginaseactivity and this value insignificantly differed fromblank values. Table 2 summarizes the main physico�chemical and catalytic properties of RrA .
Cytotoxicity
Statistically significant (p < 0.05) cytotoxic effect ofRrA was found in experiments with the following celllines: K562 (IC50 = 1.80 IU/mL, Cmin = 0.016 IU/mL),DU145 (IC50 = 9.19 IU/mL, Cmin = 0.08 IU/mL),MDA�MB�231 (IC50 = 34.62 IU/mL, Cmin = 0.4 IU/mL),and MCF�7 (IC50 = 43.3 IU/mL, Cmin = 10 IU/mL)(Fig. 7). The enzyme cytotoxicity towards these celllines evaluated by the IC50 value decreased in the fol�lowing order: EcA > RrA > EwA (Table 3).
Antitumor Activity
Daily administration of RrA (4000 U/kg) for 10 dayssignificantly increased lifespan of L5178y bearingmice: MLS of 29.2 ± 7.3 versus 17.0 ± 0.9 days in con�trol; T/C = 172% (p < 0.05) (Fig. 8) with 14% of miceconsidered to be cured (i.e. without visible signs oftumor on autopsy). Animals demonstrated reasonabletolerability to the therapy without cases of animaldeath induced by toxic action of the enzyme prepara�tion.
DISCUSSION
In this study we have prepared a recombinant pro�ducer strain of intracellular RrA, developed the proce�dure for purification of the target protein and charac�terized the main physico�chemical properties of thisprotein and its antiproliferative effect. All its featuresallow to perform critical evaluation of a novel recom�binant L�asparaginase and perspectives for subsequentinvestigation in oncology.
Fig. 7. Cytotoxicity of RrA and some other L�asparagi�nases in human tumor cell cultures. (�) RrA, (�) EcA, ( ) EwA (a—chronic myelogeneousleukemia cell line K562, b—breast cancer cell line MDA�MB�231, c—prostate cancer cell line DU145, d—breastcancer cell line MCF�7).
All bacterial L�asparaginases are now subdividedinto two main types. The main criteria for their dis�crimination include extra� or intracellular localiza�tion, affinity to particular substrates and quaternarystructure [32]. It is generally accepted that type IL�asparaginases are constitutively expressed enzymeslocalized in cytoplasm and characterized by high Kmvalues (10–3 M) for L�asparagine. They include intra�cellular L�asparaginases from E. coli, Bacillus subtilis,Methanococcus jannaschii, Pyrococcus horikoshii, etc.[33, 34]. Their Km values for L�asparagine are about3.5 mM and it is believed that these enzymes do notexhibit antitumor activity [35, 36]. Type II bacterialL�asparaginases belong to periplasmic enzymes andare characterized by low Km for asparagine (10–5 M)and wide substrate specificity [37]. The type IIL�asparaginases include EcA and ErA used in clinicaloncology and also almost all known L�asparaginaseswith detectable antiproliferative activity.
RrA cannot be referred either to type I or type IIdue to intracellular localization and reasonably lowKm values (0.22 ± 0.01 mM) and significant antiprolif�erative activity demonstrated in vitro and in vivo.Moreover, there are intracellular enzymes classified astype II L�asparaginases, for example L�asparaginasefrom Saccharomyces cerevisiae [33]. Using strict crite�ria proposed by D.T. Bonthron and M. Jaskolski andbased on features of primary structure RrA belongs totype I L�asparaginases because instead of the sequence122SADGP126, which is highly conserved in type IIL�asparaginases (EcAII) RrA contains the sequenceof three residues 122SDA124 typical for type I L�aspara�ginases [33]. Another feature of recombinant RrA,which is similar other intracellular type I L�asparagi�nases, consists in almost negligible L�glutaminaseactivity. In contrast to existing notions on the absenceof any antiproliferative effect in intracellular L�aspar�
aginases results of this study suggest that some intrac�ellular L�asparaginases demonstrate the antiprolifera�tive effect regardless to their taxonomic characteristics.Lack of the antiproliferative effect in L�asparaginasesfrom Pseudomonas geniculata and L�glutaminase/L�as�paraginase from Pseudomonas acidovorans may beattributed to non�optimal conditions of their use(dose, duration of therapeutic course) or used of atumor model with low sensitivity (Gardner’s lym�phoma 6C3HED) [37–39]. Thus, the recombinantL�asparaginase RrA isolated and investigated in thisstudy may be considered as the first intracellularL�asparaginase with recognized antiproliferativeactivity in vivo. Positive characteristics of RrA deter�mining future perspectives of this novel enzyme foroncology include short amino acid sequence andextremely low L�glutaminase activity suggestinghighly selective and specific action.
