Copyright � 2006 by the Genetics Society of AmericaDOI: 10.1534/genetics.106.060053

Regulation of DNA Replication Machinery by Mrc1 in Fission Yeast

Naoki Nitani,* Ken-ichi Nakamura,*,† Chie Nakagawa,* Hisao Masukata*,†

and Takuro Nakagawa*,1

*Department of Biological Science, Graduate School of Science and †Graduate School of Frontier Biosciences, Osaka University,Osaka 560-0043, Japan

Manuscript received April 30, 2006Accepted for publication July 6, 2006

ABSTRACT

Faithful replication of chromosomes is crucial to genome integrity. In yeast, the ORC binds replicationorigins throughout the cell cycle. However, Cdc45 binds these before S-phase, and, during replication, itmoves along the DNA with MCM helicase. When replication progression is inhibited, checkpoint regulationis believed to stabilize the replication fork; the detailed mechanism, however, remains unclear. To examinethe relationship between replication initiation and elongation defects and the response to replicationelongation block, we used fission yeast mutants of Orc1 and Cdc45—orp1-4 and sna41-928, respectively—attheir respective semipermissive temperatures with regard to BrdU incorporation. Both orp1 and sna41 cellsexhibited HU hypersensitivity in the absence of Chk1, a DNA damage checkpoint kinase, and were defectivein full activation of Cds1, a replication checkpoint kinase, indicating that normal replication is required forCds1 activation. Mrc1 is required to activate Cds1 and prevent the replication machinery from uncouplingfrom DNA synthesis. We observed that, while either the orp1 or the sna41 mutation partially suppressed HUsensitivity of cds1 cells, sna41 specifically suppressed that of mrc1 cells. Interestingly, sna41 alleviated thedefect in recovery from HU arrest without increasing Cds1 activity. In addition to sna41, specific mutationsof MCM suppressed the HU sensitivity of mrc1 cells. Thus, during elongation, Mrc1 may negatively regulateCdc45 and MCM helicase to render stalled forks capable of resuming replication.

DURING DNA replication, various kinds of inter-mediate DNA structures are formed, including

single-stranded, nicked, and Y-shaped DNA. These rep-lication intermediates appear to be unstable, especiallywhen the progression of replication is hampered bydNTP starvation, nonhistone DNA-binding proteins, orDNA lesions (Ivessa et al. 2003; Branzei and Foiani

2005). The collapsed DNA structures resulting fromstalled replication forks are a great threat to genomeintegrity. Therefore, stalled replication forks must beprocessed faithfully to prevent chromosomal aberra-tions that can cause cell death or cancer in multicel-lular organisms.

DNA replication is initiated at specific chromosomalloci known as replication origins. Origin recognitioncomplexes (ORCs) bind the origin and serve as landingpads for other replication factors (for reviews, see Tye

1999; Lei and Tye 2001; Bell and Dutta 2002). Prior toentry into the S-phase, the minichromosome mainte-nance (MCM) complex is loaded onto the origin via thefunction of Cdc18/Cdc6 and Cdt1. Several lines ofevidence indicate that the MCM complex is likely to be areplicative DNA helicase that functions with the aid of

other factors and protein modifications (Aparicio et al.1997; Ishimi 1997; Kelman et al. 1999; You et al. 1999;Chong et al. 2000; Labib et al. 2000). Cdc45 appears tobe an essential accessory factor for the MCM helicasesince Cdc45 is associated with the MCM helicase onlyduring the S-phase and since DNA unwinding by theMCM helicase is stimulated by the presence of Cdc45(Zou and Stillman 1998; Tercero et al. 2000; Walter

and Newport 2000; Masuda et al. 2003). In addition,Cdc45 as well as MCM moves along the DNA, and thedestruction of these factors prevents further replicationfollowing replication initiation (Aparicio et al. 1997;Labib et al. 2000; Terceroet al. 2000). Therefore, in con-trast to the ORC, Cdc45 participates in both the initia-tion and the elongation phases of replication.

The progression of DNA replication is monitored bythe checkpoint mechanism to ensure that stalled rep-lication forks are stabilized and mitosis occurs only afterall the chromosomes have completely replicated (forreviews, see Hartwell and Weinert 1989; Carr 2002;Nyberg et al. 2002; Zhou and Bartek 2004). Most fac-tors involved in the checkpoint have been conservedfrom yeast to humans. In the fission yeast Schizosaccha-romyces pombe, Rad3 is the central player in the checkpointmechanism and is required for the phosphorylationand activation of the downstream kinases, Cds1 andChk1 (Murakami and Okayama 1995; Walworth and

1Corresponding author: Department of Biological Science, GraduateSchool of Science, Osaka University, 1-1 Machikaneyama, Toyonaka,Osaka 560-0043, Japan. E-mail: takuro4@bio.sci.osaka-u.ac.jp

Genetics 174: 155–165 (September 2006)

Bernards 1996; Lindsay et al. 1998). The phosphory-lation of Cds1 and Chk1 results in increased kinaseactivity (Lindsay et al. 1998; Lopez-Girona et al. 2001;Capasso et al. 2002). The activated kinases inhibit cellcycle-dependent kinase (CDK) by phosphorylating CDKregulators (e.g., Wee1, Mik1, and Cdc25), thus causingcell cycle arrest (Rhind et al. 1997; Furnari et al. 1999;Raleigh and O’Connell 2000). In addition, Cds1 andChk1 may contribute to DNA metabolism by regulatingthe expression, localization, and activity of a set of pro-teins that is involved in the repair of DNA damage and/or in the processing of stalled replication forks (Huang

et al. 1998; Boddy et al. 2000, 2003; Caspari et al. 2002;Sogo et al. 2002; Kai et al. 2005). Although Cds1 andChk1 share many activation factors, including the Rad3–Rad26 complex (homolog of the ATR–ATRIP complexin humans), they are activated in different situations(Lindsay et al. 1998; Martinho et al. 1998; Harris et al.2003). Cds1 is activated when replication is blockedduring the S-phase, while Chk1 is activated when DNAdamage occurs either within or outside the S-phase. Theactivation of Cds1 specifically depends on Mrc1, whilethat of Chk1 depends on Crb2/Rhp9 (Saka et al. 1997;Alcasabas et al. 2001; Tanaka and Russell 2001). Inaddition to its function in Cds1 activation, Mrc1 hasbeen shown to prevent the extensive uncoupling of theCdc45-containing replication machinery from DNAsynthesis when replication is hindered by dNTP de-pletion (Katou et al. 2003). Mrc1 associates with thereplication fork and preferentially binds branched DNAstructures in vitro (Katou et al. 2003; Zhao and Russell

2004; Calzada et al. 2005; Nedelcheva et al. 2005).However, its mechanism of action in preventing the un-coupling of the replication machinery from DNA syn-thesis remains unclear.

In this study, we used the fission yeast mutants of Orc1(a subunit of the ORC) and Cdc45—orp1-4 and sna41-928, respectively—and demonstrated that these mu-tants are hypersensitive to hydroxyurea (HU) in theabsence of Chk1 and partially defective in Cds1 activa-tion at their respective semipermissive temperatureswith regard to the ability to incorporate a nucleosideanalog, 5-bromodeoxyuridine (BrdU). These results areconsistent with the concept that normal replication isrequired for full activation of the replication check-point. Interestingly, either the orp1 or the sna41 muta-tion suppresses the HU sensitivity of a cds1D mutant;however, only the sna41 mutation suppresses the HUsensitivity of an mrc1D mutant. The sna41 mutation sup-presses the defect in the recovery from HU arrest butdoes not increase Cds1 activity in mrc1D cells. In ad-dition to the sna41 mutation of Cdc45, mutations of theMCM protein suppress the HU sensitivity of an mrc1D

mutant in an allele-dependent manner. These resultssuggest that Mrc1 negatively regulates Cdc45 and MCMhelicase to render the stalled replication forks capableof resuming replication.

