Regulation of Expression of the Rat Orthologue of MouseDouble Minute 2 (MDM2) by H2O2-induced Oxidative Stressin Neonatal Rat Cardiac Myocytes□S
Received for publication, June 30, 2009 Published, JBC Papers in Press, July 28, 2009, DOI 10.1074/jbc.M109.037887
Sampsa Pikkarainen1, Robert A. Kennedy2, Andrew K. Marshall3, El Li Tham4, Kenneth Lay, Thomas A. Kriz,Balvinder S. Handa, Angela Clerk, and Peter H. Sugden5
From the National Heart and Lung Institute Division, Faculty of Medicine, Imperial College London,London SW7 2AZ, United Kingdom
The Mdm2 ubiquitin ligase is an important regulator of p53abundance and p53-dependent apoptosis. Mdm2 expression isfrequently regulated by a p53 Mdm2 autoregulatory loopwhereby p53 stimulates Mdm2 expression and hence its owndegradation. Although extensively studied in cell lines, rela-tively little is known about Mdm2 expression in heart whereoxidative stress (exacerbated during ischemia-reperfusion) is animportant pro-apoptotic stimulus.We demonstrate thatMdm2transcript and protein expression are induced by oxidativestress (0.2 mM H2O2) in neonatal rat cardiac myocytes. In othercells, constitutiveMdm2 expression is regulated by the P1 pro-moter (5� to exon 1), with inducible expression regulated by theP2 promoter (in intron 1). In myocytes, H2O2 increasedMdm2expression from the P2 promoter, which contains two p53-re-sponse elements (REs), one AP-1 RE, and two Ets REs. H2O2 didnot detectably increase expression of p53mRNA or protein butdid increase expression of several AP-1 transcription factors.H2O2 increased binding of AP-1 proteins (c-Jun, JunB, JunD,c-Fos, FosB, and Fra-1) to anMdm2AP-1 oligodeoxynucleotideprobe, and chromatin immunoprecipitation assays showed itincreasedbindingof c-Junor JunB to theP2AP-1RE. Finally, anti-sense oligonucleotide-mediated reduction of H2O2-inducedMdm2 expression increased caspase 3 activation. Thus, increasedMdm2 expression is associatedwith transactivation at theP2AP-1RE (rather than the p53 or Ets REs), and Mdm2 induction poten-tially represents a cardioprotective response to oxidative stress.
Exposure of cardiac myocytes to sufficiently high levels ofreactive oxygen species (ROS)6 such as H2O2 leads to their
death (1–3), and this probably involves a continuum from apo-ptosis to necrosis, depending on the severity of the oxidativestress (4). In aerobic tissues such as the heart, themitochondriaprobably represent a significant source of ROS, and increasedROS production by these organelles during hypoxia and ische-mia-reperfusion injury may be particularly important in myo-cardial injury (5, 6). However, at lower concentrations, ROShave been reported to promote either growth of the cardiacmyocyte (7) or to induce “preconditioning” (8), either of whichpotentially increases the ability of the cardiac myocyte to sur-vive cytotoxic stresses. H2O2-induced oxidative stress simulta-neously stimulates a number of potentially pro-apoptotic andcytoprotective signaling pathways in the whole heart or cardiacmyocytes (9), and the final outcome (cell death or survival)could depend onwhich signaling pathway(s) predominates andendures.As shown by ourmicroarray studies, H2O2 can positively and
negatively regulate global gene expression in cardiac myocytes(3, 10). One gene consistently up-regulated by H2O2 in rat car-diac myocytes at toxic and nontoxic concentrations is theorthologue of transformed mouse 3T3 cell double minute 2(Mdm2) (3, 10), a proto-oncogene (11, 12), to which we willrefer as Rdm2.7 The human orthologue will be abbreviated asHDM2. The Mdm2 protein binds to the pro-apoptotic p53tumor suppressor transcription factor to inhibit its transacti-vating activity (13). Perhapsmore importantly,Mdm2 is a ubiq-uitin-protein isopeptide ligase that ubiquitinates p53 and otherproteins (13), thus promoting their proteasomal degradation.Indeed, the stability of p53 protein appears to be of majorimportance in controlling its abundance (13). In addition,Mdm2 may autoubiquitinate to promote its own degradation(14, 15).Regulation ofMdm2 expression is complex and involves two
alternative promoters. The P1 promoter lies 5� to exon 1 andthe P2 promoter lies within intron 1 (16). P1 primarily regulates
□S The on-line version of this article (available at http://www.jbc.org) containssupplemental Figs. 1–3 and an additional reference.
1 Supported by fellowships from the Sigrid Juselius Foundation, the FinnishFoundation for Cardiovascular Research, the Instrumentarium Founda-tion, the Aarne and Aili Turunen Foundation, the Maud Kuistila Founda-tion, and the Paavo Nurmi Foundation.
2 Held a United Kingdom Medical Research Council Studentship for Trainingin Research Methods.
3 British Heart Foundation Ph.D. student.4 Supported in part by the Fondation Leducq.5 To whom correspondence should be addressed: NHLI Division, Faculty of
Medicine, Imperial College London, Flowers Bldg. (4th Floor), ArmstrongRd., London SW7 2AZ, United Kingdom. Tel.: 44-20-7594-3410; Fax: 44-20-7594-3419; E-mail: [email protected].
6 The abbreviations used are: ROS, reactive oxygen species; 5�-RACE, 5�-rapidamplification of cDNA ends; ARE, AU-rich instability region; ChIP, chroma-tin immunoprecipitation; DTT, dithiothreitol; E64, trans-epoxy-succinyl-L-
7 Rdm2 and HDM2 refer specifically to rat and H. sapiens, respectively,whereas Mdm2 will refer specifically to the mouse or to the three ortho-logues generally.
constitutive expression of Mdm2 with P2 contributing to alesser extent. Inducible expression ofMdm2 is regulated by P2,which contains two p53-response elements, and through thesep53 itself regulates stress-induced expression ofMdm2 as partof a negative feedback loop (16). Transcripts from the P1 pro-moter may be translated more slowly than those from P2because of the presence of short (but differing) upstream openreading frames (two in each) in exon 1 of both HDM2 andMdm2 transcripts (17, 18). However, P2 contains additionalresponse elements (AP-1, Ets) that may allow induction ofMdm2 expression in a p53-independent manner (19–21). TheP1- and the P2-regulated transcripts can each give rise to twoidentical Mdm2 proteins with translation from the initiationcodon in exon 3 encoding an Mdm2 species that migrates atabout 90 kDa on SDS-PAGE. A truncated 76-kDa species canalso be expressed from a second in-frame initiation codon inexon 4 either following removal of exon 3 by alternative splicingor by internal ribosomal entry (22, 23). Expression of p76Mdm2 protein is more favored with transcription from P1 thanfromP2, without there being any change in absolute p90Mdm2protein expression (23). p76 Mdm2 cannot bind to p53 orinhibit its transactivating activity, and it may in fact inhibit theactions of p90Mdm2 (22). Here we characterize theRdm2 geneand the expression of Rdm2mRNA and protein in response toexposure to ROS (H2O2) in neonatal rat cardiac myocytes. Wedemonstrate that up-regulation of Rdm2 expression by ROS islargely independent of p53 but correlates instead with tran-scriptional activation at the AP-1-response element. Further-more, Rdm2 is cytoprotective against ROS-induced apoptosis(caspase 3 cleavage) in cardiac myocytes.
EXPERIMENTAL PROCEDURES
Materials—H2O2 was standardized volumetrically beforeuse. It was stable at 4 °C for at least 6 months. Antibodiesagainst Rdm2 (sc-965, a mouse monoclonal antibody raised toresidues 154–167 of HDM2 corresponding to residues 169–173 in Rdm2 (supplemental Fig. 1) in which region Rdm2 andHDM2 are identical in primary sequence), c-Jun (sc-45X, forsupershifting), JunB (sc-46X), JunD (sc-74X), phospho-Elk-1(Ser-383) (sc-7979X), Fli-1 (sc-356X), c-Fos (sc-52X), FosB(sc-48X), Fra-1 (sc-605X), Fra-2 (sc-171X), and ATF2(sc-187X) were from Santa Cruz Biotechnology, Inc. Antibod-ies against c-Jun (9162, used for immunoblotting) and 17-kDacaspase-3 (9661) were from Cell Signaling Technology. Sarco-meric �-actin antibodies (A2172) were from Sigma, and appro-priate horseradish peroxidase-linked secondary antibodieswere from DAKO.Six Santa Cruz Biotechnology, Inc., anti-p53 antibodies were