REFERENCES
1. van den Berg, H., Leuk. Lymphoma, 2011, vol. 52,pp. 168–178.
2. Jaccard, A., Petit, B., Girault, S., Suarez, F., Gressin, R.,Zini, J.M., Coiteux, V., Larroche, C., Devidas, A.,Thiéblemont, C., Gaulard, P., Marin, B., Gachard, N.,Bordessoule, D., and Hermine, O., Ann. Oncol., 2009,vol. 20, pp. 110–116.
3. Yong, W., Zheng, W., Zhang, Y., Zhu, J., Wei, Y., Zhu, D.,and Li, J., Int. J. Hematol., 2003, vol. 78, pp. 163–167.
4. Obama, K., Tara, M., and Niina, K., Int. J. Hematol.,1999, vol. 69, pp. 260–262.
5. Agrawal, N.R., Bukowski, R.M., Rybicki, L.A.,Kurtzberg, J., Cohen, L.J., and Hussein, M.A., Cancer,2003, vol. 98, pp. 94–99.
6. Kobrinsky, N.L., Sposto, R., Shah, N.R.,Anderson, J.R., DeLaat, C., Morse, M., Warkentin, P.,Gilchrist, G.S., Cohen, M.D., Shina, D., and Mead�ows, A.T., J. Clin. Oncol., 2001, vol. 19, pp. 2390–2396.
11. Capizzy, R.L. and Cheng, Y.C., in Enzymes as Drugs,Holcenberg, J.S., Roberts, J., Eds., New York: JohnWiley and Sons, 1981, pp. 1–24.
12. Storti, E. and Quaglino, D., in: Experimental and Clin�ical Effects of L�Asparaginase, Grundmann, E., andOettgen, H.F., Eds., Berlin�Heidelberg�New York:Springer�Verlag, 1970, pp. 344–349.
100
80
60
40
20
0
605040302010
1
2
Lifespan, days
Survival of animals, %
Fig. 8. The antiproliferative effect YpA in vivo in micebearing Fischer L5178y leukemic cells. 1—control group,2—RrA.
24. Wade, H.E. and Philips, B.P., Anal. Biochem., 1971,vol. 72, p. 248.
25. Wriston, J.C. and Yellin, T.O., Adv. Enzymol., 1985,vol. 39, pp. 185–248.
26. Dawson, R., Elliott, D., Elliott, W., and Jones, K.M.,Spravochnik biokhimika (Data for BiochemicalResearch), Moscow: Mir, 1991.
27. Mossman, T., J. Immunol. Methods, 1983, vol. 65,pp. 55–63.
28. Treshchalina, E.M., Protivoopukholevaya activnost’veshchestv prirodnogo proiskhozhdeniya (The AntitumorActivity of Natural Substances), Moscow: Prak�ticheskaya Meditsina, 2005.
29. Chabner, B.A. and Longo, D.L., Cancer Chemotherapyand Biotherapy: Principles and Practice, Philadelphia:Lippincott�Raven, 2001.
30. Peng, G., Fritzsch, G., Zickermann, V. Schägger, H.,Mentele, R., Lottspeich, F., Bostina, M., Raderma�cher, M., Huber, R., Stetter, K.O., and Michel, H.,Biochemistry, 2003, vol. 42, pp. 3032–3039.
31. Derst, C., Henseling, J., and Röhm, K.H., Protein Sci�ence, 2000, vol. 9, pp. 2009–2017.
32. Michalska, K. and Jaskolski, M., Acta Biochim. Pol.,2006, vol. 53, pp. 627–640.
33. Bonthron, D.T. and Jaskolski, M., Acta Biochim. Pol.,1997, vol. 44, pp. 491–504.
34. Yao, M., Yasutake, Y., Morita, H., and Tanaka, I., ActaCrystallogr., 2005, vol. 61, pp. 294–301.