MATERIALS AND METHODS

Fission yeast strains and media: The yeast strains used inthis study are listed in Table 1. Yeast media were prepared andstandard genetic procedures were carried out as describedelsewhere (Alfa et al. 1993). HU (Sigma, St. Louis) was dis-solved in water to 1 m, sterilized by filtration, stored at �20�,and used at the indicated final concentrations. mrc1TkanMX6and cds1TkanMX6 strains were generated by transformingyeast cells with the PCR product obtained using the pFA6a-kanMX6 plasmid (Bahler et al. 1998) as a template. Theprimer pair used for mrc1TkanMX6 comprised 59-CTAAGGAGGACTAAGAGATGTATCGCGGCAAAGCAACTACCATTACTCGTTCAATAAGAGCTTTGTGGTGCTTAAATCTCGGATCCCCGGGTTAATTAA and 59-GTTATGTAAATTATCAATACCTCATTCAAAAAAAACAAGTTTGACAAGTCCAGCTCGTCAAATCCCCTTTCTTAGCCACGAATTCGAGCTCGTTTAAAC(the sequence complementary to the mrc11 flanking region isunderlined), and that used for cds1TkanMX6 comprised 59-TTGATCACTCATTTGCACGTTTATTTGTGTTTACTGATATACATGGTTAAAGAATTCATCCAGTTTTTCTGTTTTTAAGAATTCGAGCTCGTTTAAAC and 59-CTATTTACAATATTATAAATTTGACGGTCTAAGTATAAAAATTAATTAATTATCATTTAGAATACTAAATATTAATAATCGGATCCCCGGGTTAATTAA(the sequence complementary to the cds11 flanking region isunderlined). Yeast transformants were selected on yeast ex-tract (YE) plates containing 100 mg/ml of G418 disulfate(Nacalai Tesque), and correct integration was confirmed byPCR using the primer pairs that complemented the flankingregions of the integrated DNA (the primer sequences used areavailable upon request). To obtain the adh1 promoter, a 0.8-kbpfragment was amplified from yeast genomic DNA using thefollowing primer pair: 59-GCTCTAGATCGATGACATTCGAATGGCATGCCC and 59-GGGGTACCATATGTATGTGGTTAGAAAAAAGAAAAGAC (the sequence complementary to theadh1 promoter region is underlined). An ade61:(adh1)p-hENTconstruct was created to locate a 0.8-kbp XbaI-KpnI fragment inthe adh1 promoter that is followed by a 1.4-kbp KpnI-XbaI frag-ment containing the human equilibrative nucleoside trans-porter (hENT) gene from pKS007 (Katou et al. 2003), which is70 bp downstream of the ade61 gene. A ura41:(adh1)p-TK con-struct was created to locate a 0.8-kbp ClaI-NdeI fragment in theadh1 promoter that is followed by a 1.3-kbp BamHI fragmentcontaining the thymidine kinase (TK) gene from pYK001(Katou et al. 2003), which is 440 bp downstream of the ura41

gene.Incorporation of 5-bromodeoxyuridine: G2 cells from log-

phase cultures in YE medium were collected by elutriationwith a Beckman J6-MC centrifuge and resuspended in freshmedium at a concentration of 5 3 106 cells/ml. Next, BrdUand HU were added to a final concentration of 100 mm and10 mm, respectively. After a 3-hr incubation,�4 3 108 cells werecollected and washed with washing buffer (5 mm EDTA, 50 mm

NaF), and DNA was prepared as described (Bahler et al.1998). The DNA was fragmented to �0.5 kbp by sonicationwith Sonifier 250 (Branson, Plainview, NY) three times at atune level of 2 for 10 sec. Following ethanol precipitation, theDNA was suspended in 1.7 ml of TEN buffer [10 mm Tris-HCl(pH 7.4), 1 mm EDTA, 150 mm NaCl] supplemented withcesium chloride (CsCl) at a final concentration of 1 g/ml, andthe DNA solution was centrifuged at 80,000 rpm for 14 hr in aHitachi CS120 with a RP120VT rotor (Hitachi). The DNAsamples that were recovered from 14 fractions at the top of thecentrifuge tube were dialyzed against 10:1 TE [10 mm Tris-HCl(pH 7.4), 1 mm EDTA] using the GIBCO BRL microdialysisapparatus (Bethesda Research Laboratories, Gaithersburg,MD). Following heat denaturation (95� for 5 min), an equalvolume of 203 SSC [0.3 m Na-citrate (pH 7.0), 3 m NaCl] was

156 N. Nitani et al.

added to the DNA samples, and they were transferred to aNytran nylon membrane (Schleicher & Schuell, Keene, NH)using an SHM-48 Slot Blot hybridization manifold (Scie-Plas).For Southern hybridization, a 3.2-kbp NotI-XbaI fragment thatwas prepared from pXN289 (Okuno et al. 1997) and a 1.0-kbpXbaI fragment from p2BN052-1 (Okuno et al. 1997) werelabeled with 32P using the Megaprime DNA labeling system(Amersham, Arlington Heights, IL) and employed as theautonomous replication sequence (ARS) and non-ARS frag-ment probe, respectively. Southern blot signals were detectedusing a Fuji BAS2500 phosphorimager and were measuredusing the Image Gauge software (Fujifilm).

Preparation of cell extracts: Cells were washed with one-half culture volume of ice-cold washing buffer (50 mm NaF,5 mm EDTA), frozen in liquid nitrogen, and stored at �80�before use. They were suspended in lysis buffer [50 mm HEPES(pH 7.4), 100 mm K-acetate, 2 mm EDTA, 1 mm DTT, 0.1%NP-40, 10% glycerol, 50 mm NaF, 60 mm b-glycerophosphate,1 mm Na-orthovanadate, 1 mm PMSF, 1 mm benzamidine, 1 mg/ml leupeptin, 1 mg/ml pepstatin A] and disrupted using Bead-Beater (Biospec Products, Bartlesville, OK) after the additionof 5 ml of protease inhibitor cocktail (Sigma) and glass beads;the beads were then removed by centrifugation. After the ad-dition of 20% Triton X-100 to a final concentration of 1%,the cell lysate was incubated at 4� for 30 min with rotation ofthe tube. The protein extract was cleared by centrifugation at15,000 rpm for 10 min at 4�, and the protein concentration wasdetermined by the Bradford assay (Protein Assay; Bio-Rad,Hercules, CA).

Cds1 kinase assays: Cds1 kinase assays were performed es-sentially as described elsewhere (Boddy et al. 1998). In a totalvolume of 0.5 ml, 1.5 mg of cell extracts were mixed withglutathione-Sepharose-bound GST-Wee170 in lysis buffer sup-plemented with 1% Triton X-100. After rotation for 1.5 hr at4�, the Sepharose beads were washed with 0.3 ml of the lysisbuffer supplemented with 1% Triton X-100 and then with 0.3ml of kinase buffer [50 mm Tris-HCl (pH 7.6), 10 mm MgCl2]three times each. The mixture of beads was then incubatedwith 50 ml of kinase buffer containing 100 mm ATP (Pharmacia,Piscataway, NJ) and 0.25 ml of [g-32P]ATP (.4000 Ci/mmol,ICN Biomedicals) at 30� for 30 min. The reaction was ter-minated by the addition of 20 ml of Laemmli sample buffer(Bio-Rad), followed by heat denaturation. The Fuji BAS2500phosphorimager was used to detect 32P-labeled proteins thatwere then measured using Image Gauge software (Fujifilm).