tested. Thesewere 2B2.71 (sc-71819, amousemonoclonal anti-body IgG2b raised against residues 370–378 of human p53),DO-1 (sc-126, a mouse monoclonal antibody IgG2a raisedagainst residues 11–25 of human p53), FL-393 (sc-6243, a rab-bit polyclonal antibody IgG raised against full-length humanp53), Pab 240 (sc-99, a mousemonoclonal antibody IgG1 raisedagainst residues 156–214 of mammalian p53), Pab 246 (sc-100,a mouse monoclonal antibody IgG1 raised against residues88–93 ofmouse p53), andR-19 (sc-1313, a goat polyclonal anti-body IgG raised against an epitope mapping to the C terminus
of rat p53). With the exception of DO-1, which is not explicitlyspecified by the supplier as being able to recognize rat p53, allother antibodies are supposed to recognize rat p53 on immu-noblotting. As negative and positive controls, we used lysatesfrom nontransfected 293T cells (sc-117752) and from 293Tcells transfected with mouse p53 (sc-125766), respectively, andextracts of daunorubicin-treated cardiac myocytes.The p53 electrophoretic mobility shift assay (EMSA) oli-
godeoxynucleotide probe was from Santa Cruz Biotechnology,Inc. (sc-2579). Other probes were synthesized by Sigma Geno-sys (Sigma). Phosphorothioate-protected ODNs and standardoligonucleotides were fromMWG Biotec. Lipofectin was fromInvitrogen. SMART RACE cDNA amplification kits were fromClontech.Primary Culture of Neonatal Rat Cardiac Myocytes—Myo-
cytes (yield of 3.5–4.5 million cells/heart) were dissociatedfrom the ventricles of 1–3-day-old Sprague-Dawley rat heartsby an adaptation of the method of Iwaki et al. (24) as describedpreviously (25). Unless stated otherwise, cells were plated ingelatin-coated Primaria culture dishes (BD Biosciences) at adensity of 2 � 106 cells/35-mm dish or 4 � 106 cells/60-mmdish for 18 h in 15% (v/v) fetal calf serum. For most experi-ments, serum was withdrawn for the 24 h before experimenta-tion, and the cells were used 2 days after their isolation.Extraction of RNA, cDNA Synthesis, and Semiquantitative or
Quantitative PCR (RT-sqPCR or RT-qPCR)—RNA (for whichquantity and purity were assessed from the A260 and the A260/A280 ratio (1.8–2.0 deemed acceptable)) was isolated from car-diac myocytes with RNA-Bee (GEHealthcare) according to themanufacturer’s instructions; cDNA was synthesized with ran-dom hexamers, and RT-sqPCR (see Table 1 for details of prim-ers) measurements were performed as described in detail pre-viously (3, 10). To ensure that there was no amplification ofgenomicDNA, primerswere designed to cross exonboundarieswhere possible (Table 1), and controls in which the RT step wasomitted were carried out. The resulting RT-sqPCR productswere analyzed by ethidium bromide-agarose gel electrophore-sis and the bandswere captured underUV illumination. Sizes ofPCR products were estimated by comparison with a �X174 RFDNA HaeIII digest DNA ladder or a 100-bp DNA ladder(Invitrogen). Densitometric analysis was performed usingImageMaster 1D Prime, version 3.0 (GE Healthcare). Valueswere normalized to the housekeeping gene Gapd. PCR cyclesused (Table 1) were within the exponential phase of amplifi-cation (confirmed by construction of amplification curvesfrom PCR over a range of cycle numbers). Sequences of PCRamplicons were determined using an ABI 3100 genetic ana-lyzer by the Advanced Biotechnology Centre (Imperial Col-lege London).For RT-qPCR, cDNA was prepared from 1 �g of RNA using
high capacity reverse transcription kits (Applied Biosystems).Primers for qPCR were designed with Primer Express version3.0 using deduced Rdm2 sequences (supplemental Fig. 2; Table1). qPCR was performed using a 7500 real time PCR system(Applied Biosystems). A master mix containing (per reaction)12.5 �l of Sybr-Green Jump Start Taq Readymix (Sigma) and 5�l of oligonucleotides (200 mM forward and reverse primers)was dispensed into Optical 96-well reaction plates (Applied
Mdm2 Induction by H2O2 in Cardiac Myocytes
27196 JOURNAL OF BIOLOGICAL CHEMISTRY VOLUME 284 • NUMBER 40 • OCTOBER 2, 2009
Biosystems), and cDNA template was added (7.5 �l, 1:15 dilu-tion in water). PCR conditions for all primer pairs were 50 °Cfor 2 min, 95 °C for 10 min, followed by 40 cycles of 95 °C for15 s and 60 °C for 60 s. Following qPCR, dissociation curveanalysis was performed to check for aberrant amplificationproducts. An absolute quantification protocol was used. Valueswere normalized to Gapd expression.5�-RACE—Poly(A)� RNA was purified from total RNA (150
�g) using oligo(dT)-cellulose (Sigma). Briefly, total RNA (in600 �l of deionized water) was incubated for 5 min at 65 °Cfollowed by addition of 1 volume of 2� binding buffer (20 mM
Tris-HCl, pH 7.5, 1 M NaCl, 2 mM EDTA, 0.1% (w/v) SDS)).Oligo(dT)-cellulose (5 mg in 100 �l of binding buffer) wasadded followed by rotation at room temperature for 15 min.The oligo(dT)-cellulose was washed twice with binding buffer(1 ml) and twice with washing buffer (10 mM Tris-HCl, pH 7.5,0.2 M NaCl, 1 mM EDTA, 0.05% (w/v) SDS). Poly(A)� RNAwasrecovered in 250 �l of elution buffer (10 mM Tris-HCl, pH 7.5,1 mM EDTA, 0.05% (w/v) SDS; two incubations of 5 min at37 °C). The purification procedure was repeated, and poly(A)�RNA was precipitated with 50 �l of 4 M NaCl and 2 volumes ofethanol followed by centrifugation (12,000 � g, 15 min, 4 °C).After washing with 70% (v/v) ethanol and centrifugation,poly(A)� RNA was dissolved in deionized water (8 �l).
Poly(A)� RNA was reverse-transcribed using a SMART RACEcDNAamplification kit (Clontech). Poly(A)�RNA (0.9�g) wasmixedwith oligo(dT) primer (10mM5�-CDS primerA, 1�l), 10mMSMART IIA oligonucleotide (10mM, 1�l) in a total volumeof 5 �l. This was heated at 72 °C for 2 min and cooled on ice.Subsequently, 5� reaction buffer (2 �l; 250 mM Tris-HCl, pH8.3, 30 mM MgCl2, 375 mM KCl), 10 mM dNTP (1 �l), 20 mM
DTT (1 �l), and PowerScriptTM reverse transcriptase (1 �l)were added, and themixture was incubated at 42 °C for 90min.Reverse transcriptase was inactivated at 72 °C for 7 min. The5�-RACE cDNA reaction mixture (10 �l) was diluted to 250 �lwith 10 mM Tricine, pH 8.5, 1 mM EDTA and stored at �80 °C.Sequence corresponding to 5�-end of Rdm2mRNAwas ampli-fied using the SMARTRACE cDNA amplification kit UniversalPrimer A Mix (complementary for the extended 5�-end of the5�-RACE cDNA) and a reverse primer to mRNA in exon 3 ofRdm2 exon 3 (bases 269–302, see Table 1). For each PCR,5�-RACE cDNA (2.5 �l) was combined with 10�“Advantage”polymerase buffer (10 �l; 40 mM Tricine/KOH, pH 9.2, 15 mM
KOAc, 3.5 mM Mg(OAc)2), 5�-RACE 1 primer (1 �l, 10 �M),10�Universal PrimerAMix (5�l), dNTP (10mM), andAdvan-tage 2 polymerase buffer (1 �l). The PCR program was as fol-lows: 94 °C for 5 min; 5 cycles of 94 °C for 30 s and 72 °C for 2min; 5 cycles of 94 °C for 30 s, 70 °C for 30 s, and 72 °C for 2min;
TABLE 1Details of RT-sqPCR/qPCR primers usedFor the Rdm2 transcript, the numbering used refers to the deduced sequence shown in supplemental Fig. 2. For Rdm2, primers for Rdm2(A) were used for sqPCR analysisof general Rdm2 expression; primers for Rdm2(B) were used for qPCR analysis of general Rdm2 expression; primers for Rdm2(C) and Rdm2(D) were used to investigateP1/P2 promoter usage (sqPCR); primers forRdm2(E)were used for 5�-RACE (sqPCR); and primers forRdm2(F)were used forChIP analysis (sqPCR). The sequence ofRdm2intron 1, in which the primers used for chromatin immunoprecipitation lie, is shown in Fig. 1. The predicted rat FosB transcript sequence (NM_001013146.1) is truncatedat its 3�-end. The rat FosB gene is located on chromosome 1 at 78668523..78673784 (RGSC genome assembly version 3.4). The RT-sqPCR product corresponds to78667636..78667773, sequence: ACCCCTGTGCAGTATTATGCCATGTCCCTCTCACCCCCACGGGCAACCCAGGCGCCCTTGGCCGTCCTCGTTGGGCCTT-TCTGGTTTTGGGCAGCAGGGGGCGCTGCGACGCCCGTCTTGCTGGAGCGCTTTATACTG (primers underlined and boldface). In contrast, the mouse FosBmRNA sequence (NM_008036.2) is more extended and contains the PCR sequence described. The PCR sequence identifies two rat ESTs (C06882.1 and CB747983.1) andthese lie 3� to the predicted ratFosB transcript. In addition, the two rat ESTs correspond to the 3�-untranslated region of themouseFosBmRNA.NA indicates not applicable.