Flow cytometry analysis: The cells were fixed in 70% ethanoland stored at 4�. After washing in 50 mm Na-citrate, they weresuspended in 50 mm Na-citrate solution containing 100 mg/mlRNase and 500 ng/ml propidium iodide, incubated at 37� for2 hr, and then subjected to sonication to resolve cell aggrega-tion (Sonifier 250, Branson). The DNA content of the cells wasmeasured using the FACScan system with CellQuest software(Becton Dickinson, Franklin Lakes, NJ).

RESULTS

At their respective semipermissive temperatures, theorp1-4 and sna41-928 mutants exhibit HU hypersensi-tivity in the absence of Chk1, a DNA damage check-point kinase: Orc1 is required solely for replicationinitiation, while Cdc45 is required for both initiationand elongation. To examine the relationship betweenreplication initiation and elongation and the responseto replication elongation block, we used the orc1/orp1-4and cdc45/sna41-928 mutants. To demonstrate thatDNA synthesis is partially defective in these mutants attheir respective semipermissive temperatures, the TKand hENT genes were integrated into the yeast genome,allowing the incorporation of a heavy thymidine analog,BrdU, into the synthesized DNA. TK converts exoge-nous thymidine to thymidine monophosphate, whichthen enters the yeast pathway of thymidine triphosphateformation (McNeil and Friesen 1981; Hodson et al.2003). hENT is a membrane protein that facilitates thediffusion of nucleosides down their concentration gra-dients (Griffiths et al. 1997). Synchronous cultures inthe G2 phase were obtained by centrifugal elutriationand divided into two equal aliquots. To ensure that DNAsynthesis occurred only around the origin, HU, whichis a specific inhibitor of ribonucleotide reductase, wasadded to both aliquots. BrdU was added to one aliquotto a final concentration of 100 mm. After a 3-hr in-cubation in the presence of HU, DNA was extracted andseparated on CsCl density gradients. The fragment ofinterest in the gradients was determined by slot blothybridization using the ARS and non-ARS fragmentsas probes (Figure 1A). BrdU incorporation into theARS region was evident by its shift from the light to theheavy position (Figure 1B, top). As expected, the non-ARS region showed essentially the same profile in the

TABLE 1

Fission yeast strains used in this study

Strain Genotype

TNF34 h�

TNF938 h� orp1-4HM328 h� sna41-928TNF344 h� nda4-108HM259 h� nda1-376TNF909 h�, cdc19-P1HM350 h�, chk1Tura41

TNF256 h�, cds1TkanMX6TNF264 h�, mrc1TkanMX6TNF1215 h� orp1-4 chk1Tura41

TNF947 h� orp1-4 mrc1TkanMX6TNF941 h�, orp1-4, cds1TkanMX6TNF326 h�, sna41-928, chk1Tura41

TNF293 h�, sna41-928, mrc1TkanMX6TNF283 h�, sna41-928, cds1TkanMX6TNF355 h�, nda4-108, mrc1TkanMX6NNF103 h�, nda4-108, cds1TkanMX6TNF912 h�, nda1-376, mrc1TkanMX6TNF916 h�, nda1-376, cds1TkanMX6TNF929 h�, cdc19-P1, mrc1TkanMX6TNF899 h�, cdc19-P1, cds1TkanMX6TNF351 h�, cds1TkanMX6, chk1Tura41

TNF370 h�, mrc1TkanMX6, leu1-32TNF1848 h�, sna41-928, mrc1TkanMX6, leu1-32TNF374 h�, nda4-108, mrc1TkanMX6, leu1-32TNF1055 h�, ade61:(adh1)p-hENT, ura41:(adh1)p-TKTNF1079 h�, ade61:(adh1)p-hENT, ura41:(adh1)p-TK,

orp1-4TNF1065 h�, ade61:(adh1)p-hENT, ura41:(adh1)p-TK,

sna41-928

Mrc1 Negatively Regulates Cdc45 and MCM 157

presence or absence of BrdU (Figure 1B, bottom). At28�, 47 and 29% of the ARS region shifted to the heavyposition in the wild-type and orp1 mutant strains, re-spectively (Figure 1C). At 30�, the efficiency of BrdUincorporation was reduced in the sna41 mutant com-pared to that of the wild-type strain (Figure 1D). Theseresults demonstrate that DNA replication is partiallydefective in the orp1-4 and sna41-928 mutants at 28� and30�, respectively.

To study the effect of defective replication on theresponse to replication elongation block, we examinedthe HU sensitivity of the orp1 and sna41 mutants by aserial dilution test with logarithmically growing cells(Figure 2). Since the DNA damage checkpoint pathwayis activated and functions as a backup system to maintaincell viability when the replication fork that is stalled byHU treatment is collapsed (Boddy et al. 1998; Lindsay

et al. 1998), we carried out the HU sensitivity test in thepresence or absence of Chk1. Although the orp1 mutantexhibited similar sensitivity as the wild-type strain, theorp1 chk1D mutant exhibited higher sensitivity than thechk1D mutant at 25� and 28� (Figure 2A). The sna41mutant also exhibited HU hypersensitivity at 30� in theabsence of Chk1 (Figure 2B). The enhancement of HUsensitivity by the elimination of Chk1 was observed inthe cds1D mutant (Figure 2B), suggesting that the orp1and sna41 mutants have defects in the Cds1 pathway.The temperature sensitivity of the orp1 and sna41 mu-tants was also enhanced by a chk1 deletion, and thisunderlines the importance of Chk1 in replication-deficient cells (Figure 2, data not shown).

Activation of Cds1, a replication checkpoint kinase, ispartially defective in the orp1-4 and sna41-928 mutants:To determine whether the orp1 and sna41 mutations, at

their respective semipermissive temperatures, affect theactivation of the Cds1 pathway, we examined the Cds1kinase activity that is induced by HU treatment. Cellextracts of the wild-type, orp1, and cds1D mutant strainswere prepared before and after HU treatment at 28�,and an in vitro kinase assay was performed in thepresence of [g-32P]ATP and bacteria-expressed GST-Wee170 as the substrate (Figure 3, A and B). In the wild-type strain, �10-fold Wee1 phosphorylation inductionwas observed after HU treatment. In the cds1D mutant,almost no Wee1 phosphorylation was observed (Figure3A), indicating that in this assay, Wee1 phosphorylationdepends on Cds1. Wee1 phosphorylation in the pres-ence of HU was lower in the orp1 mutant than in thewild-type strain. Quantification of the phosphorimagersignal revealed that the Cds1 kinase activity was slightlybut significantly decreased in the orp1 mutant (Figure3B). Further, Wee1 phosphorylation at 30� was also lowerin the sna41 mutant than in the wild-type strain (Figure3, C and D). These results are consistent with the notionthat normal replication is required for full activation ofthe replication checkpoint kinase (see discussion).

The HU sensitivity of the mrc1 mutant is suppressedby the sna41-928 mutation but not by the orp1-4 mu-tation: To explore the genetic relationship between theorp1-4 and sna41-928 mutations and the replicationcheckpoint mutations, a series of double mutants wereconstructed and examined for their sensitivity to HU(Figure 4). We observed that both the orp1 and the sna41mutations suppressed the HU sensitivity of cds1D cells(Figure 4, A and B). It is possible that a reduction inthe number of replication forks can partially alleviatethe problem that occurs in the absence of Cds1 (seediscussion).

Figure 1.—BrdU incor-poration in the orp1-4 andsna41-928 mutants. BrdUincorporation followed bydensity gradient fraction-ation was carried out tomeasure the replication effi-ciency. (A) Positions of thears2004 and ars2005 repli-cation origins on chromo-some II are indicated asopen boxes. Positions ofthe ARS and non-ARS re-gions used as hybridizationprobes are indicated assolid boxes. (B) Slot blotanalysis to detect the ARS(top) and non-ARS (bot-tom) regions in the wild-type strain (TNF1055) at28�. The fraction number

of the CsCl density gradient is indicated at the bottom. (C) BrdU incorporation in the ARS region in wild-type and orp1(TNF1079) cells at 28�. (D) BrdU incorporation in the ARS region in wild-type and sna41 (TNF1065) cells at 30�. The percentageof the total DNA in each fraction in the absence (�BrdU, open circles) or presence (1BrdU, solid circles) of BrdU is indicated. Theproportion of the dark shaded area to the total shaded area (dark and light shading) is indicated. Essentially, no BrdU incorporationwas observed in the non-ARS region (B, data not shown).

158 N. Nitani et al.

In addition to its role in Cds1 activation, Mrc1 isrequired to prevent the uncoupling of the replicationmachinery from DNA synthesis. Contrary to the case ofcds1D cells, mrc1D cells did not exhibit suppressed HUsensitivity due to the orp1 mutation (Figure 4A). How-ever, the sna41 mutation specifically suppressed the HUsensitivity of mrc1D cells (Figure 4B). To confirm thatthe sna41 mutation is a bona fide cause of the HU sen-sitivity suppression in mrc1D cells, we introduced anempty vector (p.vector) and a plasmid containing thesna411 or the mrc11 gene (p.sna41 and p.mrc1, respec-tively) into yeast cells and examined the HU sensitivity.Figure 4C shows that sna41 mrc1D cells harboringp.sna41 exhibit higher sensitivity than those harboringp.vector or p.mrc1. Importantly, p.sna41 did not affectthe HU sensitivity of mrc1D cells as well as the wild-typeand sna41 cells (Figure 4C, data not shown). Theseresults imply that a mutation of Cdc45 specifically sup-presses the HU sensitivity of the mrc1D mutant.

A time-course analysis using an acute dose of HUrevealed the efficient suppression of the HU sensitivityof mrc1D cells by the sna41 mutation at 30�. Figure 5A

shows that mrc1D cells are less sensitive than cds1D cellsand that within the time course, the sensitivity of mrc1D

cells is almost entirely suppressed by the sna41 muta-tion. At the 6-hr time point, the relative viability of mrc1D

cells was 2.6 6 0.9%, while that of sna41 mrc1D cellswas 118 6 33%. Given the observation that the HUsensitivity of mrc1D cells was efficiently suppressed by thesna41 mutation, it is possible that the sna41 mutationincreases Cds1 activity in mrc1D cells. To test this, weperformed an in vitro kinase assay to measure the Cds1activity in the mrc1D, sna41 mrc1D, and wild-type strainsgrown at 30� (Figure 5, B and C). We observed that theCds1 kinase activity was equally low in mrc1D and sna41mrc1D cells. Thus, it appears that the sna41 mutationsuppresses the HU sensitivity but not the defective Cds1activation of mrc1D cells. It is also noted that there is aresidual activation of Cds1 kinase even in the absenceof Mrc1, consistent with the different HU sensitivity inmrc1D and cds1D cells (Figure 5A). These results suggestthat there are Mrc1-dependent and Mrc1-independentpathways for Cds1 activation.

The sna41-928 mutation alleviates the defect inrecovery from replication block in the mrc1 mutant:Mrc1 as well as Cds1 is required for recovery from thereplication block that is induced by HU treatment. Toexamine the recovery, logarithmically growing cells ofthe wild-type, mrc1D, sna41, and sna41 mrc1D strainswere treated with an acute dose of HU for 3 hr to blockreplication, washed with distilled water, and releasedinto HU-free medium to allow them to resume cell cycleprogression; the DNA content of the cells was thenmonitored by FACS analysis (Figure 6A). The wild-typeand sna41 cells showed essentially the same phenotype;the DNA content reached 2C from 1C by 60 min afterrelease. In contrast, the DNA content of mrc1D cellsincreased very slowly, indicating that Mrc1 is requiredfor recovery from replication block. However, the FACSprofile of sna41 mrc1D cells was more similar to those ofthe wild-type and sna41 cells than to that of mrc1D cells(Figure 6A, see 40 and 60 min). Recovery from thereplication block was also examined by staining the cellswith DAPI and counting the number of binucleate cells(Figure 6B). With the wild-type and sna41 strains,binucleate cells started accumulating at 80 min afterrelease and reached a peak at 100 min. With the mrc1D

strain, no accumulation of binucleate cells was appar-ent. However, with the sna41 mrc1D strain, binucleatecells accumulated although later than in the wild-typeand sna41 strains. In summary, these results show thatthe sna41 mutation alleviates the defect in recoveryfrom replication block in the mrc1D mutant.

Mutations in the MCM helicase can also suppress theHU sensitivity of the mrc1 mutant: Given that the MCMhelicase as well as Cdc45 is essential for both initiationand elongation phases of replication and that thereare genetic and physical interactions between them(Miyake and Yamashita 1998; Zou and Stillman

Figure 2.—HU sensitivity of the orp1-4 and sna41-928 mu-tants. (A) Serial dilution assay to examine the HU sensitivityof the wild-type (TNF34), chk1D (HM350), orp1 (TNF938),and orp1 chk1D (TNF1215) strains at 25� and 28�. (B) Serialdilution assay to examine the HU sensitivity of the wild-type, chk1D, sna41 (HM328), sna41 chk1D (TNF326), cds1D(TNF256), and cds1D chk1D (TNF351) strains at 30�. Log-phase cultures in EMM medium were serially diluted 10-foldwith distilled water and plated onto YE medium supple-mented with 2 mm HU. The plates were incubated at the tem-perature indicated above each part.

Mrc1 Negatively Regulates Cdc45 and MCM 159

1998; Masuda et al. 2003; Yamadaet al. 2004), mutationsin MCM might also suppress the HU sensitivity of themrc1D mutant. To test this possibility, we constructeda series of double mutants and examined their sensi-tivity to HU (Figure 7). We first examined mutantalleles of the Mcm2 subunit of the Mcm2–7 complex.