Mdm2 Induction by H2O2 in Cardiac Myocytes
OCTOBER 2, 2009 • VOLUME 284 • NUMBER 40 JOURNAL OF BIOLOGICAL CHEMISTRY 27197
then 25 cycles of 94 °C for 30 s, 68 °C for 30 s, and 72 °C for 2min), and finally 72 °C for 4 min. PCR products were analyzedon ethidium bromide-stained 2% agarose gels and the bandswere captured under UV illumination. Products were excisedfrom the gel and thenpurified usingQIAquick PCRpurificationcolumns for automated sequencing (Advanced BiotechnologyCentre, Imperial College London).Soluble and Nuclear Protein Extraction—For immunoblot-
ting, myocytes were washed in ice-cold PBS (three times) andscraped into 100 �l (35-mm dishes) or (in the case of 60-mmdishes) into 80 �l (antisense experiments) or 150 �l (remainingexperiments) of ice-cold buffer A (20 mM �-glycerophosphatepH 7.5, 20 mM NaF, 2 mM EDTA, 0.2 mM Na3VO4, 10 mM
benzamidine, 5 mM DTT, 1 mM PMSF, 0.2 mM leupeptin, 2 �M
microcystin LR, 10 �M E64, 1% (v/v) Triton X-100). After cen-trifugation (10,000 � g, 5 min, 4 °C), supernatant protein con-centrations were determined using the Bradford method (26),boiled with 0.33 volume of SDS electrophoresis buffer (300 mM
DTT, 0.2% (w/v) bromphenol blue), and stored at �20 °C.For crude nuclear extracts, PBS-washed myocytes were
scraped into 150 �l of ice-cold buffer B (10 mMHEPES, pH 7.9,10 mM KCl, 1.5 mM MgCl2, 0.3 mM Na3VO4, 0.2 mM leupeptin,10 �M E64, 5 mM DTT, 0.3 mM PMSF, 2 �M microcystin LR).Extracts were centrifuged (10,000 � g, 5 min, 4 °C), and thepellets resuspended in 100 �l of Buffer B containing 0.1% (v/v)Nonidet P-40. Samples were centrifuged (10,000 � g, 5 min,4 °C), and the pellets were resuspended in 50 �l of ice-coldbuffer C (20 mM HEPES, pH 7.9, 420 mM NaCl, 1.5 mM MgCl2,0.2 mM EDTA, 25% (v/v) glycerol, 0.3 mM Na3VO4, 0.2 mM
leupeptin, 10 �M E64, 5 mM DTT, 0.3 mM PMSF, 2 �M micro-cystin LR). Suspensionswere incubated on ice (1 h) withmixingevery 15 min and then centrifuged (10,000 � g, 5 min, 4 °C).Supernatantswere retained and stored at�80 °Corwere boiledwith SDS electrophoresis buffer.Immunoblotting—Proteins were separated by SDS-PAGE
using between 8 and 12% (w/v) resolving gels as appropriatewith 4–6% (w/v) stacking gels and transferred to nitrocellulosemembranes as described previously (27). Gels were standard-ized using “rainbow” markers (GE Healthcare). Nonspecificbinding sites were blocked (60min, room temperature) with 5%(w/v) nonfat milk powder in TBST (20 mM Tris-HCl, pH 7.5,137mMNaCl, 0.1% (v/v) Tween 20). Blots were incubated over-night with primary antibodies diluted in TBST containing 5%(w/v) bovine serum albumin. Membranes were washed inTBST (three times for 5min, room temperature) and incubated
(1 h, room temperature) with horseradish peroxidase-conju-gated secondary antibodies in TBST containing 1% (w/v) non-fat milk powder. After washing in TBST (three times for 5 min,room temperature), bands were detected by the enhancedchemiluminescence method (reagents from Santa Cruz Bio-technology, Inc.). In some cases the sensitivity of detection wasincreased by using unconjugated secondary antibodies inTBST, 1% (w/v) nonfat milk powder, and after washing withTSBT, blots were incubated with horseradish peroxidase-con-jugated tertiary antibodies before detection by enhancedchemiluminescence.Antisense ODN Transfection—The 20-mer antisense phos-
phothioate-protected ODN, 5�-TGACATCTGCTCTCACTC-GG-3�, was directed against Rdm2 mRNA exon 7, bases 602–621 (supplemental Fig. 2). A mixed backboneHDM2 antisenseODN (5�-UGACACCTGTTCTCACUCAC-3�) against thecorresponding region (HDM2 mRNA bases 660–679, acces-sion numberNM_002392.2) has been used previously to inhibitHDM2 expression in colon cancer cells (28). A randomsequence (5�-TGGATCCGACATGTCAGA-3�) was used as acontrol. For transfection experiments, cells in 60-mm disheswere washed three times with antibiotic-free Dulbecco’s mod-ified Eagle’s medium before exposure to Dulbecco’s modifiedEagle’s medium containing 200 nM ODN and 20 �g/ml Lipo-fectin (Invitrogen). Myocytes were incubated for 24 h at 37 °Cand then the medium was then replaced with Lipofectin-freemaintenancemedium containing 200 nMODN. Cells were pre-incubated for 1 h before exposure to 0.2 mM H2O2 for 6 h andextracted into 80 �l of buffer A (see above).EMSAs—Double-stranded ODN EMSA probes (see Table 2)
were prepared essentially as described previously (29). Briefly,ODNs were 5�-labeled with 15 �Ci of [�-32P]ATP (GE Health-care), 10 IU of T4 polynucleotide kinase (Promega) (12 �l finalvolume), and 1.2 �l of Promega 10� polynucleotide kinasebuffer. The reactionmixturewas incubated (37 °C, 30min), andthe reaction was then terminated by addition of 1 �l of EDTA(0.25 M). Excess [�-32P]ATP was removed by centrifugation(700 � g, 3 min, room temperature) through Chroma Spin col-umns (pore size 10) (Clontech) in 1� TE buffer (10 mM Tris-HCl, pH 8.0, 1 mM EDTA), and the EMSA probes were dilutedto 0.4 ng/�l. Crude nuclear extracts (10 �g) were incubated (10min, room temperature) with 4 �l of binding buffer (50 mM
Tris-HCl, pH 7.5, 250 mM NaCl, 5 mM EDTA, 1 mM DTT, 25%(v/v) glycerol) and 1 �g of poly(dI-dC) (GE Healthcare) in atotal volume of 20 �l. Radiolabeled EMSA probe (1 �l, 0.4 ng)was added, and the mixture was incubated (20 min, room tem-
TABLE 2Sequences of EMSA probesSee Fig. 1 for details of position in the Rdm2 gene and its intron 1. For p53 EMSAs, a consensus p53 probe was used. NA indicates not applicable.
Mdm2 Induction by H2O2 in Cardiac Myocytes
27198 JOURNAL OF BIOLOGICAL CHEMISTRY VOLUME 284 • NUMBER 40 • OCTOBER 2, 2009
perature). Samples were subjected to electrophoresis (120 V,3 h) on 5% (w/v) nondenaturing polyacrylamide gels formed in1� TBE buffer (89 mMTris, 89 mM boric acid, 2 mM EDTA, pH8.3) with 0.5� TBE as running buffer. Gels were dried ontoWhatman 3MMpaper and exposed to x-ray film for 24–48 h at�80 °C. Images were analyzed semi-quantitatively by densi-tometry (ImageMaster 1D Prime, version 3.0, GE Healthcare).For competition experiments, crude nuclear extracts wereincubated (10 min) with the required amount of unlabeledcompeting probe in binding buffer with poly(dI-dC) as in thestandard assay, followed by addition of the radiolabeled wildtype probe and continuation of the assay in the standard man-ner. For supershift assays, crude nuclear extracts (3 �g protein)were preincubated (1 h, 4 °C) with 1–2 �g of antibody.ChIP Assays—Myocytes were exposed to H2O2 (0.2 mM, 2 h),
and formaldehyde (final concentration of 1% (w/v)) was addedtomedium (10min, room temperature). Cross-linking was ter-minated with 0.125 M glycine (5 min). Myocytes were rinsedtwice in ice-coldPBSandscraped into200�l ofPBScontaining0.2mM leupeptin, 10 �M E64, 5 mM DTT, 1 mM PMSF, and 2 �M
microcystin LR. Suspensions were centrifuged (4000 � g, 10 min,4 °C) and pellets resuspended in 0.8ml of ChIP lysis buffer (50mM
DTT, 0.3 mM PMSF, 2 �M microcystin LR, 0.5% (v/v) NonidetP-40). Suspensionswere incubatedon ice (10min)andcentrifuged(4000� g, 10min, 4 °C), and thepelletswere resuspended in0.8mlof sonication buffer (50 mM Tris-HCl, pH 8.0, 10 mM EDTA, 1%(v/v) SDS, 0.2mM leupeptin, 10�M E64, 5mMDTT, 1mM PMSF,and 2 �Mmicrocystin LR). Samples were sonicated (five times for30 s, 0 °C, amplitude 30% (Sonics Vibra-CellTM sonicator with a2-mm probe) followed after each sonication by 2 min of recovery
in ice-water) to shear DNA into fragments of 200–800 bp. Soni-cated samples were centrifuged (4000 � g, 10 min, 4 °C), and thesupernatants were retained. Samples (20 �l) for total DNA inputwere taken at this stage. Sonicated extracts (750 �l) were dilutedwith 3.65 ml of ChIP buffer (20 mM Tris-HCl, pH 8.0, 150 mM
NaCl, 2 mM EDTA, 0.01% (w/v) SDS, 1% (v/v) Triton X-100) andwerepreclearedwith30�l of 50%proteinA-Sepharose slurrycon-taining 5�g/ml sonicated salmon spermDNA(rotation at 4 °C for30min). Following centrifugation (200� g, 1min, 4 °C), anti-tran-scription factor antibodies (5 �g) were added followed by incuba-tion (4 °C, 16 h, withmixing by rotation). Antibody-protein-DNAcomplexeswere recoveredby incubation (1h, 4 °C,withmixingbyrotation)with 50%proteinA-Sepharose slurry (80�l containing 5�g/ml sonicated salmon spermDNA). ProteinA-Sepharose-anti-body-transcription factor complexes were recovered by centrifu-gation (200 � g, 1 min, 4 °C), and pellets were washed in low saltbuffer (20mMTris-HCl, pH 8.0, 150mMNaCl, 2mMEDTA, 0.1%(w/v) SDS, 1% (v/v) Triton X-100, 1 ml), high salt buffer (20 mM
Tris-HCl, pH 8.0, 500mMNaCl, 2mMEDTA, 0.1% (w/v) SDS, 1%(v/v)TritonX-100, 1ml), andLiClbuffer (10mMTris-HCl, pH8.0,250 mM LiCl, 1 mM EDTA, 1% (w/v) deoxycholic acid, 1% (v/v)Nonidet P-40) and then twice in 10 mM Tris-HCl, pH 8.0, 1 mM
EDTA.Protein-DNAcomplexeswererecoveredby incubation(15min, 65 °C) with 0.1 MNaHCO3, 1% (w/v) SDS (250 �l), and sam-ples were centrifuged (200 � g, 1 min, 4 °C) and supernatantsretained. This elution step was repeated, and supernatants werecombined. Cross-linking was reversed by incubation (16 h, 65 °C)with 0.2 M NaCl. DNA was extracted by mixing equal volumes ofsamples with phenol/chloroform/isoamyl alcohol (25:24:1, pH8.0) andwith separation of the phases by centrifugation (15,000�g, 10min, 4 °C). The upper aqueous phases were retained, and
FIGURE 1. Deduced structure of the 5� region of the Rdm2 gene. Further details are provided under “Results.” The complete deduced sequence of matureRdm2 mRNA is shown in supplemental Fig. 2. The numbering refers to the positions of the nucleotides in the gene sequence. The positions of the primers usedto determine P1/P2 promoter usage in exons 1, 2 (forward primers F1 and F2, respectively), and in exon 4 are indicated, as are the two alternative translationalinitiation codons (ATG(1) for p90 Rdm2 and ATG(2) for p76 Rdm2). The consensus sequences for the transcription factor response elements are as follows:MZF-1, AGTGGGGA or the more extended CGGGNGAGGGGGAA (36); Ets, C(A/C)GGA(A/T)G(C/T) (34); AP-1, TGA(C/G)TCA (33); NF-E2, (C/T)TGCTGA(C/G)T-CA(C/T) (35); p53, two (A/G)(A/G)(A/G)C(A/T)(A/T)G(C/T)(C/T)(C/T) elements separated by 0 –13 nucleotides (31). The positions of the response elements andthe 5� to 3� directions applicable are marked by arrows. The positions of the primers used in the chromatin immunoprecipitation studies of the AP-1 responseelement are indicated by underlying asterisks (see also Table 1).
Mdm2 Induction by H2O2 in Cardiac Myocytes
OCTOBER 2, 2009 • VOLUME 284 • NUMBER 40 JOURNAL OF BIOLOGICAL CHEMISTRY 27199
DNA was precipitated by adding 1 volume of isopropyl alco-hol for 1 h on ice. Following recovery of DNA by centrifuga-tion (21,000 � g, 10 min, 4 °C), DNA was washed (70% (v/v)ethanol) and resuspended in 20 �l of Milli-Q water for sub-sequent PCR. PCRs were performed in 1� Buffer IV� (ABGene, 25 �l) containing Taq polymerase (1 unit), dATP,dCTP, dGTP, and dTTP (0.2 mM each) and 50 pmol of prim-ers. PCR settings were as follows: 94 °C for 4 min; 35 cycles of(94 °C for 30 s; 59 °C for 30 s; 72 °C for 30 s), followed by72 °C for 4 min. The resulting RT-PCR products were ana-lyzed by ethidium bromide-agarose gel electrophoresis, andthe bands were captured under UV illumination.
Statistical Analysis—Results are expressed as means � S.E.Statistical significancewas determined by either Student’s t testor one-way analysis of variance (ANOVA) followed by Tukey’smultiple comparison test, as appropriate. p values of �0.05were considered significant.
RESULTS
Structure of the Rdm2 Gene—Mdm2 (NP_034916.1, 489 res-idues) and HDM2 (NP_002383.2, 497 residues) are encoded byestablished genes and are highly conserved, sharing preciseidentity in about 80% of residues (supplemental Fig. 1). In con-trast, Rdm2 is a predicted gene on chromosome 7(q22) in the
FIGURE 2. Expression of Rdm2 transcripts and protein in cardiac myocytes exposed to H2O2. RNA or protein was extracted, and Rdm2 mRNA or proteinabundances were determined by RT-sqPCR, RT-qPCR, or immunoblotting as described under “Experimental Procedures.” A–C, myocytes were exposed to 0.2mM (A and B) or 1 mM H2O2 (C) for the times indicated and Rdm2 transcripts measured by RT-sqPCR (A) or RT-qPCR (B and C). D and E, dependence of Rdm2 mRNAexpression at 2 h (D, RT-sqPCR; E, RT-qPCR) or 1 h (E, RT-qPCR) on H2O2 concentration. No RT, as a control for genomic contamination, the RT step was omitted.F and G, Rdm2 protein abundances were determined by immunoblotting of whole cells extracts at the times indicated. Primary antibody dilutions were bothat 1:750. Representative primary data are shown, and the quantified results are expressed as means � S.E. for at least three independent observations onseparate preparations of myocytes.
Mdm2 Induction by H2O2 in Cardiac Myocytes
27200 JOURNAL OF BIOLOGICAL CHEMISTRY VOLUME 284 • NUMBER 40 • OCTOBER 2, 2009
NCBI data base (www.ncbi.nlm.nih.gov) whose provisionalprocessed transcript NM_001108099.1 (December 21, 2008)encodes a protein that differs significantly from Mdm2 andHDM2. A BLAST search of the mouse Mdm2 transcriptNM_010786.3 against the rat genome identified a 24,233-bpsequence on the minus strand of contig NW_047774 corre-sponding to a 2930-nucleotide transcript from 12 exons withhigh homology to the Mdm2 transcript (supplemental Fig.2). The deduced 2930-nucleotide sequence of the full-length
transcript is identical to the 2855-nucleotide NM_001108099.1 exceptthat it contains an extra exon,the 75-nucleotide (protein-cod-ing) exon 4. A BLAST search ofthis exon revealed 14 rat ESTs witha region of precise sequence iden-tity within them, thus establishingthat exon 4 is transcribed and ispresent in mature Rdm2 mRNA.The structural relationship of thefirst four exons in Rdm2 is shown inFig. 1. The initiation codon for p90-Rdm2 lies in exon 3 and that forp76-Rdm2 lies in-frame in exon 4(Fig. 1). Two short and overlappingupstream open reading frames arepresent in exon 1 of the deducedRdm2mRNA sequence (supplemen-tal Fig. 2). The HDM2 and Mdm2transcripts also each contain two (dif-fering) upstreamopen reading frames(17, 18). The deduced amino acidsequence of Rdm2 and the Mdm2sequence are �90% identical, al-though Mdm2 possesses a moreextended Ser-rich region at residues203–211 (supplemental Fig. 1).Expression of Rdm2 mRNA and
Protein in Response to H2O2—Weexamined the effects of H2O2 onRdm2 expression by RT-sqPCR andRT-qPCR. Up-regulation of Rdm2mRNA was rapid, being detectableat 1 h (Fig. 2, A–C), maximal at 2 h,and maintained for at least 6–24 h.The absolute extent of maximal up-regulation depended on the tech-nique used with sqPCR giving 3–4-fold (Fig. 2A) but with qPCR giving20–30-fold (Fig. 2, B and C). Thisprobably reflects differences inprimer design and the semi-quanti-tative nature of densitometric anal-ysis. At 1 h, Rdm2 mRNA wasdetectably induced with 0.1 mM
H2O2 and maximally induced with0.2–0.3 mM H2O2 (Fig. 2, D and E).At higher concentrations of H2O2,
Rdm2mRNA abundances remained at control values (Fig. 2,Dand E). At 2 h of exposure, the maximal response was greaterand was shifted to higher H2O2 concentrations (Fig. 2E). These“bell-shaped” concentration dependences are typical of a num-ber of responses of the cardiac myocyte to H2O2. The stimula-tion ofRdm2 expression byH2O2 at 1 hwas prevented by cyclo-heximide (Fig. 3, A and B), indicating that Rdm2 is not animmediate early gene (i.e. the stimulation of its transcription byH2O2 is dependent on preceding de novo protein synthesis).
FIGURE 3. Rdm2 is not an immediate early gene nor is Rdm2 mRNA stabilized by H2O2. A and B, cardiacmyocytes were pretreated with cycloheximide (CHX, 20 �M) for 30 min and then exposed additionally to 0.2 mM
H2O2 for 2 h (A, RT-sqPCR) or 1 h (B, RT-qPCR). C, H2O2 (0.2 mM) exposure does not affect Rdm2 transcriptstability. Myocytes were exposed (F) or not exposed (Œ) to 0.2 mM H2O2 for 2 h and then to 4 �M actinomycinD for the times indicated, followed by RT-sqPCR. No RT, as a control for genomic contamination, the RT step wasomitted. Results were fitted to monophasic exponential decay curves. Representative primary data are shown,and the quantified results are expressed as means � S.E. for 3– 4 independent observations on separatepreparations of myocytes. Statistical significance was as follows: *, p � 0.001 by one-way ANOVA with Tukey’smultiple comparison test.
Mdm2 Induction by H2O2 in Cardiac Myocytes
OCTOBER 2, 2009 • VOLUME 284 • NUMBER 40 JOURNAL OF BIOLOGICAL CHEMISTRY 27201
BecauseH2O2 can inhibit overall protein synthesis in cardiacmyocytes (3), we investigatedwhether the increased abundanceof Rdm2 transcripts was reflected in their translation into pro-tein (Fig. 2, F and G). Rdm2 migrated at about 90 kDa on SDS-PAGE, and protein abundance increased about 5-fold over 45min to 1.5 h (Fig. 2F). In some blots, multiple bands wereobserved (Fig. 2, F andG). Although one of thesemay representp76-Rdm2, theymay be degradation products or cross-reactingspecies. Abundance of Rdm2 protein wasmaximal at 1–2 h anddeclined gradually thereafter (Fig. 2G) but remained elevatedover control values (about 2–3-fold greater) for up to 8 h.Abundance of any individual mRNA species is regulated by the
rate of its transcription and the rate of its degradation. The 3�-un-translated region of Rdm2mRNA contains an AU-rich instabilityelement (probably a class I ARE consisting of overlapping or adja-centAUUUApentamers (30), bases 2072–2085, see supplementalmaterial Fig. 2), which is orthologous with a putative Mdm2mRNA ARE (see the Organism ARED (23, 30), although theMdm2 ARE may be nonfunctional (23). We therefore examinedthe half-life of Rdm2 transcripts when transcription was inhibited(by actinomycin D) in the absence or presence of 0.2 mM H2O2(Fig. 3C). The data sets (n� 4 for each condition)were treated asmonophasic exponential decays. Rdm2mRNAwas degradedwith a half-life of 1.16 h (k � 0.596 � 0.140 h�1) in theabsence of H2O2, whereas it was 1.82 h (k � 0.381 � 0.141h�1) in the presence of H2O2. There was thus no significantdifference in the stability of the transcripts under the twoconditions, and thus up-regulation of Rdm2 expressionresults primarily from increased transcription.Alternative Promoter Usage in Rdm2 Transcription—Tran-
scription ofMdm2 andHDM2 is regulated by two alternative pro-moters, P1 or P2, lying 5� to exon 1 or exon 2, respectively (16). Toassess alternative promoter usage for Rdm2, we used forwardprimers in exon 1 (F1) or in exon 2 (F2) and a reverse primer inexon 4 (Fig. 1 and supplemental Fig. 2) to produce amplicons of333 bp fromP1 (longmRNA) or 220 bp fromeither P1 or P2 (long� short mRNAs). In unstimulated cardiac myocytes, mRNA wasdetectable at 333 bp (Fig. 4A) using primer F1, and this wouldcontribute to the 220-bp band seen with primer F2 to an inacces-sible extent. Following exposure to H2O2 (0.2 mM for 2 h), therewere no changes in the amplicon abundances using primer F1, butprimer F2 amplicon abundances increased about 4–5-fold. Thesequences of the 220- and 333-bp PCR products were con-firmed, indicating that H2O2-inducible transcription wasregulated by the P2 promoter.To confirm increased P2 promoter usage, we conducted
5�-RACE. The theoretical lengths of the amplicons were 332 bpfor a transcript expressed from the P1 promoter and 162 bp fora transcript expressed from the P2 promoter (Fig. 1 and supple-mental Fig. 2). Under control conditions, the major product(amplicon A) was 300–400 bp in length with a weaker band(amplicon B) at 100–200 bp (Fig. 4B). Following exposure toH2O2 (0.2 mM, 2 h), the product corresponded essentially com-pletely to the shorter amplicon B. DNA sequencing confirmedthat amplicon A corresponded to exons 1–3 (up to thereverse primer site), whereas amplicon B corresponded toexons 2 and 3. These results confirm that transcripts origi-nate from P1 with some expression from P2 in the control,
whereas promoter usage shifts primarily to P2 followingexposure to H2O2.Transcription Factor Response Elements in Intron 1 of the
Rdm2 Gene—We identified potential regulatory elements inRdm2 intron 1 by analogy with published data for intron 1 oftheMdm2 andHDM2 genes and by using TFSEARCH. Start-ing the number of intron 1 from its 5�-end, a region in intron1 of theMdm2 (residues 402–523), Rdm2 (residues 374–494),
FIGURE 4. Promoter usage for Rdm2 expression. A, cardiac myocytes wereexposed to or not treated with 0.2 mM H2O2 for 2 h. RNA was extracted, andRT-sqPCR was used with a reverse primer in exon 4 and forward primers lyingin exon 1 (primer F1) to assess P1 promoter usage (long product, 333 bp) orexon 2 (primer F2) to assess combined P1 and P2 promoter usage (short prod-uct, 220 bp) (Fig. 1 and Table 1). Representative primary data are shown, andthe quantified results are expressed as means � S.E. for six independentobservations on separate preparations of myocytes. Statistical significanceversus control: *, p � 0.01 by one-way ANOVA with Tukey’s multiple compar-ison test. B, 5�-RACE for Rdm2 transcripts in myocytes exposed or not exposedto 0.2 mM H2O2 for 2 h. The theoretical lengths of amplicon A (from P1 pro-moter use) and amplicon B (from P2 promoter use) are 332 and 162 bp,respectively.