A temperature-sensitive mutation of Mcm2, cdc19-P1(Forsburg and Nurse 1994), suppressed the HU sen-sitivity of both mrc1D and cds1D cells at 25� (Figure 7A).However, a cold-sensitive mutation of Mcm2, nda1-367(Miyake et al. 1993), suppressed the HU sensitivity ofcds1D but not mrc1D cells at 33� (Figure 7B). These

Figure 4.—Suppression of the HUsensitivity of the replication checkpointmutants by the orp1-4 or the sna41-928mutation. The effect of the orp1-4 (A)and sna41-928 (B) mutations on theHU sensitivity of the mrc1D and cds1Dmutants was examined. HU sensitivityof the isogenic wild-type (TNF34), orp1(TNF938), sna41 (HM328), mrc1D(TNF264), cds1D (TNF256), orp1 mrc1D(TNF947), orp1 cds1D (TNF941), sna41mrc1D (TNF293), and sna41 cds1D(TNF283) strains was examined by a10-fold serial dilution assay. (C) Themrc1D leu1 (TNF370) and sna41 mrc1Dleu1 (TNF1848) transformants harbor-ing the vector plasmid (p.vector;p940XB), which comprised the LEU2gene of Saccharomyces cerevisiae andars2004 (Okuno et al. 1997), or theplasmid containing the sna411 gene(p.sna41; pTN520) or the mrc11 gene(p.mrc1; pTN521) were grown to logphase in EMM, 10-fold serially diluted,and spotted onto EMM plates supple-mented with HU. The HU concentra-tion and the incubation temperatureare indicated above each part.

Figure 3.—Cds1 kinase activity in the orp1-4 and sna41-928 mutants. (A) Exponentially growing wild-type (TNF34), orp1(TNF938), and cds1D (TNF256) cells in EMM medium were treated with 10 mm HU for 0, 3, or 4 hr at 28�. GST-Wee170 was ex-pressed in Escherichia coli and affinity purified using glutathione Sepharose 4B. Then, 1.5 mg of the total extract prepared fromyeast cells and GST-Wee170 beads were mixed and subjected to kinase reactions with [g-32P]ATP to probe the phosphorylated pro-teins (see materials and methods). Reaction products were separated on 12% SDS–PAGE (29:1), the phosphorylated proteinswere detected using a phosphorimager (top, 32P), and the GST-Wee170 was visualized by Coomassie Brilliant Blue staining (bottom,Coomassie). (B) Relative amount of phosphorylated Wee1 in the wild-type, orp1, and cds1D cells at 28�. (C) Cds1 kinase activity wasmeasured using wild-type, sna41 (HM328), and cds1D cells as in A, except the temperature used was 30�. (D) Relative amount ofphosphorylated Wee1 in the wild-type, sna41, and cds1D cells at 30�. The value is the mean of two independent experiments, andthe error bar shows the standard deviation.

160 N. Nitani et al.

results demonstrate that the HU sensitivity of mrc1D

cells is suppressed by a mutation of Mcm2 in an allele-dependent manner.

Another subunit of the MCM complex, Mcm5, wasexamined. It was observed that a cold-sensitive mutationof Mcm5, nda4-108 (Miyake et al. 1993), suppressed theHU sensitivity of mrc1D as well as cds1D cells at 35�(Figure 7C). It was confirmed that the nda4 mutationis a bona fide cause of the suppression in mrc1D cells, bycomparison of the HU sensitivity of nda4 mrc1D trans-formants harboring an empty vector or the plasmidcontaining the nda41 gene (p.vector and p.nda4, respec-tively) (Figure 7D). As was seen in the case of sna41-928(Figure 5A), the nda4 mutation efficiently suppressedthe HU sensitivity of mrc1D cells in a time-course analysisusing an acute dose of HU (Figure 7E). Thus, it appearsthat the HU sensitivity of mrc1D cells can be suppressednot only by a mutation of Cdc45 but also by specificmutations of the MCM helicase.

DISCUSSION

Throughout the cell cycle, the ORC binds replicationorigins and is required exclusively for replication initia-tion. In contrast, the Cdc45 protein is essential to boththe initiation and the elongation phases of replication.To examine the relationship between initiation and elon-gation defects and the response to replication elonga-tion block, we used the temperature-sensitive fission yeastmutants of Orc1 and Cdc45, i.e., orp1-4 and sna41-928,respectively. We observed that at their respective semi-permissive temperatures, the extent of BrdU incorpora-tion was lower in orp1 and sna41 cells than in the wild-typecells. At the same temperatures, orp1 or sna41 cells ex-hibited HU hypersensitivity in the absence of Chk1 kinaseand were partially defective in the HU-induced activationof Cds1 kinase. While the HU sensitivity of the cds1D

mutant was partially suppressed by either the orp1 or thesna41 mutation, the sensitivity of the mrc1D mutant wasspecifically suppressed by the sna41 mutation.

Roles of Orc1 and Cdc45 in the activation of thereplication checkpoint: To monitor the replication ef-ficiency of orp1-4 and sna41-928 cells at their respectivesemipermissive temperatures, we examined the incor-poration of the thymine analog BrdU into genomicDNA and observed that it was lower in the orp1 andsna41 cells than in the wild-type cells. It is likely that theinitiation of replication is defective in the orp1 mutant,while both initiation and elongation are defective in thesna41 mutant. At the same temperatures, the orp1 andsna41 cells exhibited HU hypersensitivity in the absenceof Chk1. A synergetic enhancement of HU sensitivity isobserved between the cds1 and chk1 mutants (Boddy

et al. 1998; this study). Cds1 and Chk1 checkpoint ki-nases are involved in the replication and DNA damagecheckpoint pathways, respectively. In the absence ofCds1, at least a fraction of the stalled forks is convertedinto aberrant DNA structures (e.g., double-strand breaks)that in turn induce the Chk1 pathway. Thus, the en-hancement of HU sensitivity by a chk1 deletion that isobserved in the orp1 and sna41 mutants suggests thatthese mutants have a defect in the Cds1 pathway. In fact,the HU-induced activation of Cds1 kinase is partiallyimpaired in the orp1 and sna41 mutants. Since the orp1and sna41 mutants show HU hypersensitivity only in theabsence of Chk1, the reduced activity of Cds1 kinasemight be slightly insufficient for all the replication forksand/or it could not arrest cell-cycle progression suffi-ciently without the aid of Chk1 kinase. These results areconsistent with the notion that normal replication isrequired for full activation of the replication checkpointmechanism. It is possible that the number of replicationforks is reduced in the replication mutant, and thisaccounts for the defect in checkpoint activation, as was

Figure 5.—The sna41-928 mutation does notsuppress the mrc1 defect inCds1 activation. (A) Time-course analysis of the HUsensitivity. Exponentiallygrowing cells of the wild-type(TNF34), sna41 (HM328),mrc1D (TNF264), cds1D(TNF256), sna41 mrc1D(TNF293), and sna41 cds1D(TNF283) strains that weregrown at 30� in EMM me-dium were treated with anacute dose of HU (10 mm).Aliquots of the cells were col-lected at the indicated time

point, appropriately diluted with distilled water, and plated on YE medium. The viability corresponding to the 0-hr time point is indicated.The value is the mean of three independent experiments, and the error bar shows the standard deviation. (B) Exponentially growingmrc1D, sna41 mrc1D, and cds1D cells in EMM medium were treated with 10 mm HU for 0, 3, or 4 hr at 30�. Using the cell extracts, phos-phorylationofGST-Wee170 wasexaminedasdepicted inFigure3. (C)RelativeamountofphosphorylatedWee1 in mrc1D, sna41mrc1D, andcds1D cells.

Mrc1 Negatively Regulates Cdc45 and MCM 161

proposed in budding yeasts (Shimada et al. 2002; Lee

et al. 2003; Terceroet al. 2003). Recently, using Xenopusegg extracts, it has been shown that even after DNAsynthesis is inhibited, the MCM helicase together withCdc45 continues a certain extent of DNA unwinding togenerate single-stranded DNA, which is important forcheckpoint activation (Zou and Elledge 2003; Byun

et al. 2005). Thus, it is also possible that at its semipermis-sive temperature, the replication elongation mutant ispartially defective in the formation of a single-strandedregion that is sufficiently long for checkpoint activation.These two possibilities are not mutually exclusive, and

we consider that both hold true for the sna41 mutant, asdiscussed below.