Mdm2 Induction by H2O2 in Cardiac Myocytes
27202 JOURNAL OF BIOLOGICAL CHEMISTRY VOLUME 284 • NUMBER 40 • OCTOBER 2, 2009
and HDM2 genes (residues 406–524) is highly conserved with�75% identity (supplemental Fig. 3). This contains the twop53-response elements (31, 32) and a composite AP-1-Ets ele-ment (Ets(AP-1)) (33, 34). An upstream Ets (Ets(upstream)) ele-ment in Rdm2 and Mdm2 lies outside the conserved region(supplemental Fig. 3 and Fig. 1). High stringency searching alsoreveals an NF-E2-like site (35) in Rdm2 that overlaps with theAP-1 site and is conserved between Mdm2 and HDM2. Rdm2and Mdm2 also contain a sequence reminiscent of an MZF-1element (36) that is not conserved in HDM2, although HDM2contains an alternativeMZF-1 site (supplemental Fig. 3). How-ever, neither NF-E2 nor MZF-1 are thought to be significantlyexpressed outside hematopoietic cells (35, 37), and they werenot studied further.p53—Induction of p53 is frequently a response tomutational
or cytotoxic interventions and is of established importance inthe regulation of inducible expression ofMdm2 (16).We exam-ined whether p53 mRNA expression increased in response toH2O2. Although an amplicon of the appropriate size for p53was detectable by RT-sqPCR, exposure of myocytes to 0.2 mM
H2O2 for up to 24 h did not alter its expression (results notshown).The matter of whether p53 protein in induced by ROS is
contentious, anddoubts have been raised about the reliability ofantibodies obtained from Santa Cruz Biotechnology, Inc. (see
under “Discussion”). We character-ized six different antibodies usinglysates of 293T cells with (positivecontrol) or without (negative con-trol) transfection with mouse p53(Fig. 5). Three of these reliablydetected p53 by immunoblotting inour hands (FL-393 (Fig. 5A), Pab240 (Fig. 5B) and 2B2.71 (Fig. 5C)).In all cases, p53 migrated slightlymore rapidly than a 52-kDa marker(RPN800E, GE Healthcare). WithFL-393 (Fig. 5A) and 2B2.71 (Fig.5C), cross-reacting proteins weredetectable in whole cell extracts of293T cells, one of which migratedslightly more slowly than p53 at�52 kDa.We confirmed that p53 incrude nuclear extracts of rat cardiacmyocytes, which had been exposedto the anthracycline daunorubicin(anthracyclines induce p53 in thesecells (38)), co-migrated withmurinep53 in the positive-control 293Tcells (Fig. 5D).Following exposure of cardiac
myocytes to 0.2 mM H2O2, Rdm2transcript abundances reach theirmaximum levels in crude nuclearextracts after about 2 h (Fig. 2,A–C). If de novo induction of tran-scription factor proteins is a prereq-uisite for this event, it should occur
within this period. We assessed whether p53 protein wasinduced over a period of up to 8 h in crude nuclear extracts ofcardiac myocytes exposed to 0.2 mM H2O2 using antibodiesFL-393 (Fig. 6A), 2B2.71 (Fig. 6,B andC), and Pab 240 (Fig. 6D).We also assessed whether increasing the H2O2 concentrationto 0.5 mM had any additional effect (Fig. 6C). In all cases, apositive control for p53 protein induction was included usingcrude nuclear extracts of cardiac myocytes exposed to 0.5 �M
daunorubicin for 6.5–7.5 h. In no instance could we detectinduction of p53 by H2O2 (Fig. 6, A–D), although p53 proteinwas reliably detected following treatment with daunorubicin(0.5 �M for 6.5–7.5 h).
To confirm the immunoblotting results (Fig. 6, A–D), weassessed whether any p53 DNA binding activity could bedetected in crudenuclear extracts ofmyocytes exposed toH2O2using EMSAs. Although daunorubicin increased protein bind-ing to a p53-response element consensus sequence, 0.2 mM
H2O2 did not induce any detectable binding (Fig. 6E). DO-1antibodies to p53 produced a supershifted band onEMSAswithdaunorubicin, whereas FL-393 antibodies prevented binding tothe probe (Fig. 6F), thus confirming that the band detected onEMSAs with daunorubicin was indeed p53. An irrelevant anti-body (to JunD) did not supershift the complex (Fig. 6F). Thus,by using two independent methodologies and a variety of anti-bodies, we were unable to find evidence for p53 induction by
FIGURE 5. Characterization of p53 antibodies. Extracts of 293T cells that had either been transfected withmouse p53 (positive control) or not transfected (negative control) were examined by SDS-PAGE and immuno-blotting with FL-393 antibody (A), Pab 240 antibody (B), or 2B2.71 antibody (C and D), all at 1:1000 dilution.D, a crude nuclear extract from cardiac myocytes exposed to 0.5 �M daunorubicin for 6.5 h was included. Theposition of the 52-kDa molecular mass marker is indicated.
Mdm2 Induction by H2O2 in Cardiac Myocytes
OCTOBER 2, 2009 • VOLUME 284 • NUMBER 40 JOURNAL OF BIOLOGICAL CHEMISTRY 27203
H2O2.We conclude that it is unlikely that p53 is responsible forthe increased Rdm2 P2 promoter activity induced by H2O2.Ets—We examined whether Ets proteins may regulate Rdm2
expression. An EMSA probe corresponding exactly to theEts(upstream) region (Table 2 and Fig. 1) detected three com-plexes in crude nuclear extracts of myocytes exposed to 0.2 mM
H2O2 for 0 or 30 min, with complex 2 showing evidence ofinducibility (Fig. 7A). Unlabeled wild type probe competedeffectively for binding to complexes 1 and 2 (but not to complex3) even at an equimolar concentration, whereas an unlabeledprobe with two mutated bases did not completely compete forbinding evenwhen in a 100-fold excess (Fig. 7A). Thus complex3 represents nonspecific binding. Binding of complex 1 was“constitutive” and remained constant over 2 h (Fig. 7B). Never-theless, complex 1may still be important in regulation of the P2promoter as its transactivating activity (as opposed to DNAbinding activity) could be subject to regulation (e.g. phospho-rylation (39)). Complex 2 was transiently induced to a maxi-mum of about 8-fold after 30 min (Fig. 7B). By 1 h, �60% of theinduction had been lost, and abundances had returned to baseline by 2 h (Fig. 7B), i.e. its peak induction significantly precededRdm2 induction.We also examined the Ets(AP-1) element usingEMSAs with a probe corresponding exactly to the Ets(AP-1)region (Table 2 and Fig. 1). Although a complex was detectable,its abundance was not altered by exposure of myocytes to 0.2
mM H2O2 for up to 8 h (results notshown). Furthermore, unlabeledprobe for the Ets(AP-1) region did noteffectively compete until present ata 50–100-fold excess (results notshown). Overall, any binding of pro-teins to the Ets sequence EMSAprobes is either not inducible, notspecific, or does not follow a timecourse appropriate for induction ofRdm2 expression.AP-1—The AP-1 element is situ-
ated immediately 5� to the Ets(AP-1)element in the Rdm2 P2 promoter(Fig. 1). An EMSA probe corre-sponding exactly to this AP-1sequence (Table 2 and Fig. 1)detected a complex in crude nuclearextracts of myocytes that was com-peted by unlabeledwild type but notmutant probe (Fig. 7C). Levels ofthis complex were increased byH2O2 to a maximum at 1–2 h (Fig.7D). Supershift EMSAswere used toidentify the AP-1 proteins (the Junand Fos familymembers) binding tothe AP-1 probe. In the absence ofstimulation, the complex was par-tially supershifted by antibodies toJunB or JunD but not by antibodiesto c-Jun (Fig. 8A). Following expo-sure to H2O2 (0.2 mM 1.5 h), anti-bodies to JunB, JunD, and, addition-
ally, c-Jun partially supershifted the complex (Fig. 8B).Antibodies to c-Fos, FosB, and Fra-1 also supershifted thiscomplex, but antibodies to Fra-2 or ATF2 were ineffective (Fig.8C). When a mixture of all supershifting antibodies (c-Jun,JunB, JunD, c-Fos, FosB, and Fra-1) was used, supershifting ofthe complex was essentially complete (Fig. 8D). For c-Jun andJunB, ChIP assays confirmed that binding to an Rdm2 P2sequence containing theAP-1 site (Fig. 1 andTable 1) increasedfollowing exposure of cardiacmyocytes to H2O2 (0.2mM, 1.5 h)(Fig. 8E). These results indicate that Fos and/or Jun family tran-scription factors bind to theRdm2P2AP-1 sequence, and this isincreased by H2O2.Expression of Jun and Fos Family Members—We examined
the time courses of expression of c-Jun, JunB, and JunD tran-scripts and proteins in response to 0.2 mM H2O2. Transcriptsfor both c-Jun (Fig. 9A) and JunB (Fig. 9B) were increasedmax-imally (about 8- and 4-fold for c-Jun and JunB, respectively) byH2O2 after about 1 h but had declined to control values by 4 h.Protein abundances followed time courses essentially similar tothose for transcripts with c-Jun showing a 7–8-fold increase(Fig. 9,C andD), and JunB showing a 2.0–2.5-fold increase (Fig.9, E and F). There were no changes detectable in JunD tran-script or protein abundances (results not shown).A similar pattern of mRNA expression was observed for the
Fos family members implicated by EMSAs in the binding to the
FIGURE 6. H2O2 does not induce expression of p53 in cardiac myocytes. Myocytes were exposed to 0.2 mM
(A–F) or 0.5 mM (C) H2O2 for the times indicated or to daunorubicin. A–D, immunoblots of crude nuclear extractsfrom myocytes. Blots were probed with the p53(FL-393) antibody (A) at a dilution of 1:1200, with the 2B2.71antibody (B and C) at a dilution of 1:1000, or with the Pab 240 antibody (D) at a dilution of 1:1000. For 2B2.71 andPab 240, an amplification step with an rabbit anti-mouse antibody and a goat anti-rabbit horseradish peroxi-dase-conjugated tertiary antibody were used. E, EMSAs of crude nuclear extracts were carried out with a p53consensus binding sequence probe. F, myocytes were exposed to 0.5 �M daunorubicin for 7.5 h, and supershiftEMSAs were carried out with the antibodies indicated. Representative primary data are shown for three inde-pendent observations on separate preparations of myocytes.