A mutation of either Orc1 or Cdc45 suppresses theHU sensitivity of the cds1 mutant: The serial dilutiontest revealed that the sna41-928 mutation partially sup-presses the HU sensitivity of the cds1D mutant. Since theorp1-4 mutation also suppresses the HU sensitivity ofcds1D, it appears that a decrease in the number of rep-lication forks can alleviate the defect in cds1D. It ispossible that the protein factor that is required for thestability of stalled forks is limited in a cell, and itsactivation by Cds1 is essential for a number of stalledforks in wild-type cells. Alternatively, Cds1 might berequired for the coordinated processing of neighbor-ing forks, since a decrease in the number of replicationforks can lead to an increase in the distance between theforks. Further studies are required to address thesepossibilities.

A mutation of Cdc45 but not Orc1 suppresses theHU sensitivity of the mrc1 mutant: The HU sensitivityof the mrc1D mutant was suppressed by the sna41-928mutation but not by the orp1-4 mutation. This specificsuppression by the sna41 mutation suggests that a defectin the elongation phase of replication accounts for thesuppression of HU sensitivity in mrc1D cells. A time-course experiment using an acute dose of HU revealedthat mrc1D cells are less sensitive than cds1D cells andthat the sensitivity of mrc1D cells is almost entirelysuppressed by sna41. When replication is blocked byHU, Mrc1 is required to activate Cds1 and prevent theuncoupling of the replication machinery from DNAsynthesis (Tanaka and Russell 2001; Katou et al.2003). The Cds1 activation defect in mrc1D cells doesnot appear to be suppressed by sna41 since the in vitroactivity of Cds1 kinase was similarly low in the mrc1D

and sna41 mrc1D cells. However, the resumption of DNAsynthesis and cell cycle progression in mrc1D cells afterrelease from HU arrest was facilitated by the sna41mutation. Thus, it is likely that the role of Mrc1 in theprevention of uncoupling is related to Cdc45.

Mutations in the MCM helicase suppress the HUsensitivity of the mrc1 mutant in an allele-specific man-ner: We found that the HU sensitivity of mrc1D cells canbe suppressed not only by a mutation of Cdc45 but alsoby mutations of the MCM helicase. Mutations of theMcm2 subunit of MCM suppress the HU sensitivity ofmrc1D cells in an allele-dependent manner; the cdc19-P1but not the nda1-376 mutation of Mcm2 suppresses theHU sensitivity of mrc1D cells. However, at the same tem-peratures, the HU sensitivity of cds1D cells is suppressedby either the cdc19 or the nda1 mutation, indicating thatboth mutations cause some defect under the experi-mental conditions. It has been shown that the nda1 mu-tation causes an accumulation of cells with a 1C DNAcontent at a restrictive temperature (Forsburg andNurse 1994). Chromatin binding of MCM is impairedin nda1 as well as orc1/orp1-4 cells at their restrictive

Figure 6.—The sna41-928 mutation suppresses the defect inrecovery from HU arrest in the mrc1D mutant. Exponentiallygrowing cells of the wild-type (TNF34), sna41 (HM328), mrc1D(TNF264), and sna41 mrc1D (TNF293) strains in EMM mediumwere treatedwith 10mmHUfor 3 hrat30�,washedwith distilledwater, and then released into HU-free YE medium. Culture ali-quots of 1 ml were collected at the indicated time points andstored at 4� in 70% ethanol. (A) Flow cytometry analysis ofthe DNA content of the cells after release from HU arrest. Solidhistograms represent the DNA content at the indicated timepoints, and shaded histograms represent that at the 0-hr timepoint. (B) Percentage of binucleate cells indicative of passagethrough mitosis. At each time point, at least 200 cells were ex-amined by microscopy, and the cells containing two DAPI-stained bodies were counted.

162 N. Nitani et al.

temperatures (Yamada et al. 2004), indicating thatreplication initiation is defective in nda1 cells. Theinitiation defect in nda1 cells may account for the HU-sensitivity suppression of cds1D cells, as was discussedfor the orc1/orp1-4 case (see above). Inability of the nda1mutation to suppress the HU sensitivity of mrc1D cellssuggests that some specific defect in the elongation maybe required for the suppression. Contrary to the nda1mutation, the cdc19 mutation does not accumulate cellswith a 1C DNA content at a restrictive temperature(Forsburg and Nurse 1994), suggesting that cdc19causes a defect in an elongation phase of replication.The cdc19 mutation decreases expression levels of Mcm2and impairs interaction between MCM subunits evenat a nonrestrictive temperature of 25� (Sherman et al.1998), the temperature at which the HU sensitivity ofmrc1D cells is suppressed by cdc19 (this study). Thus, theunstable replication machinery formed in cdc19 cells,which may cause defects in both initiation and elonga-tion phases of replication, could account for the sup-pression of both cds1D and mrc1D cells.

In addition to a mutation of Mcm2, we found that amutation of Mcm5, nda4-108, also suppresses the HUsensitivity of mrc1D and cds1D cells. Amino acid residues

conserved among the orthologs from different organ-isms are altered by sna41-928 (A410T), nda4-108 (R50C),and cdc19-P1 (P257L and T272I) mutations (Forsburg

et al. 1997; Yamada et al. 2004), suggesting that con-served functions of Cdc45 and MCM are affected bythese mutations. Interestingly, there is an intimate rela-tionship between the nda4-108 and the sna41-928 muta-tions. sna41-928 was originally identified as one of theCdc45 mutations that can suppress the cold-sensitivegrowth defect of nda4-108 cells (Miyake and Yamashita

1998; Yamada et al. 2004). In both nda4 and sna41 cellsat their restrictive temperatures, association of Cdc45 toreplication origins is severely impaired although MCMas well as another replication factor, Sld3, is loaded andaccumulated on the origin (Yamadaet al. 2004). In addi-tion, in nda4 cells at a restrictive temperature, physicalinteraction between MCM and Cdc45 proteins detectedin wild-type cells is disrupted while the MCM complexappears to be intact, and the cold-sensitivity of nda4is partially alleviated by overexpression of the wild-typesna411 gene. Given these observations, it seems plausi-ble that, even at the semipermissive temperature, theassociation between Mcm5 and Cdc45 may be partiallyimpaired in nda4 and sna41 cells. Collectively, the MCM

Figure 7.—Mutations in the MCM helicase suppress the HU sensitivity of the replication checkpoint mutants. (A) HU sensitivityof the isogenic wild-type (TNF34), cdc19 (TNF909), mrc1D (TNF264), cds1D (TNF256), cdc19 mrc1D (TNF929), and cdc19 cds1D(TNF899) strains was examined by a 10-fold serial dilution test. (B) HU sensitivity of the isogenic wild-type, nda1 (HM259), mrc1D,cds1D, nda1 mrc1D (TNF912), and nda1 cds1D (TNF916) strains was examined. (C) HU sensitivity of the isogenic wild-type, nda4(TNF344), mrc1D, cds1D, nda4 mrc1D (TNF355), and nda4 cds1D (NNF103) strains was examined. The HU concentration and theincubation temperature are indicated above each part. (D) The nda4 mrc1D leu1 (TNF374) transformants harboring the vectorplasmid (p.vector: pXN289) or the plasmid containing the nda41 gene (p.nda4; pTN774) were grown to log phase in EMM at 35�,serially diluted 10-fold, and spotted onto EMM plates supplemented with 6 mm HU. (E) Exponentially growing cells in EMMmedium at 35� were treated with an acute dose of HU (12.5 mm). Aliquots of cells were collected at the indicated time points,appropriately diluted with distilled water, and plated on YE medium. The viability corresponding to the 0-hr time point is indi-cated. The value is the mean of three independent experiments, and the error bar shows the standard deviation.