Mdm2 Induction by H2O2 in Cardiac Myocytes
27204 JOURNAL OF BIOLOGICAL CHEMISTRY VOLUME 284 • NUMBER 40 • OCTOBER 2, 2009
Rdm2P2AP-1 sequence (Fig. 10,A–D). Transcript abundancesincreased by �20-fold for c-Fos (Fig. 10A), 15-fold for FosB(Fig. 10B), and 10-fold for Fra-1 (Fig. 10C) over 1–2 h beforesubsequently declining. Abundances of Fra-2 did not changesignificantly (results not shown) in accord with the results ofsupershift EMSAs (Fig. 8C). For c-Fos protein, abundanceincreased by�15-fold over the same time period before declin-ing (Fig. 10D). Antibodies against FosB and Fra-1 were not sat-isfactory for unequivocal use in immunoblotting in our hands.
These results suggest that one factorin the increase in binding of AP-1proteins to the Rdm2 P2 sequence isan increase in their abundances.Effects of Rdm2 on Caspase 3
Cleavage in H2O2-treated CardiacMyocytes—Mdm2 and its ortho-logues are generally considered tobe antiapoptotic. We examinedwhether Rdm2 expression delayedthe pro-apoptotic effects of oxida-tive stress in cardiacmyocytes usingan antisense ODN to a region ofRdm2 exon 7 (supplemental Fig. 2).This reduced H2O2-stimulatedexpression of Rdm2 protein by�75% (Fig. 11, A, top panel, and B).Apoptosis was assessed by forma-tion of the 17-kDa active (cleaved)form of caspase 3. H2O2 increasedthe abundance of 17-kDa caspase 3in the absence or presence of lipo-fectin by about 2.5–4-fold (Fig. 11,A, middle panel, and C), thus dem-onstrating that, under the condi-tions used,H2O2was pro-apoptotic.The Rdm2 antisense ODN (but not ascrambled ODN) further increasedthe H2O2-mediated stimulation of17-kDa caspase 3 formation bysome 2–3.5-fold (depending on thevalue of 17-kDa caspase 3 formation(lipofectin, no H2O2, or nonsenseoligodeoxynucleotide � H2O2)used as denominator) (Fig. 11, A,middle panel, and C). As judged byimmunoblotting for �-actin, theadherence of the myocytes to theculture disheswas unaffected by anytreatment (Fig. 11A, bottom panel).These results suggest that one roleof increased Rdm2 expression inmyocytes exposed to oxidativestress is to reduce or delayapoptosis.
DISCUSSION
Effects of H2O2 on Mdm2 Expres-sion in the Heart—The effects of
ROS generally and H2O2 in particular onMdm2 expression incardiac and noncardiac cells have not been extensively exam-ined previously. In noncardiac cells, H2O2 up-regulatesMdm2mRNA and protein expression in concert with up-regulation ofp53, and the assumption is that induction of p53 protein isresponsible for up-regulation ofMdm2 (40–42). However, thismay not be universal (43). Of relevance to cardiac myocytes, inthe H9c2 rat ventricular myoblast line, H2O2 (0.4 mM, 24 h)increases Rdm2 protein abundance (44), whereas in contrast to
FIGURE 7. Binding of proteins to the Ets(upstream) and AP-1-response elements in the Rdm2 P2 promoter asassessed by EMSAs. Cardiac myocytes were exposed to 0.2 mM H2O2 as indicated and crude nuclear extractsprepared. Sequences of probes are given in Table 2. A and C, EMSAs using the Ets(upstream) probe (A) or the AP-1probe (C). Binding specificities were assessed using unlabeled probe. Two specific complexes (1 and 2) weredetected with the Ets(upstream) probe (A), and one was detected for the AP-1 probe (C). B and D, time courses ofbinding to the Ets(upstream) probe (B) or the AP-1 probe (D). Representative primary data are shown, and thequantified results are expressed as means � S.E. for 3–5 independent observations on separate preparations ofmyocytes.
Mdm2 Induction by H2O2 in Cardiac Myocytes
OCTOBER 2, 2009 • VOLUME 284 • NUMBER 40 JOURNAL OF BIOLOGICAL CHEMISTRY 27205
our microarray data (3, 10), Rdm2 transcript abundance wasreported to decrease in cardiac myocytes exposed to H2O2 (0.1mM, 1 h) (45). To study Rdm2 in more detail, we first needed tocharacterize the Rdm2 gene and its transcript and Rdm2 pro-tein using bioinformatics approaches (Fig. 1 and supplemental
Figs. 1–3). The current details forRdm2mRNA in the NCBI data base(www.ncbi.nlm.nih.gov) are mis-leading as the 75-bp exon 4 has beenomitted. It could be argued that thisshorter species lacking “exon 4” isspecific to the rat and could arise,for example, by alternative splicing/exon skipping. However, in additionto identifying exon 4 in rat ESTs, thereverse primer (Table 1) used in theexperiments described in Fig. 3Alies within exon 4, and products ofthe predicted sizes were generated,thus establishing that exon 4 isexpressed in mature Rdm2mRNA.We showed that Rdm2 tran-
scripts and Rdm2 protein were rap-idly induced (within 1–2 h) byH2O2and that this occurs over the 0.1–1mM range (Fig. 2, A–E). At higherconcentrations, expression declines(Fig. 2,D and E). Rdm2was not reg-ulated as an immediate early gene(Fig. 3, A and B), and the up-regula-tion of the transcript did not involvetranscript stabilization (Fig. 3C). Asin other cells (16), constitutiveRdm2 expression involved the 5�-P1promoter, whereas H2O2-inducibleexpression was largely regulatedthrough the P2 promoter withinintron 1 (Fig. 4, A and B). Intron 1contains several potential transcrip-tion factor binding sites, includingsites for p53, AP-1 and Ets (Fig. 1),any or all ofwhichmay be importantin the inducible expression ofRdm2.Induction of p53 by H2O2 in Car-
diac Myocytes—At least two studiesreport that H2O2 induced expres-sion of p53 transcripts and proteinin neonatal rat cardiac myocytes inculture (2, 45). Because our originaldata contradicted these studies, wehave been encouraged to go to greatlengths to prove that our data arecorrect. In addition to the antibody(FL-393)we originally used, we usedtwo further antibodies (Pab 240 and2B2.71) for immunoblotting. Wefirst confirmed the selectivity and
specificity of these antibodies for p53 by immunoblotting com-mercially available whole cell extracts of 293T cells transfectedwithmouse p53 (Fig. 5,A–C). All three antibodies detected p53as a band that migrated slightly more rapidly that the 52-kDamarker (Fig. 5, A–C). This band was absent from the negative
FIGURE 8. Binding of AP-1 proteins to the AP-1-response element in the Rdm2 P2 promoter as assessedby supershift EMSAs or ChIP assays. Cardiac myocytes were exposed to 0.2 mM H2O2 as indicated and crudenuclear extracts prepared. A–D, supershift EMSAs were performed using the antibodies indicated. SS, super-shifted complex. E, ChIP assays using c-Jun or JunB antibodies, as indicated. Representative primary data areshown, and the quantified results are expressed as means � S.E. for three independent observations onseparate preparations of myocytes. Statistical significance versus control: *, p � 0.05 by an unpaired two-wayStudent’s t test.
Mdm2 Induction by H2O2 in Cardiac Myocytes
27206 JOURNAL OF BIOLOGICAL CHEMISTRY VOLUME 284 • NUMBER 40 • OCTOBER 2, 2009
control cell line, although it should be noted that cross-reactingproteins of different apparent molecular masses could bedetected with two of the antibodies, including one thatmigrated with the 52-kDamarker (Fig. 5,A,C, andD). Further-more, rat p53 (induced by treatment of cardiac myocytes withdaunorubicin) co-migrated with murine p53 in the positivecontrol cell line (Fig. 5D). None of the three antibodies detectedany increase in p53 expression in cardiac myocytes followingexposure to H2O2, despite a clear induction with daunorubicin(Fig. 6, A–D). Furthermore, we could not detect any inductionof p53 by H2O2 using EMSAs despite the clear induction bydaunorubicin of a band that could be supershifted with p53antibodies (Fig. 6, E and F). Thus, we are confident that 0.2 mM
H2O2 does not induce expression of p53 in cardiac myocytes,and this probably excludes any role for p53 in H2O2-inducedRdm2 expression.It is not entirely clear why others have detected p53 induc-
tion byH2O2 (2, 45), but there are at least four potential areas ofconcern as follows: (i) the antibody used; (ii) the cell extractsused; (iii) the conditions used; and (iv) the absence of positivecontrols for p53. First, both von Harsdorf et al. (2) and Long et
al. (45) used amonoclonal antibody fromCalbiochem of whichthere are six currently listed. Not surprisingly, given the timeelapsed, none of the authors of Ref. 2 could recall whichantibody was used, and indeed the choice may have beenlimited or nomenclature not specified by the supplier at thisstage. In the report by Long et al. (45), Dr. Jose Marín-Garcíainformed us that they had used the Calbiochem Ab-4 anti-body (catalogue number OP32) from the Pab 246 clone, buthe now purchases this from Santa Cruz Biotechnology, Inc.(catalogue number sc-100). We found that Pab 246 cross-reacted with several proteins in the 52-kDa region in 293Twhole cell extracts (results not shown), and we did not usethis antibody. Second, in both reports, whole cell extracts ofcardiac myocytes were used rather than crude nuclearextracts. Generally, we find that whole cell extracts areunsatisfactory for detection of nuclear transcription factorsby immunoblotting, mainly because of cross-reaction withother proteins. Indeed, two of the three antibodies showedcross-reactivity with a band at 52 kDa in 293T whole cellextracts (Fig. 5, A, C and D), which was not detectable innuclear extracts from rat cardiac myocytes (Fig. 5D and Fig.