Mrc1 Negatively Regulates Cdc45 and MCM 163

complex integrity and/or its association to Cdc45 ap-pear to be impaired in the mutants that can suppressthe HU sensitivity of mrc1D cells. Our findings providegenetic evidence that Mrc1 negatively regulates the rep-lication machinery containing Cdc45 and the MCMhelicase for the recovery from replication block.

We are grateful to Mitsuhiro Yanagida, Paul Russell, KatsunoriTanaka, Paul Nurse, Teresa Wang, Ayumu Yamamoto, Kunihiro Ohta,and Katsuhiko Shirahige for providing strains, plasmids, and anti-bodies. We also thank Sanae Miyake and Shigeru Yamashita for shar-ing their unpublished results and the members of our laboratory forhelpful discussions. This work was supported by a grant-in-aid forcancer research from the Ministry of Education, Science, Technology,Sports, and Culture of Japan and by funding from the SumitomoFoundation and the Naito Foundation awarded to T.N.

LITERATURE CITED

Alcasabas, A. A., A. J. Osborn, J. Bachant, F. Hu, P. J. Werler et al.,2001 Mrc1 transduces signals of DNA replication stress to acti-vate Rad53. Nat. Cell Biol. 3: 958–965.

Alfa, C., P. Fantes, J. Hyams, M. Mcleod and E. Warbrick,1993 Experiments With Fission Yeast. Cold Spring Harbor Labora-tory Press, Cold Spring Harbor, NY.

Aparicio, O. M., D. M. Weinstein and S. P. Bell, 1997 Componentsand dynamics of DNA replication complexes in S. cerevisiae: redis-tribution of MCM proteins and Cdc45p during S phase. Cell 91:59–69.

Bahler, J., J. Q. Wu, M. S. Longtine, N. G. Shah, A. McKenzie, 3rd

et al., 1998 Heterologous modules for efficient and versatilePCR-based gene targeting in Schizosaccharomyces pombe. Yeast 14:943–951.

Bell, S. P., and A. Dutta, 2002 DNA replication in eukaryotic cells.Annu. Rev. Biochem. 71: 333–374.

Boddy, M. N., B. Furnari, O. Mondesert and P. Russell, 1998 Rep-lication checkpoint enforced by kinases Cds1 and Chk1. Science280: 909–912.

Boddy, M. N., A. Lopez-Girona, P. Shanahan, H. Interthal, W. D.Heyer et al., 2000 Damage tolerance protein Mus81 associateswith the FHA1 domain of checkpoint kinase Cds1. Mol. Cell.Biol. 20: 8758–8766.

Boddy, M. N., P. Shanahan, W. H. McDonald, A. Lopez-Girona,E. Noguchi et al., 2003 Replication checkpoint kinase Cds1regulates recombinational repair protein Rad60. Mol. Cell. Biol.23: 5939–5946.

Branzei, D., and M. Foiani, 2005 The DNA damage response dur-ing DNA replication. Curr. Opin. Cell Biol. 17: 568–575.

Byun, T. S., M. Pacek, M. C. Yee, J. C. Walter and K. A. Cimprich,2005 Functional uncoupling of MCM helicase and DNA poly-merase activities activates the ATR-dependent checkpoint. GenesDev. 19: 1040–1052.

Calzada, A., B. Hodgson, M. Kanemaki, A. Bueno and K. Labib,2005 Molecular anatomy and regulation of a stable replisomeat a paused eukaryotic DNA replication fork. Genes Dev. 19:1905–1919.

Capasso, H., C. Palermo, S. Wan, H. Rao, U. P. John et al.,2002 Phosphorylation activates Chk1 and is required forcheckpoint-mediated cell cycle arrest. J. Cell Sci. 115: 4555–4564.

Carr, A. M., 2002 DNA structure dependent checkpoints as regula-tors of DNA repair. DNA Repair 1: 983–994.

Caspari, T., J. M. Murray and A. M. Carr, 2002 Cdc2-cyclin B ki-nase activity links Crb2 and Rqh1-topoisomerase III. Genes Dev.16: 1195–1208.

Chong, J. P., M. K. Hayashi, M. N. Simon, R. M. Xu and B. Stillman,2000 A double-hexamer archaeal minichromosome mainte-nance protein is an ATP-dependent DNA helicase. Proc. Natl.Acad. Sci. USA 97: 1530–1535.

Forsburg, S. L., and P. Nurse, 1994 The fission yeast cdc191 geneencodes a member of the MCM family of replication proteins.J. Cell Sci. 107: 2779–2788.

Forsburg, S. L., D. A. Sherman, S. Ottilie, J. R. Yasuda and J. A.Hodson, 1997 Mutational analysis of Cdc19p, a Schizosaccharo-myces pombe MCM protein. Genetics 147: 1025–1041.

Furnari, B., A. Blasina, M. N. Boddy, C. H. McGowan and P.Russell, 1999 Cdc25 inhibited in vivo and in vitro by check-point kinases Cds1 and Chk1. Mol. Biol. Cell 10: 833–845.

Griffiths, M., N. Beaumont, S. Y. Yao, M. Sundaram, C. E. Boumah

et al., 1997 Cloning of a human nucleoside transporter impli-cated in the cellular uptake of adenosine and chemotherapeuticdrugs. Nat. Med. 3: 89–93.

Harris, S., C. Kemplen, T. Caspari, C. Chan, H. D. Lindsay et al.,2003 Delineating the position of rad41/cut51 within the DNA-structure checkpoint pathways in Schizosaccharomyces pombe. J. CellSci. 116: 3519–3529.

Hartwell, L. H., and T. A. Weinert, 1989 Checkpoints: controlsthat ensure the order of cell cycle events. Science 246: 629–634.

Hodson, J. A., J. M. Bailis and S. L. Forsburg, 2003 Efficient label-ing of fission yeast Schizosaccharomyces pombe with thymidineand BUdR. Nucleic Acids Res. 31: e134.

Huang, M., Z. Zhou and S. J. Elledge, 1998 The DNA replicationand damage checkpoint pathways induce transcription by inhibi-tion of the Crt1 repressor. Cell 94: 595–605.

Ishimi, Y., 1997 A DNA helicase activity is associated with an MCM4,-6, and -7 protein complex. J. Biol. Chem. 272: 24508–24513.

Ivessa, A. S., B. A. Lenzmeier, J. B. Bessler, L. K. Goudsouzian, S. L.Schnakenberg et al., 2003 The Saccharomyces cerevisiae helicaseRrm3p facilitates replication past nonhistone protein-DNA com-plexes. Mol. Cell 12: 1525–1536.

Kai, M., M. N. Boddy, P. Russell and T. S. Wang, 2005 Replicationcheckpoint kinase Cds1 regulates Mus81 to preserve genome in-tegrity during replication stress. Genes Dev. 19: 919–932.