FIGURE 9. Expression of c-Jun and JunB transcripts and proteins. Cardiac myocytes were exposed to 0.2 mM H2O2 as indicated. mRNA abundance wasdetermined by RT-sqPCR, and protein abundance in crude nuclear extracts was assessed by immunoblotting. A and B, expression of c-Jun (A) and JunB (B)transcripts. No RT, no reverse transcriptase step. C–F, expression of c-Jun (C and D) and JunB (E and F) proteins. Antibody dilutions are as follows: c-Jun, 1:750;JunB, 1:5000. Representative primary data are shown, and the quantified results are expressed as means � S.E. for 3– 4 independent observations on separatepreparations of myocytes.
Mdm2 Induction by H2O2 in Cardiac Myocytes
OCTOBER 2, 2009 • VOLUME 284 • NUMBER 40 JOURNAL OF BIOLOGICAL CHEMISTRY 27207
6, A–D) but which, in the absence of a positive control, couldbe mistaken for p53. Third, although the conditions used byLong et al. (45) (0.1 mM H2O2 for 30 min, 1 h, or 24 h)resembled our own, von Harsdorf et al. (2) used a potentiallymore severe oxidative stress (0.1 mM H2O2, 0.1 mM Fe2� for1 h, followed by further culture in H2O2/Fe2�-free mediumfor up to 23 h). The combination of H2O2 and Fe2� leads to acatalytic disproportionation of H2O2 into the highly reactivehydroxyl radical (which is toxic and induces a severe oxida-tive stress), and a peroxide radical, and is commonly knownas the Fenton reaction (Fe2� �H2O23 Fe3� �OH� �OH�;Fe3� �H2O23 Fe2� �OOH� �H�). Fourth, for both of thepublished studies (2, 45), there were no positive controls forp53, nor were the positions of molecular mass markersincluded.
Regulation of Inducible Mdm2 byp53-independent Mechanisms—Ex-pression of theMdm2 gene can alsobe regulated by p53-independentmechanisms (19–21). Thus, pointmutations in any one of the AP-1,Ets(AP-1), or Ets(upstream) elementsreduce induction of Mdm2 expres-sion by oncogenic Ras or Raf inNIH-3T3 cells (19). Furthermore,elevated HDM2 expression in abreast cancer cell line is partlydependent on the composite AP-1-Ets(AP-1) element (20). In contrast,up-regulation of Mdm2 in certainmouse erythroleukemia lines ispartly attributable to increasedexpression of Fli-1 (an Ets familytranscription factor) and mayinvolve the Ets(upstream) element(21).Ets family transcription factors
number 20 members (39) thatrequire a core GGA motif forresponse element recognition withslightly varying preferences in theflanking sequences (34). In cardiacmyocytes exposed to H2O2, consti-tutive (complex 1) and transientlyinducible (complex 2) protein bind-ing to the Ets(upstream) element wasdetected by EMSAs (Fig. 7,A andB).We attempted to supershift theEts(upstream) complexes with anti-bodies to the biologically activatedform of Elk-1 (phospho-Elk-1(Ser-383)) (the orthologous residue in ratElk-1 is in fact Ser-382) and to Fli-1but were unsuccessful (results notshown).We consider it unlikely thatthe Ets(upstream) element is signifi-cant inRdm2 up-regulation becauseof the following: (i) the level of com-
plex 1 does not change and (ii) levels of complex 2 were return-ing to zero time values before any significant induction ofRdm2transcripts or Rdm2 protein was detectable (Fig. 2, A–C and F,and Fig. 7B). Equally, we could not obtain any convincing evi-dence that the Ets(AP-1) element might be involved. The EMSAband with the Ets(AP-1) probe was not inducible and was notcompeted by unlabeled probe.We turned our attention to the AP-1 site. AP-1 is a het-
erodimer of Fos and Jun family members or possibly ahomodimer of Jun family members, and it controls the tran-scription of numerous genes (46). TheAP-1 complex can eitheractivate or inhibit gene expression, and its two subunits do notnecessarily act in concert. Thus, whereas c-Fos and FosB act inconcert with c-Jun (the most powerful transcriptional regula-tor), c-Jun may be antagonized by JunB and by Fra-1 and Fra-2,
FIGURE 10. Expression of c-fos, Fos-B, and Fra-1 transcripts and c-Fos protein. Cardiac myocytes wereexposed to 0.2 mM H2O2 as indicated. mRNA abundance was determined by RT-sqPCR, and protein abundancein crude nuclear extracts was assessed by immunoblotting. A–C, expression of c-Fos (A), FosB (B), and (C) Fra-1transcripts assessed by RT-sqPCR. No RT, no reverse transcriptase step. D, expression of c-Fos protein. Antibodydilution for c-Fos: 1:20,000. Representative primary data are shown and the quantified results are expressed asmeans � S.E. for 3– 4 independent observations on separate preparations of myocytes.
Mdm2 Induction by H2O2 in Cardiac Myocytes
27208 JOURNAL OF BIOLOGICAL CHEMISTRY VOLUME 284 • NUMBER 40 • OCTOBER 2, 2009
which do not contain transactivation domains. Furthermore,the transactivating activities of AP-1 proteins can be influencedby post-translational modification (e.g. phosphorylation). Aswith Ets transcription factors, there is evidence that AP-1 mayparticipate in regulation ofMdm2 expression (19). In our study,EMSAs showed specific binding of proteins to the Rdm2 AP-1element (Fig. 7C) with a time course consistent with inductionof Rdm2 expression (Fig. 2, A–C, and Fig. 6D). c-Jun and JunDbound to the probe in unstimulated cells (Fig. 8A). In cellsexposed to H2O2, JunB (Fig. 8B) and Fos family members(c-Fos, FosB, Fra-1, but not Fra-2) were also bound (Fig. 8C).The binding of Fra-1 is a little surprising given that expression
of Rdm2 is increased, but Fra-1 is supposed to reduce AP-1-de-pendent stimulation of gene expression (46), and we do nothave any explanation for this at present. A mixture of antibod-ies to c-Jun, JunB, JunD, c-Fos, FosB, and Fra-1 resulted inessentially a complete supershift of the complex (Fig. 8D). Ofthe Jun and Fosmembersmentioned but with the exceptions ofJunD and Fra-2, transcripts (and usually proteins) were inducedby H2O2 (Figs. 9 and 10) within the time period chosen forsupershifting (1.5 h). Using ChIP assays, we demonstratedincreased binding of c-Jun and JunB to an Rdm2 P2 promoterregion encompassing the AP-1 site (Fig. 8E). ChIP assays usingantibodies to the remaining Fos/Jun proteins were less success-ful, presumably because of their inadequacy in immunoprecipi-tation protocols. These results strongly suggest that the Rdm2AP-1 element is of significance in the up-regulation of Rdm2expression by H2O2, and that increased abundances of AP-1transcription factors (several of which have been confirmed asimmediate early genes in cardiac myocytes in the context ofendothelin stimulation (47)) participate in Rdm2 mRNAup-regulation.H2O2 and ROS are established regulators of AP-1 (48). All of
the three major MAPK cascades (JNK, ERK1/2, and p38MAPK) are activated byH2O2 in cardiacmyocytes (49) andmayinfluence AP-1 expression and activity. JNKs phosphorylatec-Jun in its transactivation domain and increase its transacti-vating activity (46). In addition, c-Jun mRNA and protein areup-regulated by a combination of activation of ERK1/2 (toincrease transcription of c-Jun) and JNKs (to increase proteinstability) (50). Thus, H2O2-mediated stimulation ofMAPK cas-cades might be a factor in the up-regulation of AP-1 transcrip-tion factor levels and activities in our study.Cardioprotective Effects of Mdm2—p90 Mdm2 is present in
whole murine heart in greater abundance than p76 Mdm2(although both at much lower abundances than in other tissuessuch as testis) (23). Cardioselective deletion ofMdm2 is embry-onically lethal, and this lethality can be rescued by deletion ofp53 (51), thus emphasizing the importance ofMdm2 in limitingp53 expression during cardiac development. In the developedheart, the role of Mdm2 in cardioprotection is implicit from anumber of studies. Increasing Mdm2 abundance by overex-pression of the transcriptional coactivator p300 protectsagainst apoptosis induced by the cardiotoxic anthracyclinedoxorubicin inmice in vivo (52). Cardiospecific overexpressionof insulin-like growth factor 1 increases the associationbetween p53 andMdm2 thus reducing the binding of p53 to thepromoter of the proapoptotic bax gene (53). The growth factoralso reduces mechanical strain-induced apoptosis in isolatedcardiacmyocytes, one possiblemechanism involving an Rdm2-mediated reduction in p53 abundance (54). Overexpression ofMdm2 also protects against the pro-apoptotic effects ofhypoxia, and inhibition of the p53-Rdm2 interaction increasesthe sensitivity to hypoxia (55). Furthermore, reduced expres-sion of Mdm2 increases the susceptibility of the isolated heartto injury induced by ischemia and reperfusion (55).In general agreementwith these earlier studies, our studies here
suggest that the inductionofRdm2 expressionbyH2O2 representsa cytoprotective defense against oxidative stress in the cardiacmyocyte (Fig. 11). Thus, diminished H2O2-mediated induction of
FIGURE 11. “Knockdown” of Rdm2 protein in cardiac myocytes with anantisense ODN to the Rdm2 transcript increases H2O2-induced activationof caspase 3. AS, antisense ODN; NS, scrambled ODN. A, abundances of Rdm2(top panel), active caspase 3 (middle panel), and sarcomeric �-actin (bottompanel) in whole cell extracts were assessed by immunoblotting. B and C, quan-tification of Rdm2 (B) or active caspase 3 abundances (C). Antibody dilutionsare as follows: Rdm2, 1:500; caspase 3, 1:1000; �-actin, 1:2000. Representativeprimary data are shown, and the quantified results are expressed as means �S.E. for four independent observations on separate preparations of myocytes.Statistical significance versus control: *, p � 0.05; **, p � 0.001 by one-wayANOVA with Tukey’s multiple comparison test.