Katou, Y., Y. Kanoh, M. Bando, H. Noguchi, H. Tanaka et al.,2003 S-phase checkpoint proteins Tof1 and Mrc1 form a stablereplication-pausing complex. Nature 424: 1078–1083.

Kelman, Z., J. K. Lee and J. Hurwitz, 1999 The single minichromo-some maintenance protein of Methanobacterium thermoautotrophi-cum DH contains DNA helicase activity. Proc. Natl. Acad. Sci.USA 96: 14783–14788.

Labib, K., J. A. Tercero and J. F. Diffley, 2000 UninterruptedMCM2–7 function required for DNA replication fork progres-sion. Science 288: 1643–1647.

Lee, J., A. Kumagai and W. G. Dunphy, 2003 Claspin, a Chk1-regulatory protein, monitors DNA replication on chromatinindependently of RPA, ATR, and Rad17. Mol. Cell 11: 329–340.

Lei, M., and B. K. Tye, 2001 Initiating DNA synthesis: from recruit-ing to activating the MCM complex. J. Cell Sci. 114: 1447–1454.

Lindsay, H. D., D. J. Griffiths, R. J. Edwards, P. U. Christensen,J. M. Murray et al., 1998 S-phase-specific activation of Cds1kinase defines a subpathway of the checkpoint response in Schizo-saccharomyces pombe. Genes Dev. 12: 382–395.

Lopez-Girona, A., K. Tanaka, X. B. Chen, B. A. Baber, C. H.McGowan et al., 2001 Serine-345 is required for Rad3-dependent phosphorylation and function of checkpoint kinaseChk1 in fission yeast. Proc. Natl. Acad. Sci. USA 98: 11289–11294.

Martinho, R. G., H. D. Lindsay, G. Flaggs, A. J. DeMaggio, M. F.Hoekstra et al., 1998 Analysis of Rad3 and Chk1 proteinkinases defines different checkpoint responses. EMBO J. 17:7239–7249.

Masuda, T., S. Mimura and H. Takisawa, 2003 CDK- and Cdc45-dependent priming of the MCM complex on chromatin duringS-phase in Xenopus egg extracts: possible activation of MCM heli-case by association with Cdc45. Genes Cells 8: 145–161.

McNeil, J. B., and J. D. Friesen, 1981 Expression of the Herpes sim-plex virus thymidine kinase gene in Saccharomyces cerevisiae.Mol. Gen. Genet. 184: 386–393.

Miyake, S., and S. Yamashita, 1998 Identification of sna41 gene,which is the suppressor of nda4 mutation and is involved inDNA replication in Schizosaccharomyces pombe. Genes Cells 3:157–166.

Miyake, S., N. Okishio, I. Samejima, Y. Hiraoka, T. Toda et al.,1993 Fission yeast genes nda11 and nda41, mutations of whichlead to S-phase block, chromatin alteration and Ca21 suppres-sion, are members of the CDC46/MCM2 family. Mol. Biol. Cell4: 1003–1015.

164 N. Nitani et al.

Murakami, H., and H. Okayama, 1995 A kinase from fission yeastresponsible for blocking mitosis in S phase. Nature 374: 817–819.

Nedelcheva, M. N., A. Roguev, L. B. Dolapchiev, A. Shevchenko,H. B. Taskov et al., 2005 Uncoupling of unwinding from DNAsynthesis implies regulation of MCM helicase by Tof1/Mrc1/Csm3 checkpoint complex. J. Mol. Biol. 347: 509–521.

Nyberg, K. A., R. J. Michelson, C. W. Putnam and T. A. Weinert,2002 Toward maintaining the genome. DNA damage and rep-lication checkpoints. Annu. Rev. Genet. 36: 617–656.

Okuno, Y., T. Okazaki and H. Masukata, 1997 Identification of apredominant replication origin in fission yeast. Nucleic AcidsRes. 25: 530–537.

Raleigh, J. M., and M. J. O’Connell, 2000 The G(2) DNA damagecheckpoint targets both Wee1 and Cdc25. J. Cell Sci. 113: 1727–1736.

Rhind, N., B. Furnari and P. Russell, 1997 Cdc2 tyrosine phos-phorylation is required for the DNA damage checkpoint in fis-sion yeast. Genes Dev. 11: 504–511.

Saka, Y., F. Esashi, T. Matsusaka, S. Mochida and M. Yanagida,1997 Damage and replication checkpoint control in fissionyeast is ensured by interactions of Crb2, a protein with BRCTmotif, with Cut5 and Chk1. Genes Dev. 11: 3387–3400.

Sherman, D. A., S. G. Pasion and S. L. Forsburg, 1998 Multipledomains of fission yeast Cdc19p (MCM2) are required for itsassociation with the core MCM complex. Mol. Biol. Cell 9:1833–1845.

Shimada, K., P. Pasero and S. M. Gasser, 2002 ORC and the intra-S-phase checkpoint: a threshold regulates Rad53p activation inS phase. Genes Dev. 16: 3236–3252.

Sogo, J. M., M. Lopes and M. Foiani, 2002 Fork reversal andssDNA accumulation at stalled replication forks owing to check-point defects. Science 297: 599–602.

Tanaka, K., and P. Russell, 2001 Mrc1 channels the DNA replica-tion arrest signal to checkpoint kinase Cds1. Nat. Cell Biol. 3:966–972.

Tercero, J. A., K. Labib and J. F. Diffley, 2000 DNA synthesisat individual replication forks requires the essential initiation fac-tor Cdc45p. EMBO J. 19: 2082–2093.

Tercero, J. A., M. P. Longhese and J. F. Diffley, 2003 A central rolefor DNA replication forks in checkpoint activation and response.Mol. Cell 11: 1323–1336.

Tye, B. K., 1999 MCM proteins in DNA replication. Annu. Rev.Biochem. 68: 649–686.

Walter, J., and J. Newport, 2000 Initiation of eukaryotic DNAreplication: origin unwinding and sequential chromatin associa-tion of Cdc45, RPA, and DNA polymerase a. Mol. Cell 5: 617–627.

Walworth, N. C., and R. Bernards, 1996 rad-dependent responseof the chk1-encoded protein kinase at the DNA damage check-point. Science 271: 353–356.

Yamada, Y., T. Nakagawa and H. Masukata, 2004 A novel interme-diate in initiation complex assembly for fission yeast DNA repli-cation. Mol. Biol. Cell 15: 3740–3750.

You, Z., Y. Komamura and Y. Ishimi, 1999 Biochemical analysis ofthe intrinsic Mcm4-Mcm6-Mcm7 DNA helicase activity. Mol. Cell.Biol. 19: 8003–8015.

Zhao, H., and P. Russell, 2004 DNA binding domain in the repli-cation checkpoint protein Mrc1 of Schizosaccharomyces pombe.J. Biol. Chem. 279: 53023–53027.

Zhou, B. B., and J. Bartek, 2004 Targeting the checkpoint kinases:chemosensitization versus chemoprotection. Nat. Rev. Cancer 4:216–225.

Zou, L., and S. J. Elledge, 2003 Sensing DNA damage throughATRIP recognition of RPA-ssDNA complexes. Science 300:1542–1548.

Zou, L., and B. Stillman, 1998 Formation of a preinitiation com-plex by S-phase cyclin CDK-dependent loading of Cdc45p ontochromatin. Science 280: 593–596.

Communicating editor: P. Russell

Mrc1 Negatively Regulates Cdc45 and MCM 165