Mdm2 Induction by H2O2 in Cardiac Myocytes
OCTOBER 2, 2009 • VOLUME 284 • NUMBER 40 JOURNAL OF BIOLOGICAL CHEMISTRY 27209
Rdm2 using an antisenseODN toRdm2 promoted caspase 3 acti-vation (Fig. 11, A and C). It is pertinent to ask how Rdm2 candecrease apoptosis, given thatH2O2didnot inducep53expression(Fig. 6).One explanationmaybe that other pro-apoptotic proteinsexpressed in myocytes are inhibited or down-regulated by Rdm2.Precedents for this exist. For example, treatment of p53-null neu-roblastoma cells with the HDM2-protein interaction inhibitor,Nutlin-3, stimulates apoptosis by inhibiting the interaction withthe p53-related protein p73 (56). It should perhaps also be notedthat inhibition ofHDM2 is currently under intensive investigationas a chemotherapeutic intervention (57). From the results of ourown and other studies, such therapies may decrease cardiacmyo-cyte survival, particularly under conditions of oxidative stress,which probably occur during myocardial ischemia and heartfailure.
Acknowledgments—We thank Santa Cruz Biotechnology, Inc., for pro-viding a number of reagents free of charge and the following for assistingus in our attempts to trace the antibodies used in their studies in moredetail: R. Dietz, P.-F. Li, J. Marín-García, and R. von Harsdorf.
REFERENCES1. Cook, S. A., Sugden, P. H., and Clerk, A. (1999) Circ. Res. 85, 940–9492. von Harsdorf, R., Li, P. F., and Dietz, R. (1999) Circulation 99, 2934–29413. Clerk, A., Kemp, T. J., Zoumpoulidou,G., and Sugden, P.H. (2007)Physiol.
Genomics 29, 118–1274. Suzuki, K., Kostin, S., Person, V., Elsasser, A., and Schaper, J. (2001) J. Mol.
Cell. Cardiol. 33, 983–9945. Solaini, G., and Harris, D. A. (2005) Biochem. J. 390, 377–3946. Murphy, M. P. (2009) Biochem. J. 417, 1–137. Siwik, D. A., Tzortzis, J. D., Pimental, D. R., Chang, D. L., Pagano, P. J.,
Singh, K., Sawyer, D. B., and Colucci, W. S. (1999) Circ. Res. 85, 147–1538. Vanden Hoek, T. L., Becker, L. B., Shao, Z., Li, C., and Schumacker, P. T.
(1998) J. Biol. Chem. 273, 18092–180989. Sugden, P. H., and Clerk, A. (2006) Antioxid. Redox. Signal. 8, 2111–212410. Kemp, T. J., Causton, H. C., and Clerk, A. (2003) Biochem. Biophys. Res.
Commun. 307, 416–42111. Cahilly-Snyder, L., Yang-Feng, T., Francke, U., and George, D. L. (1987)
Somat. Cell Mol. Genet. 13, 235–24412. Fakharzadeh, S. S., Trusko, S. P., and George, D. L. (1991) EMBO J. 10,
1565–156913. Toledo, F., and Wahl, G. M. (2006) Nat. Rev. Cancer 6, 909–92314. Fang, S., Jensen, J. P., Ludwig, R. L., Vousden, K. H., andWeissman, A. M.
(2000) J. Biol. Chem. 275, 8945–895115. Honda, R., and Yasuda, H. (2000) Oncogene 19, 1473–147616. Barak, Y., Gottlieb, E., Juven-Gershon, T., andOren,M. (1994)Genes Dev.
8, 1739–174917. Brown, C. Y., Mize, G. J., Pineda, M., George, D. L., and Morris, D. R.
(1999) Oncogene 18, 5631–563718. Jin, X., Turcott, E., Englehardt, S., Mize, G. J., and Morris, D. R. (2003)
J. Biol. Chem. 278, 25716–2572119. Ries, S., Biederer, C., Woods, D., Shifman, O., Shirasawa, S., Sasazuki, T.,
McMahon, M., Oren, M., and McCormick, F. (2000) Cell 103, 321–33020. Phelps,M., Darley,M., Primrose, J. N., and Blaydes, J. P. (2003)Cancer Res.
63, 2616–262321. Truong, A. H., Cervi, D., Lee, J., and Ben-David, Y. (2005) Oncogene 24,
962–96922. Saucedo, L. J., Myers, C. D., and Perry, M. E. (1999) J. Biol. Chem. 274,
8161–816823. Mendrysa, S. M., McElwee, M. K., and Perry, M. E. (2001) Gene 264,
139–14624. Iwaki, K., Sukhatme, V. P., Shubeita, H. E., and Chien, K. R. (1990) J. Biol.
Chem. 265, 13809–1381725. Bogoyevitch, M. A., Clerk, A., and Sugden, P. H. (1995) Biochem. J. 309,
437–44326. Bradford, M. M. (1976) Anal. Biochem. 72, 248–25427. Clerk, A., Bogoyevitch, M. A., Anderson, M. B., and Sugden, P. H. (1994)
J. Biol. Chem. 269, 32848–3285728. Tortora, G., Caputo, R., Damiano, V., Bianco, R., Chen, J., Agrawal, S.,
Bianco, A. R., and Ciardiello, F. (2000) Int. J. Cancer 88, 804–80929. Harrison, J. G., Sugden, P. H., and Clerk, A. (2004) Biochim. Biophys. Acta
1644, 17–2530. Halees, A. S., El-Badrawi, R., and Khabar, K. S. (2008) Nucleic Acids Res.
36, D137–D14031. el-Deiry, W. S., Kern, S. E., Pietenpol, J. A., Kinzler, K.W., and Vogelstein,
B. (1992) Nat. Genet. 1, 45–4932. Veprintsev, D. B., and Fersht, A. R. (2008) Nucleic Acids Res. 36,
1589–159833. Angel, P., and Karin, M. (1991) Biochim. Biophys. Acta 1072, 129–15734. Hollenhorst, P. C., Shah, A. A., Hopkins, C., and Graves, B. J. (2007)Genes
Orkin, S. H. (1993) Nature 362, 722–72836. Morris, J. F., Hromas, R., and Rauscher, F. J., 3rd (1994)Mol. Cell. Biol. 14,
1786–179537. Hromas, R., Collins, S. J., Hickstein, D., Raskind,W., Deaven, L. L., O’Hara,
P., Hagen, F. S., and Kaushansky, K. (1991) J. Biol. Chem. 266,14183–14187
38. Poizat, C., Sartorelli, V., Chung,G., Kloner, R. A., andKedes, L. (2000)Mol.Cell. Biol. 20, 8643–8654
39. Sharrocks, A. D. (2001) Nat. Rev. Mol. Cell Biol. 2, 827–83740. Uberti, D., Yavin, E., Gil, S., Ayasola, K. R., Goldfinger, N., and Rotter, V.
(1999) Brain Res. Mol. Brain Res. 65, 167–17541. Yoneda, K., Chang, M. M., Chmiel, K., Chen, Y., andWu, R. (2003) J. Am.
Soc. Nephrol. 14, S284–S28942. McNeill-Blue, C.,Wetmore, B. A., Sanchez, J. F., Freed,W. J., andMerrick,
B. A. (2006) Brain Res. 1112, 1–1543. Bonini, P., Cicconi, S., Cardinale, A., Vitale, C., Serafino, A. L., Ciotti,
M. T., and Marlier, L. N. (2004) J. Neurosci. Res. 75, 83–9544. Foo, R. S., Chan, L. K., Kitsis, R. N., and Bennett,M. R. (2007) J. Biol. Chem.
282, 5529–553545. Long, X., Goldenthal, M. J., and Marín-García, J. (2007) Mol. Cell. Bio-
chem. 303, 167–17446. Shaulian, E., and Karin, M. (2002) Nat. Cell Biol. 4, E131–E13647. Cullingford, T. E., Markou, T., Fuller, S. J., Giraldo, A., Pikkarainen, S.,
Zoumpoulidou,G., Alsafi, A., Ekere, C., Kemp, T. J., Dennis, J. L., Game, L.,Sugden, P. H., and Clerk, A. (2008) Genome Biol. 9, R32
48. Karin, M., and Shaulian, E. (2001) IUBMB Life 52, 17–2449. Clerk, A., Michael, A., and Sugden, P. H. (1998) Biochem. J. 333, 581–58950. Clerk, A., Kemp, T. J., Harrison, J. G., Mullen, A. J., Barton, P. J., and
Sugden, P. H. (2002) Biochem. J. 368, 101–11051. Grier, J. D., Xiong, S., Elizondo-Fraire, A. C., Parant, J. M., and Lozano, G.
(2006)Mol. Cell. Biol. 26, 192–19852. Kawamura, T., Hasegawa, K., Morimoto, T., Iwai-Kanai, E., Miyamoto, S.,
Kawase, Y., Ono, K., Wada, H., Akao, M., and Kita, T. (2004) Biochem.Biophys. Res. Commun. 315, 733–738
53. Leri, A., Liu, Y., Wang, X., Kajstura, J., Malhotra, A., Meggs, L. G., andAnversa, P. (1999) Circ. Res. 84, 752–762
54. Leri, A., Liu, Y., Claudio, P. P., Kajstura, J., Wang, X., Wang, S., Kang, P.,Malhotra, A., and Anversa, P. (1999) Am. J. Pathol. 154, 567–580
55. Toth, A., Nickson, P., Qin, L. L., and Erhardt, P. (2006) J. Biol. Chem. 281,3679–3689
56. Peirce, S. K., and Findley, H. W. (2009) Int. J. Oncol. 34, 1395–140257. Dey, A., Verma, C. S., and Lane, D. P. (2008) Br. J. Cancer 98, 4–8
Mdm2 Induction by H2O2 in Cardiac Myocytes
27210 JOURNAL OF BIOLOGICAL CHEMISTRY VOLUME 284 • NUMBER 40 • OCTOBER 2, 2009
Lay, Thomas A. Kriz, Balvinder S. Handa, Angela Clerk and Peter H. SugdenSampsa Pikkarainen, Robert A. Kennedy, Andrew K. Marshall, El Li Tham, Kenneth
-induced Oxidative Stress in Neonatal Rat Cardiac Myocytes2O2(MDM2) by HRegulation of Expression of the Rat Orthologue of Mouse Double Minute 2
doi: 10.1074/jbc.M109.037887 originally published online July 28, 20092009, 284:27195-27210.J. Biol. Chem.
10.1074/jbc.M109.037887Access the most updated version of this article at doi:
Alerts:
When a correction for this article is posted•
When this article is cited•
to choose from all of JBC's e-mail alertsClick here
![Evolution of the p53-MDM2 pathway1158898/FULLTEXT01.pdf · ation [9]. In vertebrates, MDM2 belongs to a family with two members, MDM2 and MDM4. To date, members of the p53/p63/p73](https://static.documents.pub/doc/80x56/5e6a22570899fb6605504c19/evolution-of-the-p53-mdm2-1158898fulltext01pdf-ation-9-in-vertebrates-mdm2.jpg)
